Molecular phylogeny and diversification of the “Haenydra” lineage

(Hydraenidae, genus Hydraena), a north-Mediterranean endemic-rich group of

rheophilic Coleoptera

Marco Trizzinoa*, Paolo A. Audisioa, Gloria Antoninia, Emiliano Mancinib and Ignacio Riberac

a Sapienza Rome University, Italy, Department of Biology and Biotechnologies “C. Darwin” b Sapienza Rome University, Italy, Department of Public Health and Infectious Diseases c Institute of Evolutionary Biology (CSIC–UPF), Barcelona, Spain

*Correspondence: Marco Trizzino, Sapienza Rome University, Dipartimento di Biologia e

Biotecnologie "C. Darwin", via A. Borelli 50, I–00161 Rome, Italy. E–mail:

marco.trizzino@uniroma1.it

Running title: Molecular phylogeny of “Haenydra”

Abstract

Hydraena is the largest genus within the water beetle family Hydraenidae, with more than 800

species distributed worldwide. Within this large genus some monophyletic groups of species are

recognised, among them the “Haenydra” lineage, including ca. 90 species distributed in the western

Palaearctic from the Iberian peninsula to Iran. Species of “Haenydra” have often very restricted

distributions, and are typical of clean small rivers and streams. We obtained ca. 2.5 Kb of

mitochondrial and nuclear protein-code and ribosomal markers of 101 specimens of 69 species of

“Haenydra”, and used Bayesian and Maximum Likelihood phylogenetic methods to reconstruct

their phylogeny and diversification history. We found a derived phylogenetic position of the

“Haenydra” lineage within the genus Hydraena, as sister to the species of the H. bisulcata group.

Within “Haenydra” three main lineages were recognised, with poorly resolved relationships among

them: the H. iberica, H. gracilis and H. dentipes lineages, the former restricted to the Iberian

peninsula but the later two distributed through the whole north-Mediterranean area. A Bayesian

relaxed molecular clock approach using a combined mitochondrial rate of 2% divergence per MY

estimated the origin of “Haenydra” in the Tortonian, ca. 8 Mya, and the main diversification and

the origin of most extant species in the Pliocene and Pleistocene. We did not found evidence of a

phylogenetic connection between the western and eastern species that could be traced to the

Messinian salinity crisis, with dispersal only at small geographical scales (e.g. the colonization of

Corsica and Sardinia from NW Italy and SW France). The H. gracilis and H. iberica lineages were

estimated to have diversified under a pure birth model with a speciation rate of 0.64 and 0.23

species/MY respectively, while the H. dentipes lineage was estimated to have a decreasing

diversification rate with time, with an average rate of 0.29 sp/MY.

Key words: Western Palaearctic, glacial cycles, Messinian, narrow endemics.

1. Introduction

Most species of Metazoa are small, with a mode around five millimetres (May, 1978), and for

any given lineage, the distribution of the size of the geographical ranges is strongly right-skewed,

with the smallest size class being the modal one (Schoener, 1988; Gaston and He, 2002; Gaston

2003). These two strong macroecological patterns, combined with a general inverse correlation

between the size of the geographical range and probability of extinction (Jablonski, 1987; Lee and

Jetz, 2011), place the diversification dynamics of lineages of small organisms with abundance of

local endemics at the centre of the evolutionary stage. However, and despite their obvious

relevance, our understanding of the phylogeny and biogeography of many of the large groups that

could be considered most representative of the evolutionary processes leading to the current

diversity is very incomplete.

A good example of these highly diverse but poorly known groups of organisms is the water

beetle genus Hydraena Kugelann. With more than 800 described species, and several hundreds not

yet described (M. Jäch, personal communication, 2010), it represents the largest genus within

family Hydraenidae, distributed all over the world. Within the large genus Hydraena several

monophyletic groups of species have been recognised, among them most notably the species of the

“Haenydra” lineage, considered by some authors as a subgenus, or even a separate genus (see

below). The “Haenydra” lineage currently includes ca. 90 species distributed in the north

Mediterranean area, from the Iberian peninsula to Iran, which usually live in a layer of nearly

stationary water where they adhere to the submerged stones within the fastest regions of cold, clean

and fast-flowing permanent streams, mostly between 500 and 1500 m a.s.l. These species are

frequently endemic to extremely narrow areas (several species are known only from the type

locality or from a single mountain massif), and are thus also important for conservation. The lineage

also includes some species with wide geographic ranges, such as Hydraena gracilis Germar,

distributed in almost the whole Europe eastwards to the Urals and including the British Isles, or H.

truncata Rey, ranging from the north of the Iberian peninsula to Ukraine (Jäch, 2004; Ribera et al.,

2011; see Appendix 1).

A likely way of speciation through cycles of range expansion and fragmentation was recently

hypothesized by Ribera et al. (2011) in a work dealing with the molecular biogeography of the

“Haenydra” of the Iberian peninsula. According to this model, some species of “Haenydra” are

likely to have originated in the areas in which they are currently found due to the fragmentation

(mostly during Plio–Pleistocene glacial cycles) of the range of a widespread species. In the same

work the monophyly of the “Haenydra” lineage was tested for the first time with molecular data,

and its origin was estimated to have occurred in the Tortonian, approximately 9 Ma. However, the

dataset analysed by Ribera et al. (2011) included almost exclusively western Mediterranean species,

so that the origin and phylogenetic relationships of most of the central and eastern Mediterranean

species is still unknown.

In this work we add 26 species and several additional specimens of different localities to the

dataset of Ribera et al. (2011), allowing a comprehensive (ca. 80% of the known species) and

geographically unbiased representation of the lineage. We aim to establish the evolutionary

relationships among the different species groups and complexes of the “Haenydra” lineage,

establish its phylogenetic position within the large genus Hydraena, and investigate its mode of

diversification. More specific questions to be addressed are 1) are the main clades within

“Haenydra” restricted to specific geographic areas?; 2) are there any trans-Mediterranean

phylogenetic link between the eastern (Turkish) and the western (Iberian) species, as described for

other organisms (see e.g. Oosterbroek and Arntzen, 1992)?; or 3) could periods of accelerated (or

reduced) diversification be identified, corresponding to major geologic or paleoclimatic events

shaping the current diversity of the lineage?

2. Material and methods

2.1. Background on the taxonomy of “Haenydra”

Since its description, the genus Hydraena has been the subject of taxonomic debates.

Different authors split it in several, often paraphyletic genera and subgenera (Kuwert, 1888;

Seidlitz, 1888; Rey, 1886; Perkins, 1980, 1997; Berthélemy, 1986; Hansen, 1991, 1998), while

others synonymised putatively monophyletic subgenera with Hydraena s.str. (Hansen, 1991, 1998;

Perkins, 1997).

In this context, Jäch and co–authors (2000) carried out a cladistic analysis of the whole genus

using morphological characters and recognised only two monophyletic subgenera (Hydraenopsis

Janssens and Hydraena s.str.), synonymising all the previously described genera and subgenera

with Hydraena s.str. However, they identified some derived well–supported monophyletic clades

within Hydraena s.str. that were defined as “lineages”. Among them, the "Haenydra" lineage (or

Hydraena gracilis group sensu Jäch et al., 2000), previously considered by many authors as a valid

genus (Rey, 1886; Ienistea, 1968; Jäch, 1988; Audisio and De Biase, 1990, 1995; Rocchi, 2009) or

subgenus (Berthélemy, 1986; Jäch, 1992; Audisio et al., 1993, 1996; Perkins, 1997; Hansen, 1998).

“Haenydra” includes almost 90 species distributed exclusively in the western Palaearctic, from

Portugal to Iran, and in most of large N Mediterranean islands (Jäch, 2004; Audisio et al., 2009,

Ribera et al., 2011; Trizzino et al., 2011), but it is absent from North Africa, the Balearic Islands,

Crete, and Cyprus.

The species of Hydraena belonging to the “Haenydra” lineage are recognised mainly by the

absence of parameres in the male genitalia, the hypomeral setae largely reduced in size and number

(often absent), the rounded apex of the antennal club, the elytral striae remarkably straight and

reduced in number, the tip of the median subapical projection of the gonocoxite distinctly raised,

and the closure of the hypomeral antennal pocket exclusively formed by a mesial, and never lateral,

hypomeron (d’Orchymont, 1930, Berthelemy, 1986; Perkins, 1997; Jäch et al., 2000). Hydraenidae

specialists are generally in accordance about the monophily of the “Haenydra” lineage, but they

have often been discordant about its phylogenetic position within Hydraena, considering it as sister

to the rest of the genus (Perkins, 1997) or as a derived lineage (Jäch et al., 2000). According to

features of the male genitalia (and partially to the external morphology) “Haenydra” species could

be divided into species complexes (see Appendix 1 for a complete list of species and their

distributions; a morphological and taxonomic revision of this lineage is in preparation by M.

Trizzino and P. Audisio).

2.2. Taxon sampling

The complete dataset, integrated with the sequences of Ribera et al. (2011), comprised 101

specimens belonging to 69 of the 88 described species of “Haenydra”. For this work we added data

of 26 species of “Haenydra” not included in Ribera et al. (2011), mostly from the central and

Eastern Mediterranean, together with duplicated specimens of another 22 species (Appendix 2). All

the species complexes reported in Appendix 1 were represented in the dataset and, when feasible, at

least two specimens from different geographic areas for each species were analysed (Appendix 2).

For each of the 19 missing species of “Haenydra”, at least one closely related species belonging to

the same complex was included.

A selection of 26 species including most of the species groups previously defined within the

subgenus Hydraena s.str. were included as outgroups (Jäch et al., 2000; Ribera et al., 2011). All

outgroup sequences, with the exception of H. assimilis, were those used in Ribera et al. (2011)

(Appendix 2). Species groups or subgenera that were shown to be distantly related to Hydraena

s.str. in the previous analyses (Jäch et al., 2000; Ribera et al., 2011) were not included

(Hydraenopsis Janssens, Hydraena rugosa group, H. monikae group, H. circulata group and

“Photydraena” lineage). Trees were rooted using the species of the H. palustris group, shown to be

the sister taxon of the remaining species of Hydraena s.str. in Ribera et al. (2011), in agreement

with Jäch et al. (2000).

For “Haenydra” species we followed the taxonomy and nomenclature of Jäch (2004) (see

Appendix 1 for the authors of all species of “Haenydra”), except for H. aroensis, considered by

Jäch (2004) as a subspecies of H. subintegra but treated here as a separated species. We also follow

Ribera et al. (2011) in splitting the Spanish endemic Hydraena catalonica in the populations from

the Pyrenees (H. catalonica p) and the Montseny massif in central Catalonia (H. catalonica m). The

specimens considered as “H. saga complex” in Ribera et al. (2011) are here treated as two different

species (H. diazi and H. fosterorum ), following their formal description by Trizzino et al. (2011).

2.3. DNA extraction and sequencing

Specimens were collected alive in the field and directly killed and preserved in 96% ethanol

or in pure acetone. DNA was extracted from whole specimens by a standard phenol–chloroform

extraction or by the DNeasy Tissue Kit (Qiagen GmbH, Hilden, Germany) following the

instructions of the manufacturer. Vouchers and DNA samples are kept in the collections of the

Museo Nacional de Ciencias Naturales (MNCN, Madrid), the Institute of Evolutionary Biology

(CSIC-UPF, Barcelona) and in the DNA collection of the Department of Biology and

Biotechnologies "C. Darwin", University Sapienza (CSR, Rome). Most DNA extractions were non–

destructive, to preserve voucher specimens for subsequent morphometric and morphological

studies. Whenever possible only males were sequenced, and the male genitalia (used for the

identification of the species) dissected and mounted previous to the extraction to ensure a correct

identification.

We amplified and sequenced four gene fragments, two mitochondrial (3’ end of cytochrome

c oxidase subunit 1 [cox1], and 3’ end of large ribosomal unit plus the Leucine transfer plus the 5’

end of NADH dehydrogenase subunit 1 [rrnL+trnL+nad1]; see Table 1 for primers and Appendix 2

for the new sequences). Nuclear markers used in Ribera et al. (2011) (small ribosomal unit [SSU]

and large ribosomal unit [LSU]) were not sequenced for the 26 additional species of “Haenydra”

analysed in this paper due to the almost complete absence of variability through the lineage

demonstrated in Ribera et al. (2011). The SSU and LSU sequences of the outgroup species (with the

exception of H. assimilis) and for a representation of 9 ingroup species (Ribera et al., 2011) were

included in the analyses. In some specimens the cox1 fragment was amplified using internal primers

to obtain two fragments of ~ 400 bp each (Table 1).

Amplifications were performed with the following general cycle conditions: initial

denaturation at 95°C for five minutes, followed by 33–38 cycles of denaturation at 94°C for 1 min,

annealing at 47°–58°C for 30 sec, 1–min extension at 72°C and a last 7–min elongation step at

72°C. Reactions were performed in a 25µl volume containing (NH4)2SO4 16 mM, Tris–HCl 67

mM (pH 8.8 at 25°C), MgCl2 3 mM, 1 mM of each dNTP, 0.8 pmol of each primer and 1.25 units

of Taq DNA polymerase (Platinum® Taq DNA Polymerase, Invitrogen). The amplified products

were purified by EXOSAP–IT enzymatic reactions or simply precipitated, and sent to an external

sequencing service. Sequences were assembled and edited with Staden Package software program

ver. 2003.1.6 (Bonfield et al., 2005) or by Sequencher 4.7 (Gene Codes, Inc., Ann Arbor, MI). New

sequences have been deposited in GenBank (see Appendix 2 for Accession Numbers).

2.4. Phylogenetic analyses

Sequences were aligned with the online version of MAFFT v.6 using the G–INS–i algorithm

and default parameters (Katoh and Toh, 2008). Bayesian analyses were conducted on a combined

data matrix with MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001), using two partition strategies:

1) five partitions corresponding to the six genes (the rrnL+trnL fragment was considered a single

partition); and 2) five partitions corresponding to the three codon positions for the two combined

protein coding genes, the nuclear ribosomal genes, and the mitochondrial ribosomal gene plus the

Leucine transfer. The best fitting model to analyse each partition was selected by jModelTest

(Posada, 2008) using the Akaike Information Criterion (AIC). The two partition strategies were

compared using Bayes factors (BF) (Kass and Raftery, 1995), as computed in Tracer 1.5

(Drummond and Rambaut, 2007) using 1000 replicates. A partition was considered significantly

better when the 2ln(BF) had an increase of 10 or more for each additional parameter (p) (i.e. a PM

factor = [delta]2lnBF/[delta]p >10; Pagel and Meade, 2004; Miller et al., 2009).

MrBayes run for 15 and 25x10^6 generations for the gene and codon partition respectively,

using default values and saving trees every 500 generations. “Burn–in” values were established

after visual examination of plots of standard deviation of the split frequencies between the two

simultaneous runs. Convergence between runs was assessed with Tracer v1.5.

A Maximum Likelihood (ML) phylogeny reconstruction was performed using RAxML

v7.0.4, using the partition by genes with a GTR+G+I model. We run 100 replicas and selected the

tree with the highest likelihood. Node supports were estimated implementing a fast bootstrapping

algorithm (1000 replicates with the CAT approximation, Stamatakis et al., 2008), using the same

partition by genes.

2.5. Estimation of divergence times

To estimate the relative age of divergence of the lineages we used the Bayesian relaxed

phylogenetic approach implemented in Beast v1.5.4 (Drummond and Rambaut, 2007), which

allows variation in substitution rates among branches. We used an uncorrelated lognormal relaxed

molecular clock model to estimate substitution rates and the Yule process of speciation as the tree

prior. Well–supported nodes obtained in the Bayesian analyses of the combined sequence

(mitochondrial and nuclear) were constrained to ensure that we obtained an identical topology. We

ran two independent analyses sampling each 1000 generations, and used Tracer v1.5 to determine

convergence, measure the effective sample size of each parameter and calculate the mean and 95%

highest posterior density interval for divergence times. Results of the two runs were combined with

LogCombiner v1.4.8 and the consensus tree compiled with TreeAnnotator v1.5.4 (Drummond and

Rambaut, 2007).

The analyses were run for 30x10^6 generations, with the initial 10% discarded as burn–in.

Because of the absence of fossil record to calibrate the trees, we used as a prior a rate of 2.0% of

pairwise divergence per MY, established for a closely related family (Leiodidae) for a combination

of mitochondrial markers including those used here (Ribera et al., 2010). This rate applies to the

combined mitochondrial protein coding and ribosomal genes, so we applied a GTR+I+G model of

DNA substitution with four rate categories for the combined mitochondrial data set only. We set as

a prior rate a normal distribution with average rate of 0.01 substitutions/site/MY, and with a

standard deviation of 0.001. We also included a calibration point based on the separation between

the Peloponnesus and mainland Greece, estimated to have occurred at ca. 2.5 Ma (Simaiakis and

Mylonas, 2008). This age was set as the upper limit for the split between Hydraena vedrasi and its

sister based on our molecular data (see Results), the Peloponnesus endemic H. jaechiana. Thus, for

this clade of sister species, we set a tmrca (timing of most recent common ancestor) with a truncated

normal distribution, with an upper value equal to 2.5, a mean of 1.5 and a standard deviation of 0.5.

2.6. Diversification analyses

We estimated the rate of diversification using the log-lineage through time approach (LTT)

(Harvey et al., 1994; Nee et al., 1994), using the ultrametric tree obtained in Beast for the whole

“Haenydra” lineage and for each the main clades within it (see Results). We tested the adequacy of our data to different diversification models with likelihood

methods. The models tested were a pure birth (Yule), a birth-death with constant diversification

rate, two models with variable diversification rates (logarithmic and exponential), and a pure birth

model with a shift in the diversification rate (Table 2). We checked the significance of the result

with a function that generates a null distribution of the statistic and returns the probability of the

observed AIC (Akaike Information Criterion) for constancy of diversification rates (see Rabosky,

2006).

We used the [gamma]-statistic (Pybus and Harvey, 2000) for measuring the relative timing of

the diversification, i.e. whether there is a constant diversification through the tree, or the interior

nodes are closer to the tips or to the root than expected under a pure birth process. The [gamma] -values of complete reconstructed phylogenies follow a standard normal distribution. If [gamma] <

0, the internal nodes can be said to be closer to its root than expected under a pure birth process, and

vice versa (Pybus and Harvey, 2000). To test the significance of the [gamma]-statistic we generated

a null distribution of 10,000 random simulations using a pure birth process including the known

missing taxa in a random position in the tree, and tested the observed [gamma] against it (Pybus

and Harvey, 2000).

To account for the possible effect of the non-randomness of the missing species (Brock et al.,

2011) we included them in the tree in the most likely position according to morphology (basically,

the structure of the male aedeagus; see Appendix 5). As their position could not be always

unambiguously established, we created polytomies and generated sets of 1,000 trees randomly

resolving the polytomies in Mesquite v2.74 (Maddison and Maddison, 2010), with nodes placed in

the middle of the branch. The [gamma]-statistic was computed for the whole set of 1,000 trees, and

the significance of the extreme values (maximum and minimum) computed. All diversification tests

were done using the R libraries ‘ape’ (Paradis et al., 2004) and ‘laser’ (Rabosky, 2006).

3. RESULTS

3.1. Molecular phylogeny

The final data matrix included 127 terminals (69 ingroup and 26 outgroup species, Appendix

2) and 2534 aligned characters. The selected evolutionary model was GTR+I+G for each one of the

mitochondrial gene or codon partitions, whereas HKY+G was selected for the gene SSU and

K80+G for LSU. An HKY+G model was implemented in MrBayes for the nuclear genes both

separately (gene partition) or in combination (codon partition).

For the gene partition the two runs of MrBayes converged to split frequencies lower than

0.01 after 12,35x10^6 generations, which was considered as the “burnin” fraction. For the codon

partition the standard deviation of the split frequencies stabilised at values around 0.01, but even

after 29x10^6 generations global convergence (as measured with the total –lnLikelihood or with

Bayes factors) was poor, mostly due to the uncertainty in the estimation of the parameter alpha for

the 3rd codon positions in one of the chains. The chain with the best likelihood had an estimation of

alpha of 0.097+- 0.007, while the other chain had an estimation of 85.7+-84.5. The estimation of the

alpha parameter for the combined nuclear ribosomal genes also differed significantly between runs,

even if in each of them the convergence was good (Appendix 3).

Despite the large differences in the estimation of some parameters and in the global

likelihood (with a Bayes factor of more than 300, i.e. considered to be significant, Kass and Raftery,

1995) differences in topology and branch lengths between the two independent runs of the codon

partition were minimal, and affecting only the position of one of the outgroups (H. hayashii).

Similarly, differences between the topologies obtained with the codon and gene partitions were very

small, affecting only two species, H. bensae (in the codon partition the two specimens of H. bensae

appeared as paraphyletic) and H. carniolica (Fig. 1; Appendix 4). In both cases the nodes affected

had low support, with Bayesian posterior probabilities (Bpp) lower than 0.8.

The topology obtained with ML was also very similar to that obtained with Bayesian

Methods, with good supports for most nodes (Fig. 1). Differences affected the resolution of some

clades (usually higher in ML) and the position of some species (H. discreta, H. schuleri and H.

carniolica within “Haenydra”, and H. hayashii among the outgroups, Fig. 1 and Appendix 4). In all

cases, the support of the incongruent nodes was low, with bootstrap values lower than 50% in ML

and Bpp lower than 0.8 in MrBayes.

Within Hydraena s.str. all analyses recovered four well supported major clades: 1) the

“Haenydra” lineage, 2) the H. bisulcata group, 3) a clade including the H. riparia, H. rufipes, H.

pygmaea, and H. holdausi groups, and 4) the H. palustris group, used to root the tree. The

"Haenydra” lineage" and the H. bisulcata group were sisters, and both sister to the remaining

previously recognised species groups, included in a unique poorly resolved clade (Fig. 1).

All analyses strongly supported the monophyly of the “Haenydra” lineage and its derived

phylogenetic position within Hydraena s.str. (Fig. 1). Three major monophyletic lineages were

observed within “Haenydra”: the Hydraena gracilis, H. dentipes and H. iberica lineages (Fig. 1). In

the ML reconstruction, H. iberica and its allies turned out to be sister to the rest of the lineage, but

with a low bootstrap support. The monophyly of both H. iberica (Bpp = 1; ML bootstrap = 100) and

H. gracilis lineages (Bpp = 1; ML bootstrap = 83) was strongly supported (Fig. 1), but the H.

dentipes lineage included some poorly supported nodes, unresolved in the Bayesian analyses using

the codon partition, with some isolated species or species complexes: H. schuleri, H. carniolica, H.

lazica, H. caucasica and the H. subintegra and H. scitula complexes (Fig. 1, Appendix 4). Within

the two major lineages (H. dentipes and H. gracilis) there were several strongly supported

monophyletic clades often corresponding to previously identified species complexes (see

Discussion and Appendix 1).

Some of the species with more than one sequenced specimen were not retrieved as

monophyletic. For instance, Hydraena septemlacuum and H. larissae resulted paraphyletic in all the

analyses (Fig. 1), and H. bensae only in the Bayesian analysis using a partition by codon (in

addition to the previously identified cases of H. gracilis and H. catalonica, Ribera et al., 2011).

There were also some incongruences between the named species and the topology of the trees in the

H. gracilis complex sensu Jäch (1995), due to an incomplete resolution of the corresponding sub–

clades (Fig. 1).

3.2. Molecular clocks and diversification

For the analysis with Beast (Fig. 2) we constrained the well-supported nodes of the topology

obtained with MrBayes (Figs 1–2). Using a calibration of 0.01 substitutions/site/MY in

combination with the constraint of the age of separation between H. vedrasi and H. jaechiana (see

Methods), the origin of the “Haenydra” lineage was estimated to be at ca. 8.3 Mya (Tortonian),

with a wide confidence interval. The two main lineages (H. gracilis and H. dentipes) differentiated

ca. 7.6–7.8 Mya, with the major clades likely originating between ca. 4 and ca. 6 Mya (Messinian).

The majority of terminal clades of allopatric sibling species were estimated to be less than 3.0 MY

old (i.e. of Plio–Pleistocene origin).

We analysed the modes of diversification in the whole “Haenydra” lineage and its three

main clades separately (H. iberica, H. dentipes and H. gracilis lineages). The [gamma]-statistic of

Pybus and Harvey (2000) was not significantly different from that obtained with a constant

diversification rate for all lineages tested except for H. dentipes, which showed the nodes

significantly sifted towards the origin, i.e. a decrease of the diversification rates with time (Table 2;

Fig. 3). When the missing species were randomly added to the tree (according to the procedure

outlined in Pybus and Harvey, 2000) the significance decreased (p= 0.08). The non-constancy of the

diversification rate in the H. dentipes lineage was confirmed with the selection of an exponential

diversification model, significantly rejecting the pure birth model with a constant speciation rate

(Table 2). On the contrary, for all other tested lineages the best model was a pure birth (H. gracilis,

H. iberica), or the best model could not be said to be significantly better that the pure birth (whole

“Haenydra” lineage).

The inclusion of the missing species in their most likely phylogenetic position according to

morphology did not change the results of the diversification analyses (Table 2; Fig. 3). The H.

dentipes was the only lineage with a non-constant [gamma]-statistic and a model of diversification

significantly distinct from a pure birth (Table 2). The effect of adding the missing species was

spread through the tree and did not change its overall shape, as clearly seen from the LTT plots

(Fig. 3).

There were also large differences in the estimated speciation rate of the different lineages,

with the H. gracilis lineage having a speciation rate (0.6 species/MY) approximately double that of

other lineages even after the inclusion of the missing species in their most likely phylogenetic

position (Table 2).

4. DISCUSSION

4.1. Phylogeny of “Haenydra”

We obtained a very robust phylogeny of the genus Hydraena despite differences in the

reconstruction method (Bayesian probabilities or Maximum Likelihood) and the used partition

model (by gene or by codon). Differences between the obtained topologies were found only at

poorly supported nodes, and more pronounced between different inference methods than between

different partition models. It is remarkable that despite the difficulties in estimating some

parameters of the third codon positions (see Pons et al., 2010 for a detailed discussion referring to

protein coding mitochondrial genes in Coleoptera), the topologies and branch lengths obtained were

almost identical. Differences in the alpha parameter of the third codon positions of almost three

orders of magnitude translated in a single topological difference in a node with low support. Despite

the overall similarity of the trees obtained, the comparison through Bayes factors were all highly

significant using standard criteria, both when comparing the two runs of the codon partition that

failed to converge and the two different partitions.

As suggested by previous analyses (Jäch et al., 2000; Ribera et al., 2011), the species

belonging to the “Haenydra” lineage form a strongly supported monophyletic clade within the large

genus Hydraena s.l., and in particular within the subgenus Hydraena s.str., in which they occupy a

derived position. Within Hydraena s.str., all the main groups described by morphological cladistic

analyses (Jäch et al., 2000) were confirmed by our molecular analyses (Hydraena riparia, H.

rufipes, H. pygmaea and H. holdausi groups, in addition to “Haenydra”). Among the analysed taxa,

the H. bisulcata group appeared most closely related to “Haenydra”, although the dataset did not

include species belonging to the Chinese H. armipalpis group, which is considered by some authors

as the sister group of “Haenydra” (Jäch and Díaz, 2000a; Jäch et al., 2000).

Within “Haenydra” the relationships among the three main lineages were not supported. The

species of the H. iberica lineage are all Iberian endemics, and several authors have proposed a

taxonomic relationship between this group and H. truncata (Berthélemy, 1966; Berthélemy and

Whytton De Terra, 1977; Díaz and Garrido, 1993), but this affinity is not supported by our results.

The H. gracilis lineage includes more than 25 species (Appendix 1) with relatively similar

external morphology (habitus dark brown to black; absence of relevant male secondary sexual

characters, excluding a fringe of long setae on male metatibiae, typical of almost all “Haenydra”

species, and elytra with an engraved sutural notch in females), as well as an aedeagus typically

characterised by a complex and spiral-shaped distal lobe (Jäch, 1995; Trizzino et al., 2011). With

the exception of Hydraena gracilis and H. excisa, widely distributed throughout Europe, the species

belonging to this clade typically exhibit reduced geographic ranges. According to our molecular

clock calibration, this clade originated ~5.6 Ma, and most species share a more recent origin (<2.6

Ma), corresponding to the Pleistocene glacial cycles that played a pivotal role in species

diversification and geographic distributions.

The H. gracilis complex sensu Jäch (1995), although confirmed as monophyletic by

molecular data, needs a morphological re-analysis. Both mitochondrial and nuclear markers did not

clearly differentiate closely related species that are morphologically distinct, e.g. H. gracilis, H.

crepidoptera and H. graciloides (Jäch, 1995). This apparent incongruity between morphological

and molecular data may be due to incomplete lineage sorting associated with a recent origin of these

species. The recent origin of the H. gracilis complex is compatible with the availably data on

Quaternary fossils (Abellán et al., 2011). There are records of H. gracilis remains in Late Glacial

and Holocene deposits in Britain and Sweden, and the oldest remains are from France (La Grand

Pile), from the Eemian interglacial ca. 100,000 ya (Ponel, 1995). At a cox1 rate of 4% difference

per MY (Ribera et al., 2010), this would match the differences observed within the clade of

European and Anatolian H. gracilis (ca. 3-4 base pair differences for the sequenced fragment).

The H. dentipes lineage as defined here includes a series of well supported clades that can be

readily recognised based on their morphology and distribution. One of these clades, including H.

caucasica, groups (with low support) the species of Haenydra with the easternmost distribution, in

Turkey, Lebanon and Iran (see Appendix 1 for missing species; Jäch, 1988, 1992; Jäch et al., 2006;

Bilton and Jäch, 1998). These species are characterised by a relatively homogeneous habitus and the

male genitalic features, and their relationships with the rest of the H. dentipes lineage were not well

established.

The Iberian endemic H. tatii complex (Delgado and Soler, 1991; Audisio et al., 1996)

includes three sibling species (H. tatii, H. manfredjaechi and H. gaditana), and was recently

investigated by Ribera et al. (2011). Their results demonstrated a non–random distribution among

the group, and that the clade likely originated some 3.3 Ma during an acute cooling period that

facilitated the early expansion of the ancestral species. The H. monstruosipes complex (Ribera et

al., 2011) includes two species characterised by pronounced male secondary sexual characters and

relatively localised and allopatric ranges in the north-west of the Iberian peninsula. Ribera et al.

(2011) suggested a sister group relationship of the H. monstruosipes and H. tatii complexes,

hypothesising a common origin for these five Iberian endemic species ca. 3.3. Ma. However, our

results partially contrasted with these conclusions, suggesting (albeit with low support) that the H.

monstruosipes complex is more related to the Italian H. devillei complex than to the Iberian H. tatii

complex (Figs 1–2). Under this phylogenetic hypothesis, the geographic analyses of Ribera et al.

(2011) would have to be applied to the H. monstruosipes plus devillei complexes, also with fully

allopatric distributions in perfect agreement with their phylogenetic distances. They would thus be

the result of a process of range expansion and fragmentation independent to that of the species of

the H. tatii complex.

The Hydraena evanescens clade includes a group of seven species characterised by a reddish

habitus (Audisio et al., 2009; Audisio and De Biase, 1995) and a circum–Tyrrhenian distribution.

Molecular data suggests a split of this clade into two monophyletic groups corresponding to the H.

decolor complex (Audisio and De Biase, 1995) and the H. evanescens complex (Audisio et al.,

2009). The H. decolor complex comprises four notably rare and mainly allopatric species from the

Apenines and the Ligurian and Maritime Alps. The H. evanescens complex includes three species

endemic to Tyrrhenian islands, H. evanescens (Corsica), H. tyrrhena (north and central Sardinia)

and H. rosannae (southwest Sardinia).

4.2. Diversification and biogeography of “Haenydra”

According to our estimations the "Haenydra" lineage originated ca. 8–9 Mya (Tortonian),

and its radiation extended through the Messinian salinity crisis and afterwards during the

Pleistocene glacial cycles. The absence of species of “Haenydra” from north Africa and some

Mediterranean islands (Baleares, Crete, Cyprus) suggest a northern origin, with expansion to the

southern areas only after the re–opening of the Gibraltar Strait at the end of the Messinian salinity

crisis (~5 Mya), and in any case after the formation of the Mid–Aegean trench, isolating the island

of Crete (ca. 12–9 Mya: Dermitsakis and Papanikolau, 1981; Simaiakis and Mylonas, 2008).

Despite the availability in Crete of several suitable high–quality habitats with cold running water,

“Haenydra” species are absent in this Island, whereas a single endemic species of Hydraena s.str.,

with relatively more ancient east Mediterranean affinities, is widespread (H. subinura

d’Orchymont; see Audisio and De Biase, 1990). The origin of the oldest Iberian species, the H.

iberica lineage, does predate the end of the Messinian, providing in principle opportunities for a

north African colonisation. However, the current distribution of the species of the lineage does not

reach the Baetic cordilleras in the south, being restricted to the Hercinian biogeographical area of

Ribera (2000), and it is likely that this northwestern Iberian distribution has been maintained since

the origin of the group (Ribera et al., 2011).

We did not found any clear geographic separation between the three main clades within

“Haenydra”. Although one of them (the H. iberica lineage) is restricted to the Iberian peninsula, the

more diverse H. gracilis and H. dentipes lineages are widespread through the whole north

Mediterranean area, from Iberia to Turkey (Fig. 4). Both lineages include some of the widespread

species (H. gracilis or H. excisa in the H. gracilis lineage, and H. dentipes or H. truncata in the H.

dentipes lineage, Jäch, 2004).

The lack of geographical separation between the main lineages, and the presence of some

widespread species among the most numerous local endemics is in agreement with the scenario

proposed by Ribera et al. (2010) for the diversification of “Haenydra”, with repeated cycles of

range expansion and subsequent fragmentation resulting in species with reduced geographical

ranges likely to have originated, and persisted, in the areas in which they are currently found. Given

the estimated origin of the “Haenydra” lineage, predating the Messinian salinity crisis, there are two

possible main routes allowing these range expansions and the dispersal through Europe. The first

would be a northern route through the main river basins, which has also been hypothesized for some

groups of freshwater fishes (Banarescu, 1990, 1992; Levy et al., 2009). In the case of fishes and

other non-flying organisms, dispersal would be facilitated by river-captures, when a portion of the

high course of a river is “captured” by a contiguous drainage system due to tectonic or

geomorphologic events. This allows partial faunal exchanges between the two river basins, with the

small-scale dispersal of most freshwater organisms inhabiting reocrenic and epirithral habitats,

which are thus able to cross-colonise spring and upland river areas belonging to distinct but

contiguous drainage systems. The species of Hydraena have aerial respiration, and thus are not as

linked to the aquatic medium as fishes, and even if most of the restricted endemics are not able to

fly, some of the widespread species do fly (e.g. H. gracilis, Jäch, 1997). Nevertheless, the same

conditions that allowed the dispersal of lotic freshwater fishes through the northern Mediterranean

area would certainly have also favoured the dispersal of species of “Haenydra”.

An alternative and potentially faster southern route of dispersal, first proposed by freshwater

fishes by Bianco (1990) (see also Zardoya and Doadrio, 1999; Levy et al., 2009), allows the

possibility of coastal diffusion of freshwater organisms through a more or less contiguous network

of river mouths during the brief freshwater Lago–Mare stage of the Messinian Salinity Crisis (a

period of ca. 100,000 years occurring 5.0 Mya, Hsü et al., 1977). The first scenario (north

Mediterranean route) requires the geographic continuity of the species ranges: both if speciation

was the result of a stepping-stone process through contiguous river basins, or the result of local

rarefaction of a widespread species that experienced a sudden range expansion, the resulting species

would be geographically close to each other, with no phylogenetically close species at large

geographical distances (Ribera et al., 2010). On the contrary, the second scenario (southern

dispersal during the Messinian) would allow the possibility of closely related species to be currently

found at large geographical distances, due to the disappearance of the suitable connecting habitats

in early Pliocene.

We did not found evidence of Miocenic trans-Mediterranean links in our molecular

phylogeny, suggesting the lack of direct dispersal routes during the Messinian salinity crisis through

areas below the current sea level. The only clear trans-Mediterranean connection is the presence of

H. exasperata in the Iberian Peninsula, a member of the H. excisa complex, and whose most closely

related species, both based on morphological and molecular data, live in the Balkans and in the

Near East (e.g. H. christinae, H. phallica, H. akbesiana, H. integra). However, the cladogenetic

event separating H. exasperata from its eastern allies is estimated to have occurred some 2 Mya, i.e

in early Pleistocene, and then most likely due to a fast westwards expansion of an eastern

Mediterranean species. There is, on the contrary, a strong geographical structure in the

reconstructed phylogeny, with groups of closely related species having also close geographical

distributions (Appendix 1; Jäch, 2004), in agreement with the expectations of a northern

Mediterranean dispersal route.

There are, however, some examples of a likely dispersal during the Pliocene through

emerged land bridges, but involving short geographical distances. The relationship of the Corso-

Sardinian species of the H. evanescens complex with those of the H. decolor complex, distributed in

southeast France and northwest Italy, clearly suggests a link between the mountain areas of the

emerged northwestern portion of peninsular Italy and the Corso-Sardinian microplate. During the

last phase of detachment and rotation of the Corso-Sardinian microplate (5–3 Mya) there were also

limited land connections between Corsica and northern Sardinia (Jolivet et al., 2006). Our

estimation of the origin of the species of the H. evanescens complex (ca. 4 Mya) does not support a

Messinian ori- gin, as has been hypothesised for other groups of Corso-Sardinian endemics (e.g.

land snails, Ketmaier et al., 2006), although due to the large confidence intervals this possibility

cannot be excluded. The traditional hypothesis of a vicariant origin through the tectonic separation

of the microplates at the end of the Eocene would re- quire a link with Iberian or Pyrenean species,

something not sup- ported by our results (see a detailed explanation of the alternative scenarios in

Audisio et al., 2009).

The overall diversification pattern of the “Haenydra” lineage was best described by a simple

birth process, with a constant diversification rate of ca. 0.4 species per MY. Although not

particularly high when compared to classic examples of fast radiations in plants or some groups of

vertebrates, with rates above 2 species per MY (see e.g. Valente et al., 2010), this rate is

nevertheless higher than those reported for many groups of insects (e.g. 0.25 sp/MY for butterflies

in the Neotropical Andes, Elias et al, 2009), including beetles (0.22 sp/MY for north American tiger

Beetles, Barraclough and Vogler, 2002; 0.08-0.10 sp/MY for different groups of ground beetles,

Ober and Heider, 2010; or 0.05 to 0.07 sp/MY for the whole Coleoptera, Hunt et al., 2007). Within

“Haenydra” there were substantial differences in the mode of diversification, with the H. gracilis

lineage having the higher speciation rate (0.65 sp/MY) with no sign of decreasing with time. On the

contrary, the H. dentipes linage, although more diverse due to its oldest age, had an overall

estimated speciation rate of ca. half this value (0.3 sp/MY), and strong evidence of decreasing rates

with time. This pattern of decreasing diversification rates with time, resulting in the lack of

correlation of the age of the clade with its total richness, seems to be more common than

traditionally assumed, and has been attributed to a ecological “saturation” of niche space (Rabosky,

2009; Ricklefs, 2010). In a different group of water beetles (Dytiscidae) there is an overall good

correlation between species number and the age of the main clades within the family (Ribera et al.,

2008), but at a shallower level (tribe Hyphydrini) there was also a strong correlation between the

total number of species and the combined geographic span of the clade (Ribera and Balke, 2007).

The saturation of the geographical space as a reason for a decreasing diversification would be in

agreement with the reduced geographic extend of the Hydraena dentipes in comparison with the H.

gracilis lineage (ca. 4 and 10x10^6 Km2 respectively; Fig. 4), although most of the range of the H.

gracilis lineage is occupied by only two species with very wide European distributions, H. gracilis

and H. excisa (Jäch, 2004). The morphology of the species of the H. dentipes lineage is more

diverse than that of the species of the H. gracilis lineage, but the possible relationships of these

morphological differences with the ecology of the species is at present totally unknown.

Acknowledgements

We thank all collectors mentioned in Appendix 2 for the help with specimens for study. We

are indebted to Lucilla Carnevali and Stefano De Felici (University "Sapienza", Rome) for the help

with geographic map, and to Manfred Jäch (NMW) and Juan Díaz (University of Santiago, Spain)

for their valuable comments and suggestions. Thanks to Niccolò Falchi (University "Sapienza",

Rome) and W. Zelenka (NMW) for the habitus of H. solarii and H. catalonica (Fig. 1). Photos of

habitus of H. hungarica, H. saga, H. truncata and H. nigrita are taken from the website:

http://www.colpolon.biol.uni.wroc.pl/index.htm (Iconographia Coleopterorum Poloniae). Finally,

we thank Andrew Cline (Sacramento, California, USA) for the linguistic revision of the manuscript.

A visit of the first author to the NMW was supported by Synthesys (Application AT–TAF–53).

References

Abellán, P., Benetti, C.J., Angus, R.B., Ribera, I. 2011. A review of range shifts in Quaternary

European aquatic Coleoptera. Global Ecol. Biogeogr. 20, 87–100.

Audisio, P., De Biase, A., 1990. Materiali per una biogeografia delle Hydraena and Haenydra della

Grecia e delle isole Egee. I Contributo (Coleoptera, Hydraenidae). Fragm. Entomol. 22(3),

381–398.

Audisio, P., De Biase, A., 1995. Materiali per un'analisi biogeografica delle specie italiane dei

generi Hydraena Kugelann ed Haenydra Rey (Coleoptera, Hydraenidae) (Coleoptera,

Hydraenidae). Fragm. Entomol. 27, 163–189.

Audisio, P., De Biase, A., Jäch, M.A., 1993. A new species of the Hydraena (Haenydra) excisa

complex from Turkey (Coleoptera, Hydraenidae). Linz. Biol. Beitr. 25(1), 489–492.

Audisio, P., De Biase, A., Jäch, M.A., 1996. Greek species of the genus Hydraena (subgenus

Haenydra Rey) (Coleoptera, Hydraenidae). Aq. Ins. 18, 65–90.

Audisio, P., Trizzino, M., De Biase, A., Mancini, E., Antonini, G. 2009. A new species of

Hydraena (Coleoptera: Hydraenidae) of the H. evanescens complex from Sardinia. Zootaxa.

2318, 281–289.

Banarescu, P., 1990. Zoogeography of Fresh Waters, Volume 1. General Distribution and Dispersal

of Freshwater Animals. AULA-Verlag: Wiesbaden, Germany.

Banarescu, P., 1992. Zoogeography of Fresh Waters, Volume 2. Distribution and Dispersal of

Freshwater Animals in North America and Eurasia. AULA-Verlag: Wiesbaden, Germany.

Barraclough, T.G., Vogler, A.P., 2002. Recent diversification rates in North American tiger beetles

estimated from a dated mtDNA phylogenetic tree. Mol. Biol. Evol. 19, 1706–1716.

Barraclough, T.G., Hogan, J.E., Vogler, A.P., 1999. Testing whether ecological factors promote

cladogenesis in a group of tiger beetles (coleoptera : Cicindelidae). Proc. R. Soc. B 266,

1061–1067.

Bianco, P.G., 1990. Potential role of the paleohistory of the Mediterranean and Paratethys basins on

the early dispersal of Euro-Mediterranean freshwater fishes. Ichthyol. Explor. Freshwaters.

1, 167–184.

Berthèlemy, C., 1966. Recherches ècologique et biogèographiques sur les Plècoptères et

Colèoptères d'eau courante (Hydraenidae et Elminthidae) des Pyrènèes. Ann. Limn. 2 (2),

227–458.

Berthélemy, C., 1986. Remarks on the genus Hydraena and revision of the subgenus Phothydraena

(Coleoptera: Hydraenidae). Ann. Limn. 22, 181–193.

Berthélemy, C., Whitton De Terra, L.S., 1977. Hydraenidae et Elmidae du Portugal (Coleoptera).

Ann. Limn. 13 (1), 29–45.

Bilton, D.E., Jäch, M.A., 1998. Hydraena (Haenydra) hosseinieorum sp.n. (Insecta: Coleoptera:

Hydraenidae) from Iran. Ann. Nat. Mus. Wien, Series B. 100, 343–348.

Bonfield, J., Beal, K., Jordan, M., Cheng, Y., Staden, R., 2005. The Staden Package Manual.

Medical Research Council, Laboratory of Molecular Biology, Cambridge, U.K.

Brock, C.D., Harmon, L.J., Alfaro, M.E., 2011. Testing for temporal variation in diversification

rates when sampling is incomplete and nonrandom. Syst. biol. 60, 410–419.

Díaz, J.A., Garrido, J., 1993. Hydraena (Haenydra) altamirensis sp. n. from the Iberian Peninsula

(Coleoptera, Hydraenidae). Aq. Ins. 15 (3), 169–175.

d'Orchymont, A., 1930. Nouvelles notes sur quelques Hydraena paléarctiques. Bull. Ann. Soc.

Entomol. Belg. 70, 218–228.

d'Orchymont, A., 1940. Contribution à l'étude des Palpicornia. XIV. Bull. Ann. Soc. Ent. Belg.

16(43), 1–8.

Delgado, J.A., Soler, A.G., 1991. A new species of aquatic beetle of the genus Hydraena (subgenus

Haenydra) from the Iberian Peninsula (Coleoptera: Hydraenidae). Aq. Ins. 13(4), 217–222.

Dermitzakis, M.D., Papanikolaou, D.J., 1981. Palaeogeography and geodynamics of the Aegean

region during the Neogene. Ann. Géol. Pays Hellen. 30, 245–289.

Drummond, A., Rambaut, A., 2007. Beast: Bayesian evolutionary analysis by sampling trees. BMC

Evol. Biol. 7, 214.

Elias, M., Joron, M., Willmott, K., Silva-Brandão, K.L., Kaiser, V., Arias, C.F., Gomez Piñerez,

L.M., Uribe, S., Brower, A.V.Z., Freitas, A.V.L., Jiggins, C.D., 2009. Out of the Andes:

patterns of diversification in clearwing butterflies. Mol. Ecol. 18, 1716–1729.

Ferro, G., 1985. Una nuova specie d'Hydraena (Haenydra) della Grecia (Col. Hydraenidae). XVI

contributo allo studio degli Hydraenidae. Bull. Ann. Soc. R. Belg. Entomol. 127, 217–221.

Ferro, G., 1991. Due nuove specie Paleartiche appartenenti al genere Haenydra Rey. XXV

Contributo alla conoscenza degli Hydraenidae. Bull. Ann. Soc. R. Belg. Entomol. 121(4–6),

91–93.

Ferro, G., Audisio, P., 2006. Sulla presenza di Haenydra carniolica (Pretner, 1970) in Italia nord–

orientale (Coleoptera Hydraenidae). Boll. Soc. Entomol. Ita. 138, 1–17.

Gaston, K.J. 2003. The structure and dynamics of geographic ranges. Oxford University Press,

Oxford: UK.

Gaston, K.J., He, F. 2002. The distribution of species range size: a stochastic process. Proc. R. Soc.

B 269, 1079–1086.

Hansen, M., 1991. A review of the Genera of the Beetle Family Hydraenidae (Coleoptera).

Steenstrupia 17, 1–52.

Hansen, M., 1998. World catalogue of insects. Volume 1. Hydraenidae (Coleoptera). Apollo Books,

Stenstrup, 168 pp.

Harvey, P.H., May, R.M., Nee, S., 1994. Phylogenies without fossils. Evolution 48, 523–529.

Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees.

Bioinformatics 17, 754–755.

Hunt, T., Bergsten, J., Levkanicova, Z., Papadopoulou, A., St John, O., Wild, R., Hammond, P.M.,

Ahrens, D., Balke, M., Caterino, M.S., Gómez-Zurita, J., Ribera, I., Barraclough, T.G.,

Bocakova, M., Bocak, L. & Vogler, A.P. 2007. A comprehensive phylogeny of beetles

reveals the evolutionary origins of a super-radiation. Science. 318, 1913-1916

Hsü, K.J., Montadert, L., Bernoulli, D., Cita, M.B., Erickson, A., Garrison, R.E., Kidd, R.B.,

Mèlierés, F., Müller, C.,Wright, R. 1977. History of the Messinian salinity crisis. Nature.

267, 399–403.

Ienistea, M.A., 1968. Die Hydraeniden Rümaniens (Coleoptera, Hydraenidae). Trav. Mus. Nat.

Hist. Nat. Grigore Antipa. 8, 759–795.

Jablonski, D., 1987. Heritability at the species level: analyses of geographic ranges of Cretaceous

mollusks. Science 238, 360–363.

Jäch, M.A., 1988. Updating the Hydraena Fauna of Turkey (Coleoptera, Hydraenidae). Entomol.

Bas. 12, 241–258.

Jäch, M.A., 1992. New and little known Palearctic species of the genus Hydraena (s.l.) Kugelann

(Coleoptera: Hydraenidae). Koleopt. Rund. 62, 77–125.

Jäch, M.A., 1995. The Hydraena (Haenydra) gracilis Germar species complex (Insecta:

Coleoptera: Hydraenidae). Ann. Nat. Mus. Wien, Series B. 97, 177–190.

Jäch, M.A., 1997. Daytime swarming of rheophilic water beetles in Austria (Coleoptera: Elmidae,

Hydraenidae, Haliplidae). Latissimus 9, 10–11.

Jäch, M.A., 2004. Hydraenidae. In: I. Löbl & A. Smetana (Eds), Catalogue of Palaearctic

Coleoptera. Volume 2: Hydrophiloidea – Histeroidea – Staphylinoidea. Apollo Books,

Stenstrup, pp. 102–122.

Jäch, M.A., Beutel, R.G., Díaz, J.A., Kodada, J., 2000. Subgeneric classification, description of

head structures, and world check list of Hydraena Kugelann (Insecta: Coleoptera:

Hydraenidae). Ann. Nat. Mus. Wien, Series B. 102, 177–258.

Jäch, M.A., Díaz, J.A., 2000a. Descriptions of eight new species of Hydraena (Coleoptera:

Hydraenidae). Entomol. Prob. 31(1), 41–58.

Jäch, M.A., Díaz, J.A. 2000b. New and little known Palearctic species of the genus Hydraena VI

(Coleoptera: Hydraenidae). Entomol. Prob. 31(2), 155–162.

Jäch, M.A., Díaz, J.A., 2001. New and little known Palearctic species of the genus Hydraena

Kugelann VII (Insecta: Coleoptera: Hydraenidae). Ann. Nat. Mus. Wien, Series B. 103,

363–373.

Jäch, M.A., Díaz, J.A., 2006. New and little known Palearctic species of the genus Hydraena

Kugelann (Insecta: Coleoptera: Hydraenidae) VIII. The Hydraena (s.str.) planata

Kiesenwetter complex. Ann. Nat. Mus. Wien, Series B. 107B, 57–69.

Jäch, M.A., Dia, A., Díaz, J.A., 2006. Taxonomy and ecology of the Lebanese species of the genus

Hydraena Kugelann, with descriptions of four new species (Coleoptera: Hydraenidae).

Koleopt. Rund. 76, 97–134.

Jolivet, L., Augier, R., Robin, C., Suc, J.-P., Rouchy, J.M., 2006. Lithospheric-scale geodynamic

context of the Messinian salinity crisis. Sed. Geol. 188, 9–33.

Kass, R.E., Raftery, A.E., 1995. Bayes Factors. J. Amer. Stat. Assoc. 90, 773–795.

Katoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequence alignment

program. Brief. Bioinf. 9, 286–298.

Ketmaier, V., Giusti, F., Caccone, A., 2006. Molecular phylogeny and historical biogeography of

the land snail genus Solatopupa (Pulmonata in the peri-Tyrrhenian area. Mol. Phyl. Evol.

39, 439–451.

Kuwert, A., 1888. Genearlübersicht der Hydraenen der europäischen Fauna. Dt. Entomol. Z. 32,

113–123.

Lee, T.M., Jetz, W. 2011. Unravelling the structure of species extinction risk for predictive

conservation science. Proc. R. Soc. B 278, 1329–1338.

Levy, A., Doadrio, I., Almada, V.C., 2009. Historical biogeography of European leuciscins

(Cyprinidae): evaluating the Lago Mare dispersal hypothesis. J. Biogeog. 36(1), 55–65.

Maddison, W.P. and Maddison, D.R., 2010. Mesquite: a modular system for evolutionary analysis.

Version 2.74 http://mesquiteproject.org.

May, R.M., 1978. The dynamics and diversity of insect faunas. In: L.A. Mound & N. Waloff (eds)

Diversity of insect faunas. Blackwell, pp. 188-204.

Miller, K.B., Bergsten, J., Whiting, M.F., 2009. Phylogeny and classification of the tribe Hydaticini

(Coleoptera: Dytiscidae): partition choice for Bayesian analysis with multiple nuclear and

mitochondrial protein-coding genes. Zool. Script. 38, 591–615.

Nee, S., Holmes, E.C., May, R.M., Harvey, P.H., 1994. Extinction rates can be estimated from

molecular phylogenies. Philos. T. Roy. Soc. B. 344, 77–82.

Ober, K.A. Heider, T.N., 2010. Phylogenetic diversification patterns and divergence times in

ground beetles (Coleoptera: Carabidae: Harpalinae). BMC Evol. Biol. 10, 262

Oosterbroek, P., Arntzen, J.W. 1992. Area-cladograms of circum-Mediterranean taxa in relation to

Mediterranean paleaogeography. J. Biogeogr. 19, 3–20.

Pagel, M., Meade, A., 2004. A phylogenetic mixture model for detecting pattern-heterogeneity in

gene sequence or character-state data. Syst. Biol. 53, 571–581.

Paradis, E., Claude, J., Strimmer, K., 2004. Ape: Analyses of phylogenetics and evolution in R

language. Bioinformatics 20, 289–290.

Perkins, P.D., 1980. Aquatic beetles of the family Hydraenidae in the Western Hemisphere:

Classification, biogeography and inferred phylogeny (Insecta, Coleoptera). Quaest.

Entomol. 16, 3–554.

Perkins, P.D., 1997. Life on the effective bubble: Exocrine secretion delivery systems (ESDS) and

the evolution and classification of beetles in the family Hydraenidae (Insecta: Coleoptera).

Ann. Carn. Mus. 66, 89–207.

Ponel, P., 1995. Rissian, Eemian and Würmian Coleoptera assemblages from La Grande Pile

(Vosges, France). Palaegeol., Palaeoclimatol, Palaeoecol. 114(1), 1–41.

Pons, J., Ribera, I., Bertranpetit, J., Balke, M., 2010. Nucleotide substitution rates for the full set of

mitochondrial protein–coding genes in Coleoptera. Mol. Phyl. Evol. 56, 796–807.

Posada, D., 2008. JModelTest phylogenetic model averaging. Mol. Biol. Evol. 25 (7), 1253–1256.

Pybus, O.G., Harvey, P.H., 2000. Testing macro-evolutionary models using incomplete molecular

phylogenies. Proc. R. Soc. B. 267, 2267–2272.

Rabosky, D.L., 2006. Laser: A maximum likelihood toolkit for detecting temporal shifts in

diversification rates from molecular phylogenies. Evol. Bioinform. Online 2, 257–260.

Rabosky, D.L. 2009. Ecological limits and diversification rate: alternative paradigms to explain the

variation in species richness among clades and regions. Ecol. Letters. 12, 735–743.

Rey, C., 1886. Histoire naturelle des Coléoptères de France (suite). Ann. Soc. Linn. Lyon,

32(1885), 1–187, pl. 1–2.

Ribera, I. 2000. Biogeography and conservation of Iberian water beetles. Biol. Conserv. 92, 131–

150.

Ribera, I., Balke, M., 2007. Recognition of a species-poor, geographically restricted but

morphologically diverse Cape lineage of diving beetles (Coleoptera: Dytiscidae:

Hyphydrini). J. Biogeography. 34, 1220–1232.

Ribera, I., Castro, A., Díaz, J.A., Garrido, J., Izquierdo A., Jäch, M.A., Valladares, L.F., 2011. The

geography of speciation in narrow range endemics of the “Haenydra” lineage (Coleoptera,

Hydraenidae, Hydraena). J. Biogeogr. 38(3), 502–516.

Ribera, I., Fresneda, J., Bucur, R., Izquierdo, A., Vogler, A.P., Salgado, J.M., Cieslak, A., 2010.

Ancient origin of a western Mediterranean radiation of subterranean beetles. BMC Evol.

Biol. 10, 29.

Ribera, I., Vogler, A.P., Balke, M., 2008. Molecular phylogeny and diversification of diving beetles

(Coleoptera, Dytiscidae). Cladistics. 24, 563-590.

Ricklefs, R.E., 2010. Evolutionary diversification, coevolution between populations and their

antagonists, and the filling of niche space. Proc. Natl. Acad. Sci. US. 107, 1265–1272.

Rocchi, S., 2009. Coleotteri acquatici endemici presenti nell'appennino settentrionale (Coleoptera:

Dytiscidae, Hydraenidae, Scirtidae, Elmidae). Onychium. 7, 48–52.

Schoener, T.W., 1987. The geographical distribution of rarity. Oecologia 74, 161–173.

Seidlitz, G., 1888. Fauna Baltica. Die Kaefer (Coleoptera) der deutshen Ostseeprovinzen

Russlands, 2. Ed. 10 + LVI + 192 + 818 pp. Konisberg.

Shull, V.L., Vogler, A.P., Baker, M.D., Maddison, D.R., Hammond, P.M., 2001. Sequence

alignment of 18s ribosomal rna and the basal relationships of adephagan beetles: Evidence

for monophyly of aquatic families and the placement of trachypachidae. Syst. Biol. 50, 945–

969.

Simaiakis, S., Mylonas, M., 2008. The Scolopendra species (Chilopoda: Scolopendromorpha:

Scolopendridae) of Greece (E-Mediterranean): a theoretical approach on the effect of

geography and palaeogeography on their distribution. Zootaxa. 1792, 39–53.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and

phylogenetic utility of mitochondrial gene-sequences and a compilation of conserved

polymerase chain-reaction primers. Ann. Entomol. Soc. America. 87, 651–701.

Stamatakis, A., Hoover, J., Rougemont, J., 2008. A Rapid Bootstrap Algorithm for the RAxML

Web–Servers. Syst. Biol. 75(5), 758–771.

Trizzino, M., Jäch, M.A., Audisio, P.A., Ribera, I., 2011. Molecular and morphological analyses

confirm two new species of the Hydraena saga–emarginata clade (Coleoptera Hydraenidae,

Hydraeninae) from Spain and France. Zootaxa. 2760, 29–38.

Valente, L.M, Savolainen, V., Vargas, P., 2010. Unparalleled rates of species diversification in

Europe. Proc. R. Soc. B 277, 1489–1496.

Vogler, A.P., Desalle, R., Assmann, T., Knisley, C.B., Schultz, T.D., 1993. Molecular population

genetics of the endangered tiger beetle cicindela dorsalis (Coleoptera, Cicindelidae). Ann.

Entomol. Soc. America. 86, 142–152.

Zardoya, R., Doadrio, I., 1999. Molecular evidence on the evolutionary and biogeographical

patterns of European cyprinids. J. Mol. Evol. 49, 227–237.

FIGURE CAPTIONS

Figure 1: Phylogram obtained by RAxML with the combined data. Above nodes, bootstrap values

in RAxML (when >50%) / Bayesian posterior probabilities (Bpp), partition by codon / Bpp partition

by gene. With “-“, compatible nodes (i.e. not resolved); “x”, incongruent nodes. Representative

habitus of the different clades, from top to bottom: H. hungarica (lapidicola clade), H. truncata

(truncata clade), H. catalonica (dentipes clade), H. solarii (evanescens clade), H. caucasica

(caucasica clade), H. gracilis (gracilis clade), H. nigrita (Hydraena s.str.) (see Appendix 1).

Figure 2: Ultrametric tree obtained by Beast with the mitochondrial sequences, with a molecular

rate of 2% divergence per MY. The topology was constrained to be congruent to that obtained with

the combined dataset (Fig. 1). Bars at nodes represent confidence intervals, basal numbers represent

ages (MY).

Figure 3: Lineage through time (LTT) plots of the lineages used for the diversification analyses.

Thin lines, LTT of the sampled species (i.e. missing species not included): black line, Haenydra

lineage; green line, H. iberica lineage; red line, H. gracilis lineage; blue line, H. dentipes lineage.

Thick lines, range of the LTT plots of the 1000 trees including the missing species in their most

likely phylogenetic position, with polytomies randomly resolved (see Methods): pale red lines, H.

gracilis lineage; pale blue lines, H. dentipes lineage.

Figure 4: Geographic distribution of the three major lineages within “Haenydra”, Hydraena

gracilis, H. dentipes and H. iberica lineages, compiled from published and unpublished sources (M.

Trizzino and P. Audisio, in prep.).

Table 1: List of primer used for molecular analyses.

Table 2: Parameters of diversification analyses.

ELECTRONIC APPENDIX

Appendix 1: Checklist of the known species of Hydraena of the “Haenydra” lineage, with the

species complex in which they are included according to morphology and their geographic

distribution.

Appendix 2: List of studied material, with voucher number, locality, collector and accession

numbers. “New”, specimens newly included in this study (sp, new species; ex, duplicated

specimen).

Appendix 3: Parameters of the MrBayes run using a partition by codon.

Appendix 4: Results of the phylogenetic analyses with MrBayes. a) Partition by genes; b) partition

by codon. Numbers in nodes, Bayesian posterior probability.

Appendix 5: Phylogenetic position and branch lengths of the species of the “Haenydra” lineage

with no molecular data, estimated according to morphological similarity (with the exception of H.

sappho, of uncertain affinities, see main text).

0.06

H. fosterorum AI481

H. excisa AI348

H. diazi AI479

H. bitruncata AI354

H. vedrasi 104_2

H. exasperata AI506

H. bensae 21_1

H. schuleri AI400

H. solarii 62_1

H. altamirensis AI425

H. monstruosipes AI439

H. akbesiana 49_1

H. tyrrhena 21_1

H. saga AI485

H. kasyi AI1026

H. leonhardi AI339

H. dalmatina RA80

H. marcosae AI904

H. evanescens AI286

H. tarvisina AI967

H. integra AI783

H. catalonica AI1060

H. discreta 27_1

H. vedrasi RA94

H. gavarrensis AI288

H. corinna AI284

H. devincta 69_1

H. pangaei 80_1

H. gracilis 162_1

H. truncata AI508

H. bensae AI293

H. devincta AI966

H. leonhardi 97_1

H. truncata 1_1

H. tatii AI164

H. sanfilippoi 23_1

H. producta AI402

H. bolivari AI171

H. samnitica 78_1

H. devillei 13_1

H. riberai AI568

H. plumipes 34_1

H. sinope AI788

H. heterogyna AI294

H. gracilis AI333

H. dentipes AI361

H. hayashii AI691

H. unca AI276

H. truncata AI357

H. gracilis AI510

H. gaditana AI166

H. bisulcata AI172

H. anatolica AI802

H. servilia AI274

H. antiatlantica AI567

H. crepidoptera 137_1

H. reyi AI320

H. capta AI167

H. septemlacuum 141_1

H. bicuspidata 163_1

H. christinae 106_2

H. polita AI369

H. alpicola AI347

H. morio AI1203

H. devillei AI288

H. belgica AI426

H. madronensis AI424H. iberica AI181

H. epeirosi 89_1

H. lusitana AI385

H. quilisi AI1085

H. assimilis 29_1

H. emarginata AI325

H. subintegra AH147

H. palustris AI309

H. czernohorskyi 65_1

H. dalmatina AI391

H schuleri 77_1

H. hispanica AI329

H. bitruncata AI380

H. caucasica AI493

H. occitana 24_1

H. exasperata AI315

H. dochula AI1018

H. bononiensis 22_1

H. integra 140_1

H. aroensis 82_1

H. polita AI165

H. gracilis balcanica 113_1

H. dentipes 123_1

H. solodovnikovi 167_1

H. nigrita AI345

H. sinope AI803

H. pygmaea AI346

H. lapidicola 30_1

H. delia AI1061

H. heterogyna 14_1

H. polita 165_1

H. carniolica AI1049

H. manfredjaechi AI313

H. lazica 138_1

H. holdhausi AI1025

H. decolor 28_1

H. balearica AI175

H. gracilis balcanica 68_1

H. tarvisina 157_1

H. jaechiana 99_2

H. zezerensis AI182

H. fontiscarsavii 134_1

H. gracilis AI332

H. graciloides 139_1

H. muelleri 67_1

H. gracilis balcanica AI338

H. septemlacuum AI795

H. scitula 142_1

H. fosterorum AI282

H. barrosi AI954

H. subintegra 98_1

H. subacuminata AI305

H. dentipalpis AI492

H. larissae 158_1

H. catalonica AI381

H. catalonica AI350

H. lapidicola AI292

H. larissae AI303

H. rosannae 16_1

H. larissae 122_1

100/1/1

100/1/1

98/1/1

65/0.52/0.66

89/1/1

99/1/1

72/0.8/0.75

64/0.94/0.99

98/1/1

82/x/0.75

93/1/0.98

98/1/1

80 /1/1

100/1/1

76/0.74/0.91

95/1/1

96/1/1

97/1/1

70/0.98/0.93

95/1/1

100/1/1

64/0.51/-

100/1/1

86/0.89/0.99

100/1/1

75/0.95/0.94

69/1/1

59/0.67/0.58

60/0.69/0.55

84/0.99/0.99

92/0.99/1

100/1/1

100/1/1

95/1/1

58/0.72/0.52

56/0.97/0.96

100/1/1

96/1/1

100/1/1

90 /1/1

100/1/1

100/1/1

61/0.9/0.91

69/0.99/0.98

100/1/1

85/0.8/0.94

52/x/x

88/1/1

92/1/1

100/1/1

81/0.91/0.97

77/0.74/0.71

72/0.98/0.98

77/1/0.99

93/1/1

94/1/1

52/-/0.59

91/1/1

85/0.9/0.96

80/0.98/0.99

97/1/1

66/0.72/0.80

99/1/1

100/1/1

100/1/1

100/1/1

71/0.97/0.97

55/0.88/0.86

100/1/1

89/0.97/0.98

60/0.99/0.82

95/1/1

62/x/0.67

99/1/1

77/0.89/0.99

54/x/x

99/0.87/-

97/1/1

78/0.98/1

100/1/1

85/0.99/1

92/1/1

99/1/1

88/0.64/0.65

99/1/1

94/0.99/1

99/0.5/0.52

52/-/-

54/0.59/0.73

98/1/1

<50/0.9/0.74

<50/0.77/-

<50/0.83/0.84

<50/0.85/0.85

<50/0.79/0.74

<50/0.58/-

<50/0.75/0.96

“HAENYDRA”

H. iberica lineage

H. gracilis lineage

H. dentipes lineage

H. truncata clade

H. gracilis clade

H. caucasica clade

H. evanescens clade

H. dentipes clade

H. lapidicola clade

0.05.010.015.020.025.030.0

H. jaechiana 99_2

H. unca AI276

H. tyrrhena 21_1

H. diazi AI479

H. saga AI485

H. monstruosipes AI439

H. alpicola AI347

H. g. balcanica 68_1

H. madronensis AI424

H. akbesiana 49_1

H. lapidicola AI292

H. gracilis AI510

H. tarvisina AI967

H. dentipalpis AI492

H. truncata AI357

H. reyi AI320

H. dochula AI1018

H. devillei AI288

H. polita 165_1

H. lusitana AI385

H. subacuminata AI305

H. bononiensis 22_1

H. dalmatina RA80

H. bisulcata AI172

H. morio AI1203

H. delia AI1061

H. septemlacuum 141_1

H. pygmaea AI346

H. dentipes 123_1

H. carniolica AI1049

H. catalonica AI350

H. riberai AI568

H. leonhardI 97_1

H. pangaei 80_1

H. crepidoptera 137_1

H. exasperata AI506

H. solarii 62_1

H. gaditana AI166

H. occitana 24_1

H. leonhardi AI339

H. manfredjaechi AI286

H. gracilis AI332

H. nigrita AI345

H. gavarrensis AI288

H. antiatlantica AI567

H. sanfilippoi 23_1

H. decolor 28_1

H. fontiscarsavii 134_1

H. gracilis AI333

H. sinope AI788

H. g. balcanica AI338

H. heterogyna 14_1

H. catalonica AI1060

H. marcosae AI904

H. larissae AI303

H. muelleri 67_1

H. epeirosi 89_1

H. aroensis 82_1

H. dentipes AI361

H. emarginata AI325

H. g. balcanica 113_1

H. polita AI165

H. rosannae 16_1

H. sinope AI803

H. larissae 122_1

H. barrosi AI954

H. christinae 106_2

H. gracilis 162_1

H. exasperata AI315

H. truncata AI508

H. hispanica AI329

H. lazica 138_1

H. subintegra AH147

H. septemlacuum AI795

H. vedrasi 104_2

H. palustris AI309

H. kasyi AI1026

H. iberica AI181

H. bolivari AI171

H. bensae AI293

H. bicuspidata 163_1

H. integra 140_1

H. dalmatina AI391

H. vedrasi RA94

H. fosterorum AI282

H. discreta 27_1

H. truncata 1_1

H. assimilis 29_1

H. serivilia AI274

H. catalonica AI381

H. devincta AI966

H. solodovnikovi 167_1

H. scitula 142_1

H. integra AI783

H. czernohorskyi 65_1

H. evanescens AI286

H. larissae 158_1

H. graciloides 139_1

H. subintegra 98_1

H. balearica AI175

H. belgica AI426

H. schuleri 77_1

H. excisa AI348

H. caucasica AI493

H. lapidicola 30_1

H. corinna AI284

H. zezerensis AI182

H. tatii AI164

H. tarvisina 157_1

H. quilisi AI1085

H. devincta 69_1

H. bitruncata AI380

H. polita AI369

H. capta AI167

H. fosterorum 481

H. holdhausi AI1025

H. anatolica AI802

H. altamirensis AI425

H. schuleri AI400

H. hayashii AI691

H. bitruncata AI354

H. bensae 21_1

H. plumipes 34_1

H. heterogyna AI294

H. samnitica 78_1

H. devillei 13_1

H. producta AI402

“HAENYDRA”

H. iberica lineage

H. gracilis lineage

H. dentipes lineage

TORTONIAN & MESSINIANPLIOCENE

PLEISTOCENE

100

8 0

2

3

4

6

10

16

25

40

63

6 5 4 3 2 179

MY

No. lineages

Table 1 – List of primer used for molecular analyses Gene Name Sense Sequence Reference cox1 Jerry (M202) F CAACATTTATTTTGATTTTTTGG Simon et al. (1994)

Pat (M70) R TCCA(A)TGCACTAATCTGCCATATTA Simon et al. (1994) Chy F T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT Ribera et al. (2010) Tom R AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A Ribera et al. (2010) Tom-2 R A(A/G)GGGAATCATTGAATAAA(A/T)CC Ribera et al. (2010)

cyb CB3 F GAGGAGCAACTGTAATTACTAA Barraclough et al. (1999) CB4 R AAAAGAAA(AG)TATCATTCAGGTTGAAT Barraclough et al. (1999)

rrnL-nad1 16saR (M14) F CGCCTGTTTA(A/T)CAAAAACAT Simon et al. (1994) 16Sa R ATGTTTTTGTTAAACAGGCG Simon et al. (1994) 16Sb R CCGGTCTGAACTCAGATCATGT Simon et al. (1994) 16SAlf1 R GCATCACAAAAAGGCTGAGG Vogler et al. (1993) ND1A (M223) R GGTCCCTTACGAATTTGAATATATCCT Simon et al. (1994) 16Sbi F ACATGATCTGAGTTCAAACCGG Simon et al. (1994) FawND1 R TAGAATTAGAAGATCAACCAGC Simon et al. (1994)

SSU 5' F GACAACCTGGTTGATCCTGCCAGT Shull et al. (2001) b5.0 R TAACCGCAACAACTTTAAT Shull et al. (2001)

LSU Ka F ACACGGACCAAGGAGTCTAGCATG Ribera et al. (2010) Kb R CGTCCTGCTGTCTTAAGTTAC Ribera et al. (2010)

Table 2 – Parameters of diversification analyses

Clade N Nm gamma p-gamma p- missing best model 2nd best model r p dAIC r1

Haenydra 74 19 -0.245 0.4 0.59 y2r pb 0.373 0.21 -

Haenydra + 92 0 [-1.05,-0.72] [0.15,0.23] - y2r pb 0.377 0.15 -

H. dentipes 42 13 -1.699 0.04 0.08 DDX pb 0.294 0.05 1.68

H. dentipes + 55 0 [-2.60, -2.15] [<0.005,<0.02] - DDX pb 0.3 0.07 1.51

H. gracilis 28 5 0.5 0.69 0.69 pb DDX 0.645 0.15 -

H. gracilis + 33 0 [0.28,0.47] [0.61,0.69] 0.56 pb DDX 0.641 0.16 -

H. iberica 4 0 -0.398 0.35 0 pb - 0.227 - -

Results of the diversification analyses. N, number of taxa included in the tree; N.m. number of missing species; gamma, gamma statistic of Pybus and Harvey (2000); p-gamma, significance of the one tailed-test of constancy of the g-statistic through the tree, assuming complete sampling; p-missing, significance of the g-statistic compared with a null distribution of 10,000 trees including Nm missing species placed randomly in the tree; best model, model selected by the diversification test among two constant rate models, pure birth (pb) and birth and death (bd), and three variable rate models, logistic (DDL), exponential (DDX) and pure birth with two speciation rates (y2r); 2nd best model, best model of variable rate if the best is a model of constant rate, and vice-versa; r, speciation rate (pb model), p-dAIC, significance of the delta-Akaike information criteria for model comparison, using the null distribution of 10,000 simulations constructed with a pb model and the estimated r (following Rabosky 2006); r1, initial speciation rate in the DDX models. Clades with a “+” were build with the inclusion of the missing species in the most likely position according to morphology (see Appendix 1), and using 1,000 trees with the polytomies randomly resolved (see Methods). For the gamma-statistic and its significance the full range of the 1,000 randomly resolved trees is given.