MOLECULAR EPIDEMIOLOGY OFMETHICILLIN-RESISTANT

STAPHYLOCOCCUS AUREUS IN FINLAND

Saara Salmenlinna

Academic dissertation

To be publicly discussed, with permission of the Faculty of Medicine, University of

Helsinki. Haartman Institute, Haartmaninkatu 3, Helsinki,

November 8, 2002 at 12.00 noon

National Public Health Institute, Department of Microbiology,Helsinki, Finland

University of Helsinki, Faculty of Medicine, Helsinki, Finland

2

Publications of the National Public Health InstituteKTL A20/2002

ISBN 951-740-303-8 (print)ISBN 951-740-304-6 (pdf)ISBN 951-740-304-4 (html)ISSN 0359-3584

SupervisorDocent Jaana Vuopio-Varkila, M.D, PhD.Department of Microbiology,National Public Health Institute, Helsinki, Finland

ReviewersDocent Pentti Kuusela, M.D, PhD.Department of Bacteriology and Immunology,The Haartman Institute, University of Helsinki, Finland

Docent Mikael Skurnik, PhD.Department of Medical Microbiology and Molecular Biology,University of Turku, Finland

OpponentAlex van Belkum, PhD.Department of Medical Microbiology and Infectious Diseases,Erasmus Medical Center Rotterdam, Erasmus University,Rotterdam, The Netherlands

JULKAISIJA-UTGIVARE-PUBLISHERKansanterveyslaitos Folkhälsoinstitutet National Public Health InstituteMannerheimintie 166 Mannerheimvägen 166 Mannerheimintie 16600300 Helsinki 00300 Helsinki 00300 Helsinkipuh. (09) 47441 tel. (09) 47441 phone. +358-0-47441fax. (09) 47448238 fax. (09) 47448238 fax. +358-0-47448238

To my family

5

Contents

LIST OF PUBLICATIONS ............................................................................ 7ABBREVIATIONS ........................................................................................ 8ABSTRACT ................................................................................................... 91. INTRODUCTION .................................................................................... 112. REVIEW OF THE LITERATURE ........................................................... 14

2.1 Staphylococcus aureus .................................................................. 142.1.1 Laboratory diagnostics .......................................................... 142.1.2 Cell wall ................................................................................ 142.1.3 Genome ................................................................................. 152.1.4 Diseases ................................................................................. 162.1.5 Carriage ................................................................................. 172.1.6 Virulence factors.................................................................... 172.1.7 Pathogenesis .......................................................................... 20

2.2 Methicillin-resistantStaphylococcus aureus ................................................................... 212.2.1 Methicillin resistance ............................................................ 212.2.2 Evolution of MRSA............................................................... 252.2.3 MRSA surveillance ............................................................... 262.2.4 MRSA in health care facilities .............................................. 272.2.5 Community-acquired MRSA ................................................ 292.2.6 Molecular typing of MRSA................................................... 30

3. AIMS OF THE STUDY ........................................................................... 364. MATERIAL AND METHODS ................................................................ 37

4.1 National MRSA surveillance ........................................................ 374.2 MRSA strain collection ................................................................. 374.3 Epidemiological background data ................................................. 37

4.3.1 Hospital contacts ................................................................... 374.3.2 Patient days............................................................................ 38

4.4 Isolation of DNA, and primers used ............................................. 394.5 Identification and antimicrobial

susceptibility testing of MRSA ...................................................... 394.5.1 Antimicrobial susceptibility testing ...................................... 394.5.2 mecA-PCR and nuc-PCR ....................................................... 39

4.6 Typing methods ............................................................................. 414.6.1 Phage typing .......................................................................... 414.6.2 Ribotyping ............................................................................. 414.6.3 Pulsed field gel electrophoresis (PFGE) ............................... 414.6.4 Hypervariable region (HVR) hybridization .......................... 424.6.5 Multilocus sequence typing ................................................... 42

6

4.6.6 mec regulatory region PCR ................................................... 434.6.7 mec hypervariable region sequencing ................................... 434.6.8 Computer-assisted analysis of typing data ............................ 43

4.7 Definitions and nomenclature of strains ....................................... 434.8 Statistical analysis and ethical aspects .......................................... 44

5. RESULTS ................................................................................................. 455.1 Elaboration of MRSA verification and typing (I, II, III, IV) ........ 455.2 MRSA trends and epidemic strains (I, II, III, IV) ......................... 465.3 Molecular traits linked to epidemic spread (II) ............................. 495.4 MRSA clones (I, III, IV) ............................................................... 495.5 MRSA in community (III) ............................................................ 52

6. DISCUSSION........................................................................................... 536.1 Elaboration of the typing scheme.................................................. 536.2 MRSA trends and epidemic strains ............................................... 546.3 Mec hypervariable region.............................................................. 556.4 MRSA clones and transmissibility ................................................ 566.5 MRSA in community .................................................................... 586.6 Horizontal transfer of mec DNA ................................................... 59

7. CONCLUSIONS AND CONSIDERATIONSFOR THE FUTURE ................................................................................ 61

8. ACKNOWLEDGEMENTS...................................................................... 639. REFERENCES ......................................................................................... 6510. ORIGINAL PUBLICATIONS ............................................................... 89

7

LIST OF PUBLICATIONS

This thesis is based on the following articles, which are referred to in thetext by Roman numerals.

I. Salmenlinna S, Lyytikäinen O, Kotilainen P, Scotford R, Siren E,Vuopio-Varkila J. Molecular Epidemiology of methicillin-resistantStaphylococcus aureus in Finland. Eur J Clin Microbiol InfectDis 2000;19:101-7.

II. Salmenlinna S and Vuopio-Varkila J. Recognition of two groupsof methicillin-resistant Staphylococcus aureus strains based on ep-idemiology, antimicrobial susceptibility, hypervariable-region type,and ribotype in Finland. J Clin Microbiol 2001;39:2243-7.

III. Salmenlinna S, Lyytikäinen O, Vuopio-Varkila J. Community-ac-quired methicillin-resistant Staphylococcus aureus, Finland. EmergInf Dis 2002;8:602-7.

IV. Salmenlinna S, Vehkaoja L, Vuopio-Varkila J. Analysis of geneticbackground of predominant methicillin-resistant Staphylococcusaureus in Finland. Submitted for publication.

In addition, some unpublished results are included.

8

ABBREVIATIONS

AFLP amplified fragment length polymorphismagr accessory gene regulatoraux auxilliary factors for methicillin resistanceAP-PCR arbitrarily primed PCRBORSA borderline resistant Staphylococcus aureusEARSS European Antibiotic Resistance Surveillance SystemFAME fatty acid modifying enzymefem factors essential for methicillin resistanceHELICS Hospitals in Europe Link for Infection Control through Sur-

veillanceICU intensive care unitIg immunoglobulinIL interleukinMIC minimal inhibitory concentrationMRSA methicillin-resistant Staphylococcus aureusGlcNAc N-acetylglucosamineMurNAc N-acetylmuramic acidNCCLS National Committee for Clinical Laboratory StandardsNINSS Nosocomial Infection National Surveillance Scheme (UK)NNIS National Nosocomial Infections Surveillance System(USA)MHC major histocompatibility complexMLEE multilocus enzyme electrophoresisMLST multilocus sequence typingMSCRAMM microbial surface components recognizing adhesive matrix

moleculesORF open reading framePAGE polyacrylamide gel electrophoresisPBP penicillin binding proteinPCR polymerase chain reactionPFGE pulsed field gel electrophoresisPVL Penton-Valentine leucosidinRAPD randomly amplified polymorphic DNARFLP restriction fragment length polymorphismsar staphylococcal accessory gene regulatorSCCmec staphylococcal casette chromosome mecslv single locus variantST sequence typeTSST 1 toxic shock syndrome toxin 1

9

ABSTRACT

Methicillin-resistant Staphylococcusaureus (MRSA) is a major cause ofnosocomial infections worldwide, andhospital outbreaks caused by MRSAare common. Unless outbreaks arecontrolled, MRSA may reside perma-nently in a hospital environment. Suchendemic MRSA are difficult to eradi-cate, and they most likely further in-crease the number of infections, thecosts, and the length of hospital stays.MRSA strains are commmonly resis-tant to multiple antimicrobials, whichnarrows treatment possibilities andchanges the spectrum of antibioticsprescribed in hospitals.

This study was performed toanalyze comprehensively the FinnishMRSA isolates collected through anationwide surveillance program since1992 by various molecular methods.We describe the elaboration of a typ-ing scheme suitable for continuousnational surveillance in a country witha low prevalence of MRSA, and ana-lyze the overall trends of MRSA, aswell as the proportion of community-acquired MRSA. We especially focuson the characterization of predominantMRSA strains linked to interhospitalepidemics and local intrahospital out-breaks. We assess clonality, evolution,association with community acquisi-tion, and molecular traits linked to in-creased transmissibility.

The baseline number of annualMRSA remained stable in the 1980sand early 1990s. After a peak causedby extensive hospital epidemics in

1994, an increasing trend has beenobserved. The incidence of MRSA in-creased from 1.7 in 1995 to 5.0 in 2000per population of 100,000. Between1997 and 1999, one fifth of all MRSAisolates were from persons who hadnot been hospitalized within two yearsbefore the date of the MRSA isolation.It was suspected that these isolates hadbeen acquired in a community setting.

A total of 38 epidemic or localoutbreak strains were identified be-tween 1992 and 2001. By phage typ-ing, ribotyping, pulsed field gel elec-tophoresis, and multilocus sequencetyping, 31 of these strains clusteredinto eight different clones. Represen-tatives of six clones had multilocussequence types identical to interna-tional MRSA clones, the Brazilian,Iberian, UK EMRSA-16, UK EMR-SA-15, New York, and Berlin clones.Together, these clones accounted for35% of all MRSA isolates in 1997-1999. The remaining two clones,named Joensuu and Mikkeli, showeda molecular epidemiology differentfrom that of the pandemic MRSAclones. The multilocus sequence typeof Joensuu is commonly found amonginternational methicillin sensitive S.aureus strains, and the Mikkeli se-quence type is a single locus variantof another, apparently rare, MRSAtype. The Mikkeli clone was the mostprevalent MRSA clone in Finland be-tween 1997 and 2001.

Phage typing, ribotyping, andpulsed field gel electrophoresis re-vealed that three strains were associ-ated with community acquisition.

10

These strains belonged to the Mikkeliand Joensuu clones, and the third wasa triple allele multilocus sequencevariant of the Joensuu clone.

Search for epidemicity markersrevealed two different populations ofMRSA strains. One group containedstrains showing mec hypervariable re-gion hybridization pattern A combinedwith a variety of ribotypes and resis-tance to beta lactam antibiotics only.The majority of these strains were spo-radic by nature. The other group con-tained strains with mec hypervariableregion hybridization pattern B or C inassociation with two ribotypes, andresistance to other antibiotic groups inaddition to beta lactams. This groupcontained both epidemic and sporad-ic strains.

Taken together, these resultssuggest that two epidemiologicallyand evolutionarily distinct MRSApopulations exist in Finland: 1) glo-bal clonally disseminated, often mul-tiresistant strains, and 2) strains sen-sitive to multiple antibiotics with ge-netic backgrounds related to methicil-lin-sensitive S. aureus strains. Somestrains of the latter population mayhave recently acquired the mec DNAthrough horizontal transfer, and thismay have occured in a communitysetting as well.

11

1. INTRODUCTION

Nosocomial infections cause a sub-stantial burden for health and econom-ics worldwide. A nosocomial infectionis defined as an infection acquired inhospital, and which is not in the incu-bation phase on the patient’s admis-sion to hospital. However, a nosoco-mial infection may be caused by a col-onizing organism which the patientcarried before hospital admission (84).Such endogenous, sporadic infectionsaccount for the majority of all noso-comial infections (136, 290, 302).Cross-transmission may lead to epi-demics, i.e. an increased number of in-fections and/or colonizations.

Any microbial group, bacteria,viruses, fungi, or parasites can causea nosocomial infection, but bacteriaare the most prevalent organisms.Among gram positive bacteria, com-mon nosocomial agents include sta-phylococci, enterococci, streptococci,and Clostridium difficile, and amonggram negatives, Escherichia coli,Klebsiella sp, Enterobacter, Proteus,Serratia, Pseudomonas aeruginosa,Stenotrophomonas maltophilia, Acine-tobacter spp, and Haemophilus spp.An additional concern is the emer-gence and dissemination of nosocomi-al organisms with increased resistanceto antimicrobial agents. Such microbesinclude methicillin-resistant S. epider-midis and S. aureus, vancomycin-re-sistant enterococci, multiresistant andextended-spectrum beta-lactamase-producing gram negative bacteria.

By extrapolating studiesperformed in Sweden, Norway, and

the USA, it has been estimated that ap-proximately 50,000 nosocomial infec-tions occur annually in Finland, andabout 1000 persons without a seriousunderlying disease die of nosocomialinfections (2, 17, 99, 155). A recentstudy showed that the overall rate ofnosocomial bloodstream infections inFinland is similar to the rates in En-gland and in the USA, but S. aureus,enterococci and fungi are less commonas causative agents in Finland (69,157). The most common bloodstreampathogens in Finland are coagulasenegative staphylococci (31%), Escher-ichia coli (11%), and S. aureus (11%).Comparison of the number of noso-comial infections between hospitalsand countries is difficult for severalreasons. First, although definitions ofdifferent types of nosocomial infec-tions exist, they may be interpreted indifferent ways by individual reseach-ers. Second, comprehensive reportingof nosocomial infections may be dif-ficult to achieve without a substantialresource input. Third, denominatordata should be suitable, and gatheredin a uniform way (30, 155)

Because of inevitable risk fac-tors related to treatment or to patients,nosocomial infections cannot be total-ly eradicated. Invasive operations anddevices create opportunities for mi-crobes to invade the host tissue, andingreasingly ill and compromised pa-tients can be treated by evolving tech-niques and equipment. Risk factorsmost likely to result in colonization orinfection with multiresistant speciesinclude advanced age, severity of ill-

12

ness, inter-institutional transfer, pro-longed hospital stay, gastrointestinalsurgery, transplantation, exposure tomedical devices, and exposure tobroad-spectrum antibiotics (236).However, some of nosocomial infec-tions are avoidable, namely those aris-en through cross-transmission.

One of the most importantpathogens causing considerable mor-bidity and mortality in hospitals ismethicillin-resistant S. aureus(MRSA). Owing to expression of anadditional penicillin binding protein,PBP2a, with decreased affinity to beta-lactam agents, MRSA is resistant toall beta-lactam antibiotics, includingcephalosporins and staphylococcalpenicillins (15). Many isolates ofMRSA are also resistant to severalother antimicrobial groups. Between1997 and 1998, the SENTRY antimi-crobial surveillance program gathereda total of 3981 monthly consequtivebacterial specimens from several typesof infections: bloodstream, pneumo-nia, respiratory tract, skin and soft tis-sue, and urinary tract infections. Twen-ty-five European intensive care unitswere involved. The most prominentorganism was S. aureus, and 39% ofthe isolates were resistant to methicil-lin (76).

The epidemiology of MRSA ischanging constantly. Two new stagesof MRSA evolution have occurredduring recent years: emergence ofMRSA strains with reduced suscepti-bility or with resistance to glycopep-tide antibiotics (GISA or GRSAstrains, respectively) (31), and com-

munity-acquisition of MRSA by per-sons without known risk factors (29).

The first GISA strain was re-ported in 1997 in Japan, and thus farabout two dozen strains of this typehave been reported in different partsof world. The resistance mechanisminvolves thickening of cell wall pep-tidoglycan, which walls off vancomy-cin from the target (110). In July 2002,the first GRSA was reported in theUSA in a catheter exit site in a patientwith several underlying diseases andmultiple courses of antimicrobial ther-apy. This strain showed minimal in-hibitory concentration (MIC) of van-comycin and teicoplanin of >128 µg/ml and 32 µg/ml, respectively, andcontained the enterococcal vanA gene(31).

Community-acquired MRSAhave been isolated from persons withrisk factors for MRSA, such as intra-venous drug use or previous hospitalstays. However, between 1997 and1999, community-acquired MRSAcaused fatal infections in four childrenwithout any known risk factors forMRSA (29). Although it is not knownwhether the community-acquired iso-lates were originally hospital born, itseems that transmission of MRSAmay occasionally occur in the com-munity, and serious infections maydevelop in previously healthy persons.

This study focuses on molecu-lar epidemiology of MRSA in Finlandby analyzing, by various typing meth-ods, the MRSA strain collection gath-ered by nationwide MRSAsurveillance between 1992 and 2001.

13

The resulting molecular information al-lows the development of a hypothesison the evolution of different populationsof MRSA, and examined together withepidemiological background informa-tion, the characterization of strains as-sociated with community acquisition.

14

2. REVIEW OF THE LITERA-TURE

2.1 STAPHYLOCOCCUSAUREUS

2.1.1 Laboratory diagnosticsS. aureus is a gram positive, catalasepositive aerobic or anaerobic coccusshowing hemolytic and large yellowcolonies. The laboratory diagnosticsis based on culture and biochemicaltests: typical morphology, positivecoagulase reaction, fermentation ofmannitol and trehalose, and produc-tion of heat stabile nuclease (thermo-nuclease). The ability of coagulase toclot plasma is the most widely usedmethod for identification. A four–hourtube coagulase test with reconsitutedplasma is definitive, and a slide testfor bound coagulase is a means of rap-id screening for species identification(130). Latex agglutination tests, suchas Slidex Staph Plus (Biomérieux,France) and Staphaurex Plus (MurexBiotech, England), consist of latexparticles coated with IgG (bound byprotein A), fibrinogen (bound byclumping factor), and IgG for S. au-reus specific antigens. The thermonu-clease can be detected using a metach-romatic agar diffusion procedure andDNA toluidine blue agar (143).

2.1.2 Cell wallThe outermost layers of pathogens areimportant in the infection process (6).Most S. aureus isolates are covered bya polysaccharide capsule. Capsularpolysaccharides can be classified into

eleven different serotypes. Beneath thecapsule S. aureus harbors a typicalgram positive cell wall (86). The grampositive cell wall differs from that ofgram negative bacteria in two majorcharacteristics: a gram positive cellwall has a thicker and highlycrosslinked peptidoglycan layer, andit lacks the outer membrane (12, 18,220, 287) (Figure 1).

The peptidoglycan consists ofglycan strands of N-acetylglu-cosamine-N-acetylmuramic acid(GlcNAc-MurNAc) disaccarides,crosslinked by tetrapeptides consist-ing of L-alanine, D-glutamine, L-lysine, and D-alanine (86). In S. au-reus, a pentaglysine inter-bridge linksthe tetrapeptide units of adjacent gly-can strands. S. aureus produces fourpenicillin-binding proteins, PBP1-4,involved in the cell wall peptidogly-can assembly (141). The biological ac-tivity of these native PBPs is similarto that of serineproteases, and they actas transpeptidases in the crosslinkingof the glycan chains (181, 299). PBP2

Figure 1. Schematic presentation of S.aureus cell wall.

Teichoic acid

Capsule

Membrane

Peptidoglycan

15

is a bifunctional protein which, in ad-dition to transpeptidase activity, alsoacts as transglycosylase (91). PBPsbind effectively to beta-lactam antibi-otics, and in the presens of theseagents, the cell wall assembly is dis-continued.

Another common feature in thegram positive cell wall is teichoic acid,a carbohydrate-phosphate polymercovalently linked to MurNAc (12).Teichoic acids bind divalent cationsand possess antigenic properties (146).

2.1.3 GenomeThe genomic positions of various ge-netic markers of S.aureus have beenlocalized by creating physical maps of

the genome. The development of S.aureus chromosomal maps beganthrough definition of three linkagegroups consisting of nine auxotrophicmarkers and a novobiocin resistancemarker on S. aureus NCTC 8325(211). By inclusion of a large numberof additional markers, and the use ofpulsed field gel electrophoresis(PFGE) and subsequent hybridizationwith available probes, the physicalmap of S. aureus NCTC 8325 contin-ued to be more and more precise (116,210, 295) (Figure 2). However, untildata from genome sequencing becameavailable, the mutual distances be-tween genetic markers within eachPFGE fragment were unknown.

sak

A

N

B

M G E

L

D

K

F

I

H

C

J

O

A = 674 B = 361 C = 324 D = 262 E = 257 F = 208 G = 175 H = 135 I = 117 J = 80 K = 76 L = 44 M = 36 N = 10 O = 10 P = 9

purA spa

fnbA, fnbB

coa

recA

femA, femB

Figure 2. S.aureus NCTC 8325 physical map. Adapted from (205). SmaI restriction frag-ments A-P, their sizes in kilobase pairs, and examples of identified genetic markers.

16

Knowledge of bacterial struc-tures and functions has increased andwill further increase owing to recentadvances in genome sequencing andin other genome-wide analysis. Todate, genomes of seven S. aureusstrains have been elucidated or aresoon to be completed, COL, NCTC8325, N315, Mu50, MW2, UK EMR-SA-16, and MSSA 476, (http://www.sanger.ac.uk/Projects/S_aureus,http://www.tigr.org/tigr-scripts/CMR2/CMRHomePage.spl, http://www.genome.ou.edu/staph.html) (11,139). Half of all predicted proteins ofstrain N315 were similar to those ofBacillus subtilis or Bacillus halodu-rans, and these proteins mostly codedfor essential functions such as DNAreplication, protein synthesis, and car-bohydrate metabolism. Nearly 40% ofall predicted proteins were similar toas yet unknown proteins, or showedno sequence similarity in global data-bases. Furthermore, some of the openreading frames (ORFs) were similarto those of taxonomically distant or-ganisms, but not all of them differedin GC content or codon usage. How-ever, the first sextant of the chromo-some showed accumulation of ORFswith unusual codon composition. Ithas been suggested that this regioncontains exogenous genes recentlyacquired through lateral transfer (139).

2.1.4 DiseasesStaphylococcus aureus causes a widevariety of diseases, from mild skin in-fections to severe life threatening sys-temic infections (297). It is a common

cause of skin and subcutaneus infec-tions, including folliculitis, furuncu-losis, cellulitis, mastitis, and impeti-go. Recurrent abscesses of the skin andthe subcutaneous tissue may be diffi-cult to treat. The preferable tratmentfor folliculitis and local abscesses issurgical drainage, whereas cellulitis isusually treated with antimicrobials.Impetigo can range from mild, recur-rent infections to a more severebullous form and to the potentiallylife-threatening scalded skin syndrome(144). S. aureus is also commonly as-sociated with postoperative wound in-fections, catheter-related infections,toxic shock syndrome (TSS), and foodpoisoning. TSS and food poisoning aretoxin-mediated diseases. The com-mon, self-limiting, food poisoning iscaused by enterotoxins present in con-taminated food, and is characterizedby nausea, vomiting, headache, andsometimes diarrhea. The symptomsstart four to five hours after consump-tion of contaminated food (112, 304).TSS, caused by TSST-1, is a poten-tially fatal condition, most commonlyassociated with the use of highly ab-sorbent tampons, but also known innon-invasive S. aureus infections inchildren. The symptoms include highfever, rash, desquamation of skin oneto two weeks after onset, hypotension,and involvement of multiple organsystems (63, 247, 268)

Serious S. aureus infections in-clude osteomyelitis, pneumonia, sep-sis, acute endocarditis, myocarditis,pericarditis, cerebritis, meningitis,scalded skin syndrome, and sterile site

17

abscesses (297). S. aureus pneumoniais rare in a community setting, but fair-ly common in a hospital setting, espe-cially as a consequence of influenzain elderly patients (154). Acute osteo-myelitis primarily affects long bonesin children, whereas chronic (durationof infection >6 months) osteomyelitisis more common in adults after bacte-remia, or as a complication of pene-trating wounds (298). S. aureus sep-sis most often originates in a local in-fection focus such as cellulitis, pneu-monia, or a wound, or is related to anintravascular device (301). Complicat-ed sepsis may hematogenously spreadthe infection to other organs, such asheart, bone, and joints. Annually, S.aureus causes 700-900 septic infec-tions in Finland, and is the third mostcommon causative agent of nosoco-mial sepsis (157). S. aureus endocardi-tis can present as right-sided en-docarditis, often among intravenousdrug users, as left-sided native valveinfection, or as prosthetic valve en-docarditis (120)

2.1.5 CarriageNasal carriage of S. aureus is one ofthe major risk factors for S. aureusinfection (131). Although S. aureuscan be found in different parts of thebody, anterior nares is the primary eco-logical niche in humans (65, 227). Inthe healthy population 10-35% of in-dividuals carry S. aureus persistently,20-75% intermittently, and 5-50%never carry S. aureus in the nose. Pro-portions of nasal carriage patterns dif-fer, depending on the study design and

definitions for persistant-, intermit-tent-, and non-carrier (192). Other riskfactors for S. aureus infection includeage, dialysis, repeated rupture of theskin, and underlying conditions, suchas renal or liver disease and diabetes.

2.1.6 Virulence factorsS. aureus harbors an extensive arse-nal of virulence factors contributingto its ability to propagate and spreadwithin the human host. The form andseverity of the disease result from acomplex interplay between the hostdefense and the activities of the viru-lence factor repetoire of the infectingstrain. Considerable knowledge existson the contribution of several viru-lence factors to specific diseases.Much less is known of the consertedaction of these factors, their interac-tion with the host, and the relative im-portance of each factor in infection.One virulence factor may be indis-pensable in some infections, but insig-nificant in others. According to theirbiological function, the virulence fac-tors can be divided into three groups:those involved in adhesion, in hostdefense evasion, and in tissue pene-tration (Table 1). One factor can servein one or more of these activities, anddifferent factors are produced in dif-ferent growth phases.

Most clinical S. aureus strainsproduce capsular polysaccaride of se-rotype 5 or 8. The capsule may inhibitbinding of antibodies and thereby op-sonization, and phagocytosis (264,266). In addition, capsular polysaccha-ride may have a role in bacterial ad-

18

↑

Table 1. Examples of Stapylococcus aureus virulence factors. = upregulation, = downregulation. Adapted from (223), table 3-1, and from (193),table 1. n.d, not determined or not reported in the literature.

↑

Virulence factor Gene Regulation system Production

phase

Proposed virulence

function

Reference

Clumping factor clfA sar� Exponential Attachment (41, 175)

Fibrinogen binding protein A fbaA agr� , sar� Exponential Attachment (40)

Fibronecting binding protein B fnbB agr� , sar� Exponential Attachment, invasion (45, 127, 173,252)

Collagen binding protein cna sar� Exponential Attachment (21)

Coagulase coa agr� , sae� Exponential Attachment (87, 226)

Protein A spa agr� , sarA� ,

sarS� ,sae�Exponential Host defence evasion,

attachment

(42, 87, 104)

Enterotoxin A entA agr� All Host defence evasion (63)

Enterotoxins B-E, G-J entB-E, entG-J agr� Postexponential Host defence evasion (63)

Toxic shoc syndrome toxin tst agr� , sar� Postexponential Host defence evasion (63)

Exfoliative toxin eta, etb agr� Postexponential Host defence evasion (144)

Lipase geh agr� , sar� Postexponential Host defence evasion (21)

Serine protease spr agr� , sar� Postexponential Host defence evasion (224)

V8 protease sasP, sspA agr� , sar� Postexponential Host defence evasion (8, 127)

Fatty acid metabolizingenzyme

n.d. agr� , sar� Postexponential Host defence evasion (33, 178)

Penton-Valentine leucosidin lukF-PV, lukS-

PV

n.d. Postexponential Host defence evasion

Leucosidin R lukF-R, lukS-R agr� n.d. Host defence evasion

Capsular polysaccarides cap1-8 locus agr� Postexponential Host defence evasion (156)

Staphylokinase sak agr� n.d. Host defence evasion (8)

Hemolysins � , � , � hla, hlb, hld agr� , sarA� Postexponential Tissue penetration (226)

Hemolysin � hlg agr� Postexponential Tissue penetration (8)

Phospholipase C plc agr� n.d. Tissue penetration (8)

Metalloprotease aur agr� n.d. Tissue penetration (8)

Hyaluronidase hysA, hal agr� Postexponential Tissue penetration (8)

19

hesion to polymer surfaces in medi-cal devices (180).

The role of free coagulase in thevirulence of S. aureus is uncertain.However, since it is produced by themajority of strains and has biologicalfunction as a prothrombin activator, itis considered a probable virulence fac-tor. The cell wall bound clumping fac-tor, another fibrinogen binding pro-tein, shares a significant sequence sim-ilarity with coagulase, and its role inadherence is clearer than that of coag-ulase (61, 175, 250).

Surface proteins needed in at-tachment to host tissue are expressedin the logarithmic growth phase dur-ing cell wall synthesis. These micro-bial surface components recognizingadhesive matrix molecules(MSCRAMMs) (212) include fi-bronectin binding protein, fibrinogenbinding protein, collagen binding pro-tein, and clumping factor. Protein A,another surface protein also producedduring cell wall synthesis, may havea role in host defense evasion, sinceits biological function is to bind theIgG Fc-domaine (277). The surfaceproteins of gram positive bacteria havea common overall structure. An ami-noterminal secretory signal peptide di-rects the export of the protein, and itis then cleaved off. The hydrophobiccarboxyterminal remains within thecell membrane, and just outside of thecell membrane the protein is thencleaved between threonine and glycineresidues in a well-conserved LPXTGmotive. In staphylococci, the proteinis anchored to the pentaglycine cross-

bridge in the cell wall peptidoglycan.A proline-rich area spans the cell wall,and the extracellular amino-terminuscontains a unique sequence that rec-ognizes the target molecule in its en-vironment (77).

S. aureus produces a wide vari-ety of exoproteins, most of them dur-ing the postexponential growth phase.These proteins degrade the host tissueto nutrients required for the growth ofthe bacteria, and/or allow the bacteriato penetrate deeper into the host tis-sue (63). The majority of strains pro-duce hemolysins, nucleases, proteas-es, lipases, hyaluronidase, and colla-genase. Alpha-hemolysin (or alpha-toxin) is dermonecrotic, neurotoxic,and lyses mammalian cells, especial-ly red blood cells, by forming a porein the target membrane (19). Beta-hemolysin acts as sphingomyelinase,gamma-hemolysin has leucocytolyticactivity, and it has been suggested thatdelta-hemolysin has surfactant orchannel forming properties (63). Sta-phylokinase is a plasminogen activa-tor (145). Hyaluronidase digests hy-aluronic acid present in the skin, bone,umbilical cord, vitreous body of theeye, and synovial fluid. Some S. au-reus strains produce additional exo-proteins, which may have host defenseevasion as their major function in vivo.One serine protease has the ability tocleave and inactivate IgG antibodies(224). Another function of proteasesmay include protection against anti-microbial peptides. It has been pro-posed that a fatty acid modifying en-zyme (FAME) detoxifies bactericidal

20

fatty acids (178). Penton-Valentineleucocidin (PVL) has leucocytolyticactivity. Exfoliative toxin, TSST 1,and enterotoxins A-E and G-J are po-tent superantigens (63, 144).

Genes for S. aureus virulencefactors may reside in plasmids, bacte-riophages, transposons, or pathogenic-ity islands of the chromosome. Recentsequencing of two S. aureus strainsrevealed three new classes of patho-genicity islands: TSST family islands,exotoxin islands, and enterotoxin is-lands. A considerable number of newputative virulence genes were alsoidentified (139).

The genes coding for virulencefactors are not essential for cell-divi-sion and growth, but are useful in cer-tain situations and environments. Con-stitutive expression of these geneswould be an unnecessary waste of en-ergy. Instead, many virulence factorsare concomitantly upregulated, where-as others, not needed at that point intime, are down-regulated (Table 1).Two major global regulator systemshave been identified: accessory generegulator (agr) and staphylococcal ac-cessory gene regulator (sar) (8). Oth-er regulatory genes and operons, suchas sae, sigB, ssrA-ssrB, and arlS-srlR(78, 87, 138, 310), as well as environ-mental factors (172), also affect theregulation of virulence factors.

The agr regulation turns off thesurface protein expression in the lateexponential phase of growth, and turnson the synthesis of secreted proteinsfor a relatively short time period. Theswich-off mechanism of the secretedproteins’ expression is unknown. Two

distinct agr gene products, generatedfrom promoter P2, form a classical sig-nal transduction pathway, which isactivated by an autoinduction proteinalso translated from the same promot-er. Signal transduction leads to acti-vation of a response regulator AgrA(195). AgrA acts together with anoth-er accessory transcription factor, SarA,to further upregulate promoter P2 andanother agr promotor, P3 (43). Thetranscript from the latter, RNAIII, isthe actual effector in the agr-regula-tion (195). RNAIII primarily acts atthe transcription level, probablythrough one or more regulatory pro-teins. It has also been shown thatRNAIII forms a specific complex withleader sequences of some of the up-regulated genes (177). SarA, coded forby the sar locus, regulates the expres-sion of certain exoprotein genes direct-ly, without agr-activity. Many suchgenes, as well as the intergenic regionbetween P2 and P3 of the agr operon,contain an AT-rich sequence recog-nized by SarA (43).

2.1.7 PathogenesisStaphylococcal pathogenesis resultsfrom various bacterial activities me-diated by virulence factors, and fromthe immunological response by thehost. It is commonly thought that bac-terial adherence to host tissue is a pre-requisite for colonization and infec-tion. This is achieved by theMSCRAMMs (212). Subsequent sur-vival, growth, and establishment ofinfection depend on the ability of thebacterium to circumvent host defense.The primary host response is mediat-

21

ed by polymorphonuclear leucocytes(288), which are attracted by expres-sion of adhesion molecules on endot-helial cells. The cell wall components,peptidoglycan and teichoic acids, trig-ger signaling pathways leading to therelease of cytokines (70, 106). Leu-cocytes and other host cellular factorscan be destructed by locally actingbacterial toxins. Anti-inflammatoryresponse is also achieved by the sta-phylococcal extracellular adherenceprotein, Eap, which inhibits the re-cruitment of host leucocytes by directinteraction with the host adhesive pro-teins ICAM-1, fibrinogen, and vit-ronectin (39). If not attenuatedenough, however, the robust local in-flammatory response may lead to theformation of an abscess. Inside an ab-scess, the bacteria gradually fall intoa state of nutritional stress as the den-sity of bacteria increases. At this pointthe autoinduction of secreted virulencefactors could enable the bacteria tobreak out and spread to new locations(194).

In toxin mediated diseases, su-perantigens bind non-specifically tothe major histocompatibility complexII (MHC II) and crosslink it to the vari-able beta chain of T-lymphocyte.Since the normal route of internaliza-tion, processing, and antigen presen-tation is bypassed, this unspecificbinding leads to massive expansion ofT-lymphocytes and production of cy-tokines. Superantigens also induceendotoxin hypersensitivity and binddirectly to endothelial surfaces, prob-ably causing capillary leakage throughendothelial cell death or intercellular

gap formation.In invasive diseases, such as

sepsis and endocarditis, staphylococ-ci must interact with the endothelium.By using MSCRAMMs, the bacteriacan adhere to damaged areas of the en-dothelium, or directly to the endothe-lial cell via the adhesin-receptor mech-anism or via bridging ligands (122).The bacteria may then be phagocy-tized into endothelial cells (102, 196)and/or reach the underlining tissue(154). Both endothelial phagocytosisand tissue invasion elicit an inflam-matory response leading to the relaseof IL -1, -6, -8, tumor necrosis factor(TNF), and subsequently interferon-gamma. Leucocytes adhere to endot-helial cells and increase vascular per-meability.

Although S. aureus is primarilyan extracellular pathogen, it maysometimes survive inside non-profes-sional phagocytes, such as fibroblasts,renal cells, and osteoblasts. Intracel-lular survival may explain the persis-tent and recurrent nature of certain sta-phylococcal infections (222). Intrac-ellular staphylococci often appear assmall colony variants which havemutations affecting electron transport(170), and show slowly growing, non-pigmented colonies with reduced pro-duction of virulence factors (291).

2.2 METHICILLIN-RESISTANTSTAPHYLOCOCCUS AUREUS

2.2.1 Methicillin resistanceMethicillin-resistant strains of S. au-reus are able to grow in the presenceof beta-lactams and its derivatives,

22

including cephalosporins and staphy-lococcal penicillins. Low-level methi-cillin resistance can result from theproduction of large amounts of beta-lactamases, or increased productionand/or modified penicillin-binding ca-pacity of normal PBPs (168, 269).Such borderline resistant S. aureusstrains (BORSA) seldom have mini-mal inhibitory concentrations (MIC)of methicillin exceeding 16 µg/ml, andtheir clinical significance is thought tobe limited. The challence is to differ-entiate BORSA strains from the truemethicillin-resistant Staphylococcusaureus (MRSA) strains (35).

The most clinically relevant andthe most prevalent form of methicil-lin resistance is characterized by pro-duction of an additional penicillinbinding protein, PBP2a (or PBP2’)(26, 228, 275). PBP2a has probablyevolved by recombination of a peni-cillinase gene and a PBP gene similarto PBP2 and PBP3 of Escherichia coli(255). PBP2a has an unusually lowbinding affinity for all beta-lactamantibiotics, substituting the nativePBPs and allowing continuous cellwall assembly (36, 228). However, theproduction of PBP2a alone is not suf-ficient for optimal expression of me-thicillin resistance (216). Native PBP2provides the transglycosylase functionof glycan chain elongation in spite ofthe presence of beta-lactams, andPBP2a is required for the transpepti-dase function (215).

The PBP2a is inducible and cod-ed by the mecA gene, which is part ofan additional DNA region, staphylo-

coccal casette chromosome mec (SC-Cmec), found in methicillin-resistantstrains, but not in methicillin-suscep-tible strains (14, 128, 167). SCCmecis always located in the same regionin the S. aureus chromosome, betweenspa and purA (137, 209). The se-quence of the chromosomal regionwhere SCCmec is integrated seems tobe highly homologous among differ-ent strains. Four structurally differentSCCmec types (SCCmec I-IV) and afew variants have been identified (Fig-ure 3.) (117, 158, 198). All SCCmectypes contain common features, in-cluding the mecA gene and part of itsregulatory region, and ccrA and ccrBgenes. The mecR1- and mecI-genescode for the regulatory proteins of themecA, MecR1 is a signal transducingprotein with a penicillin binding do-main and a transmembrane domain,and MecI is a repressor protein of themecA gene (140, 248, 263). ccrA andccrB code for recombinases CcrA andCcrB of the resolvase-invertase fami-ly. CcrA and CcrB are required for siteand orientation specific integrationand excision of the SCCmec (118,128).

Other genetic and environmen-tal factors independent of SCCmecalso have influence on methicillin re-sistance (15, 16, 34, 56, 57, 235). In-sertional inactivation studies haveidentified several normal staphylococ-cal genes necessary for methicillin re-sistance. Mutations in these fem (fac-tors essential for methicillin resis-tance) or aux (auxilliary) factors in-hibit the peptodoglycan precursor for-

23

kdp operon Tn554pUB110

ccrA1

ccrB1 mecR1

mecA

IS1272

upgQ

IS431pls

xylrrepC

pretetK

mer operon

mation (Figure 4). FemA, FemB, andFemX (or FmhB) add glycine recid-ues in the pentaglycine interbridgebetween peptidoglycan strains (230,256). Amidation of glutamate in thestem peptide is inhibited in femC (orglnR) mutants (97, 257), glucosamine-1-phosphate formation is inhibited infemD (or femR or glmM) mutants(124), and precursor formation isblocked at the lysine addition step infemF mutants (202). Other factors that

may have influence on methicillin re-sistance include global regulators sarand agr (217), ilm gene coding for alipophilic membrane protein, andgenes coding for murein hydrolases.

The expression of methicillin re-sistance varies among strains (107,166, 234). Strains with intact mecI-mecR1 regulon are phenotypicallymethicillin sensitive, since mecA is ef-fectively repressed by MecI (260).Constitutive expression of methicillin

Figure 3. SCCmec types according to published sequences, accession numbers AB033763(SCCmec I), AB063172 (SCCmec IV), D86934 (SCCmec II), and AB037671 (SCCmec III).

Casette chromosome recombinase (ccrA, ccrB)

Penicillin binding protein 2’ (mecA)

Two componen regulator of mecA (mecI and mecR1)

Insertion sequence (IS431 or IS1272)

Transposon, plasmid (Tn554, Tn554ψ, pUB110)

Other elements (genes)

SCCmecI, 34kbp

SCCmecIV, 24kbp

SCCmecII, 53kbp

SCCmecIII, 67kbp

24

resistance requires alterations in reg-ulatory genes and absence of beta-lac-tamase regulatory genes (blaI andblaR1), which are also able to repressmecA (98). Clinical MRSA isolatesshow deletions in mecI and somemecR1 regions, or mutations in mecIor in the promoter region of mecA(133, 260). Some strains express me-thicillin resistance heterogeneously;only a small subset of the population(10-3-10-7) is resistant to high methi-cillin concentrations. Others are ho-mogeneously resistant, i.e. each bac-terium of the population shows uni-form high-level resistance (107).Strains with eagle-type resistance aresensitive in low concentrations ofmethicillin, but resistant in high con-centrations. This type of resistance isachieved by exposing strains with in-tact mecA regulon to a high methicil-lin concentration. The expression of

eagle-type resistance and the conver-sion of heterogeneous resistance tohomogeneous resistance are thoughtto result from the same genetic factorindependent of SCCmec and fem fac-tors (134, 234).

Methicillin-resistant strains of S.aureus are often resistant to other an-tibiotic groups in addition to beta lac-tams. The SCCmec itself may carryseveral resistance genes generally lo-cated in integrated plasmids or trans-posons. Macrolide-lincosamine-strep-togramin (MLS) resistance resideswithin Tn554, and has been linked toSCCmec types II, III, and IIIA (44,265). Tetracycline resistance gene liesin pT181 in SCCmec type III (129).Aminoglygoside resistance genes arelocated either within pUB110 (aadD,tobramycin resistance) (28) found inSCCmec types IA and II or in pG01(gentamycin resistance), which also

Figure 4. Factors affecting peptidoglycan assembly and methicillin resistance.

MurNAc GlcNAc

FemA

FemB

FemX (FmhB)

FemF

FemC (GlnR)L-Ala

L-Glu

L-Lys

D-Ala

D-Ala

FemD (GlmM)

25

contains a gene for trimetoprim resis-tance (179). Fluoroquinolone resis-tance often forms during treatmentbecause of mutation in the topoi-somerase IV gene (grlA), the primarytarget of these agents in staphylococ-ci, and high-level resistance arisesthrough an additional mutation in theDNA gyrase gene (126, 189). Rifamp-in and mupirocin resistance occur be-cause of a point mutation in target en-zymes, RNA polymerase and isole-ucyl-t-RNA synthethases, respective-ly (9, 300). High-level resistance tomupirocin arises through acquisitionof a plasmid containing an additionalisoleucyl-t-RNA-synthethase gene(276), but other mechanisms may alsobe involved (241). Strains intermedi-ately resistant to glycopeptides(GISA) have been described in differ-ent geographic locations (110, 162,219, 232, 253). The molecular mech-anism of resistance has not been fullyelucidated. However, thickening of thecell wall through accumulation of ex-cess peptidoglycan, either by in-creased synthesis or by decreased turn-over, seems to be common to all GISAstrains (52, 103, 108). This results inthe trapping of glycopeptide mole-cules in the cell wall, and the block-ing of the access to the major target ofglycopeptide antibiotics, D-ala-D-alaresidue on the N-acetyl-muramicacidprecursor in the cytoplasm (108). Re-cently, a truly glycopeptide resistantstrain (GRSA) was isolated. Thisstrain had the vanA gene of glycopep-tide resistant enterococci. A vancomy-cin-resistant enterococcus was also

isolated from the same infection site,suggesting that a van gene transferfrom enterococci to staphylococci mayhave occurred (31).

Primary diagnosis of methicil-lin resistance can be performedthrough antimicrobial susceptibilitytesting recommended by NationalCommittee for Clinical LaboratoryStandards (NCCLS). The test methodsare based either on diffusion of oxacil-lin from commercially prepared filterpaper disks into the agar or on serialtwofold dilution of oxacillin in an agaror broth base (187, 188). A commer-cially available MIC test, E-test (ABBiodisk, Sweden), is widely used inFinland. Heterogeneously resistantMRSA strains grow more slowly thando homogeneously resistant strains,and may be more difficult to detect.Addition of NaCl to the growth medi-um, an incubation temperature of30 °C, and an incubation time of 48 haid detection. Automated antimicro-bial susceptibility testing systems arewidely used in the USA, but not in Fin-land. A commercial agglutination test(MRSA Screen, Denka Seiken, Japan)based on the detection of PBP2a, andcommercial agar plates with oxacillinsupplements, are available for thescreening for methicillin resistance(132). Definitive diagnosis is achievedusing the detection of the mecA geneby PCR (182), hybridization, or a com-mercially available fluorescence test.

2.2.2 Evolution of MRSAFirst MRSA strains were described in1961 (121), in the same time period

26

when methicillin was introduced intoclinical use. The origin of the mecAgene and SCCmec is unknown, but themecA gene and the flanking regionshave also been detected in other sta-phylococcal species. One possiblesource is Staphylococcus sciuri, sinceone series of studies suggested thatmecA is a native element in S. sciuri;a mecA gene, showing 88% overallsimilarity with mecA of MRSA, waspresent in each of more than 100 in-dependent isolates from different eco-logical sources and representing awide variety of genotypes (49). How-ever, the majority of these isolatesshowed no resistance to methicillin.The isolates which were resistant tomethicillin had a further copy of mecA,identical to that of MRSA isolates (46,309).

The mode of transfer of themecA gene from an unknown donorto S. aureus has been subject to a de-bate. Initially, all MRSA strains werethought to be descendants of a singlecommon ancestor, since they showedpigmentation different from MSSAstrains, invariable survival capacity,and a typical resistance profile (142).Later, their clonality was studied in amore precise way by using a MRSAstrain collection of 472 isolates fromdifferent geographic areas, and DNAprobes to the mecA region and staphy-lococcal transposon Tn554. Twenty-nine Tn554 patterns and six differenttemporally ordered mecA patternswere found. Each Tn554 pattern as-sociated with only one mecA pattern,suggesting that Tn554 polymorphism

had arisen after mecA integration intothe S.aureus chromosome (135). How-ever, another study suggested thatmecA had integrated into different S.aureus lineages as evidenced by sizedifferences in the evolutionary well-conserved housekeeping proteins(183). The same protein profiles werealso found in common MSSA strains.When a set of MRSA strains withthese protein profiles were recently an-alyzed using microarrays comprising96% of the S.aureus COL genome, itbecame evident that SCCmec had in-tegrated into at least five MRSA lin-eages, which were highly different intheir overall gene content (75). Itseems, however, that the horizontaltransfer of SCCmec is a relatively rareevent, although horizontal transfer ofgenetic material othervise plays a ma-jor role in the evolution of S. aureus(75, 139)

2.2.3 MRSA surveillanceThe trends of MRSA numbers and thecharacteristics of isolates (e.g. antimi-crobial resistance) can be followed bysurveillance systems (13). The surveil-lance may be ongoing, restricted tocertain defined areas (e.g. high riskunits or operations) and performed atseveral levels (local, national, interna-tional), and should always includefeedback information to the instanceswhich provided the data. The surveil-lance aims at recognizing outbreaks,monitoring the success of infectioncontrol methods, and ultimately reduc-ing the number of MRSA and costsattributable to MRSA infections. In-

27

dividual hospitals often report the to-tal number of MRSA strains isolatedwithin a certain time period. Compari-son of these reports may be difficultowing to differences or lack of denom-inator data. National MRSA data maybe gathered as part of nosocomial in-fections surveillance systems, andsome countries additionally requireMRSA cases to be reported to nation-al infectious diseases registers (http://www.ktl.fi/ttr/). The Nosocomial In-fection National Surveillance Scheme(NINSS) in the UK involves monitor-ing blood stream infections and surgi-cal site infections of more than 100hospitals (http://www.phls.co.uk/ser-vices/nisu.htm). The National Noso-comial Infections Surveillance (NNIS)System in the USA is based on volun-tary participation of 315 acute-caregeneral hospitals (http://www.cdc.gov/ncidod/hip/surveill/nnis.htm). International initiatives in-clude HELICS (Hospitals in EuropeLink for Infection Control throughSurveillance), one of whose tasks isto define and validate a methodologyfor pooling and analyzing nosocomi-al infection data from intensive careand surgery units, collected in Euro-pean networks (http://helics.univ-lyon1.fr/index.htm). EARSS (Europe-an Antibiotic Resistance SurveillanceSystem) collects antimicrobial resis-tance data in a standardized manner,allowing analysis of temporal and geo-graphical resistance trends (http://www.ears.rivm.nl) (90). The SEN-TRY Antimicrobial Surveillance Pro-gram monitors the predominant patho-

gens and antimicrobial resistance ofnosocomial and community-acquiredinfections through global sentinel hos-pitals. The objects covered by SEN-TRY include bacteremia, fungemia,outpatient respiratory infections,wound infections, and urinary infec-tions (62).

2.2.4 MRSA in health care facili-tiesS. aureus is one of the major causativeagents of nosocomial bacteremia (69),postoperative wound infection (190,213), and catheter related infections(71). Most nosocomial S. aureus in-fections are endogenous, caused by thepatient’s own carriage strain (136).Susceptibility information on S. au-reus bacteremias, gathered by theEARSS, indicate that the proportionof methicillin resistant strains in Eu-rope varies from country to country,and reaches 40-50% in several areas(Figure 5). The Nordic countries and

0

5

10

15

20

25

30

35

40

45

50

Den Ger Bel UK Ita

1999

2000

2001

Figure 5. Proportion (%) of S. aureus resis-tant to methicillin in European countries in1999-2001. Den, Denmark; Ger, Germany;Bel, Belgium; UK, United Kingdom; Ita, Italy.Source: EARSS (http://www.earss.rivm.nl/index.html).

%

28

the Netherlands still have low propor-tions of MRSA in S. aureus bactere-mias, from 0 to 2.5% in 1999 through2001 (http://www.earss.rivm.nl/index.html). A recent study revealedthat the proportion of MRSA amongS. aureus blood isolates rose from 18.1to 26.1% in San Francisco County be-tween 1996 and 1999 (113). The USNational Nosocomial Infections Sur-veillance System (NNIS) reported a55.3% methicillin resistance rateamong S. aureus strains from 5070ICU patients in 2000, indicating anincrease of 29% compared with theprevious five years (1), (http://www.cdc.gov).

Prevalence studies show thatMRSA is a major cause of nosocomi-al infections worldwide, and may ac-count for up to 20-40% of all S. au-reus infections (258, 293). In the USA,the prevalence of MRSA in hospitalsincreased from 2.4% in 1975 to 29%in 1991 (205). Similar trends havebeen reported in Europe. In centralEurope, the prevalence of MRSA in-creased from 1.7% in 1990 to 8.7% in1995 (307). In Australia, MRSA hasattained endemic levels of 20-40% inthe eastern cities, Sydney, Melbourne,and Brisbane, during the past decade.Other major Australian cities, Perth,Darwin, Adelaide, and Camberra, hadlower rates of MRSA in the beginningof the 1990s. Recently, proportions ofMRSA in these latter cities have beenapproaching to those of Sydney (272).Data on MRSA prevalence in Asia andAfrica are scarce, but sporadic reportssuggest a rapid increase of methicil-

lin resistance among S. aureus: from2% in 1988 to 33% in 1998 in twoSaudi-Arabian tertiary-care hospitals(159), from 26.7% in 1990 to 70.9%in 1997 in one hospital in Taiwan (37),and from 9.8% in 1992 to 45.4% in1998 in India, according to a surveil-lance study on S. aureus strains sub-mitted for typing (171). Prevalencestudies of short time periods revealed27.5% and 30.5% methicillin resis-tance among S. aureus isolates in SriLanka and Ethiopia, respectively (85,267)

The proportion of methicillinresistance of S.aureus varies amonghospitals of individual countries. Thisvariation has previously been corre-lated with the number of hospital ICUbeds, total beds, annual admissions, orannual length of stay (100, 119, 205).Recently, this correlation has becomeless evident (113). Extensive use ofantibiotics within a hospital may partlyexplain differences among hospitals intransmission rates of resistant organ-isms (249).

The main reservoir of MRSAin hospitals consists of infected or col-onized patients. The spread of MRSAfrom one patient to another occursmainly through contaminated hands ofhealth care personnel (254). TheMRSA prevention methods in non-en-demic countries, such as Finland, in-clude careful hand desinfection aftereach patient contact, wearing glovesand a gown when caring for MRSApatients, treatment of colonized pa-tients, and isolation of MRSA patientsand suspected MRSA positive patients

29

until three negative MRSA cultureshave been obtained. (289, 294). In Fin-land, a patient is suspected to be aMRSA carrier if the patient has previ-ously been MRSA positive, has shareda room with a MRSA positive patient,has been hospitalized outside the Nor-dic countries within the past sixmonths, or has been transferred froma hospital with an ongoing MRSA ep-idemic (294). Countries with endem-ic MRSA focus their screening andisolation resources on high risk depart-ments where the impact of MRSAspread is most pronounced (67).

The primary route of nosocomi-al MRSA spread between hospitalsand countries is clonal disseminationof relatively few international epidem-ic clones. In the UK, the first epidem-ic MRSA (UK EMRSA-1) seemed tobe similar to the epidemic strain ineastern Australia (270). This strainwas later superceded by a series ofother MRSA strains (UK EMRSA-2-14), and in the 1990s by UK EMR-SA-15 and –16 (163, 174). UK EMR-SA-15 and-16 gradually spreadthroughout the country, and they havealso been identified elsewhere in Eu-rope. In Germany, six different epi-demic strains have gradually dissemi-nated throughout the country (306).The Iberian and Pediatric clones, orig-inally identified in Spain and Portu-gal, respectively, have subsequentlybeen identified in several countries inEurope, Latin America, and in theUSA (58, 93, 165, 229). The NewYork strain has spread widely in theUSA and a similar strain also exists

in Japan (7). Why these particularclones have been so successful inspreading remains to be elucidated.

2.2.5 Community-acquiredMRSAMRSA strains of nosocomial originmay be transmitted in the communitythrough discharged patients or healthcare workers. Another possibility isthat MRSA strains arise de novothrough acquisition of SCCmec intothe genomes of previously suscepti-ble S.aureus strains.

Long-term care facilities, suchas nursing homes, have been suspect-ed as being reservoirs of MRSA. Re-cent studies suggest that, in the USA,long-term care residents commonlyharbor antibiotic-resistant organisms,and MRSA is the most common or-ganism found (184, 271). The rates ofMRSA colonization in the nares andin wounds range from 8-53%, and 30-82%, respectively (23). Europeanstudies from the UK and Ireland sug-gest that the rates of MRSA coloniza-tion in long term care residents arelower, from 0.81% to 17% (50, 79,186, 204). Even if MRSA coloniza-tion rates are high in long-term carefacilities, infections of MRSA mayoccur infrequently. It has been sug-gested that facilities with endemicMRSA should perform routine sur-veillance of MRSA infections anduphold basic infection control practic-es to prevent transmission. Knowledgeof the MRSA colonization status ofresidents is not so necessary. Onlywhen a certain threshold of MRSA

30

infections is reached, should more in-tensive prevention measures, such asscreening and isolation, be implement-ed until the chain of transmission isdisrupted (203, 204). Prevention mea-sures for long-term care facilities withnon-endemic MRSA have not beensuggested. Some studies indicate thatMRSA strains isolated from long-termcare residents originate in the refer-ring hospitals, since the strains showphage types similar to hospital strains(79).

Community acquisition ofMRSA has been described in ruralcommunities with a low socio-eco-nomic status, e.g. among Australianaboriginees, American Indians, and incertain areas in New Zealand, Tonga,and Samoa (72, 95, 160, 272). Out-breaks of community MRSA havebeen described among intravenousdrug users, members of a sports group,and families (150, 152, 239). One out-break of gastroenteritis has also beenattributed to a community MRSA(125). The overall prevalence of com-munity MRSA among urban homelessand marginally housed adults, subject-ed to crowded living conditions withpoor access to sanitation facilities, was2.4%. However, the urban poor whodid not have known MRSA risk fac-tors had an MRSA prevalence similarto that of the general population (38).Household pets may also carry MRSA(151), and transmission to humans hasbeen suspected (32). Reports onMRSA in the community are conflict-ing. MRSA colonization in healthy in-dividuals without MRSA risk factors

and health-care facility contacts seemto be rare (4, 237, 249, 259). On theother hand, MRSA caused the deathsof four healthy children without anyknown risk factors (29), and certainpatient groups are commonly colo-nized with MRSA prior to hospital ad-mission (72, 147, 238). These obser-vations warrant wider investigationson the frequency of, and risk factorsspecific for, community acquisition ofMRSA. In contrast to MRSA strainsfound in long-term care residents, oth-er community-acquired MRSA usual-ly show antibiotic resistance patternsand genotypes differing from those ofhospital isolates (3, 95).

2.2.6 Molecular typing of MRSAMolecular typing through phenotypicor genotypic methods aims at defin-ing whether a group of strains of a sin-gle species is clonal, i.e. arises from acommon precursor. For MRSA, thisinformation is needed for various pur-poses. In an outbreak investigation, anincreased number of spacially andtemporally related strains are typed inorder to identify whether the outbreakis due to the spread of a single strain.Molecular typing provides informa-tion on changes in the MRSA popula-tion during long-term surveillance,after implementation of infection con-trol measures, or after a change in an-tibiotic prescribing policy. Typing isalso used to deduce evolution and glo-bal spread of MRSA strains. A largenumber of typing methods have beendeveloped over the past decades. Thechoice of the typing method depends

31

Method Target Principle Outcome Phage typing Cell surface

components Infection of strains with phages, differentiation by ability of phages to lyse distinct strains

Lytic plaques on bacterial lawn on plate

Pulsed field gel electrophoresis

Whole genome Total genomic digestion with infrequent cutters, followed by electrophoresis with periodic changes in the orientation of electric field

Restriction fragment length polymorphism of total genomic DNA

Ribotyping rRNA genes Total genomic digestion, followed by Southern hybridization with rDNA probe

Restriction fragment length polymorphism based on the size and number of fragments that contain rRNA genes

HVR-hybridization Hypervariable region within mec DNA

Total genomic digestion, followed by Southern hybridization with probes recognizing the hypervariable region

Restriction fragment length polymorphism based on the size and number of fragments that contain HVR-sequence

Multilocus sequence typing

Seven housekeeping genes

Sequencing of each gene Nucleotide sequence

Table 2. Basic principles of methods used for typing of MRSA in this study. Adapted from (221)

32

on the purpose of the analysis (out-break investigation, surveillance, evo-lution studies), and on the biologicalperformance and technical efficiencyof the method (283) (Table 2). An op-timal method for all purposes of typ-ing should show high typeability, tech-nical reproducibility, ease of interpre-tation of results, and low cost. For out-break investigations the general avail-ability of the method and ease of per-formance are of practical importance.The discriminatory power should behigh for outbreak investigations, butless high for population studies, oth-erwise the clonal relationships mayremain obscure (74). Reproducibilityis particularly important if the typingresults are (electronically) stored andlater compared with new results.

Phenotypic typing methodscharacterize the strain relations indi-rectly through the expression of dif-ferent genes. The results are often in-fluenced by environmental factors.Therefore phenotypic identity or sim-ilarity is not always due to genomicidentity, and genomic identity is notalways reflected phenotypically.

Phage typing is one of the old-est methods used for discrimination ofMRSA strains; the first set of phageswas established over 50 years ago(208), and phage type data on histori-cal S. aureus strains are available (82,303). Phage typing is based on vari-able capabilities of different bacte-riophages to lyse different MRSAstrains (207). Although an internation-al set of phages for S. aureus and anadditional set for MRSA have been

established, and standardization hasbeen attempted, this method showsconsiderable inter-laboratory variationand variable typeability, and requirestechnical expertise (10, 164). Howev-er, it is rapid and usually sufficientlydiscriminative for short-term outbreakinvestigations.

Antimicrobial sensitivity testinghas been a useful adjunct to MRSAtyping in short outbreaks caused bymultiresistant strains, since the anti-biogram is often the first typing resultavailable (231). Different patterns pre-dict different sources of infection.However, the antimicrobial suscepti-bility pattern of an individual strainmay change during treatment (126), orbecause of antibiotic selection pres-sure in hospitals.

Multilocus enzyme electro-phoresis (MLEE) is based on electro-phoretic mobility of several proteinsessential for cell viability and growth(245). This method is not sufficientlydiscriminative for outbreak investiga-tions, but instead provides informationon population studies. Other pheno-typic typing methods, such as biotyp-ing, serotyping, polyacrylamide gelelectrophoresis (PAGE) analysis ofreleased or cell wall bound proteins,and immunoblotting, can be used asadditional methods (244, 261). How-ever, these methods are not often usedbecause of lack of appropriate repro-ducibility or discriminatory power.

Genotypic typing is based on theanalysis of a chromosome or extrach-romosomal DNA, allowing directcomparison of genotypes between

33

111). Additional discrimination can beachieved by subsequent restrictionfragment length polymorphism(RFLP) analysis. PCR amplification ofa tandem repeat region of the extra-cellular part of staphylococcal coagu-lase, and subsequent AluI digestion,results in moderate discrimination ofstrains (92, 261). The variation in theprotein A repeat units is also a targetfor typing. Changes in the protein Arepeat region may, however, occurmore rapidly than the entire genomeevolves, and thus be an unsuitable tar-get for purposes other than outbreakinvestigation (280). The ribosomalRNA sequences and the spacer se-quence between 16S and 23S rDNAhave also been targets for PCR-basedtyping. Another approach is to use asPCR targets polymorphic non-codingrepetitive (ERIC or REP) sequencesscattered around bacterial genomes(59). Arbitrarily primed PCR (AP-PCR) and randomly amplified poly-morphic DNA analysis (RAPD) arebased on short primers and low-strin-gency amplification conditions. Am-plification of random sequences formsa PCR-pattern shared by identicalstrains. Low-stringency PCR condi-tions may reduce the reproducibilityof this method, and it is seldom suit-able for ongoing epidemiological sur-veillance, unless sophisticated equip-ment, high techical skills, and meansfor computerized data storage and in-terpretation are available (201). Am-plified fragment length polymorphism(AFLP) is a PCR-typing methodrecently adapted for discrimination of

strains. Analysis of plasmid profilesor restriction fragment analysis ofplasmids has been used in outbreakinvestigations. Although the methodis technically simple and feasible inmost laboratories, its use is restrictedbecause of its variable typeability anddiscriminatory power.

The restriction of chromosomalDNA with frequently cutting enzymesand subsequent agarose gel electro-phoresis provides a discriminative fin-gerprint of the whole chromosome.Owing to the large number of frag-ments, the interpretation may be sub-jective and therefore non-reproduc-ible. The interpretation can be im-proved by Southern blotting the DNAfragments to membrane and by high-lighting a subset of the fragments withspecific probes (278). The probes mustinclude both conservative (to providetypeability) and variable (to retain dis-crimination) sequence areas. Prefera-bly the target sequence should occurin multiple locations within the chro-mosome. DNA sequences meetingthese criteria among MRSA strainsinclude ribosomal RNA operons,Tn554, IS256, and IS 257/IS431. In-dividual hybridization with multipleprobes, each recognizing a single-copygene, such as those for most virulencefactors, can also be used, but this ap-proach is fairly laborious.

Several typing methods basedon polymerase chain reaction (PCR)have been developed. Specific geneswith polymorphic repeat regions, suchas coa- and spa genes, have been usedas targets for PCR amplification (80,

34

bacteria (292). In this method, chro-mosomal DNA is first digested withfrequent cutters, specific adapters arethen linked to the resulting fragments,and a subset of the fragments is selec-tively amplified using primersrecognizing the adapter sequence andextending the original fragment by oneto three selective bases. The largenumber of fluorecently labeledamplicons is finally separated byelectrophoresis.

Binary typing is based on dif-ferential hybridization of up to 12 se-lected probes with different MRSAstrains. For each strain analyzed, 12“yes” or “no” (1 or 0) results are ob-tained (284). The suitable probes, hy-bridizing only with a subset of char-acterized MRSA strains, were initial-ly identified by RAPD (285). Themethod has proved to be useful in thecharacterization of the genetic diver-sity of MRSA clone, as well as in de-tecting nationwide spread of oneMRSA clone (282, 286).

Pulsed field gel electrophoresis(PFGE), introduced in 1984 (243), isregarded as the “gold standard” meth-od for distinguishing MRSA strains.In this method, chromosomal DNA isdigested with infrequently cutting en-zymes having recognition sequencesof six to eight bases in length. The di-gestion yields large fragments of DNA(20-800kb), which cannot be separat-ed in conventional agarose gel elec-trophoresis. In PFGE, the direction ofthe electric field periodically chang-es, which allows separation of DNAfragments of up to 10 Mb in size. The

separation is primarily based on thetime needed for reorientation, longerfor larger than for smaller fragments,instead of the speed of migration.

Comparison of whole genomesequences would be the ultimate andthe most stringent typing method forany bacterium. However, for the pur-poses described above, whole genomesequencing is not feasible. Instead,identification of regions with bothconservative and variable sequencs isneeded. The degree of variation de-pends again on the purpose of typing.For population analysis of MRSA,multilocus sequence typing (MLST)has been used successfully (161).MLST is based on the sequencing ofseven “housekeeping” genes. A dis-tinct number is assigned to each dif-ferent sequence of the same allele, andthe allelic profile of the seven genes de-fines a sequence type (ST). Isolates withidentical sequence types are consideredclonal with a high degree of accuracy(74). For outbreak investigations,sequencing a single discriminatorylocus, such as short sequence repeats(SSR) in spa or coa genes (80), maybe more convenient and less costly.

Data storage and interpretationissues are essential as massive vol-umes of genotypic and phenotypicdata may be generated in both short-term and long-term approaches. In ad-dition, international comparison ofMRSA strains has become increasing-ly relevant because of the pandemicspread of MRSA strains. Despite es-tablished interpretation criteria (262),availability of sophisticated software

35

packages, and several inter-laborato-ry standardization initiatives for PFGE(46, 281), inter-laboratory reproduc-ibility is difficult to achieve. Althoughsoftware which transform bands math-ematically to numerical values do ex-ist, PFGE and other banding patternbased methods are prone to bias dueto manual selection of bands. There-fore, databases based on binary outputor sequence of numbers or letterswould facilitate internationalcomparison of strains.

36

3. AIMS OF THE STUDY

The purpose of this study was to in-vestigate the molecular epidemiologyof methicillin-resistant Staphylococusaureus in a low-prevalence country.The phenotypic and genotypic char-acteristics of Finnish MRSA isolateswere analyzed in order to gain newinsights into the short-term and long-term evolution of MRSA. The specif-ic aims were:

1. To elaborate a MRSA typingscheme suitable for continuousnationwide MRSA surveillancein Finland.

2. To analyze trends of MRSA oc-currence in Finland in the 1990sand to analyze molecular char-acteristics of isolates in order toidentify those linked to epidem-ics.

3. To estimate the proportion ofisolates of community-acquiredMRSA in Finland, and to deter-mine if any molecular type as-sociates with community acqui-sition.

4. To recognize internationallyspread MRSA clones in Finland,to search for molecular traitslinked to the epidemic spread ofMRSA, and to analyze theclonality of the most commonMRSA strains encountered inFinland.

37

4. MATERIAL AND METHODS

4.1 NATIONAL MRSA SUR-VEILLANCE

Until 1995, data on the annual num-bers of MRSA isolations were collect-ed voluntarily on a weekly basis andwere available from the major micro-biology laboratories, which includedthose of all central and university hos-pitals, as well as the major private lab-oratories. Since 1995, microbiologylaboratories have reported MRSA iso-lations, as well as all blood and cere-brospinal fluid isolations of S. aureus,to the National Infectious DiseaseRegister at the National Public HealthInstitute (KTL). In this register, thetime interval within which S. aureusisolates from the same person are in-terpreted as one case is 36 months. Thefollowing data concerning each isolateare reported to the register: age andgender of the patient, health care in-stitution, date of isolation, and sourceof positive culture.

4.2 MRSA STRAIN COLLEC-TION

Since 1992, all microbiology labora-tories have been asked to send allMRSA isolates to the Laboratory ofHospital Bacteriology at KTL. Thepresent study reports the analysis ofthis population-based MRSA collec-tion from 1992 to 2001 (Table 3).Eighteen internationally characterizedepidemic MRSA strains were used ascontrols. These strains were obtainedfrom the Harmony group (http://

www.phls.org.uk/International/Har-mony/Harmony.htm), and includedtype strains for Belgium EC-1(97S96), Belgium EC-2 (97S99), Bel-gium EC-3 (97S101), France A (162),France B (97121), France C (10828),Greece 1 (3680), Spain E1 (5), N. Ger-man I (134/93), Hannover III (1000/93), Berlin IV (825/96), UK EMRSA-1 (NCTC 11939), UK EMRSA-3(M307), UK EMRSA-15 (90/10685),UK EMRSA-16 (96/32010), Pediatricclone (HDE288), Brazilian clone(HSJ216), and Iberian clone(HPV107).

4.3 EPIDEMIOLOGICALBACKGROUND DATA

4.3.1 Hospital contactsFor publication III, the data on previ-ous hospitalization periods of MRSApositive persons were retrieved fromthe National Hospital Discharge Reg-ister (HILMO) at the National Re-search and Development Centre forWelfare and Health (STAKES).HILMO is a civil register comprisingcomprehensive health-care recordsprovided by all hospitals and health-care centers in Finland, including out-patient surgery. Each report to the reg-ister includes patient identity informa-tion, admission and discharge dates,the code of the health-care provider,the type of service, speciality, the place(home or institution) from which thepatient came to the institution, and thedate of the surgical procedures.

For MRSA positive persons re-garding whom no HILMO reports

38

could be found, additional backgroundinformation was collected by sendingquestionnaires to infection-controlnurses at the relevant health-care fa-cilities. The information collected in-cluded: 1) whether the MRSA-posi-tive person was a patient or a staffmember, 2) whether the specimen wastaken on a clinical or a screening ba-sis, and 3) whether the screening sam-ple was taken because of a hospitalcontact abroad or because of an epi-demic situation.

4.3.2 Patient daysAnnual patient days in health carewere retrieved from public HILMO(Net-HILMO, http://info.stakes.fi/net-tihilmo), with no access to client spe-cific information. A patient day wasdefined as 24 h during which a patientoccupied a bed in a health-care insti-tute. The admission and dischargedays together counted as one patientday.

Table 3. MRSA isolates and methods used in the study.

Public-ation

Focus of study Selection criteria for Finnish isolates (number of isolates studied)

Methods used

I MRSA trends and identification of epidemic strains

All isolates, one per person, isolated in 1992-1997 (891)

• Antimicrobial susceptibility

• Phage typing • PFGE and ribotyping for

a subset of strains

II Molecular traits for epidemic spread

All sporadic isolates from year 1995 (47), and representatives of intra- and interhospitally spread strains (25) from 1992-1999

• Ribotyping • Phage typing • Antimicrobial

susceptibility • HVR hybridization for

representatives of each ribotype

III Community-

acquired MRSA

All isolates, one per person, from 1997-1999 (526)

• PFGE • HVR hybridization for a

subset of strains • Phage typing • Antimicrobial

susceptibility • Search for

hospitalization periods from the hospital discharge register (HILMO) and by a questionnaire

IV Clonality and

evolution of MRSA

Representatives of the most common strains in 1997-1999 (14)

• MLST • Mec regulatory region-

PCR • HVR sequencing

39

4.4 ISOLATION OF DNA, ANDPRIMERS USED

Total genomic DNA was prepared forall PCR-methods, ribotyping, hyper-variable region hybridization, andMLST. DNA was purified using aguanidium isothiocyanate method(218) (Publication I-III), a Qiagen Tis-sue Purification Kit (Qiagen, Germa-ny), or a method using phenol chloro-form elution (101) (Publication IV).

The primers used in the study(Table 4) were purchased from Amer-sham Pharmacia Biotech, England.

4.5 IDENTIFICATION ANDANTIMICROBIAL SUSCEPTI-BILITY TESTING OF MRSA

On reception at the Laboratory ofHospital Bacteriology, all isolates sus-pected of being MRSA were verifiedfor oxacillin resistance by disk diffu-sion and MIC-tests (see 4.5.1) and/orby mecA-PCR (see 4.5.2). Initially, S.aureus species identification was ver-ified only if the species identificationwas suspected of being incorrect: anatypical or mixed culture, or non-typable by S. aureus phages. The iden-tification methods included Slidex ag-glutination test (BioMérieux, France),nuc-PCR (see 4.5.2), coagulase test(130), API Staph (BioMérieux,France), API ID 32 Staph(BioMérieux, France), and biochemi-cal tests. Since 2000, all isolates havebeen tested routinely for correct spe-cies identification and methicillin re-sistance by nuc- and mecA-PCRs, re-spectively.

4.5.1 Antimicrobial susceptibilitytestingThe antimicrobial susceptibilities weretested by the disk diffusion methodafter overnight incubation at 37°C onMuller-Hinton agar plates accordingto the guidelines recommended by theNCCLS. The antimicrobials tested in-cluded gentamicin, tobramycin, eryth-romycin, clindamycin, chlorampheni-col, ciprofloxacin, rifampin, fucidicacid, trimethoprim-sulfamethoxazole,tetracycline, mupirocin, and vancomy-cin. Oxacillin resistance was deter-mined by the disk diffusion methodafter 24-48 h growth at 30°C. MIC ofoxacillin was determined by the E-testaccording to the manufacturer’s in-structions (AB Biodisk, Sweden).

4.5.2 mecA-PCR and nuc-PCRmecA-PCR and nuc-PCR were per-formed either separately as describedearlier (24, 182) or as a multiplex ap-plication. A 50 µl volume of PCR re-action mixture contained 1 µl of puri-fied genomic DNA, 50 pmol of eachof the nuc- and mecA-primers, 0.2 mMof dNTP, 1 U of DynaZyme poly-merase (Finzymes, Finland), and 5 µlof 10x buffer containing 15 mM ofMgCl

2. The PCR amplification proto-

col included initial denaturation at96°C for 10 min, followed by 40 cy-cles of denaturation at 96°C for 30 s,annealing at 46°C for 30 s, and exten-sion at 72°C for 2 min, and final ex-tension at 72°C for 5 min. The result-ing amplicons were run in a 1.5% SeaKem agarose gel (BMA, USA) at 90Vfor 1 h.

40

Primer Sequence 5’→→→→3’ Reference mecA, forward mecA, reverse

AAAATCGATGGTAAAGGTTGGC AGTTCTGCAGTACCGGATTTGC

(182)

nuc, forward nuc, reverse

GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC

(24)

arcC-Up arcC-Dn aroE-up aroE-Dn glpF-Up glpF-Dn gmk-Up gmk-Dn pta-Up pta-Dn tpi-Up tpi-Dn yqiL-Up yqiL-Dn

TTGATTCACCAGCGCGTATTGTC AGGTATCTGCTTCAATCAGCG ATCGGAAATCCTATTTCACATTC GGTGTTGTATTAATAACGATATC CTAGGAACTGCAATCTTAATCC TGGTAAAATCGCATGTCCAATTC ATCGTTTTATCGGGACCATC TCATTAACTACAACGTAATCGTA GTTAAAATCGTATTACCTGAAGG GACCCTTTTGTTGAAAAGCTTAA TCGTTCATTCTGAACGTCGTGAA TTTGCACCTTCTAACAATTGTAC CAGCATACAGGACACCTATTGGC CGTTGAGGAATCGATACTGGAAC

(73)

mecI forward mecI reverse mecR1 penicillin binding domaine, forward mecR1 penicillin binding domaine, reverse mecR1 transmembrane domaine, forward mecR1 transmembrane domaine, reverse

AATGGCGAAAAAGCACAACA GACTTGATTGTTTCCTCTGTT GTCTCCACGTTAATTCCATT GTCGTTCATTAAGATATGACG CAGGGAATGAAAATTATTGGA CGCTCAGAAATTTGTTGTGC

(260)

Druforward TCTGAAGCAGCTTTAAATGATG Publication IV ISP3TT TTACTTTAGCCATTGCTACCTT (200)

Table 4. Primers used in the study

41

4.6 TYPING METHODS

4.6.1 Phage typingPhage typing was performed with aninternational set of phages (207), pur-chased from Statens Serum Institut,Copenhagen, Denmark, at 1x and100x routine test dilutions, both withand without heat treatment, 55°C for3 min, of the bacteria (53). The phagepattern was defined on the basis of theweakest test dilution that producedclear lytic reactions. A minimum of20 lytic plaques (++ reaction) was re-quired to define a positive reaction foreach phage.

All isolates included in thisstudy were typed by phages. In publi-cation I, the identification of epidem-ic strains was primarily based on ph-age typing.

4.6.2 RibotypingRibotyping was performed as de-scribed in publication I. Briefly, ge-nomic DNA was digested separatelywith one to three restriction enzymes,HindIII, EcoRI, and ClaI (BoehringerMannheim, Germany). DNA frag-ments were separated by electrophore-sis, transferred to nylon membrane(Boehringer Mannheim), and hybrid-ized with digoxygenin labeled plasmidpKK3535 containing the rrn operonof Escherichia coli (25). Digoxygen-in labeled DNA marker III (Boehring-er Mannheim, Germany) or MluI di-gested Citrobacter koseri (94) wasused as the molecular weight standard.A difference of one band in a ribotype,as detected by visual analysis, wasconsidered to represent a new type. An

arbitrary identification letter was as-signed to each ribotype obtained bydifferent enzymes.

In publication I, ribotyping wasused to characterize further the isolatessuspected of being linked to epidem-ics, and those nontypable by phages.In publication II, ribotyping by EcoRIwas used for genomic characterizationof all isolates with unique phage pat-terns (sporadic isolates) from the year1995. In publication III, ribotypingwas used to verify the relatedness ofisolates from the years 1997-1999 ifresults from PFGE and phage typingwere ambiguous.

4.6.3 Pulsed field gel electro-phoresis (PFGE)The genomic DNA was prepared inagarose blocks as described previously(89, 209) with slight modificationsdescribed in publication I. Briefly, a0.5 ml volume of logaritmic phasecells and an equal volume of 2% Sea-Plaque agarose (FMC Bioproducts,USA) were mixed and solidified. TheDNA purification protocol includedlysostaphin and proteinase K treament,followed by washing steps with phe-nylmethylsulfonyl fluoride and TEbuffer (10 mM Tris and 1 mM EDTA,pH 8.0). Restriction fragment lengthpolymorphism following SmaI-diges-tion was detected with Chef DR III,Chef Navigator, or Chef Mapper (Bio-Rad, USA) for 24 h, on 1% SeaKemagarose gel (FMC BioProducts, USA)at 6 V/cm with initial and final switch-ing times of 10 s and 60 s, respective-ly. A Lambda Ladder PFG marker(New England BioLabs, USA) was

42

used as the molecular weight standard.Since 2001, the Harmony PFGE pro-tocol has also been used for analysis.In the Harmony protocol the chromo-somal DNA fragments are separatedby two phases: phase 1 for 10 h, withthe initial and final switching times of5 s to 15 s; and phase 2 for 13 h, with15 s to 60 s, respectively. The molec-ular weight standard in the Harmonyprotocol is S. aureus NCTC 8325. Oth-erwise the method was performed asabove. PFGE profiles differing byfewer than four bands were interpret-ed as identical or closely related (262)

In publication I, PFGE was usedto characterize further the suspectedepidemic strains and the isolates non-typable by phages. In publication III,all isolates from the years 1997-1999,showing differences in phage typing,were typed by PFGE.

4.6.4 Hypervariable region(HVR) hybridizationThe genomic DNA was digested withEcoRI and BglII restiction enzymes,and hybridized with two probes pre-pared from plasmid pBBB30 (233).HVR probe I is a 3.6-kb fragment thatrecognizes the HVR of the mec DNA,starting within the mecA gene andreaching up to IS431 mec. HVR probeII is a 1.5-kb fragment digested withHindIII from the 3.6-kb fragment. Thisprobe recognizes the direct repeat unit(dru) -region and an E. coli ugpQ-likesequence within the mec DNA. Thedigoxigenin-labeling of the probes,eletrophoresis and blotting to nylonmembrane of genomic DNA frag-

ments, and hybridization were per-formed as described in publication II.Digoxygenin-labeled molecularweight marker III (Boehringer Man-nheim, Germany) or Citrobacter kos-eri (94) was used as the molecularweight marker.

The HVR-hybridization wasperformed on representatives of dif-ferent ribotypes identified in sporadicisolates from the year 1995, as well ason all epidemic and local outbreakstrains identified before the year 2000(publication II). Equally, the HVR-hy-bridization with HVR probe I was per-formed on all representatives of themost common MRSA strains from theyears 1997-1999 (publication III).

4.6.5 Multilocus sequence typingMultilocus sequence typing was per-formed as previously described (73).Internal fragments of seven house-keeping genes [carbamate kinase(arcC), shikimate dehydrogenase(aroE), glycerol kinase (glpF), guany-late kinase (gmk), phosphate acetyl-transferase (pta), triosephosphateisomerase (tpi), and acetyl coenzymeA acetyltransferase (yqiL)] were am-plified by PCR. The PCR productswere purified, and the sequences ofboth strands (or occasionally of onestrand only) were determined by ABIPrism 310 Genetic Analyzer using theBigDye fluorecent terminator chem-istry (Applied Biosystems, UK). Theforward and reverse sequencing prim-ers for each gene fragment were thesame as those used for the initial PCR.The allele numbers were assigned to

43

each loci by the MLST database (http://www.mlst.net) and allelic profiles,defining the sequence types (STs) foreach strain, were compared with thoseavailable in the database and withthose found in the literature.

The MLST was used to delin-eate the clonality and evolution of themost common Finnish MRSA strainsidentified during 1997-1999 (publica-tion IV)

4.6.6 mec regulatory region PCRUsing primers and a PCR protocoldescribed earlier (260), three differentfragments within the mec regulatoryregion were separately amplified. Thefragments were: 1) almost the entiremecI gene, 2) the penicillin bindingdomaine of the mecR1 gene, and 3)the membrane spanning domaine ofthe mecR1 gene. The resulting ampli-cons were run and detected in agarosegel.

4.6.7 mec hypervariable regionsequencingThe direct repeat region (dru) betweenthe glycerophosphoryl diester phos-phodiesterase (ugpQ)-like sequenceand IS431 was amplified by usingprimers Druforward and ISP3TT. TheDruforward primer was designed onthe basis of mec sequence data in theEMBL database (accession no.Y14051), and the ISP3TT primer wasmodified from an ISP3 primer de-scribed previously (200). The purifiedamplicons were sequenced by ABI310 by using BigDye fluorescent ter-minator chemistry (Applied Biosys-tems, Warrington, UK). The sequenc-

ing primers were the same as those forthe initial PCR.

4.6.8 Computer-assisted analysisof typing dataComputer-assisted analysis of PFGEtypes and ribotypes was performed byBioNumerics, version 1.0 or 2.0 (Ap-plied Maths, Belgium), using Dicecoefficient and UPGMA (unweightedpair group method using arithmeticaverages).

4.7 DEFINITIONS AND NO-MENCLATURE OF STRAINS

Strain types were identified on thebasis of the phage pattern (publica-tions I and II), ribotype (publicationsII and III), and PFGE type (publica-tion III). The strain types of two iso-lates were considered to be the sameif the phage types were similar and theribotypes were identical and/or thePFGE types differed by fewer thanfour bands. Multiresistance was de-fined as resistance to more than threeantimicrobial groups other than beta-lactams, and multisensitivity as resis-tance up to three antimicrobial groupsother than beta-lactams.

A sporadic strain of MRSA wasdefined as a strain isolated from oneperson only and displaying a uniqueantimicrobial susceptibility and/orstrain type (publications I-IV). MRSAisolates sharing the same strain typesand isolated from two or more personsin the same hospital were defined asrepresentatives of local outbreakstrains (publications I and II). MRSAisolates sharing the same strain type

44

and isolated from two or more personsat two or more hospitals were definedas representatives of an epidemicMRSA strain (publications I and II).

In this study, a clone was definedas a group of MRSA strains the mem-bers of which are most probably de-scendants of a single ancestor. To beclassified as members of the sameclone, isolates had to have identical orsingle locus variant MLST profiles, orribotypes differing by fewer than fourbands, and PFGE patterns differing byless than seven bands (publications IIIand IV). Clone assignment by PFGEwas not performed if more than sevenband differences occured. A clone maycontain different epidemic or localoutbreak strains.

Unless an international name fora strain was known, each epidemicstrain and clone was named accord-ing to the city/region where the strainwas first isolated or suspected of hav-ing been imported from. For interna-tional communication, an identifica-tion code number was given to eachlocal outbreak strain and epidemicstrain.

An MRSA isolate was definedas community acquired if the MRSA-positive specimen was obtained out-side hospital settings or within 2 daysof hospital admission, and if it wasfrom a person who had not been hos-pitalized within 2 years before the dateof the MRSA isolation (publicationIII).

4.8 STATISTICAL ANALYSISAND ETHICAL ASPECTS

For categorigal variables, proportionswere compared by the chi-square testwith Yates’ correction or by Fisher’sexact test, as appropriate. The meansand medians of the continuous vari-ables were compared by Student’s ttest or Mann-Whitney U test, depend-ing on the sample distribution.

On the approval of the FinnishMinistery of Social Affairs and Healthand of the data protection authority,the National Research and Develop-ment Centre for Welfare and Healthgave us permission to use the datafrom the HILMO register.

45

5. RESULTS

5.1 ELABORATION OF MRSAVERIFICATION AND TYPING(I, II, III, IV)

Table 5 shows the methods used forthe verification and typing of MRSAisolates at the KTL Laboratory ofHospital Bacteriology during the years1992-2002. The current scheme in-cludes species verification and methi-cillin-resistance verification by mul-tiplex mecA-nuc-PCR, antimicrobialsensitivity testing, and typing by ph-

ages and by PFGE. Ribotyping is usedin cases of ambiguity between PFGEand phage typing results (Figure 6).MLST is available for identifying thegenetic background of emerging epi-demic strains.

Results of MRSA verificationand typing are reported to the refer-ring laboratory and to the infectioncontrol nurse of the relevant health-care facility. Reception of notificationat the National Infectious DiseaseRegister of each confirmed MRSA isconcurrently verified.

Table 5. Elaboration of the MRSA verification and typing at the Laboratory of Hospital Bac-

teriology, KTL.

Purpose Methods Year 92 93 94 95 96 97 98 99 00 01 02 Identification Slidex

Coagulase Nuc-PCR API Staph, API ID 32 Other biochemical tests

Antimicrobial resistance

Oxa disk diffusion Oxa E-test Antibiogram MRSA Screen MecA-PCR 1)

Typing Phage typing PFGE 2) Ribotyping MLST

Performed selectively on a subset of isolates, performed routinelyon all isolates. 1) Until 1997, and between 1997 and 1999, mecA-PCR was performed onisolates having an oxacillin MIC of 1-6 µg/ml, and ≤64 µg/ml, respectively. 2) PFGE wasperformed retrospectively in 1997-1999.

46

5.2 MRSA TRENDS AND EPI-DEMIC STRAINS (I, II, III, IV)

On the basis of the data received frommajor microbiology laboratories, thenumber of isolates received for typ-ing in the Laboratory of Hospital Bac-teriology, and the MRSA notificationsto the National Infectious Disease

Register, the annual number of MRSAisolations ranged from 89 to 340 dur-ing 1981-2001 (Figure 7).

Between 1995 and 2001, 1322MRSA isolations were reported to theNational Infectious Disease Register.The median age of MRSA positivepersons was 58 years (range <1-98),and 51% (674) were male. Fourty-four

Figure 6. MRSA verification and typing scheme at KTL, and the system of reporting tolaboratories.

Figure 7. Number of MRSA isolations in Finland during 1981-2001.

0

50

100

150

200

250

300

350

400

1981

1983

1985

1987

1989

1991

1993

1995

1997

1999

2001

Year

Num

ber

ofis

ola

tes

Slidex Plus

Final answer

- Name of the strain

- Comment on regional

occurrence of the strain

Nuc-PCR

Biochemical tests

Urgent

S.aureus

Other bacterial species

Slidex Plus

MRSA Screen

-Antimicrobial susceptibility

(disk diffusion)

-Oxacillin MIC

-Vancomycin MIC

-MRSA Screen

-MecA-PCR

-Nuc-PCR

-Phage typing

Preliminary answer

-MRSA/MSSA

-Phage type

-PFGE-typing

-(Ribotyping)

Answer by phone

-MRSA/not MRSA

Suspected

MRSA

Unclear

47

% (577) of the isolations were frompersons of 60 years of age or older,and 10% (131) were from childrenunder the age of 16. The incidence ofMRSA ranged from 1.7 per popula-tion of 100,000 in 1995 to 5.0 in 2000(Table 6). In 1995, 70% (69/89) of allnotifications were received from theHelsinki metropolitan area, and 11 of

21 hospital districts reported noMRSA isolations. By 2001, all but twohospital districts reported MRSA, andthe majority of notifications were out-side the Helsinki metropolitan area(Figure 8). During 1995-2001, the pro-portion of methicillin resistanceamong S. aureus blood isolates re-mained at a level of 1% or less.

Table 6. Incidence and age distribution of MRSA cases in1995 through 2001

Figure 8. Number of annual MRSA isolations by hospital district in 1995 through 2001.

Number of MRSA isolations: =0, =1-10, >10.

1995 1998 2001

NA. Not applicable, since denominator data were not available.

Year Number of

MRSA

notifications

MRSA

incidence per

population of

100,000

MRSA

incidence

per 100,000

patient days

Median

age,

years

Number of

persons

<16 years

(%)

Number of

persons

� 65 years

(%)

1995 89 1.7 NA 65 6 (7) 47 (53)

1996 108 2.1 7.11 63 10 (10) 52 (48)

1997 120 2.3 8.10 52 13 (11) 49 (41)

1998 189 3.7 12.93 51 20 (11) 54 (29)

1999 211 4.1 14.77 57 23 (11) 87 (41)

2000 261 5.0 18.47 61 25 (10) 122 (47)

2001 344 NA NA 63 34 (10) 166 (48)

48

During the period of this study,from 1992 to 2001, a total of 1847S.aureus isolates were verified asMRSA and typed. Of all isolates, 79%(1457 of 1847) were classified as epi-demic or local outbreak strains. Theproportion of sporadic isolates duringthe periods 1992-1997 and 1997-1999were 46% (345/748) on the basis ofphage typing, and 11% (56/526) on thebasis of phage typing and PFGE, re-spectively.

During 1992-2001, a total of 26different epidemic and 12 local out-break strains were identified (Table 7).Fourteen (54%) of the epidemic strainsand 5 (41%) of the local outbreakstrains were multiresistant, i.e. resis-tant to more than three antimicrobialgroups other than beta lactams. Ri-botyping by HindIII, EcoRI, and ClaIdivided the strains into 20, 18, and 15different types, respectively, and acombined analysis yielded 23 ri-botypes. PFGE differentiated thestrains into 29 distinct types and into9 subtypes with no more than fourband differences. Computer-assistedanalysis of the PFGE types of the ep-idemic and outbreak strains revealed8 clusters of strains with similarity val-ues of at least 75%.

Two epidemic strains were iso-lated from more than 200 persons, andanother seven strains caused epidem-ics involving 50-100 persons. Thelargest epidemic, caused by the strainHelsinki I, occurred in Southern Fin-land and involved 270 persons. Theepidemics started in 1992, peaked in1994, and declined within a few years.However, this strain is still isolated oc-

casionally, although most of the cur-rent isolates exhibit subtype level vari-ation, or 4 to 7 band differences inPFGE as compared with the originalepidemic strain. The other highly prev-alent epidemic strain, Mikkeli II,emerged in several hospitals simulta-neously in 1997. The detection of itsemergence was delayed, since the iso-lates from different parts of the coun-try exhibited wide variation in phagetypes, and no epidemiological linkagebetween isolates from different areaswas apparent. Along with comprehen-sive, but retrospective, PFGE analy-sis of isolates from 1997 to 1999, thegenomic relatedness among these ep-idemiologically unrelated isolates wasdetected.

Hypervariable region hybridiza-tion with HVR probe I differentiatedthe epidemic and local outbreak strainsinto 4 types: A, B, C, and D, each ofwhich consisted of two bands. TheHVR probe II recognized one of thesetwo bands, showing the position of druand flanking sequences. Multisensi-tive strains had the mec HVR hybrid-ization pattern A. The only exceptionto this was the strain Helsinki III,which was multiresistant and still hadHVR-type A. HVR types B, C, and Dwere found in multiresistant strains. Asingle multisensitive strain (Turku IV)with HVR-type C was identified.Strains showing HVR type A and Bwere negative in mecI-PCR. Sequenc-ing of the dru region within HVR wasperformed on representatives of HVRtypes A, B, C, and D. Sequencing con-firmed that HVR types B and D had adeletion of about 1000 kb as compared

49

with strains with other HVR types.The dru sequences were highly simi-lar within each HVR type and withinHVR types B and D together.

5.3 MOLECULAR TRAITSLINKED TO EPIDEMICSPREAD (II)

Ribotyping, with EcoRI restrictionenzyme, of 72 strains, including allsporadic MRSA isolates from the year1995 and the local outbreak and epi-demic strains identified during 1992-1999, revealed 18 different ribotypes.The two most prevalent types, differ-ing from each other by one band, madeup 49% (35/72) of all strains. Of thesporadic strains, 45% (21/47) showedeither of these types. Correspondingfigures for epidemic and local out-break strains were 64% (9/14) and45% (5/11), respectively.

Hypervariable region hybridiza-tion with HVR probe I differentiatedthe 72 strains into 7 types: A, B, C, D,E, F, and G. Most of the sporadic iso-lates were either of HVR type A (22/47, 47%) or HVR type C (16/47,34%). The epidemic strains weremostly of HVR type B (4/14, 29%) ortype C (6/14, 43%). Of the local out-break strains, 7 (64%) were of HVRtype A.

Of the sporadic strains, 30% (14/47) were multiresistant, whereas forthe epidemic, and the local outbreakstrains the corresponding figures were

79% (11/14) and 45% (5/11), re-spectively. Multiresistance was morecommon among epidemic than among

non-epidemic strains (11/14 vs. 19/58,p<0.005)

In a combined analysis of anti-biotic susceptibility and genotype, theMRSA strains clustered into two maingroups. One group included strainsshowing mec HVR hybridization pat-tern A combined with a variety of ri-botypes and resistance to beta lactamantibiotics only. The majority of thesestrains were sporadic by nature. Theother group included strains with mecHVR hybridization patterns B or C inassociation with the two major ri-botypes. This group included both ep-idemic and sporadic strains.

5.4 MRSA CLONES (I, III, IV)

Of all 38 local outbreak and epidemicstrains, genotyping classified 31strains into 8 clones (Table 7). On thebasis of MLST, representatives of sev-en of these clones were found to beidentical with the internationallyknown S. aureus clones: ST 247, ST239, ST 36, ST 22, ST 5, ST 45, andST 12. The first six clones are alsoknown as the Iberian, Brazilian, UKEMRSA-16, UK EMRSA-15, NewYork (or Pediatric), and Berlin clones.The ST12 clone was named Joensuuclone in Finland. On the basis of ri-botypes and/or clustering by PFGE,six of the remaining seven strains alsobelong to either the Brazilian clone orto the Iberian clone. Finally, the Hels-inki VIII strain was a triple alleleMLST variant of Joensuu II, and maythus belong to the Joensuu clone, al-though the definition for a clone usedin this study (see section 4.7), would

50

Clone Strain identification

Number of isolates

Year of first isolation in Finland

Geographical occurrence in Finland

Mul

tire

sist

ance

PF

GE

typ

e 1)

PF

GE

clu

ster

2)

Rib

otyp

e

HV

R3)

ML

ST3)

Name Id. no Brazilian Helsinki VI

Helsinki VII Lohja Kokkola Pori II

E19 E20 E24 E27 O16

15 12 62 78 3

1998 1998 1998 1997 1993

South South South Many regions West

Yes Yes Yes No No

1 2 3 4 4b

I - III II II

B.b:d C:a:e B:b:d A:a:e AN:a:e

C C C A A

239 239 241, 239 slv 8, 239 slv

Iberian Turku I Turku II Turku III Kotka Kerimäki Tampere III

E6 E7 O8 E10 O29 O25

40 62 2 32 34 15

1991 1992 1992 1992 2000 1998

West West West East East Central

Yes Yes Yes Yes No Yes

5 5b 5c 5d 6 7

III III III III III -

A:a:e B:b:d B:b:d B:b:d A:a:e A.a:e

B B B B B

247 247 slv

New York (or Pediatric)

Helsinki I Koskela Bel EC-3 Moscow Helsinki III

E1 O26 E34 E32 O3

270 5 33 3 6

1992 1999 2001 2000 1994

South South Many regions Many regions South

Yes Yes Yes Yes Yes

8 9 10 11 12

IV IV IV IV -

I:g:e I:g:e CH:cb:e A:a:e F:g:e

D D A

5

Table 7. MRSA clones and strains during 1992-2001 in Finland

51

UK EMRSA-16 Helsinki V Pori I

E5 E15

75 32

1995 1993

South Many regions

Yes No

13 13b

V V

AR:af:q AF:j:y

C A

36 30, 36 slv

Mikkeli Tampere I Mikkeli I Mikkeli II Karkkila

E12 O11 E23 O37

54 51 241 7

1994 1993 1997 2000

Central East Many regions South

No No No No

14 14b 14c 15

VI VI VI -

AP:ad:c AP:ad:c AP:ad:c AP:ad:c

A A A

59 slv

Berlin Kemi Kajaani Joensuu I Pello Berlin IV

E17 O18 E21 E28 E38

50 11 8 35 13

1996 1997 1996 2000 1998

Many regions North East Many regions Many regions

No No No No No

16 16b 16c 17 18

VII VII VII VII VII

AG:aa:r BB:g:r AW:bo:n CC:bs:ax CG::aa:r

A A A

45

Joensuu Joensuu II Nurmes Vaalijala

E22 E36 O33

20 2 32

1998 2001 2001

Many regions East, South East

No No No

19 20 21

VIII VIII VIII

AH:z:v CJ:ch:h AH:ci:e

A 12

UK EMRSA-15 UK EMRSA-15 E30 44 1997 Many regions No 22 - CB:br:al A 22 Undefined (Iberia or Brazil)

Helsinki II Helsinki IV Lithuania Seinäjoki Tampere II Turku IV

E2 O4 E35 E14 E13 O9

36 3 4 5 19 25

1993 1994 2000 1992 1994 1993

South South South, East West Central West

Yes Yes Yes Yes Yes No

23 24 25 26 27 28

- I I I - -

A:a:j A:a:z A:a:e B:b:d B:b:d A:b:d

B C C C C

Undefined Helsinki VIII E31 18 1997 Many regions No 29 - Bz:ax:h A New

1) PFGE types and subtypes, ≤4 bands difference2) Cluster of strains with ≥75% similarity level by Bionumerics (dice coefficient, UPGMA, tolerance 1-2%)3) Blank, not determined

52

not allow this assignment. For fourclones (Iberian, Brazilian, New York,and Berlin), other strain types showingfour to seven PFGE band differencesas compared with epidemic and localoutbreak strains have been identified.

Within one and the same clone,antimicrobial resistance patterns ofdifferent strains were mostly similar.A few exceptions were found: 1)Kokkola, Pori I, and Kerimäki strains,which showed multisensitive patternsin contrast to multiresistant patterns ofall other members of the correspond-ing clones, 2) Pello strain, whichshowed two patterns, multiresistantand multisensitive, and 3) Helsinki Vand Pori I strains, which constitutedone clone, but showed different anti-microbial resistance patterns. Strainsrepeatedly isolated during long timeperiods (Helsinki I, Helsinki V, Kemi)showed changes in their antimicrobi-al resistance patterns.

5.5 MRSA IN COMMUNITY(III)

In 1997-1999, MRSA was isolatedfrom 526 persons. Their median agewas 51 years (range 0-96), and 291(55%) were male. Of all 526 persons,108 (21%) did not have any verifiedlink to health-care facilities within twoyears before the MRSA isolation date.Their MRSA isolates were classifiedas community acquired. The HILMOregister and the questionnaire surveyshowed 418 (79%) persons who hadat least one contact with a hospital, andtheir MRSA isolates were classifiedas hospital acquired. The median age

of the persons who did not have anycontact with a health-care facility waslower than that of the persons who did(34 vs. 58 years, p<0.01).

Among the 526 MRSA isolates,the typing scheme showed 84 straintypes, 56 of which were sporadic and28 were shared by at least two persons.The distributions of sporadic (in total56/526, 11%) and shared (in total 470/526, 89%) strain types was similar inpersons with (43/418, 10%) and with-out (13/108, 12%) connections tohealth-care facilities.

Fourteen strain types, each ofwhich was isolated from ten or morepersons, represented 80% (421/526) ofall MRSA isolations. Three of the 14common strain types were more like-ly to be found in persons who did nothave a contact with a health-care fa-cility than in those who did have sucha contact: Mikkeli clone, HelsinkiVIII, and Joensuu II. Of all strains iso-lated from persons who had no hospi-tal contact, 94% were multisensitive.Of the 56 sporadic strains, 41% weremultisensitive.

53

6. DISCUSSION

6.1 ELABORATION OF THETYPING SCHEME

Comprehensive typing of all MRSAisolates, or any particular nosocomialpathogen, has been considered unnec-essary or even useless: “At best, suchan expenditure of time, effort, andmoney provides some degree of infor-mation on the baseline genotypes oforganisms in nosocomial environ-ment. At the worst, the result is amountain of data, which is difficult tointerpret in the absence of clear driv-ing epidemiological question” (88).However, we describe a typing schemesuitable for assisting in continuousnationwide MRSA surveillance. Inaddition to providing baseline infor-mation on genotypes for the wholecountry, and assistance in local out-break investigations, this scheme hasbrought new information on the evo-lution and clonality of the FinnishMRSA. It is possible to conduct suchintensive typing only in countries withlow MRSA prevalence, and naturallythis scheme needs to be subjected toconstant evaluation and revision asnew methods become available.

It was estimated that the propor-tion of sporadic strains was higherduring 1992-1997 than during 1997-1999. This difference may not be real,since for the first period the sporadic-ity was mostly determined on the ba-sis of phage typing. The reproducibil-ity of phage typing is not sufficient forlong-term surveillance, since, as

shown by a recent study, fewer thanone half of the same isolates typed ondifferent days show identical reac-tions, or show reactions differing instrength only (10). The value of ph-age typing results for individual labo-ratories is also questionable. Sinceonly strong reactions (++ or greater)are reported, a difference merely in thestrength of the reactions of a group ofstrains may lead to incorrect interpre-tation. Therefore, the use of phage typ-ing for surveillance purposes shouldbe reconsidered. However, since ph-age typing performs well in short out-break investigations (208), and isavailable only at KTL in Finland, itcontinues to be part of our routine typ-ing scheme.

A more reliable identification ofstrains with similar genetic back-grounds was achieved by inclusion ofPFGE in the routine typing scheme.The current widely accepted guide-lines for interpreting PFGE patternsare restricted to outbreak investiga-tions within a limited time frame(262). Our decision to use PFGE andthe same guidelines also for continu-ous MRSA surveillance was based onseveral reasons: 1) PFGE was regard-ed as a gold standard method for thetyping of MRSA; 2) the same methodcould be used for both outbreak inves-tigations and surveillance; 3) comput-er-assisted analysis, storage of data,and comparison functions were avail-able; 4) long-term reproducibility ofother DNA-based typing methods,such as RAPD, might be more diffi-cult to achieve (273); and 5) a less dis-

54

criminative method, ribotyping, wasavailable for isolates showing PFGEpatterns difficult to interpret.

MLST is not sufficiently dis-criminative for local outbreak inves-tigations, where the question is wheth-er patient-to-patient transmission hasoccurred. In addition, MLST is too la-borious and time consuming for inten-sive surveillance in which every newMRSA isolate is typed. However,when a new epidemic strain emerges,MLST is a powerful tool for determin-ing whether the same clone has beenencountered previously elsewhere,and for investigating the evolutionaryorigin of the emerging strain. In orderto optimize the global comparison ofpathogenic isolates, essential informa-tion, such as geographical prevalenceand distribution, virulence properties,and antimicrobial resistance data foreach pathogen, should be provided.This process has already begun forMRSA, Neisseria meningitidis, andantibiotic-resistant pneumococci (161,169).

The current typing scheme doesnot include any method for typing mecDNA. However, according to thepresent study and recent reports (107,198, 199), comprehensive assignmentof MRSA lineages requires identifi-cation of both the genetic bacgroundof the strain and the structural type ofthe associated mec DNA. A multiplexPCR method (197), recently devel-oped for rapid identification of thestructural types of mec DNA, shouldbe evaluated, using the Finnish MRSAstrain collection, for its potential in-clusion in the routine typing scheme.

6.2 MRSA TRENDS AND EPI-DEMIC STRAINS

Until 1997 the number of MRSA iso-lations remained stable, with a base-line of 100-150 annual isolations. Apeak in 1994 (225 isolations) was dueto the spread of the Helsinki I epidemicstrain in the Helsinki metropolitanarea. Some uncertainty remains aboutthe data collected prior to 1995, sincethe diagnostic criteria for detectingmethicillin resistance and the guide-lines for weekly reporting of MRSAwere not well described. Since the es-tablishment of the National InfectiousDisease Register in 1995, a continu-ous increase in MRSA numbers hasbeen detected. The MRSA numbers ofthe first three years of the NationalInfectious Disease Register (1995-1997) remained within the baseline ofthe previous decade, but has exceed-ed that since 1998. This increase maybe partly due to enhanced diagnosticsand a general awareness of MRSA. In1995, MRSA isolations were mostlyreported from the hospital districtswith the highest population densities.By 2001, MRSA isolations were re-ported from all over the country.

A reliable comparison of MRSAtrends with other countries is difficult,since proper denominator data arerarely available for analyses. Accord-ing to one year’s nationwide surveil-lance in Switzerland, this country andFinland had a similar incidence ofMRSA in 1997, 9.3 vs. 8.1 per 100,000patient days, respectively (20). In Can-ada, the incidence of MRSA during theperiod 1996 to 1999 was higher than

55

in Finland, but both countries experi-enced a similar rate of increase. InCanada, the number increased from12.7 per 100,000 patient days in 1996to 22.6 per 100,000 patient days in1999 (251). The corresponding figuresin Finland were 7.1 in 1996 and 18.1in 1999. The median age of MRSApositive persons was lower in Finlandthan in Canada, 58 vs. 71, respective-ly. However, there are differences be-tween the Canadian and the Finnishsurveillance systems. The Canadiansurveillance is conducted through sen-tinel hospitals, most of which are ter-tiary-care teaching hospitals (251),whereas in Finland, all clinical micro-biology laboratories report MRSA iso-lations. A national MRSA survey inIreland in 1995 revealed a two-weekperiodical MRSA prevalence of 12.7per 100,000 population (123). Thisfigure is more than five-fold as com-pared with that of Finland for thewhole year, 2.3 per 100,000 popula-tion in 1997.

Despite a reasonably goodMRSA situation on the national levelin Finland, numerous strains causinglocal intrahospital outbreaks or inter-hospital epidemics were identified.New strains emerged throughout thestudy period, and twelve strains havecontinually been isolated since theirfirst appearance, although the numbersof specific strains tend to decline bytime. Genetic alterations, as detectedby PFGE subtype variation, were oc-casionally observed in strains that re-appeared after the first outbreak hadbeen successfully controlled.

Approximately one third of allMRSA strains in Finland are multisen-sitive. This is in contrast to elsewherein Europe, where only 13 % of MRSAisolates, collected from 25 universityhospitals in 15 countries through theSENTRY study, were multisensitive(76).

6.3 MEC HYPERVARIABLEREGION

The mec determinants of the 38 epi-demic and outbreak strains were di-vided into four different types accord-ing to their hypervariable region hy-bridization profiles. An analysis ofsporadic strains from the year 1995revealed only three additional HVR-types, each encountered in only onestrain. Previous studies have shownthat hypervariable region analysis byPCR and sequencing can be used todistinguish different mec DNA types(191, 233, 308). Five to eighteen dif-ferent HVR-types have been identifiedin collections of 24-254 strains on thebasis of differences in either the num-ber or the sequence of dru repeats(185, 191, 242, 246, 308). Consistentlywith the present study, the same HVR-type was often found in different gen-otypes. It is also possible that strainswith identical genotypes harbor differ-ences in HVR types. Five differentsubclones were identified among 50isolates representing one epidemicstrain in Germany (308). In the presentstudy, the HVR types were mostlyanalyzed for one representative ofeach strain type, and therefore no con-clusion can be drawn regarding the

56

variety of HVR types within differentstrain types.

6.4 MRSA CLONES ANDTRANSMISSIBILITY

Two major groups of MRSA wereidentified on the basis of antimicrobi-al susceptibility testing, ribotyping,and hybridization analysis of the mechypervariable region of 72 epidemic,local outbreak, and sporadic MRSAstrains. One group contained mainlysporadic strains showing mec HVRtype A, multisensitivity, and a varietyof ribotypes. The other group con-tained strains with mec HVR type Bor C in association with two commonribotypes, and resistance to other an-tibiotic groups in addition to beta lac-tams. The latter group contained bothepidemic and sporadic strains. Al-though two major groups with distinctgenotypic and phenotypic traits wereidentified, none of the characteristicswere associated directly with epide-micity or sporadicity. The failure tofind such an association may be dueto incorrect assignment of sporadicstrains. Any strain isolated from oneperson only and showing a unique ph-age type and/or antimicrobial suscep-tibility pattern was defined as a spo-radic strain. A classification of straintypes on the basis of phage typingalone was later shown to be inade-quate. In addition, an MLST analysisof the most common Finnish isolatesfrom 1997-1999 showed that, althoughshowing variable PFGE patterns,many of the previously identified epi-demic and local outbreak strains ac-

tually descended from a common an-cestor. Some of the MRSA isolatesoriginally classified as sporadic mayalso have belonged to these clones.

By a combination of several typ-ing methods (phage typing, ribotyp-ing, PFGE, and MLST), this studyidentified eight clones of MRSA inFinland. Six of the clones containedstrains showing major MLST se-quence types recently identifiedamong MRSA strains from severaldifferent countries (74). Of a total oftwelve international MRSA sequencetypes identified in a collection of 359international MRSA isolates, nine (ST5, 36, 347, 239, 241, 8, 22, 45, and30) occurred in ten of the fourteenFinnish MRSA strains analyzed: Hel-sinki I, Helsinki V, Turku II, HelsinkiVI, Helsinki VII, Lohja, Kokkola, UKEMRSA-15, Kemi, and Pori I. In ad-dition, one strain, Tampere III, was asingle locus variant of ST 247.

Two of the eight MRSA clones(Joensuu and Mikkeli) encountered inFinland contained strains showing dif-ferent molecular epidemiology. Al-though these two clones were abun-dant among MRSA strains in Finland,the MLST sequence type ST 12 ofJoensuu II is commonly found amonginternational MSSA, but not amongMRSA strains (http://www.mlst.net),(74), and ST 59, the slv of the Mikke-li clone has been thus far reported inone MRSA carrier and in few MSSAstrains (http://www.mlst.net).

Patient-to-patient transmissionof MRSA depends on many factors.Patients colonized or infected with

57

MRSA are the major reservoir in hos-pitals. Patient risk factors for MRSAcolonization and infection include pre-vious hospitalization, pressure sores,indwelling devices, underlying dis-ease, and recent antibiotic use (47, 64,236). Other factors promoting thespread of MRSA include care in high-risk departments such as burns unit orintensive care unit (47, 225), staffshortage (96), frequent patient trans-fer between wards and hospitals (60,68), and antibiotic selection (249).MRSA dissemination may be reducedby appropriate infection control mea-sures and antibiotic policies (96).However, the identification of a rela-tively small number of global MRSAclones among the large diversity of S.aureus clones suggests that strain char-acteristics also influence the dissemi-nation of MRSA (http://mlst.net), (51,54, 74). The majority of the globallysuccessful clones were also identifiedin Finland. Success in transmissibili-ty seems not to be exclusively due toSCCmec, since 4 of the 12 recognizedMRSA STs (ST 5, 8, 22, and 45) inFinland were common among Euro-pean MSSA strains from the 1990s(74), (http://www.mlst.net).

The reasons for superior trans-missibility of some clones still remainunclear, although several mechanismshave been suggested. Two epidemicstrains have been shown to possessbetter environmental survival thanhave three sporadic strains. The recov-ery capacity of all five strains declinedgradually, but the epidemic strains sur-vived three months longer, in up to

approximately 1000-fold higher quan-tities (cfu/ml), than did the sporadicstrains (296). For some strains, en-hanced transmissibility may resultfrom better colonization at the expenseof reduced virulence (153), as suggest-ed for the Canadian epidemic strainCMRSA-3 (206). CMRSA-3 exhibit-ed significantly higher fibronecting-binding and coagulase titers than didanother epidemic strain, CMRSA-1,and sporadic strains. In the case ofCMRSA-3, the balance towards en-hanced colonization factor productionmay be explained by reduced and de-layed RNAIII production by the glo-bal agr regulator (206). CMRSA-1 didnot produce alpha toxin and proteas-es, and had a limited profile of secret-ed proteins but a normal level ofRNAIII production. The predominantsubtype of CMRSA-1 expressed ahigh molecular weight glycoproteinknown to prevent bacterial adhesionto fibronecting, fibrinogen, and IgG(240). However, this protein may con-fer novel adhesion functions, such asthose related to biofilm formation, andadherence to cellular lipids (114, 115).It has also been suggested that a highnumber of repeats (≥7) in the polymor-phic X-region of the protein A genewould predict an epidemic nature ofMRSA strains. A longer X-region inepidemic strains may result in a betterexposition of the Fc-binding region ofprotein A (81). Another study did notsupport this hypothesis, since no cor-relation was found between the lengthof the protein A gene repeats and thepersistence of S. aureus colonization

58

(279). In the light of the present andprevious studies and the fact that S.aureus colonization and virulence re-sult from a complicated interplay ofnumerous factors, it seems that no sin-gle mechanism is responsible for thesuccessful transmission of certainclones. Instead, these clones may har-bor a wide range of mechanisms af-fecting transmissibility, and the mech-anisms may vary between differentclones and even between subtypes ofindividual strains (206).

Reliable distinguishing of spo-radic strains from strains with evidentcapacity to spread is crucial in thesearch for molecular markers or mech-anisms for enhanced transmissibility.This requires representative popula-tion-based strain collections and care-ful characterization of isolates. Suchmaterial is available in Finland be-cause of the national reporting andtyping systems.

6.5 MRSA IN COMMUNITY

Our study showed that, from 1997 to1999, one fifth of all Finnish MRSAisolates came from persons who hadhad no contact with health-care facil-ities, suggesting that these MRSA iso-lates may be community-acquired.This unexpectedly high proportion ofcommunity-acquired isolates wasidentified despite a stringent definitionfor community acquisition (22), i.e. a2-year time period without health-carefacility contact before the MRSA iso-lation. However, a possibility remainsthat some of the MRSA-positive per-sons may have had health-care facili-

ty contacts before the 2-year cut-offperiod, and their MRSA isolates hadbeen acquired in hospital and had per-sisted ever since.

Risk factors other than previoushospital stays were not analyzed in thisstudy. Further information should becollected to develop a hypothesis onrisk factors specific for community ac-quisition. Intravenous drug use, pre-vious antibiotic use, and underlyingdiseases have previously been associ-ated with community acquisition ofMRSA (147, 176). A recent study cov-ering 30 months identified a similarproportion (22%, 20/92) of commu-nity-acquired MRSA in a universityhospital. Thirteen (65%) persons withcommunity-acquired MRSA lackedthe known risk factors (27). A knownrisk factor was defined as a previoushospitalization within 12 months, anunderlying chronic disease, the pres-ence of an indwelling catheter, a his-tory of surgical procedures, previousantimicrobial therapy, intravenousdrug use, or a household contact withan identified MRSA carrier.

Community-acquired MRSAcan be classified into four categories:1) discharged hospital patients andhospital staff members with MRSA;2) nursing-home residents withMRSA; 3) MRSA transmitted to non-hospitalized patients; and 4) MRSAarising de novo in community (48).Our study focused on the last two cat-egories by first identifying nonhospi-talized MRSA-positive persons, andthereafter comparing their isolateswith those from hospitalized patients

59

Of all MRSA strain types isolat-ed from ten or more persons during1997-1999, three were associated withcommunity acquisition: Mikkeli, Joen-suu, and Helsinki VIII. Coincidental-ly, all these strain types showed relat-ed MLST sequence types previouslyencountered mostly among successfulMSSA clones, but not among MRSAclones (74). In addition, three otherstrain types were also frequently foundamong persons without health-care fa-cility contacts: Kemi, Kokkola, andPori. All these strain types were char-acterized by multisensitivity and HVRtype A. Preliminary PFGE studies in-dicate that the strain types similar toMikkeli, Joensuu, Kemi, and Pori werealso prevalent among contemporaryMSSA isolates in Finland (unpublisheddata). In contrast, the multiresistantstrain types, representing the globallyspread MRSA clones (Brazilian, Ibe-rian, New York, and the UK EMRSA-16), were almost exclusively found inpersons who had health-care facilitycontacts.

Recent sequencing of a virulentcommunity-MRSA strain, MW2,which caused the deaths of four chil-dren without risk factors (29), suggest-ed that different factors may be need-ed for competitive survival in differ-ent environments (11). Multiresistancemay be biologically costly to maintain,and provides no additional fitness inan environment where the antibioticselection pressure is low (5). The high-ly prevalent and virulent community-MRSA, MW2, grows faster, and hasfewer transposons and insertion se-

quences than have strains adapted tothe hospital environment. In addition,MW2 harbors virulence factors notfound in other MRSA genomes whosecomplete sequences are available(139). The superantigen enterotoxinH, the penton-valentine leucocidin, abacteriocin, and a collagen-adhesinwere suggested as being partly respon-sible for the observed virulence (11).The virulence factors of the identifiedcommunity-MRSA strains in Finlandhave not yet been assessed in any way.However, most of the community-ac-quired MRSA were multisensitive,and children were more likely to havea community-acquired than a hospi-tal-acquired MRSA. These findingsagree with those of previous reports,suggesting that nonmultiresistantMRSA is emerging as an importantpathogen in the community (29, 72,105).

6.6 HORIZONTAL TRANSFEROF MEC DNA

According to the present study, hori-zontal transfer of mec DNA has part-ly influenced the epidemiology ofMRSA in Finland. This is supportedby several findings.

First, we found that similarMRSA genotypes had different mecDNA, as assessed by mec hypervari-able region hybridization and PCRanalysis of the mec-regulatory region.These results are in line with previousfindings (74, 75, 198) and suggest thatrepresentatives of similar genotypesmay have acquired the mec DNA fromdifferent donors.

60

deleted elements. This type of mecDNA has also been encountered in co-agulase negative staphylococci (109),and it may be more capable than othermec DNAs of confering beta lactamresistance to community strains of S.aureus (11, 158). Our results supportthis hypothesis.

Emergence of new MRSAclones has also been encountered inGermany (305). Furthermore, strainsresistant to fewer antimicrobial groupsthan before have also been encoun-tered in France, and these strains haveprogressively replaced previous genet-ically different, multiresistant MRSAclones (83, 148, 149).

The mecA gene is widely distrib-uted among different species of coag-ulase negative staphylococci (214,274), and such strains have been de-tected in both nosocomial infectionsand healthy carriers (55, 66). Thus,donors of mec DNA may be availableboth in nosocomial and communitysettings.

Overall, it seems evident that theincrease in the number of MRSA isnot exclusively due to clonal dissemi-nation, but that emergence of de novoMRSA through horizontal transfer ofmec DNA occurs occasionally.

Second, HVR type A was foundin many different genotypes, most of-ten in those with a multisensitive an-timicrobial resistance pattern, but alsoin some isolates of Iberian, New York,and UK EMRSA-16 clones. OtherHVR types were restricted to a fewclones: HVR B in one, C in two, andD in one clone. These results suggestthat HVR A mec may transfer moreeasily than others. It has been suggest-ed that one mec type (mecSCC IV) canspread to most, if not all, S. aureusgenotypes (5). The small size of SC-Cmec IV may explain its enhancedtransfer capacity. Although it remainsto be clarified whether different HVRtypes are associated with specific SC-Cmec types, our data suggest thatHVR type A may be similar to SCC-mec IV (158, 198)

Third, two common clones ofMRSA in Finland, the Mikkeli andJoensuu clones, expressed MLST se-quence types usually found in methi-cillin-sensitive strains (http://www.mlst.net). These MRSA clones,and the Helsinki VIII strain, which isa triple allele variant of the Joensuuclone, are multisensitive, expressHVR type A, and are associated withcommunity acquisition. Furthermore,methicillin-sensitive S. aureus strainswith PFGE types related to the Mikke-li and Joensuu clones are common inFinland. International community-ac-quired MRSA strains have beenshown to harbor a type of mec DNA,which lacks resistance determinantsother than the mecA gene, and regionsknown to contain mutated or partially

61

7. CONCLUSIONS AND CON-SIDERATIONS FOR THE FU-TURE

A suitable typing scheme for continu-ous nationwide MRSA surveillancewas established. In a low prevalencecountry, comprehensive moleculartyping, verification of methicillin re-sistance and S. aureus species, as wellas antimicrobial susceptibility testingof all new isolates is feasible. Contin-uous feedback to laboratories and in-fection control nurses is provided.

MRSA trend in Finland is in-creasing. However, the incidence ofMRSA is still low as compared withthat in many other European countriesand the USA. The proportion ofMRSA isolated from persons withouthospital contacts was surprisinglyhigh, one fifth of all isolates.

Two epidemiologically distinctMRSA populations were found. Thefirst population consisted of globalMRSA strains, which mainly spreadwithin and between hospitals throughclonal dissemination. The second pop-ulation consisted of strains genotypi-cally related to MSSA. Some of thesestrains may emerge through horizon-tal transfer of mec DNA. Subsequentclonal dissemination may occur, oftenlocally in susceptible environments,such as long-term care facilities. Someof these strains were associated withcommunity acquisition.

The two MRSA populationsmay require different infection controlmeasures. The control of globalMRSA in Finland has been quite suc-cessful, as exemplified by the decline

of such isolates in the largest hospitaldistrict. In contrast, increasing prob-lems are encountered with the MRSApopulation consisting of strains geno-typically related to MSSA. Althougheasier to treat, they may be more dif-ficult to diagnose because of their lowoxacillin MICs and heteroresistance.Factors influencing the emergence ofsuch strains are unknown, but antibi-otic selection pressure may play a role.If the emergence of such strains can-not be hindered, efforts should beaimed at the prevention of secondarytransmission.

This study brought up severalitems which call for more precise re-search in the future. Further clinicalinformation should be collected onpersons with community-acquiredMRSA in order to develop a hypothe-sis on risk factors specific for commu-nity acquisition. Association of HVR-types with different SCCmec typesshould be addressed. Many open ques-tions related to the horizontal transferof mec DNA remain to be elucidated.Is HVR type A associated with com-munity acquisition? Does mec DNAcharacterized by HVR type A trans-fer more easily than do other mecDNA types? Are the mec-integrationareas different between isolates show-ing MLST STs common to bothMRSA and MSSA as compared withthose of MSSA exclusively? Further-more, the SCCmec-types in coagulasenegative staphylococci should be stud-ied in more detail.

The near future will provide newtechniques for typing and for predict-

62

ing the epidemic capacity or pathoge-nicity of MRSA strains. Both struc-tural and transcriptional differences ingenomes can be revealed using mi-croarray hybridizations. PCR or se-quencing approaches may be devel-oped for the allotyping of already iden-tified genomic islands. The availabil-ity of complete genome sequences ofseveral strains will result in identifi-cation of new areas important for theunderstanding of the adaptive fitnessof MRSA strains found in different en-vironments.

63

8. ACKNOWLEDGEMENTS

This work was carried out in theDepartment of Microbiology, Nation-al Public Health Institute, Helsinki. Ithank Professor Jussi Huttunen, Headof the Institute, for providing excel-lent research facilities.

Professor Tapani Hovi, Head ofDepartment, and Professors MarttiVaara and Pirjo Mäkelä, former Headsof Department (Department of Bacte-riology at that time) are thanked fortheir interest in and encouragementregarding my study.

I extend my deepest gratitude tomy supervisor, Docent Jaana Vuopio-Varkila, for continuous support, dis-cussions, and guidance throughout thiswork. Without Jaana’s optimistic atti-tude and understanding this workwould not have been completed.

I am most grateful to DocentOuti Lyytikäinen for valuable discus-sions, advice, co-operation, and espe-cially for patience and guidance in myprocess of learning scientific writing.I wish to thank the other co-authorsfor their excellent collaboration andfruitful discussions. I also thank themembers of the Harmony group,whose contribution and discussionsgreatly influenced my work.

The official reviewers, DocentPentti Kuusela and Docent MikaelSkurnik, are thanked for their con-structive criticism and valuable ad-vice.

I thank everyone in the Labora-tory of Hospital Bacteriology for theirfriendship, understanding, and help inevery possible (and impossible) situ-

ation that we have encountered togeth-er. I, especially, thank Elina and Ritvafor sharing both good and bad mo-ments with me throughout these years.Aila and Merja brought jokes and ac-tion to the lab, and Salha gave us per-spective. During the past year, Tuulahas been there, ready to answer anyquestion, scientific or other, whenev-er necessary. I have had the opportu-nity to work with many other peoplein our lab, for shorter or longer peri-ods. This has been an enjoyable andinteresting part of my work.

I thank all the “Bakt-people” inthe Department of Microbiology. Youhave created a warm atmospherewhere working is fun and coffeebreaksare lively. I thank in particular KaijaHelisjoki and Ritva Marizu for every-day help, Carina Bergsten for rapidhelp with computer problems, RitvaTaipalinen for countless differentthings we have somehow ended updoing together, and Susanna and Joan-na for their friendship and listening.

Thanks to all my friends, espe-cially Janet, Kirsi, and Päivi (myfriends since long ago), and Anne andJuha (from recent years) for provid-ing me with and reminding me of “reallife”. I thank Taimi and Erkki for theirhelp in daily affairs. Whenever weneed something, Taimi’s kitchen isopen.

I warmly thank my parents, An-neli and Erkki, for their constant sup-port of and belief in me in all aspectsof life, and my brother, Samu, forcountless short but efficient discus-sions and moments of fun. If I ever

64

need an honest opinion, I will get itfrom Samu.

I thank Sami and Aaro for theirlove, and for bringing me the joy oflife (almost) every day.

October 2002

65

9. REFERENCES

1. 2001. National NosocomialInfections Surveillance (NNIS)System Report, Data Summaryfrom January 1992-June 2001,issued August 2001. Am J InfectControl 29:404-21.

2. Aavitsland, P., M. Stormark, andA. Lystad. 1992. Hospital-acquired infections in Norway: anational prevalence survey in1991. Scand J Infect Dis 24:477-83.

3. Abi-Hanna, P., A. L. Frank, J. P.Quinn, S. Kelkar, P. C.Schreckenberger, M. K. Hayden,and J. F. Marcinak. 2000. Clonalfeatures of community-acquiredmethicillin-resistantStaphylococcus aureus in children.Clin Infect Dis 30:630-1.

4. Abudu, L., I. Blair, A. Fraise, andK. K. Cheng. 2001. Methicillin-resistant Staphylococcus aureus(MRSA): a community-basedprevalence survey. EpidemiolInfect 126:351-6.

5. Ala’Aldeen, D. 2002. A non-multiresistant community MRSAexposes its genome. Lancet359:1791-2.

6. Anthony, B. F., and H. R. Hill.1988. Gram-positive bacteria: anoverview and summary of session.Rev Infect Dis 10:S345-50.

7. Aries de Sousa, M., H. deLencastre, I. Santos Sanches, K.Kikuchi, K. Totsuka, and A.Tomasz. 2000. Similarity ofantibiotic resistance patterns andmolecular typing properties ofmethicillin-resistantStaphylococcus aureus isolateswidely spread in hospitals in NewYork City and in a hospital inTokyo, Japan. Microb Drug Resist6:253-8.

8. Arvidson, S., and K. Tegmark.2001. Regulation of virulencedeterminants in Staphylococcusaureus. Int J Med Microbiol291:159-70.

9. Aubry-Damon, H., C. J. Soussy,and P. Courvalin. 1998.Characterization of mutations inthe rpoB gene that confer rifampinresistance in Staphylococcusaureus. Antimicrob AgentsChemother 42:2590-4.

10. Aucken, H. M., and K. Westwell.2002. Reaction difference rule forphage typing of Staphylococcusaureus at 100 times the routine testdilution. J Clin Microbiol 40:292-3.

11. Baba, T., F. Takeuchi, M. Kuroda,H. Yuzawa, K. Aoki, A. Oguchi,Y. Nagai, N. Iwama, K. Asano,T. Naimi, H. Kuroda, L. Cui, K.Yamamoto, and K. Hiramatsu.2002. Genome and virulencedeterminants of high virulencecommunity-acquired MRSA.Lancet 359:1819-27.

12. Baddiley, J. 1989. Bacterial cellwalls and membranes. Discoveryof the teichoic acids. Bioessays10:207-10.

13. Bax, R., R. Bywater, G. Cornaglia,H. Goossens, P. Hunter, V.Isham, V. Jarlier, R. Jones, I.Phillips, D. Sahm, S. Senn, M.Struelens, D. Taylor, and A.White. 2001. Surveillance ofantimicrobial resistance—what,how and whither? Clin MicrobiolInfect 7:316-25.

14. Beck, W. D., B. Berger-Bachi, andF. H. Kayser. 1986. AdditionalDNA in methicillin-resistantStaphylococcus aureus andmolecular cloning of mec-specificDNA. J Bacteriol 165:373-8.

15. Berger-Bachi, B. 1999. Geneticbasis of methicillin resistance in

66

Staphylococcus aureus. Cell MolLife Sci 56:764-70.

16. Berger-Bachi, B., A. Strassle, J. E.Gustafson, and F. H. Kayser.1992. Mapping andcharacterization of multiplechromosomal factors involved inmethicillin resistance inStaphylococcus aureus.Antimicrob Agents Chemother36:1367-73.

17. Bernander, S., A. Hambraeus, K.E. Myrback, B. Nystrom, and B.Sundelof. 1978. Prevalence ofhospital-associated infections infive Swedish hospitals inNovember 1975. Scand J InfectDis 10:66-70.

18. Beveridge, T. J. 1999. Structures ofgram-negative cell walls and theirderived membrane vesicles. JBacteriol 181:4725-33.

19. Bhakdi, S., and J. Tranum-Jensen.1991. Alpha-toxin ofStaphylococcus aureus. MicrobiolRev 55:733-51.

20. Blanc, D., D. Pittet, C. Ruef, A.Widmer, K. Muhlemann, C.Petignat, S. Harbarth, R.Auckenthaler, J. Bille, R. Frei,R. Zbinden, R. Peduzzi, V. Gaia,H. Khamis, E. Bernasconi, andP. Francioli. 2002. Epidemiologyof methicillin-resistantStaphylococcus aureus: results ofa nation-wide survey inSwitzerland. Swiss Med Wkly132:223-229.

21. Blevins, J. S., K. E. Beenken, M.O. Elasri, B. K. Hurlburt, andM. S. Smeltzer. 2002. Strain-dependent differences in theregulatory roles of sarA and agr inStaphylococcus aureus. InfectImmun 70:470-80.

22. Boyce, J. M. 1998. Are theepidemiology and microbiology ofmethicillin-resistant

Staphylococcus aureus changing?Jama 279:623-4.

23. Bradley, S. F. 1999. Methicillin-resistant Staphylococcus aureus:long-term care concerns. Am JMed 106:2S-10S; discussion 48S-52S.

24. Brakstad, O. G., K. Aasbakk, andJ. A. Maeland. 1992. Detection ofStaphylococcus aureus bypolymerase chain reactionamplification of the nuc gene. JClin Microbiol 30:1654-60.

25. Brosius, T., A. Ullrich, M. Raker,A. Gray, T. Dull, R. Gutell, andH. Noller. 1981. Construction andfine mapping of recombinantplasmids containing the rrnBribosomal operon of E.coli.Plasmid 6:112-118.

26. Brown, D. F., and P. E. Reynolds.1980. Intrinsic resistance to beta-lactam antibiotics inStaphylococcus aureus. FEBS Lett122:275-8.

27. Bukharie, H. A., and M. S.Abdelhadi. 2001. Theepidemiology of methicillin-resistant Staphylococcus aureus ata Saudi university hospital.Microb Drug Resist 7:413-6.

28. Byrne, M. E., M. T. Gillespie, andR. A. Skurray. 1991. 4',4'’adenyltransferase activity onconjugative plasmids isolated fromStaphylococcus aureus is encodedon an integrated copy of pUB110.Plasmid 25:70-5.

29. CDC. 1998. Four pediatric deathsfrom community-acquiredmethicillin-resistantStaphylococcus aureus -Minnesotaand North Dakoda, 1997-1999.JAMA 272829:1123-1125.

30. CDC. 1991. Nosocomial infectionrates for interhospital comparison:limitations and possible solutions.A Report from the NationalNosocomial Infections

67

Surveillance (NNIS) System.Infect Control Hosp Epidemiol12:609-21.

31. CDC. 2002. Staphylococcus aureusresistant to vancomycin, UnitedStates, 2002. Morbidity andMortality Weekly Report 51:565-567.

32. Cefai, C., S. Ashurst, and C.Owens. 1994. Human carriage ofmethicillin-resistantStaphylococcus aureus linked withpet dog. Lancet 344:539-40.

33. Chamberlain, N. R., and B.Imanoel. 1996. Genetic regulationof fatty acid modifying enzymefrom Staphylococcus aureus. JMed Microbiol 44:125-9.

34. Chambers, H. F. 1997. Methicillinresistance in staphylococci:molecular and biochemical basisand clinical implications. ClinMicrobiol Rev 10:781-91.

35. Chambers, H. F., G. Archer, andM. Matsuhashi. 1989. Low-levelmethicillin resistance in strains ofStaphylococcus aureus.Antimicrob Agents Chemother33:424-8.

36. Chambers, H. F., and M.Sachdeva. 1990. Binding of beta-lactam antibiotics to penicillin-binding proteins in methicillin-resistant Staphylococcus aureus. JInfect Dis 161:1170-6.

37. Chang, S.-C., C.-C. Sun, L.-S.Yang, K.-T. Luh, and W.-C.Hsieh. 1997. Increasingnosocomial infections ofmethicillin-resistantStaphylococcus aureus in ateaching hospital in Taiwan.International Journal ofAntimicrobial Agents 8:109-114.

38. Charlebois, E. D., D. R.Bangsberg, N. J. Moss, M. R.Moore, A. R. Moss, H. F.Chambers, and F. Perdreau-Remington. 2002. Population-

based community prevalence ofmethicillin-resistantStaphylococcus aureus in theurban poor of San Francisco. ClinInfect Dis 34:425-33.

39. Chavakis, T., M. Hussain, S. M.Kanse, G. Peters, R. G. Bretzel,J. I. Flock, M. Herrmann, andK. T. Preissner. 2002.Staphylococcus aureusextracellular adherence proteinserves as anti-inflammatory factorby inhibiting the recruitment ofhost leukocytes. Nat Med 8:687-93.

40. Cheung, A. I., S. J. Projan, R. E.Edelstein, and V. A. Fischetti.1995. Cloning, expression, andnucleotide sequence of aStaphylococcus aureus gene(fbpA) encoding a fibrinogen-binding protein. Infect Immun63:1914-20.

41. Cheung, A. L., Y. T. Chien, and A.S. Bayer. 1999. Hyperproductionof alpha-hemolysin in a sigBmutant is associated with elevatedSarA expression in Staphylococcusaureus. Infect Immun 67:1331-7.

42. Cheung, A. L., K. Eberhardt, andJ. H. Heinrichs. 1997. Regulationof protein A synthesis by the sarand agr loci of Staphylococcusaureus. Infect Immun 65:2243-9.

43. Chien, Y., and A. L. Cheung. 1998.Molecular interactions betweentwo global regulators, sar and agr,in Staphylococcus aureus. J BiolChem 273:2645-52.

44. Chikramane, S. G., P. R.Matthews, W. C. Noble, P. R.Stewart, and D. T. Dubin. 1991.Tn554 inserts in methicillin-resistant Staphylococcus aureusfrom Australia and England:comparison with an Americanmethicillin-resistant group. J GenMicrobiol 137:1303-11.

68

45. Cho, S. H., I. Strickland, M.Boguniewicz, and D. Y. Leung.2001. Fibronectin and fibrinogencontribute to the enhanced bindingof Staphylococcus aureus to atopicskin. J Allergy Clin Immunol108:269-74.

46. Chung, M., H. de Lencastre, P.Matthews, A. Tomasz, I.Adamsson, M. Aries de Sousa, T.Camou, C. Cocuzza, A. Corso, I.Couto, A. Dominguez, M.Gniadkowski, R. Goering, A.Gomes, K. Kikuchi, A.Marchese, R. Mato, O. Melter,D. Oliveira, R. Palacio, R. Sa-Leao, I. Santos Sanches, J. H.Song, P. T. Tassios, and P.Villari. 2000. Molecular typing ofmethicillin-resistantStaphylococcus aureus by pulsed-field gel electrophoresis:comparison of results obtained in amultilaboratory effort usingidentical protocols and MRSAstrains. Microb Drug Resist 6:189-98.

47. Coello, R., J. R. Glynn, C. Gaspar,J. J. Picazo, and J. Fereres.1997. Risk factors for developingclinical infection with methicillin-resistant Staphylococcus aureus(MRSA) amongst hospital patientsinitially only colonized withMRSA. J Hosp Infect 37:39-46.

48. Cookson, B. D. 2000. Methicillin-resistant Staphylococcus aureus inthe community: new battlefronts,or are the battles lost? InfectControl Hosp Epidemiol 21:398-403.

49. Couto, I., H. de Lencastre, E.Severina, W. Kloos, J. A.Webster, R. J. Hubner, I. S.Sanches, and A. Tomasz. 1996.Ubiquitous presence of a mecAhomologue in natural isolates ofStaphylococcus sciuri. MicrobDrug Resist 2:377-91.

50. Cox, R. A., and P. E. Bowie. 1999.Methicillin-resistantStaphylococcus aureuscolonization in nursing homeresidents: a prevalence study inNorthamptonshire. J Hosp Infect43:115-22.

51. Crisostomo, M. I., H. Westh, A.Tomasz, M. Chung, D. C.Oliveira, and H. de Lencastre.2001. The evolution of methicillinresistance in Staphylococcusaureus: similarity of geneticbackgrounds in historically earlymethicillin-susceptible and -resistant isolates andcontemporary epidemic clones.Proc Natl Acad Sci U S A98:9865-70.

52. Cui, L., H. Murakami, K.Kuwahara-Arai, H. Hanaki, andK. Hiramatsu. 2000. Contributionof a thickened cell wall and itsglutamine nonamidatedcomponent to the vancomycinresistance expressed byStaphylococcus aureus Mu50.Antimicrob Agents Chemother44:2276-85.

53. Davies, H. G., and D. R. Martin.1987. Heat shocking as a usefuladjunct to routine phage typing ofStaphylococcus aureus. J HospInfect 10:4-9.

54. Day, N. P., C. E. Moore, M. C.Enright, A. R. Berendt, J. M.Smith, M. F. Murphy, S. J.Peacock, B. G. Spratt, and E. J.Feil. 2001. A link betweenvirulence and ecologicalabundance in natural populationsof Staphylococcus aureus. Science292:114-6.

55. De Giusti, M., L. Pacifico, D. Tufi,A. Panero, A. Boccia, and C.Chiesa. 1999. Phenotypicdetection of nosocomial mecA-positive coagulase-negative

69

staphylococci from neonates. JAntimicrob Chemother 44:351-8.

56. de Lencastre, H., and A. Tomasz.1994. Reassessment of the numberof auxiliary genes essential forexpression of high-levelmethicillin resistance inStaphylococcus aureus.Antimicrob Agents Chemother38:2590-8.

57. De Lencastre, H., S. W. Wu, M. G.Pinho, A. M. Ludovice, S. Filipe,S. Gardete, R. Sobral, S. Gill, M.Chung, and A. Tomasz. 1999.Antibiotic resistance as a stressresponse: complete sequencing ofa large number of chromosomalloci in Staphylococcus aureusstrain COL that impact on theexpression of resistance tomethicillin. Microb Drug Resist5:163-75.

58. de Sousa, M. A., I. S. Sanches, M.L. Ferro, M. J. Vaz, Z. Saraiva,T. Tendeiro, J. Serra, and H. deLencastre. 1998. Intercontinentalspread of a multidrug-resistantmethicillin-resistantStaphylococcus aureus clone. JClin Microbiol 36:2590-6.

59. Del Vecchio, V. G., J. M.Petroziello, M. J. Gress, F. K.McCleskey, G. P. Melcher, H. K.Crouch, and J. R. Lupski. 1995.Molecular genotyping ofmethicillin-resistantStaphylococcus aureus viafluorophore-enhanced repetitive-sequence PCR. J Clin Microbiol33:2141-4.

60. Deplano, A., W. Witte, W. J. vanLeeuwen, Y. Brun, and M. J.Struelens. 2000. Clonaldissemination of epidemicmethicillin-resistantStaphylococcus aureus in Belgiumand neighboring countries. ClinMicrobiol Infect 6:239-45.

61. Dickinson, R. B., J. A. Nagel, D.McDevitt, T. J. Foster, R. A.Proctor, and S. L. Cooper. 1995.Quantitative comparison ofclumping factor- and coagulase-mediated Staphylococcus aureusadhesion to surface-boundfibrinogen under flow. InfectImmun 63:3143-50.

62. Diekema, D. J., M. A. Pfaller, J.Turnidge, J. Verhoef, J. Bell, A.C. Fluit, G. V. Doern, and R. N.Jones. 2000. Genetic relatednessof multidrug-resistant, methicillin(oxacillin)-resistantStaphylococcus aureusbloodstream isolates fromSENTRY AntimicrobialResistance Surveillance Centersworldwide, 1998. Microb DrugResist 6:213-21.

63. Dinges, M. M., P. M. Orwin, andP. M. Schlievert. 2000. Exotoxinsof Staphylococcus aureus. ClinMicrobiol Rev 13:16-34, table ofcontents.

64. Doebbeling, B. N. 1995. Theepidemiology of methicillin-resistant Staphylococcus aureuscolonisation and infection. JChemother 7:99-103.

65. Doebbeling, B. N. 1994. Nasal andhand carriage of Staphylococcusaureus in healthcare workers. JChemother 6:11-7.

66. Dominguez, E., M. Zarazaga, andC. Torres. 2002. Antibioticresistance in Staphylococcusisolates obtained from fecalsamples of healthy children. J ClinMicrobiol 40:2638-41.

67. Duckworth, G., B. Cookson, H.Humphreys, and R. Heathcock.1998. Revised guidelines for thecontrol of methicillin-resistantStaphylococcus aureus infection inhospitals. Journal of HospitalInfection 39:250-290.

70

68. Dziekan, G., A. Hahn, K. Thune,G. Schwarzer, K. Schafer, F. D.Daschner, and H. Grundmann.2000. Methicillin-resistantStaphylococcus aureus in ateaching hospital: investigation ofnosocomial transmission using amatched case-control study. JHosp Infect 46:263-70.

69. Edmond, M. B., S. E. Wallace, D.K. McClish, M. A. Pfaller, R. N.Jones, and R. P. Wenzel. 1999.Nosocomial bloodstreaminfections in United Stateshospitals: a three-year analysis.Clin Infect Dis 29:239-44.

70. Ellingsen, E., S. Morath, T. Flo, A.Schromm, T. Hartung, C.Thiemermann, T. Espevik, D.Golenbock, D. Foster, R.Solberg, A. Aasen, and J. Wang.2002. Induction of cytokineproduction in human T cells andmonocytes by highly purifiedlipoteichoic acid: involvement ofToll-like receptors and CD14. MedSci Monit 8:BR149-56.

71. Elliott, T. S., and M. H. Faroqui.1992. Infections and intravasculardevices. Br J Hosp Med 48:496-7,500-3.

72. Embil, J., K. Ramotar, L.Romance, M. Alfa, J. Conly, S.Cronk, G. Taylor, B. Sutherland,T. Louie, E. Henderson, and etal. 1994. Methicillin-resistantStaphylococcus aureus in tertiarycare institutions on the Canadianprairies 1990-1992. Infect ControlHosp Epidemiol 15:646-51.

73. Enright, M. C., N. P. Day, C. E.Davies, S. J. Peacock, and B. G.Spratt. 2000. Multilocus sequencetyping for characterization ofmethicillin-resistant andmethicillin-susceptible clones ofStaphylococcus aureus. J ClinMicrobiol 38:1008-15.

74. Enright, M. C., D. A. Robinson, G.Randle, E. J. Feil, H.Grundmann, and B. G. Spratt.2002. The evolutionary history ofmethicillin-resistantStaphylococcus aureus (MRSA).Proc Natl Acad Sci U S A99:7687-92.

75. Fitzgerald, J. R., D. E. Sturdevant,S. M. Mackie, S. R. Gill, and J.M. Musser. 2001. Evolutionarygenomics of Staphylococcusaureus: insights into the origin ofmethicillin-resistant strains and thetoxic shock syndrome epidemic.Proc Natl Acad Sci U S A98:8821-6.

76. Fluit, A. C., C. L. Wielders, J.Verhoef, and F. J. Schmitz. 2001.Epidemiology and susceptibility of3,051 Staphylococcus aureusisolates from 25 universityhospitals participating in theEuropean SENTRY study. J ClinMicrobiol 39:3727-32.

77. Foster, T. J., and M. Hook. 1998.Surface protein adhesins ofStaphylococcus aureus. TrendsMicrobiol 6:484-8.

78. Fournier, B., A. Klier, and G.Rapoport. 2001. The two-component system ArlS-ArlR is aregulator of virulence geneexpression in Staphylococcusaureus. Mol Microbiol 41:247-61.

79. Fraise, A. P., K. Mitchell, S. J.O’Brien, K. Oldfield, and R.Wise. 1997. Methicillin-resistantStaphylococcus aureus (MRSA) innursing homes in a major UK city:an anonymized point prevalencesurvey. Epidemiol Infect 118:1-5.

80. Frenay, H. M., A. E. Bunschoten,L. M. Schouls, W. J. vanLeeuwen, C. M. Vandenbroucke-Grauls, J. Verhoef, and F. R.Mooi. 1996. Molecular typing ofmethicillin-resistantStaphylococcus aureus on the

71

basis of protein A genepolymorphism. Eur J ClinMicrobiol Infect Dis 15:60-4.

81. Frenay, H. M., J. P. Theelen, L. M.Schouls, C. M. Vandenbroucke-Grauls, J. Verhoef, W. J. vanLeeuwen, and F. R. Mooi. 1994.Discrimination of epidemic andnonepidemic methicillin-resistantStaphylococcus aureus strains onthe basis of protein A genepolymorphism. J Clin Microbiol32:846-7.

82. Frimodt-Moller, N., F. Espersen,P. Skinhoj, and V. T. Rosdahl.1997. Epidemiology ofStaphylococcus aureus bacteremiain Denmark from 1957 to 1990.Clin Microbiol Infect 3:297-305.

83. Galdbart, J. O., A. Morvan, andN. El Solh. 2000. Phenotypic andmolecular typing of nosocomialmethicillin-resistantStaphylococcus aureus strainssusceptible to gentamicin isolatedin france from 1995 to 1997. JClin Microbiol 38:185-90.

84. Garner, J. S., W. R. Jarvis, T. G.Emori, T. C. Horan, and J. M.Hughes. 1988. CDC definitionsfor nosocomial infections, 1988.Am J Infect Control 16:128-40.

85. Geyid, A., and Y. Lemeneh. 1991.The incidence of methicillinresistant S. aureus strains inclinical specimens in relation totheir beta-lactamase producing andmultiple-drug resistance propertiesin Addis Abeba. Ethiop Med J29:149-61.

86. Giesbrecht, P., T. Kersten, H.Maidhof, and J. Wecke. 1998.Staphylococcal cell wall:morphogenesis and fatal variationsin the presence of penicillin.Microbiol Mol Biol Rev 62:1371-414.

87. Giraudo, A. T., A. L. Cheung, andR. Nagel. 1997. The sae locus of

Staphylococcus aureus controlsexoprotein synthesis at thetranscriptional level. ArchMicrobiol 168:53-8.

88. Goering, R. 2000. The molucalepidemiology of nosocomialinfection: past, present and future.Reviews in Medical Microbiology11:145-152.

89. Goering, R. V., and T. D.Duensing. 1990. Rapid fieldinversion gel electrophoresis incombination with an rRNA geneprobe in the epidemiologicalevaluation of staphylococci. J ClinMicrobiol 28:426-9.

90. Goettsch, W., S. L. Bronzwaer, A.J. de Neeling, M. C. Wale, H.Aubry-Damon, B. Olsson-Liljequist, M. J. Sprenger, and J.E. Degener. 2000. Standardizationand quality assurance forantimicrobial resistancesurveillance of Streptococcuspneumoniae and Staphylococcusaureus within the EuropeanAntimicrobial ResistanceSurveillance System (EARSS).Clin Microbiol Infect 6:59-63.

91. Goffin, C., and J. M. Ghuysen.1998. Multimodular penicillin-binding proteins: an enigmaticfamily of orthologs and paralogs.Microbiol Mol Biol Rev 62:1079-93.

92. Goh, S. H., S. K. Byrne, J. L.Zhang, and A. W. Chow. 1992.Molecular typing ofStaphylococcus aureus on thebasis of coagulase genepolymorphisms. J Clin Microbiol30:1642-5.

93. Gomes, A. R., I. S. Sanches, M.Aires de Sousa, E. Castaneda,and H. de Lencastre. 2001.Molecular epidemiology ofmethicillin-resistantStaphylococcus aureus inColombian hospitals: dominance

72

of a single unique multidrug-resistant clone. Microb DrugResist 7:23-32.

94. Grimont, F., and P. Grimont.1995. Determination of rRNA generestriction patterns, p. 181-200. InJ. Howard and D. Whitecombe(ed.), Diagnostic bacteriologyprotocols. Humana Press, Totowa.

95. Groom, A. V., D. H. Wolsey, T. S.Naimi, K. Smith, S. Johnson, D.Boxrud, K. A. Moore, and J. E.Cheek. 2001. Community-acquired methicillin-resistantStaphylococcus aureus in a ruralAmerican Indian community. Jama286:1201-5.

96. Grundmann, H., S. Hori, B.Winter, A. Tami, and D. J.Austin. 2002. Risk factors for thetransmission of methicillin-resistant Staphylococcus aureus inan adult intensive care unit: fittinga model to the data. J Infect Dis185:481-8.

97. Gustafson, J., A. Strassle, H.Hachler, F. H. Kayser, and B.Berger-Bachi. 1994. The femClocus of Staphylococcus aureusrequired for methicillin resistanceincludes the glutamine synthetaseoperon. J Bacteriol 176:1460-7.

98. Hackbarth, C. J., and H. F.Chambers. 1993. blaI and blaR1regulate beta-lactamase and PBP2a production in methicillin-resistant Staphylococcus aureus.Antimicrob Agents Chemother37:1144-9.

99. Haley, R. W., D. H. Culver, J. W.White, W. M. Morgan, T. G.Emori, V. P. Munn, and T. M.Hooton. 1985. The efficacy ofinfection surveillance and controlprograms in preventingnosocomial infections in UShospitals. Am J Epidemiol121:182-205.

100. Haley, R. W., A. W. Hightower, R.F. Khabbaz, C. Thornsberry, W.J. Martone, J. R. Allen, and J.M. Hughes. 1982. The emergenceof methicillin-resistantStaphylococcus aureus infectionsin United States hospitals. Possiblerole of the house staff-patienttransfer circuit. Ann Intern Med97:297-308.

101. Hallanvuo, S., M. Skurnik, K.Asplund, and A. Siitonen. 2002.Detection of a novel repeatedsequence useful forepidemiological typing ofpathogenic Yersinia enterocolitica.International Journal of MedicalMicrobiology In press.

102. Hamill, R. J., J. M. Vann, and R.A. Proctor. 1986. Phagocytosis ofStaphylococcus aureus by culturedbovine aortic endothelial cells:model for postadherence events inendovascular infections. InfectImmun 54:833-6.

103. Hanaki, H., K. Kuwahara-Arai, S.Boyle-Vavra, R. S. Daum, H.Labischinski, and K. Hiramatsu.1998. Activated cell-wall synthesisis associated with vancomycinresistance in methicillin-resistantStaphylococcus aureus clinicalstrains Mu3 and Mu50. JAntimicrob Chemother 42:199-209.

104. Hartleib, J., N. Kohler, R. B.Dickinson, G. S. Chhatwal, J. J.Sixma, O. M. Hartford, T. J.Foster, G. Peters, B. E. Kehrel,and M. Herrmann. 2000. ProteinA is the von Willebrand factorbinding protein on Staphylococcusaureus. Blood 96:2149-56.

105. Herold, B. C., L. C. Immergluck,M. C. Maranan, D. S.Lauderdale, R. E. Gaskin, S.Boyle-Vavra, C. D. Leitch, andR. S. Daum. 1998. Community-acquired methicillin-resistant

73

Staphylococcus aureus in childrenwith no identified predisposingrisk. Jama 279:593-8.

106. Heumann, D., C. Barras, A.Severin, M. P. Glauser, and A.Tomasz. 1994. Gram-positive cellwalls stimulate synthesis of tumornecrosis factor alpha andinterleukin-6 by humanmonocytes. Infect Immun62:2715-21.

107. Hiramatsu, K. 1995. Molecularevolution of MRSA. MicrobiolImmunol 39:531-43.

108. Hiramatsu, K. 2001. Vancomycin-resistant Staphylococcus aureus: anew model of antibiotic resistance.Lancet Infect Dis 1:147-55.

109. Hiramatsu, K., L. Cui, M.Kuroda, and T. Ito. 2001. Theemergence and evolution ofmethicillin-resistantStaphylococcus aureus. TrendsMicrobiol 9:486-93.

110. Hiramatsu, K., H. Hanaki, T. Ino,K. Yabuta, T. Oguri, and F. C.Tenover. 1997. Methicillin-resistant Staphylococcus aureusclinical strain with reducedvancomycin susceptibility. JAntimicrob Chemother 40:135-6.

111. Hoefnagels-Schuermans, A., W. E.Peetermans, M. J. Struelens, S.Van Lierde, and J. Van Eldere.1997. Clonal analysis andidentification of epidemic strainsof methicillin-resistantStaphylococcus aureus byantibiotyping and determination ofprotein A gene and coagulase genepolymorphisms. J Clin Microbiol35:2514-20.

112. Holmberg, S. D., and P. A. Blake.1984. Staphylococcal foodpoisoning in the United States.New facts and old misconceptions.Jama 251:487-9.

113. Huang, S. S., B. J. Labus, M. C.Samuel, D. T. Wan, and A. L.

Reingold. 2002. Antibioticresistance patterns of bacterialisolates from blood in sanfrancisco county, california, 1996-1999. Emerg Infect Dis 8:195-201.

114. Huesca, M., R. Peralta, D. N.Sauder, A. E. Simor, and M. J.McGavin. 2002. Adhesion andvirulence properties of epidemicCanadian methicillin-resistantStaphylococcus aureus strain 1:identification of novel adhesionfunctions associated with plasmin-sensitive surface protein. J InfectDis 185:1285-96.

115. Hussain, M., M. Herrmann, C.von Eiff, F. Perdreau-Remington, and G. Peters. 1997.A 140-kilodalton extracellularprotein is essential for theaccumulation of Staphylococcusepidermidis strains on surfaces.Infect Immun 65:519-24.

116. Iandolo, j. 2000. Genetic andphysical mapping ofStaphylococcus aureus 8325, p.317-325. In V. A. Fischetti, R. P.Novick, J. Ferretti, D. Portnoy,and J. Rood (ed.), Gram-positivepathogens. ASM Press,Washington D.C.

117. Ito, T., Y. Katayama, K. Asada, N.Mori, K. Tsutsumimoto, C.Tiensasitorn, and K. Hiramatsu.2001. Structural comparison ofthree types of staphylococcalcassette chromosome mecintegrated in the chromosome inmethicillin-resistantStaphylococcus aureus.Antimicrob Agents Chemother45:1323-36.

118. Ito, T., Y. Katayama, and K.Hiramatsu. 1999. Cloning andnucleotide sequence determinationof the entire mec DNA of pre-methicillin-resistantStaphylococcus aureus N315.

74

Antimicrob Agents Chemother43:1449-58.

119. Itokazu, G. S., J. P. Quinn, C.Bell-Dixon, F. M. Kahan, and R.A. Weinstein. 1996. Antimicrobialresistance rates among aerobicgram-negative bacilli recoveredfrom patients in intensive careunits: evaluation of a nationalpostmarketing surveillanceprogram. Clin Infect Dis 23:779-84.

120. Ivert, T. S., W. E. Dismukes, C. G.Cobbs, E. H. Blackstone, J. W.Kirklin, and L. A. Bergdahl.1984. Prosthetic valveendocarditis. Circulation 69:223-32.

121. Jevons, M. 1961. Celbenin-resistantstaphylococci. British MedicalJournal 1:124-125.

122. Joh, D., E. R. Wann, B.Kreikemeyer, P. Speziale, andM. Hook. 1999. Role offibronectin-binding MSCRAMMsin bacterial adherence and entryinto mammalian cells. Matrix Biol18:211-23.

123. Johnson, Z., P. Fitzpatrick, C.Hayes, G. Sayers, H. Pelly, B.McDonnell, L. Thornton, and J.Buttimer. 1997. National surveyof MRSA: Ireland, 1995. J HospInfect 35:175-84.

124. Jolly, L., S. Wu, J. van Heijenoort,H. de Lencastre, D. Mengin-Lecreulx, and A. Tomasz. 1997.The femR315 gene fromStaphylococcus aureus, theinterruption of which results inreduced methicillin resistance,encodes a phosphoglucosaminemutase. J Bacteriol 179:5321-5.

125. Jones, T. F., M. E. Kellum, S. S.Porter, M. Bell, and W.Schaffner. 2002. An outbreak ofcommunity-acquired foodborneillness caused by methicillin-

resistant Staphylococcus aureus.Emerg Infect Dis 8:82-4.

126. Kaatz, G. W., S. M. Seo, and C. A.Ruble. 1991. Mechanisms offluoroquinolone resistance inStaphylococcus aureus. J InfectDis 163:1080-6.

127. Karlsson, A., P. Saravia-Otten, K.Tegmark, E. Morfeldt, and S.Arvidson. 2001. Decreasedamounts of cell wall-associatedprotein A and fibronectin-bindingproteins in Staphylococcus aureussarA mutants due to up-regulationof extracellular proteases. InfectImmun 69:4742-8.

128. Katayama, Y., T. Ito, and K.Hiramatsu. 2000. A new class ofgenetic element, staphylococcuscassette chromosome mec,encodes methicillin resistance inStaphylococcus aureus.Antimicrob Agents Chemother44:1549-55.

129. Khan, S. A., and R. P. Novick.1983. Complete nucleotidesequence of pT181, a tetracycline-resistance plasmid fromStaphylococcus aureus. Plasmid10:251-9.

130. Kloos, W., and T. Bannerman.1999. Staphylococcus andMicrococcus, p. 264-282. In P.Murray, E. Baron, M. A. Pfaller, F.Tenover, and R. Yolken (ed.),Manual of clinical microbiology.ASM Press, Washington D.C.

131. Kluytmans, J., A. van Belkum,and H. Verbrugh. 1997. Nasalcarriage of Staphylococcusaureus: epidemiology, underlyingmechanisms, and associated risks.Clin Microbiol Rev 10:505-20.

132. Kluytmans, J., A. VanGriethuysen, P. Willemse, and P.Van Keulen. 2002. Performanceof CHROMagar Selective Mediumand Oxacillin ResistanceScreening Agar Base for

75

Identifying Staphylococcus aureusand Detecting MethicillinResistance. J Clin Microbiol40:2480-2.

133. Kobayashi, N., K. Taniguchi, andS. Urasawa. 1998. Analysis ofdiversity of mutations in the mecIgene and mecA promoter/operatorregion of methicillin-resistantStaphylococcus aureus andStaphylococcus epidermidis.Antimicrob Agents Chemother42:717-20.

134. Kondo, N., K. Kuwahara-Arai, H.Kuroda-Murakami, E. Tateda-Suzuki, and K. Hiramatsu. 2001.Eagle-type methicillin resistance:new phenotype of high methicillinresistance under mec regulatorgene control. Antimicrob AgentsChemother 45:815-24.

135. Kreiswirth, B., J. Kornblum, R. D.Arbeit, W. Eisner, J. N. Maslow,A. McGeer, D. E. Low, and R. P.Novick. 1993. Evidence for aclonal origin of methicillinresistance in Staphylococcusaureus. Science 259:227-30.

136. Kropec, A., J. Huebner, M. Riffel,U. Bayer, A. Benzing, K. Geiger,and F. D. Daschner. 1993.Exogenous or endogenousreservoirs of nosocomialPseudomonas aeruginosa andStaphylococcus aureus infectionsin a surgical intensive care unit.Intensive Care Med 19:161-5.

137. Kuhl, S. A., P. A. Pattee, and J. N.Baldwin. 1978. Chromosomalmap location of the methicillinresistance determinant inStaphylococcus aureus. J Bacteriol135:460-5.

138. Kullik, I., P. Giachino, and T.Fuchs. 1998. Deletion of thealternative sigma factor sigmaB inStaphylococcus aureus reveals itsfunction as a global regulator of

virulence genes. J Bacteriol180:4814-20.

139. Kuroda, M., T. Ohta, I. Uchiyama,T. Baba, H. Yuzawa, I.Kobayashi, L. Cui, A. Oguchi,K. Aoki, Y. Nagai, J. Lian, T. Ito,M. Kanamori, H. Matsumaru,A. Maruyama, H. Murakami, A.Hosoyama, Y. Mizutani-Ui, N.K. Takahashi, T. Sawano, R.Inoue, C. Kaito, K. Sekimizu, H.Hirakawa, S. Kuhara, S. Goto,J. Yabuzaki, M. Kanehisa, A.Yamashita, K. Oshima, K.Furuya, C. Yoshino, T. Shiba, M.Hattori, N. Ogasawara, H.Hayashi, and K. Hiramatsu.2001. Whole genome sequencingof meticillin-resistantStaphylococcus aureus. Lancet357:1225-40.

140. Kuwahara-Arai, K., N. Kondo, S.Hori, E. Tateda-Suzuki, and K.Hiramatsu. 1996. Suppression ofmethicillin resistance in a mecA-containing pre-methicillin-resistant Staphylococcus aureusstrain is caused by the mecI-mediated repression of PBP 2'production. Antimicrob AgentsChemother 40:2680-5.

141. Labischinski, H. 1992.Consequences of the interaction ofbeta-lactam antibiotics withpenicillin binding proteins fromsensitive and resistantStaphylococcus aureus strains.Med Microbiol Immunol (Berl)181:241-65.

142. Lacey, R. W., and J. Grinsted.1973. Genetic analysis ofmethicillin-resistant strains ofStaphylococcus aureus; evidencefor their evolution from a singleclone. J Med Microbiol 6:511-26.

143. Lachica, R. V., P. D. Hoeprich,and C. Genigeorgis. 1972.Metachromatic agar-diffusionmicroslide technique for detecting

76

staphylococcal nuclease in foods.Appl Microbiol 23:168-9.

144. Ladhani, S., C. L. Joannou, D. P.Lochrie, R. W. Evans, and S. M.Poston. 1999. Clinical, microbial,and biochemical aspects of theexfoliative toxins causingstaphylococcal scalded-skinsyndrome. Clin Microbiol Rev12:224-42.

145. Lahteenmaki, K., P. Kuusela, andT. K. Korhonen. 2001. Bacterialplasminogen activators andreceptors. FEMS Microbiol Rev25:531-52.

146. Lambert, P. A., I. C. Hancock, andJ. Baddiley. 1977. Occurrence andfunction of membrane teichoicacids. Biochim Biophys Acta472:1-12.

147. Layton, M. C., W. J. Hierholzer,Jr., and J. E. Patterson. 1995.The evolving epidemiology ofmethicillin-resistantStaphylococcus aureus at auniversity hospital. Infect ControlHosp Epidemiol 16:12-7.

148. Lelievre, H., G. Lina, M. E. Jones,C. Olive, F. Forey, M. Roussel-Delvallez, M. H. Nicolas-Chanoine, C. M. Bebear, V.Jarlier, A. Andremont, F.Vandenesch, and J. Etienne.1999. Emergence and spread inFrench hospitals of methicillin-resistant Staphylococcus aureuswith increasing susceptibility togentamicin and other antibiotics. JClin Microbiol 37:3452-7.

149. Lemaitre, N., W. Sougakoff, A.Masmoudi, M. H. Fievet, R.Bismuth, and V. Jarlier. 1998.Characterization of gentamicin-susceptible strains of methicillin-resistant Staphylococcus aureusinvolved in nosocomial spread. JClin Microbiol 36:81-5.

150. L’Heriteau, F., J. C. Lucet, A.Scanvic, and E. Bouvet. 1999.

Community-acquired methicillin-resistant Staphylococcus aureusand familial transmission. Jama282:1038-9.

151. Lilenbaum, W., E. L. Nunes, andM. A. Azeredo. 1998. Prevalenceand antimicrobial susceptibility ofstaphylococci isolated from theskin surface of clinically normalcats. Lett Appl Microbiol 27:224-8.

152. Lindenmayer, J. M., S.Schoenfeld, R. O’Grady, and J.K. Carney. 1998. Methicillin-resistant Staphylococcus aureus ina high school wrestling team andthe surrounding community. ArchIntern Med 158:895-9.

153. Lipsitch, M., and E. R. Moxon.1997. Virulence andtransmissibility of pathogens: whatis the relationship? TrendsMicrobiol 5:31-7.

154. Lowy, F. D. 1998. Staphylococcusaureus infections. N Engl J Med339:520-32.

155. Lumio, J. 1999.Sairaalainfektioiden esiintyvyys jasairaalahygienian merkitys, p. 19-28. In P. Kujala, P. Grönroos, A.Rantala, l. Tittanen, R. Vuento,and S. Hellsten (ed.), Infektioidentorjunta sairaalassa, vol. 4.Suomen kuntaliitto, Jyväskylä.

156. Luong, T. T., and C. Y. Lee. 2002.Overproduction of Type 8Capsular PolysaccharideAugments Staphylococcus aureusVirulence. Infect Immun 70:3389-95.

157. Lyytikainen, O., J. Lumio, H.Sarkkinen, E. Kolho, A.Kostiala, and P. Ruutu. 2002.Nosocomial BloodstreamInfections in Finnish Hospitalsduring 1999-2000. Clin Infect Dis35:E14-9.

158. Ma, X. X., T. Ito, C. Tiensasitorn,M. Jamklang, P. Chongtrakool,

77

S. Boyle-Vavra, R. S. Daum, andK. Hiramatsu. 2002. Novel Typeof Staphylococcal CassetteChromosome mec Identified inCommunity-Acquired Methicillin-Resistant Staphylococcus aureusStrains. Antimicrob AgentsChemother 46:1147-52.

159. Madani, T. A., N. A. Al-Abdullah,A. A. Al-Sanousi, T. M.Ghabrah, S. Z. Afandi, and H.A. Bajunid. 2001. Methicillin-resistant Staphylococcus aureus intwo tertiary-care centers in Jeddah,Saudi Arabia. Infect Control HospEpidemiol 22:211-6.

160. Maguire, G. P., A. D. Arthur, P. J.Boustead, B. Dwyer, and B. J.Currie. 1996. Emerging epidemicof community-acquiredmethicillin-resistantStaphylococcus aureus infection inthe Northern Territory. Med J Aust164:721-3.

161. Maiden, M. C., J. A. Bygraves, E.Feil, G. Morelli, J. E. Russell, R.Urwin, Q. Zhang, J. Zhou, K.Zurth, D. A. Caugant, I. M.Feavers, M. Achtman, and B. G.Spratt. 1998. Multilocus sequencetyping: a portable approach to theidentification of clones withinpopulations of pathogenicmicroorganisms. Proc Natl AcadSci U S A 95:3140-5.

162. Marchese, A., G. Balistreri, E.Tonoli, E. A. Debbia, and G. C.Schito. 2000. Heterogeneousvancomycin resistance inmethicillin-resistantStaphylococcus aureus strainsisolated in a large Italian hospital.J Clin Microbiol 38:866-9.

163. Marples, R. R., and E. M. Cooke.1988. Current problems withmethicillin-resistantStaphylococcus aureus. J HospInfect 11:381-92.

164. Marples, R. R., and V. T. Rosdahl.1997. International quality controlof phage typing of Staphylococcusaureus. International Union ofMicrobial Societies Subcommittee.J Med Microbiol 46:511-6.

165. Mato, R., I. Santos Sanches, M.Venditti, D. J. Platt, A. Brown,M. Chung, and H. de Lencastre.1998. Spread of the multiresistantIberian clone of methicillin-resistant Staphylococcus aureus(MRSA) to Italy and Scotland.Microb Drug Resist 4:107-12.

166. Matthews, P., and P. Steward.1984. Resistance heterogeneity inmethicillin-resistantStaphylococcus aureus. FEMSMicrobiology Letters 22:161-166.

167. Matthews, P. R., K. C. Reed, andP. R. Stewart. 1987. The cloningof chromosomal DNA associatedwith methicillin and otherresistances in Staphylococcusaureus. J Gen Microbiol133:1919-29.

168. McDougal, L. K., and C.Thornsberry. 1986. The role ofbeta-lactamase in staphylococcalresistance to penicillinase-resistantpenicillins and cephalosporins. JClin Microbiol 23:832-9.

169. McGee, L., L. McDougal, J. Zhou,B. G. Spratt, F. C. Tenover, R.George, R. Hakenbeck, W.Hryniewicz, J. C. Lefevre, A.Tomasz, and K. P. Klugman.2001. Nomenclature of majorantimicrobial-resistant clones ofStreptococcus pneumoniae definedby the pneumococcal molecularepidemiology network. J ClinMicrobiol 39:2565-71.

170. McNamara, P. J., and R. A.Proctor. 2000. Staphylococcusaureus small colony variants,electron transport and persistentinfections. Int J AntimicrobAgents 14:117-22.

78

171. Mehndiratta, P. L., S. Vidhani,and M. D. Mathur. 2001. A studyon Staphylococcus aureus strainssubmitted to a referencelaboratory. Indian J Med Res114:90-4.

172. Mekalanos, J. J. 1992.Environmental signals controllingexpression of virulencedeterminants in bacteria. JBacteriol 174:1-7.

173. Mongodin, E., O. Bajolet, J.Cutrona, N. Bonnet, F. Dupuit,E. Puchelle, and S. deBentzmann. 2002. Fibronectin-binding proteins ofStaphylococcus aureus areinvolved in adherence to humanairway epithelium. Infect Immun70:620-30.

174. Moore, P. C., and J. A. Lindsay.2002. Molecular characterisationof the dominant UK methicillin-resistant Staphylococcus aureusstrains, EMRSA-15 and EMRSA-16. J Med Microbiol 51:516-21.

175. Moreillon, P., J. M. Entenza, P.Francioli, D. McDevitt, T. J.Foster, P. Francois, and P.Vaudaux. 1995. Role ofStaphylococcus aureus coagulaseand clumping factor inpathogenesis of experimentalendocarditis. Infect Immun63:4738-43.

176. Moreno, F., C. Crisp, J. H.Jorgensen, and J. E. Patterson.1995. Methicillin-resistantStaphylococcus aureus as acommunity organism. Clin InfectDis 21:1308-12.

177. Morfeldt, E., D. Taylor, A. vonGabain, and S. Arvidson. 1995.Activation of alpha-toxintranslation in Staphylococcusaureus by the trans-encodedantisense RNA, RNAIII. Embo J14:4569-77.

178. Mortensen, J. E., T. R. Shryock,and F. A. Kapral. 1992.Modification of bactericidal fattyacids by an enzyme ofStaphylococcus aureus. J MedMicrobiol 36:293-8.

179. Morton, T. M., J. L. Johnston, J.Patterson, and G. L. Archer.1995. Characterization of aconjugative staphylococcalmupirocin resistance plasmid.Antimicrob Agents Chemother39:1272-80.

180. Muller, E., S. Takeda, H. Shiro, D.Goldmann, and G. B. Pier. 1993.Occurrence of capsularpolysaccharide/adhesin amongclinical isolates of coagulase-negative staphylococci. J InfectDis 168:1211-8.

181. Murakami, K., T. Fujimura, andM. Doi. 1994. Nucleotidesequence of the structural gene forthe penicillin-binding protein 2 ofStaphylococcus aureus and thepresence of a homologous gene inother staphylococci. FEMSMicrobiol Lett 117:131-6.

182. Murakami, K., W. Minamide, K.Wada, E. Nakamura, H.Teraoka, and S. Watanabe. 1991.Identification of methicillin-resistant strains of staphylococciby polymerase chain reaction. JClin Microbiol 29:2240-4.

183. Musser, J. M., and V. Kapur. 1992.Clonal analysis of methicillin-resistant Staphylococcus aureusstrains from intercontinentalsources: association of the mecgene with divergent phylogeneticlineages implies dissemination byhorizontal transfer andrecombination. J Clin Microbiol30:2058-63.

184. Mylotte, J. M., S. Goodnough, andA. Tayara. 2001. Antibiotic-resistant organisms among long-term care facility residents on

79

admission to an inpatient geriatricsunit: Retrospective andprospective surveillance. Am JInfect Control 29:139-44.

185. Nahvi, M. D., J. E. Fitzgibbon, J.F. John, and D. T. Dubin. 2001.Sequence analysis of dru regionsfrom methicillin-resistantStaphylococcus aureus andcoagulase-negative staphylococcalisolates. Microb Drug Resist 7:1-12.

186. Namnyak, S., Z. Adhami, M.Wilmore, H. Keynes, K.Hampton, E. Mercieca, and K.Roker. 1998. Methicillin-resistantStaphylococcus aureus: aquestionnaire and microbiologicalsurvey of nursing and residentialhomes in Barking, Havering andBrentwood. J Infect 36:67-72.

187. NCCLS. 1997. Methods for dilutionantimicrobial susceptibility testsfor bacteria that grow aerobicallyApproved Standard M7-A4.National Committee forLaboratory Standards.

188. NCCLS. 1997. Performancestandards for disc antimicrobialsusceptibility tests ApprovedStandard M2-A6. NationalCommittee for LaboratoryStandards.

189. Ng, E. Y., M. Trucksis, and D. C.Hooper. 1994. Quinoloneresistance mediated by norA:physiologic characterization andrelationship to flqB, a quinoloneresistance locus on theStaphylococcus aureuschromosome. Antimicrob AgentsChemother 38:1345-55.

190. Nichols, R. L. 1998. Postoperativeinfections in the age of drug-resistant gram-positive bacteria.Am J Med 104:11S-16S.

191. Nishi, J., H. Miyanohara, T.Nakajima, I. Kitajima, M.Yoshinaga, I. Maruyama, and K.

Miyata. 1995. Molecular typingof the methicillin resistancedeterminant (mec) of clinicalstrains of Staphylococcus based onmec hypervariable region lengthpolymorphisms. J Lab Clin Med126:29-35.

192. Nouwen, J. L., A. van Belkum,and H. A. Verbrugh. 2001.Determinants of Staphylococcusaureus nasal carriage. Neth J Med59:126-33.

193. Novick, R. P. 2000. pathogenicityfactors and their regulation, p.392-407. In V. A. Fischetti, R. P.Novick, J. Ferretti, D. Portnoy,and J. Rood (ed.), Gram-positivepathogens. ASM Press,Washington D.C.

194. Novick, R. P., S. J. Projan, J.Kornblum, H. F. Ross, G. Ji, B.Kreiswirth, F. Vandenesch, andS. Moghazeh. 1995. The agr P2operon: an autocatalytic sensorytransduction system inStaphylococcus aureus. Mol GenGenet 248:446-58.

195. Novick, R. P., H. F. Ross, S. J.Projan, J. Kornblum, B.Kreiswirth, and S. Moghazeh.1993. Synthesis of staphylococcalvirulence factors is controlled by aregulatory RNA molecule. Embo J12:3967-75.

196. Ogawa, S. K., E. R. Yurberg, V. B.Hatcher, M. A. Levitt, and F. D.Lowy. 1985. Bacterial adherenceto human endothelial cells in vitro.Infect Immun 50:218-24.

197. Oliveira, D. C., and H. LencastreHd. 2002. Multiplex PCR Strategyfor Rapid Identification ofStructural Types and Variants ofthe mec Element in Methicillin-Resistant Staphylococcus aureus.Antimicrob Agents Chemother46:2155-61.

198. Oliveira, D. C., A. Tomasz, and H.de Lencastre. 2001. The evolution

80

of pandemic clones of methicillin-resistant Staphylococcus aureus:identification of two ancestralgenetic backgrounds and theassociated mec elements. MicrobDrug Resist 7:349-61.

199. Oliveira, D. C., A. Tomasz, and H.de Lencastre. 2002. Secrets ofsuccess of a human pathogen:molecular evolution of pandemicclones of meticillin-resistantStaphylococcus aureus. LancetInfect Dis 2:180-9.

200. Oliveira, D. C., S. W. Wu, and H.de Lencastre. 2000. Geneticorganization of the downstreamregion of the mecA element inmethicillin-resistantStaphylococcus aureus isolatescarrying different polymorphismsof this region. Antimicrob AgentsChemother 44:1906-10.

201. Olmos, A., J. J. Camarena, J. M.Nogueira, J. C. Navarro, J.Risen, and R. Sanchez. 1998.Application of an optimized andhighly discriminatory methodbased on arbitrarily primed PCRfor epidemiologic analysis ofmethicillin-resistantStaphylococcus aureus nosocomialinfections. J Clin Microbiol36:1128-34.

202. Ornelas-Soares, A., H. deLencastre, B. L. de Jonge, andA. Tomasz. 1994. Reducedmethicillin resistance in a newStaphylococcus aureus transposonmutant that incorporates muramyldipeptides into the cell wallpeptidoglycan. J Biol Chem269:27246-50.

203. O’Sullivan, N. P., and C. T. Keane.2000. Risk factors for colonizationwith methicillin-resistantStaphylococcus aureus amongnursing home residents. J HospInfect 45:206-10.

204. O’Sullivan, N. R., and C. T.Keane. 2000. The prevalence ofmethicillin-resistantStaphylococcus aureus among theresidents of six nursing homes forthe elderly. J Hosp Infect 45:322-9.

205. Panlilio, A. L., D. H. Culver, R. P.Gaynes, S. Banerjee, T. S.Henderson, J. S. Tolson, and W.J. Martone. 1992. Methicillin-resistant Staphylococcus aureus inU.S. hospitals, 1975-1991. InfectControl Hosp Epidemiol 13:582-6.

206. Papakyriacou, H., D. Vaz, A.Simor, M. Louie, and M. J.McGavin. 2000. Molecularanalysis of the accessory generegulator (agr) locus and balanceof virulence factor expression inepidemic methicillin-resistantStaphylococcus aureus. J InfectDis 181:990-1000.

207. Parker, M. 1972. Phage-typing ofStaphylococcus aureus, vol. 7B.Academic Press, London.

208. Parker, M. 1983. The significanceof phage-typing in Staphylococcusaureus. Academic Press, London.

209. Patel, A. H., T. J. Foster, and P. A.Pattee. 1989. Physical and geneticmapping of the protein A gene inthe chromosome ofStaphylococcus aureus 8325-4. JGen Microbiol 135:1799-807.

210. Pattee, H., H.-C. Lee, and J.Bannantine. 1990. Genetic andphysical mapping ofStaphylococcus aureus, p. 41-58.In R. P. Novick (ed.), Molecularbiology of staphylococci. VHC,New York.

211. Pattee, P. A., and D. S. Neveln.1975. Transformation analysis ofthree linkage groups inStaphylococcus aureus. J Bacteriol124:201-11.

212. Patti, J. M., B. L. Allen, M. J.McGavin, and M. Hook. 1994.

81

MSCRAMM-mediated adherenceof microorganisms to host tissues.Annu Rev Microbiol 48:585-617.

213. Perl, T. M., and M. C. Roy. 1995.Postoperative wound infections:risk factors and role ofStaphylococcus aureus nasalcarriage. J Chemother 7:29-35.

214. Petinaki, E., A. Arvaniti, G.Dimitracopoulos, and I.Spiliopoulou. 2001. Detection ofmecA, mecR1 and mecI genesamong clinical isolates ofmethicillin-resistant staphylococciby combined polymerase chainreactions. J Antimicrob Chemother47:297-304.

215. Pinho, M. G., H. de Lencastre,and A. Tomasz. 2001. Anacquired and a native penicillin-binding protein cooperate inbuilding the cell wall of drug-resistant staphylococci. Proc NatlAcad Sci U S A 98:10886-91.

216. Pinho, M. G., A. M. Ludovice, S.Wu, and H. De Lencastre. 1997.Massive reduction in methicillinresistance by transposoninactivation of the normal PBP2 ina methicillin-resistant strain ofStaphylococcus aureus. MicrobDrug Resist 3:409-13.

217. Piriz Duran, S., F. H. Kayser, andB. Berger-Bachi. 1996. Impact ofsar and agr on methicillinresistance in Staphylococcusaureus. FEMS Microbiol Lett141:255-60.

218. Pitcher, D., N. Saunders, and R.Owen. 1989. Rapid extraction ofbacterial genomic DNAwithguanidiumthiocyanate. Letters inApplied Microbiology 8:151-156.

219. Ploy, M. C., C. Grelaud, C.Martin, L. de Lumley, and F.Denis. 1998. First clinical isolateof vancomycin-intermediateStaphylococcus aureus in a Frenchhospital. Lancet 351:1212.

220. Popescu, A., and R. J. Doyle. 1996.The Gram stain after more than acentury. Biotech Histochem71:145-51.

221. Popovic, T., I. K. Mazurova, A.Efstratiou, J. Vuopio-Varkila,M. W. Reeves, A. De Zoysa, T.Glushkevich, and P. Grimont.2000. Molecular epidemiology ofdiphtheria. J Infect Dis 181:S168-77.

222. Proctor, R. A., P. van Langevelde,M. Kristjansson, J. N. Maslow,and R. D. Arbeit. 1995. Persistentand relapsing infections associatedwith small-colony variants ofStaphylococcus aureus. Clin InfectDis 20:95-102.

223. Projan, S. J., and R. P. Novick.1997. The Molecular Basis ofpathogenicity, p. 55-81. In K.Crossley and G. Archer (ed.), Thestaphylococci in human disease.Churchill publications, new York.

224. Prokesova, L., B. Potuznikova, J.Potempa, J. Zikan, J. Radl, L.Hachova, K. Baran, Z. Porwit-Bobr, and C. John. 1992.Cleavage of humanimmunoglobulins by serineproteinase from Staphylococcusaureus. Immunol Lett 31:259-65.

225. Pujol, M., C. Pena, R. Pallares, J.Ayats, J. Ariza, and F. Gudiol.1994. Risk factors for nosocomialbacteremia due to methicillin-resistant Staphylococcus aureus.Eur J Clin Microbiol Infect Dis13:96-102.

226. Rampone, H., G. L. Martinez, A.T. Giraudo, A. Calzolari, and R.Nagel. 1996. In vivo expression ofexoprotein synthesis with a Saemutant of Staphylococcus aureus.Can J Vet Res 60:237-40.

227. Reagan, D. R., B. N. Doebbeling,M. A. Pfaller, C. T. Sheetz, A. K.Houston, R. J. Hollis, and R. P.Wenzel. 1991. Elimination of

82

coincident Staphylococcus aureusnasal and hand carriage withintranasal application of mupirocincalcium ointment. Ann Intern Med114:101-6.

228. Reynolds, P. E. 1986. Methicillin-resistant strains of Staphylococcusaureus; presence of identicaladditional penicillin-bindingprotein in all strains examined.FEMS Microbiology Letters33:251-254.

229. Roberts, R. B., A. de Lencastre,W. Eisner, E. P. Severina, B.Shopsin, B. N. Kreiswirth, andA. Tomasz. 1998. Molecularepidemiology of methicillin-resistant Staphylococcus aureus in12 New York hospitals. MRSACollaborative Study Group. JInfect Dis 178:164-71.

230. Rohrer, S., K. Ehlert, M.Tschierske, H. Labischinski, andB. Berger-Bachi. 1999. Theessential Staphylococcus aureusgene fmhB is involved in the firststep of peptidoglycan pentaglycineinterpeptide formation. Proc NatlAcad Sci U S A 96:9351-6.

231. Rossney, A. S., D. C. Coleman,and C. T. Keane. 1994.Evaluation of an antibiogram-resistogram typing scheme formethicillin-resistantStaphylococcus aureus. J MedMicrobiol 41:441-7.

232. Rotun, S. S., V. McMath, D. J.Schoonmaker, P. S. Maupin, F.C. Tenover, B. C. Hill, and D. M.Ackman. 1999. Staphylococcusaureus with reduced susceptibilityto vancomycin isolated from apatient with fatal bacteremia.Emerg Infect Dis 5:147-9.

233. Ryffel, C., R. Bucher, F. H. Kayser,and B. Berger-Bachi. 1991. TheStaphylococcus aureus mecdeterminant comprises an unusualcluster of direct repeats and codes

for a gene product similar to theEscherichia coli sn-glycerophosphoryl diesterphosphodiesterase. J Bacteriol173:7416-22.

234. Ryffel, C., A. Strassle, F. H.Kayser, and B. Berger-Bachi.1994. Mechanisms ofheteroresistance in methicillin-resistant Staphylococcus aureus.Antimicrob Agents Chemother38:724-8.

235. Sabath, L. D. 1977. Chemical andphysical factors influencingmethicillin resistance ofStaphylococcus aureus andStaphylococcus epidermidis. JAntimicrob Chemother 3:47-51.

236. Safdar, N., and D. G. Maki. 2002.The commonality of risk factorsfor nosocomial colonization andinfection with antimicrobial-resistant Staphylococcus aureus,enterococcus, gram-negativebacilli, Clostridium difficile, andCandida. Ann Intern Med136:834-44.

237. Sa-Leao, R., I. S. Sanches, I.Couto, C. R. Alves, and H. deLencastre. 2001. Low prevalenceof methicillin-resistant strainsamong Staphylococcus aureuscolonizing young and healthymembers of the community inPortugal. Microb Drug Resist7:237-45.

238. Samad, A., D. Banerjee, N.Carbarns, and S. Ghosh. 2002.Prevalence of methicillin-resistantStaphylococcus aureuscolonization in surgical patients,on admission to a Welsh hospital.J Hosp Infect 51:43-6.

239. Saravolatz, L. D., D. J. Pohlod,and L. M. Arking. 1982.Community-acquired methicillin-resistant Staphylococcus aureusinfections: a new source for

83

nosocomial outbreaks. Ann InternMed 97:325-9.

240. Savolainen, K., L. Paulin, B.Westerlund-Wikstrom, T. J.Foster, T. K. Korhonen, and P.Kuusela. 2001. Expression of pls,a gene closely associated with themecA gene of methicillin-resistantStaphylococcus aureus, preventsbacterial adhesion in vitro. InfectImmun 69:3013-20.

241. Schmitz, F. J., A. C. Fluit, E.Lindenlauf, S. Scheuring, and K.Kohrer. 2000. Molecular analysesof possible mechanisms coding forlow-level mupirocin resistance inclinical Staphylococcus aureusisolates. Eur J Clin MicrobiolInfect Dis 19:649-50.

242. Schmitz, F. J., M. Steiert, H. V.Tichy, B. Hofmann, J. Verhoef,H. P. Heinz, K. Kohrer, and M.E. Jones. 1998. Typing ofmethicillin-resistantStaphylococcus aureus isolatesfrom Dusseldorf by six genotypicmethods. J Med Microbiol 47:341-51.

243. Schwartz, D. C., and C. R. Cantor.1984. Separation of yeastchromosome-sized DNAs bypulsed field gradient gelelectrophoresis. Cell 37:67-75.

244. Seki, K., J. Sakurada, M. Murai,A. Usui, H. K. Seong, H.Jitsukawa, and S. Masuda. 1995.Auxiliary method for clonalidentification of Staphylococcusaureus by protein band pattern ofreleased proteins on SDS-polyacrylamide gel. MicrobiolImmunol 39:615-7.

245. Selander, R. K., D. A. Caugant, H.Ochman, J. M. Musser, M. N.Gilmour, and T. S. Whittam.1986. Methods of multilocusenzyme electrophoresis forbacterial population genetics and

systematics. Appl EnvironMicrobiol 51:873-84.

246. Senna, J. P., C. A. Pinto, L. P.Carvalho, and D. S. Santos.2002. Comparison of Pulsed-FieldGel Electrophoresis and PCRAnalysis of Polymorphisms on themec Hypervariable Region forTyping Methicillin-ResistantStaphylococcus aureus. J ClinMicrobiol 40:2254-6.

247. Shands, K. N., G. P. Schmid, B. B.Dan, D. Blum, R. J. Guidotti, N.T. Hargrett, R. L. Anderson, D.L. Hill, C. V. Broome, J. D.Band, and D. W. Fraser. 1980.Toxic-shock syndrome inmenstruating women: associationwith tampon use andStaphylococcus aureus andclinical features in 52 cases. NEngl J Med 303:1436-42.

248. Sharma, V. K., C. J. Hackbarth, T.M. Dickinson, and G. L. Archer.1998. Interaction of native andmutant MecI repressors withsequences that regulate mecA, thegene encoding penicillin bindingprotein 2a in methicillin-resistantstaphylococci. J Bacteriol180:2160-6.

249. Shopsin, B., B. Mathema, X. Zhao,J. Martinez, J. Kornblum, andB. N. Kreiswirth. 2000.Resistance rather than virulenceselects for the clonal spread ofmethicillin-resistantStaphylococcus aureus:implications for MRSAtransmission. Microb Drug Resist6:239-44.

250. Siboo, I. R., A. L. Cheung, A. S.Bayer, and P. M. Sullam. 2001.Clumping factor A mediatesbinding of Staphylococcus aureusto human platelets. Infect Immun69:3120-7.

251. Simor, A. E., M. Ofner-Agostini,E. Bryce, K. Green, A. McGeer,

84

M. Mulvey, and S. Paton. 2001.The evolution of methicillin-resistant Staphylococcus aureus inCanadian hospitals: 5 years ofnational surveillance. CMAJ165:21-6.

252. Sinha, B., P. Francois, Y. A. Que,M. Hussain, C. Heilmann, P.Moreillon, D. Lew, K. H.Krause, G. Peters, and M.Herrmann. 2000. Heterologouslyexpressed Staphylococcus aureusfibronectin-binding proteins aresufficient for invasion of hostcells. Infect Immun 68:6871-8.

253. Smith, T. L., M. L. Pearson, K. R.Wilcox, C. Cruz, M. V.Lancaster, B. Robinson-Dunn, F.C. Tenover, M. J. Zervos, J. D.Band, E. White, and W. R.Jarvis. 1999. Emergence ofvancomycin resistance inStaphylococcus aureus.Glycopeptide-IntermediateStaphylococcus aureus WorkingGroup. N Engl J Med 340:493-501.

254. Solberg, C. O. 2000. Spread ofStaphylococcus aureus inhospitals: causes and prevention.Scand J Infect Dis 32:587-95.

255. Song, M. D., M. Wachi, M. Doi, F.Ishino, and M. Matsuhashi.1987. Evolution of an induciblepenicillin-target protein inmethicillin-resistantStaphylococcus aureus by genefusion. FEBS Lett 221:167-71.

256. Stranden, A. M., K. Ehlert, H.Labischinski, and B. Berger-Bachi. 1997. Cell wallmonoglycine cross-bridges andmethicillin hypersusceptibility in afemAB null mutant of methicillin-resistant Staphylococcus aureus. JBacteriol 179:9-16.

257. Stranden, A. M., M. Roos, and B.Berger-Bachi. 1996. Glutaminesynthetase and heteroresistance in

methicillin-resistantStaphylococcus aureus. MicrobDrug Resist 2:201-7.

258. Struelens, M. J., and R. Mertens.1994. National survey ofmethicillin-resistantStaphylococcus aureus in Belgianhospitals: detection methods,prevalence trends and infectioncontrol measures. TheGroupement pour le Depistage,l’Etude et la Prevention desInfections Hospitalieres. Eur JClin Microbiol Infect Dis 13:56-63.

259. Suntharam, N., D. Hacek, and L.R. Peterson. 2001. LowPrevalence of Community-Acquired Methicillin-ResistantStaphylococcus aureus in Adultsat a University Hospital in theCentral United States. J ClinMicrobiol 39:1669-71.

260. Suzuki, E., K. Kuwahara-Arai, J.F. Richardson, and K.Hiramatsu. 1993. Distribution ofmec regulator genes in methicillin-resistant Staphylococcus clinicalstrains. Antimicrob AgentsChemother 37:1219-26.

261. Tenover, F. C., R. Arbeit, G.Archer, J. Biddle, S. Byrne, R.Goering, G. Hancock, G. A.Hebert, B. Hill, R. Hollis, and etal. 1994. Comparison oftraditional and molecular methodsof typing isolates ofStaphylococcus aureus. J ClinMicrobiol 32:407-15.

262. Tenover, F. C., R. D. Arbeit, R. V.Goering, P. A. Mickelsen, B. E.Murray, D. H. Persing, and B.Swaminathan. 1995. Interpretingchromosomal DNA restrictionpatterns produced by pulsed-fieldgel electrophoresis: criteria forbacterial strain typing. J ClinMicrobiol 33:2233-9.

85

263. Tesch, W., C. Ryffel, A. Strassle, F.H. Kayser, and B. Berger-Bachi.1990. Evidence of a novelstaphylococcal mec-encodedelement (mecR) controllingexpression of penicillin-bindingprotein 2'. Antimicrob AgentsChemother 34:1703-6.

264. Thakker, M., J. S. Park, V. Carey,and J. C. Lee. 1998.Staphylococcus aureus serotype 5capsular polysaccharide isantiphagocytic and enhancesbacterial virulence in a murinebacteremia model. Infect Immun66:5183-9.

265. Thakker-Varia, S., W. D. Jenssen,L. Moon-McDermott, M. P.Weinstein, and D. T. Dubin.1987. Molecular epidemiology ofmacrolides-lincosamides-streptogramin B resistance inStaphylococcus aureus andcoagulase-negative staphylococci.Antimicrob Agents Chemother31:735-43.

266. Thanh, T., and C. Y. Lee. 2002.Overproduction of type 8 capsularpolysaccharide augmentsStaphylococcus aureus virulence.Infection and Immunity 70:3389-3395.

267. Thevanesam, V., W. L.Wijeyawardana, and E. W.Ekanayake. 1994. Methicillinresistant Staphylococcus aureus:the scale of the problem in a ShriLankan hospital. J Hosp Infect26:123-7.

268. Todd, J., M. Fishaut, F. Kapral,and T. Welch. 1978. Toxic-shocksyndrome associated with phage-group-I Staphylococci. Lancet2:1116-8.

269. Tomasz, A., H. B. Drugeon, H. M.de Lencastre, D. Jabes, L.McDougall, and J. Bille. 1989.New mechanism for methicillinresistance in Staphylococcus

aureus: clinical isolates that lackthe PBP 2a gene and containnormal penicillin-binding proteinswith modified penicillin-bindingcapacity. Antimicrob AgentsChemother 33:1869-74.

270. Townsend, D. E., N. Ashdown, J.M. Bradley, J. W. Pearman, andW. B. Grubb. 1984. “Australian”methicillin-resistantStaphylococcus aureus in aLondon hospital? Med J Aust141:339-40.

271. Trick, W. E., R. A. Weinstein, P. L.DeMarais, M. J. Kuehnert, W.Tomaska, C. Nathan, T. W. Rice,S. K. McAllister, L. A. Carson,and W. R. Jarvis. 2001.Colonization of skilled-carefacility residents withantimicrobial-resistant pathogens.J Am Geriatr Soc 49:270-6.

272. Turnidge, J. D., and J. M. Bell.2000. Methicillin-resistantStaphylococcal aureus evolutionin Australia over 35 years. MicrobDrug Resist 6:223-9.

273. Tyler, K. D., G. Wang, S. D. Tyler,and W. M. Johnson. 1997.Factors affecting reliability andreproducibility of amplification-based DNA fingerprinting ofrepresentative bacterial pathogens.J Clin Microbiol 35:339-46.

274. Ubukata, K., R. Nonoguchi, M. D.Song, M. Matsuhashi, and M.Konno. 1990. Homology of mecAgene in methicillin-resistantStaphylococcus haemolyticus andStaphylococcus simulans to that ofStaphylococcus aureus.Antimicrob Agents Chemother34:170-2.

275. Ubukata, K., N. Yamashita, andM. Konno. 1985. Occurrence of abeta-lactam-inducible penicillin-binding protein in methicillin-resistant staphylococci.

86

Antimicrob Agents Chemother27:851-7.

276. Udo, E. E., L. E. Jacob, and B.Mathew. 2001. Genetic analysisof methicillin-resistantStaphylococcus aureus expressinghigh- and low-level mupirocinresistance. J Med Microbiol50:909-15.

277. Uhlen, M., B. Guss, B. Nilsson, S.Gatenbeck, L. Philipson, and M.Lindberg. 1984. Completesequence of the staphylococcalgene encoding protein A. A geneevolved through multipleduplications. J Biol Chem259:1695-702.

278. van Belkum, A. 2000. Molecularepidemiology of methicillin-resistant Staphylococcus aureusstrains: state of affairs andtomorrow’ s possibilities. MicrobDrug Resist 6:173-88.

279. Van Belkum, A., N. H. RiewartsEriksen, M. Sijmons, W. VanLeeuwen, M. Van den Bergh, J.Kluytmans, F. Espersen, and H.Verbrugh. 1997. Coagulase andprotein A polymorphisms do notcontribute to persistence of nasalcolonisation by Staphylococcusaureus. J Med Microbiol 46:222-32.

280. van Belkum, A., N. RiewertsEriksen, M. Sijmons, W. vanLeeuwen, M. VandenBergh, J.Kluytmans, F. Espersen, and H.Verbrugh. 1996. Are variablerepeats in the spa gene suitabletargets for epidemiological studiesof methicillin-resistantStaphylococcus aureus strains?Eur J Clin Microbiol Infect Dis15:768-70.

281. van Belkum, A., W. van Leeuwen,M. E. Kaufmann, B. Cookson, F.Forey, J. Etienne, R. Goering, F.Tenover, C. Steward, F. O’Brien,W. Grubb, P. Tassios, N.

Legakis, A. Morvan, N. El Solh,R. de Ryck, M. Struelens, S.Salmenlinna, J. Vuopio-Varkila,M. Kooistra, A. Talens, W.Witte, and H. Verbrugh. 1998.Assessment of resolution andintercenter reproducibility ofresults of genotypingStaphylococcus aureus by pulsed-field gel electrophoresis of SmaImacrorestriction fragments: amulticenter study. J Clin Microbiol36:1653-9.

282. van Belkum, A., W. van Leeuwen,R. Verkooyen, S. C. Sacilik, C.Cokmus, and H. Verbrugh.1997. Dissemination of a singleclone of methicillin-resistantStaphylococcus aureus amongTurkish hospitals. J Clin Microbiol35:978-81.

283. van Leeuwen, N. 2002. Binarytyping of Staphyloccus aureus.Erasmus university, Rotterdam.

284. van Leeuwen, W., C. Libregts, M.Schalk, J. Veuskens, H.Verbrugh, and A. van Belkum.2001. Binary typing ofStaphylococcus aureus strainsthrough reversed hybridizationusing digoxigenin-universallinkage system-labeled bacterialgenomic DNA. J Clin Microbiol39:328-31.

285. van Leeuwen, W., M. Sijmons, J.Sluijs, H. Verbrugh, and A. vanBelkum. 1996. On the nature anduse of randomly amplified DNAfrom Staphylococcus aureus. JClin Microbiol 34:2770-7.

286. van Leeuwen, W., A. van Belkum,B. Kreiswirth, and H. Verbrugh.1998. Genetic diversification ofmethicillin-resistantStaphylococcus aureus as afunction of prolonged geographicdissemination and as measured bybinary typing and other

87

genotyping methods. ResMicrobiol 149:497-507.

287. van Wely, K. H., J. Swaving, R.Freudl, and A. J. Driessen. 2001.Translocation of proteins acrossthe cell envelope of Gram-positivebacteria. FEMS Microbiol Rev25:437-54.

288. Verdrengh, M., and A. Tarkowski.1997. Role of neutrophils inexperimental septicemia and septicarthritis induced byStaphylococcus aureus. InfectImmun 65:2517-21.

289. Verhoef, J., D. Beaujean, H. Blok,A. Baars, A. Meyler, C. van derWerken, and A. Weersink. 1999.A Dutch approach to methicillin-resistant Staphylococcus aureus.Eur J Clin Microbiol Infect Dis18:461-6.

290. von Eiff, C., K. Becker, K.Machka, H. Stammer, and G.Peters. 2001. Nasal carriage as asource of Staphylococcus aureusbacteremia. Study Group. N Engl JMed 344:11-6.

291. von Eiff, C., C. Heilmann, R. A.Proctor, C. Woltz, G. Peters, andF. Gotz. 1997. A site-directedStaphylococcus aureus hemBmutant is a small-colony variantwhich persists intracellularly. JBacteriol 179:4706-12.

292. Vos, P., R. Hogers, M. Bleeker, M.Reijans, T. van de Lee, M.Hornes, A. Frijters, J. Pot, J.Peleman, M. Kuiper, and et al.1995. AFLP: a new technique forDNA fingerprinting. NucleicAcids Res 23:4407-14.

293. Voss, A., D. Milatovic, C.Wallrauch-Schwarz, V. T.Rosdahl, and I. Braveny. 1994.Methicillin-resistantStaphylococcus aureus in Europe.Eur J Clin Microbiol Infect Dis13:50-5.

294. Vuopio-Varkila, J., P. Kotilainen,P. Kujala, J. Lumio, M. Ristola,K. Sammalkorpi, and L.Tiittanen. 1995. OhjemetisilliiniresistenttienStaphylococcus aureustentorjunnasta C1/1995.Kansanterveyslaitos.

295. Wada, A., H. Ohta, K. Kulthanan,and K. Hiramatsu. 1993.Molecular cloning and mapping of16S-23S rRNA gene complexes ofStaphylococcus aureus. J Bacteriol175:7483-7.

296. Wagenvoort, J. H., W. Sluijsmans,and R. J. Penders. 2000. Betterenvironmental survival ofoutbreak vs. sporadic MRSAisolates. J Hosp Infect 45:231-4.

297. Waldvogel, F. A. 2000.Staphylococcus aureus (includingstaphylococcal toxic shock), p.2069-2092. In G. Mandell, J.Bennett, and R. Dolin (ed.),Principles and practise ofinfectious diseaseases, vol. 2.Churchill Livingstone,Philadelphia.

298. Waldvogel, F. A., and P. S.Papageorgiou. 1980.Osteomyelitis: the past decade. NEngl J Med 303:360-70.

299. Waxman, D. J., and J. L.Strominger. 1983. Penicillin-binding proteins and themechanism of action of beta-lactam antibiotics. Annu RevBiochem 52:825-69.

300. Wehrli, W. 1983. Rifampin:mechanisms of action andresistance. Rev Infect Dis 5:S407-11.

301. Weinstein, M. P., M. L. Towns, S.M. Quartey, S. Mirrett, L. G.Reimer, G. Parmigiani, and L.B. Reller. 1997. The clinicalsignificance of positive bloodcultures in the 1990s: aprospective comprehensive

88

evaluation of the microbiology,epidemiology, and outcome ofbacteremia and fungemia in adults.Clin Infect Dis 24:584-602.

302. Weist, K., K. Pollege, I. Schulz, H.Ruden, and P. Gastmeier. 2002.How many nosocomial infectionsare associated with cross-transmission? A prospectivecohort study in a surgical intensivecare unit. Infect Control HospEpidemiol 23:127-32.

303. Westh, H., J. O. Jarlov, H.Kjersem, and V. T. Rosdahl.1992. The disappearance ofmultiresistant Staphylococcusaureus in Denmark: changes instrains of the 83A complexbetween 1969 and 1989. ClinInfect Dis 14:1186-94.

304. Wieneke, A. A., D. Roberts, andR. J. Gilbert. 1993.Staphylococcal food poisoning inthe United Kingdom, 1969-90.Epidemiol Infect 110:519-31.

305. Witte, W., C. Braulke, D. Heuck,and C. Cuny. 2000. Methicillin-resistant Staphylococcus aureus inGerman hospitals developnarrower patterns of antimicrobialresistance. Eurosurveillance 5:31-34.

306. Witte, W., C. Cuny, C. Braulke, D.Heuck, and I. Klare. 1997.Widespread dissemination ofepidemic MRSA in Germanhospitals. Eurosurveillance 2:25-29.

307. Witte, W., M. Kresken, C.Braulke, and C. Cuny. 1997.Increasing incidence andwidespread dissemination ofmethicillin-resistantStaphylococcus aureus (MRSA) inhospitals in central Europe, withspecial reference to Germanhospitals. Clin Microbiol Infect3:414-422.

308. Witte, W., G. Werner, and C.Cuny. 2001. Subtyping of MRSAisolates belonging to a widelydisseminated clonal group bypolymorphism of the drusequences in mec-associated DNA.Int J Med Microbiol 291:57-62.

309. Wu, S., C. Piscitelli, H. deLencastre, and A. Tomasz. 1996.Tracking the evolutionary originof the methicillin resistance gene:cloning and sequencing of ahomologue of mecA from amethicillin susceptible strain ofStaphylococcus sciuri. MicrobDrug Resist 2:435-41.

310. Yarwood, J. M., J. K. McCormick,and P. M. Schlievert. 2001.Identification of a novel two-component regulatory system thatacts in global regulation ofvirulence factors ofStaphylococcus aureus. J Bacteriol183:1113-23.

89

10. ORIGINAL PUBLICATIONS