Fish & Shellfish Immunology 20 (2006) 438e449

www.elsevier.com/locate/fsi

Molecular cloning and characterisation of cytosolicmanganese superoxide dismutase (cytMn-SOD) from the

giant freshwater prawn Macrobrachium rosenbergii

Winton Cheng a, Ying-Hsiu Tung a, Chun-Hung Liu b, Jiann-Chu Chen b,*

a Department of Aquaculture, National Pingtung University of Science and Technology, Pingtung 912, Taiwan, ROCb Department of Aquaculture, College of Life and Resource Sciences, National Taiwan Ocean University,

Keelung 202, Taiwan, ROC

Received 1 April 2005; revised 3 May 2005; accepted 30 May 2005

Available online 8 September 2005

Abstract

A cytosolic manganese superoxide dismutase (cytMn-SOD) cDNA was cloned from the hepatopancreas of giantfreshwater prawn Macrobrachium rosenbergii using reverse transcription polymerase chain reaction (RT-PCR) by

degenerate primers. Both 3#- and 5#-regions were isolated by rapid amplification of cDNA end RACE method. Analysisof nucleotide sequence revealed that the cytMn-SOD cDNA clone consists of 1339 bp with an open reading frame of858 bp encoding a protein of 286 amino acids. The calculated molecular mass of the mature proteins (286 amino acids)is 31 kDa with an estimated pI of 5.52. Two putative N-glycosylation sites, NXT and NXS were observed in the cytMn-

SOD. Four conserved amino acids responsible for binding manganese were observed (H110, H158, D243 and H247).Sequence comparison showed that the cytMn-SOD deduced amino acid sequence of M. rosenbergii has an overallsimilarity of 77% and 54% to that of blue crab Callinectes sapidus and tiger shrimp Penaeus monodon, respectively.

Quantitative real-time RT-PCR analysis showed that cytMn-SOD transcript in hepatopancreas of M. rosenbergiidecreased 3 h after Lactococcus garvieae injection, but no significant change in cytMn-SOD transcript was observed inthe haemocytes 3e24 h after L. garvieae injection.

� 2005 Elsevier Ltd. All rights reserved.

Keywords: Cytosolic manganese superoxide dismutase (cytMn-SOD); Macrobrachium rosenbergii; Haemocyte; Hepatopancreas; Real-

time RT-PCR; Lactococcus garvieae injection

* Corresponding author. Tel./fax: C886 2 2462 0295.

E-mail address: jcchen@mail.ntou.edu.tw (J.-C. Chen).

1050-4648/$ - see front matter � 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.fsi.2005.05.016

439W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

1. Introduction

The giant freshwater prawn Macrobrachium rosenbergii is commercially important as an inland culturedspecies in many parts of the world [1]. Disease outbreaks caused by yeasts like Debaryomyces hansenii andCandida sake in the cool season [2,3] and bacteria like Lactococcus garvieae in the hot season [4,5] haveresulted in declined production of farmed prawns in Taiwan since 1992. Experimental injection ofL. garvieae into the ventral sinus of prawn has been documented to cause mortality, and induce muscularnecrosis similar to those observed in the naturally infected prawns [4]. It is known that in M. rosenbergiiexposed to high pH and high temperature there is decreased total haemocyte count and phenoloxidaseactivity, and increased susceptibility to L. garvieae infection [6,7]. It is also known that in M. rosenbergiiunder the stressors of therapeutants like copper sulfate, benzalkonium chloride and potassiumpermanganate there is decreased phenoloxidase activity, but increased release of superoxide anion [8e10].

In decapod crustaceans, haemocytes are involved in phagocytosis by eliminating microbes or foreignparticles [11,12]. Once a pathogen enters a host, it activates the host’s NADPH-oxidase, which in turnproduces a series of antimicrobial substances including reactive oxygen intermediates (ROIs) such assuperoxide anion (O2

�), hydrogen peroxide (H2O2) and hydroxyl radical (OHc) [13]. Superoxide anion cancause direct or indirect damage to the membrane and DNA [14]. The rapid elimination of ROIs is essentialto the proper functioning and survival of organisms. This is performed by antioxidant defense mechanismsincluding superoxide dismutase (SOD) that scavenges the superoxide anion [15,16].

Superoxide dismutases (SODs) are important antioxidant enzymes that occur in virtually all oxygen-respiring organisms. They are classified into three distinct groups depending on the metal content: ironSOD (Fe-SOD), manganese SOD (Mn-SOD) and copper/zinc SOD (Cu,Zn-SOD) [17]. In decapodcrustaceans, the characterization of SOD and its role in immunomodulation has been reported in shorecrab Carcinus maenas [18], crayfish Pacifastacus leniusculus [19], and blue crab Callinectes sapidus [17,20].

In decapod crustaceans, there are two types of Mn-SOD: cytosolic Mn-SOD (cytMn-SOD) andmitochondrial Mn-SOD (mtMn-SOD). The former has been cloned in tiger shrimp Penaeus monodon(B1784454), kuruma shrimp Marsupenaeus japonicus (BAB85211), brown shrimp Farfantepenaeus aztecus(AY211085), blue crab C. sapidus (AAF74771), grass shrimp Palaemontes pugio (AY211084), andEuropean lobster Palinurus vulgaris (P28765). The latter has been cloned in brown shrimp F. aztecus(AY211086), blue crab C. sapidus (AAF74770) and crab Charybdis feriatus (AAD10640). In addition,Cu,Zn-SOD has been cloned in crayfish P. leniusculus (AAD25400) and blue crab C. sapidus (AAF74772).

A cytMn-SOD with 1176 bp has been cloned from the blue crab C. sapidus hepatopancreas [17]. The aimof the present study was to present the nucleotide sequence of cytMn-SOD from hepatopancreas ofM. rosenbergii, and compare its sequence with other known SOD from other decapod crustaceans, andevaluate this cytMn-SOD expression when M. rosenbergii was injected with L. garvieae.

2. Materials and methods

2.1. Animal

Giant freshwater prawn M. rosenbergii (body weight 15e22 g) obtained from prawn farms in Pingtung,Taiwan, were maintained in recirculating water tanks and fed commercial pellet feed (Shinta FeedCompany, Pingtung, Taiwan) daily for one week.

2.2. Haemocyte collection

Haemolymph (0.5 ml) was withdrawn individually from the ventral sinus cavity of each shrimp intoa 1 ml sterile syringe (25 gauge) containing 0.5 ml of precooled (4 �C) anticoagulant solution (0.80 g sodium

440 W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

citrate, 0.34 g EDTA, 10 ml Tween 80 in 1 L distilled water, then the osmolality was adjusted to490 mOsm kg�1 with glucose). The diluted haemolymph was centrifuged at 500 g at 4 �C for 20 min, andthen used for the total RNA isolation.

2.3. RNA isolation of haemocyte and hepatopancreas and reverse transcription (RT)

Total RNA was isolated and further purified using the guanidinium thiocyanate method described byChomczynski and Sacchi [21]. First-strand cDNA synthesis in RT was performed by using SuperScript IIRNase H� reverse transcriptase (Promega Corporation, Madison, WI, USA) to transcribe poly (A)C RNAwith oligo-d(T)18 as the primers. Reaction conditions recommended by the manufacturer were followed.

2.4. Degenerate primer design and strategy of cytMn-SOD cDNA cloning

Full-length cytMn-SOD cDNA of M. rosenbergii was obtained by the procedures of reversetranscription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE)method. Multiple alignments and phylogenetic comparisons of SOD amino acid sequences of M.rosenbergii with other decapod crustaceans were performed. Degenerate primers were designed based onthe highly conserved nucleotides of SOD of crab C. feriatus (AAD10640), kuruma shrimp M. japonicus(BAB85211), tiger shrimp P. monodon (B1784454), and blue crab C. sapidus [17] using CLUSTAL program[22]. Amplification primers for M. rosenbergii cytMn-SOD are shown in Table 1. Briefly, first fragment ofpartial cytMn-SOD was obtained using primer M1F and M1R, then 5#- and 3#-RACE were performed tomake a full-length cytMn-SOD cDNA.

2.5. PCR and 5#- and 3#-RACE

For 3#-RACE, 3 mg of cDNA was used for PCR reaction. The reaction buffer was 50 mM TriseHClbuffer (pH 9), containing 50 mM KCl, 1% Triton X-100 (Boehringer Mannheim, Germany), 2.5 mMMgCl2, 5 U Taq polymerase, 0.25 mM dNTPs, and 1 mM of each primer. The PCR reactions were

Table 1

Degenerate and specific primers used in the experiment

Name Sequence (5#/ 3#)

M1F CACCACACAAAGCATCACCA

M1R TGGCCACCTCCATTGAACTT

cM1F GGCATATATCAACAACCTTAAAGCAGCAAC

cM2F ACAATGATGTAAATGCCATGAATGC

cM1R TGATGGCAGGTAACAACGCATTCATGGCAT

cM2R CTGTTGCTGCTTTAAGGTTGTTGAT

MnCSP1 GCATATATCAACAACCTTAAAGC

MnCSP2 TCGTTCTTAGGACAGTAGCCAAG

QMnC-F2 TGGACATTGACTCCCCTGTACTG

QMnC-R2 CTAGGTCGCCAATGGTAACGA

AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG

AUAP GGCCACGCGTCGACTAGTAC

PE3#1F CTCCTTGGCTGGACCTTCCTGTG

PE3#2F TATGATCTCGGGGGACAACCCGG

PT1 GTTGCCGACGACGAGCCTACTTTTTTTT

PT2 GTTGCCGACGACGAGCCTAC

b-actinF GAGACCTTCAACACCCCCGC

b-actinR TAGGTGGTCTCGTGGATGCC

441W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

performed with two steps as follows: in the first instance, PCR reaction were performed with 5 cycles ofdenaturation at 94 �C for 1 min, annealing at 45 �C for 1 min, then 25 cycles of denaturation at 94 �C for1 min, annealing at 50 �C for 1 min, and elongation at 72 �C for 2 min, followed by a 7 min extension at72 �C and cooling to 4 �C. For 5#-RACE, 3 mg of total RNA was reverse transcribed with oligo-d(T)18primer as described above. The first-strand cDNA used for 5#-RACE was performed by 5#-RACE system(Cat. 18374-058, Invitrogen, Carlsbad, CA, USA). The first-strand cDNA was tailed at the 5#-end byterminal transferase TdT and dCTP. The primer set consisted of cM1R and Abridged Anchor Primer(AAP) for the first-run PCR, and cM2R and Abridged Universal Amplification Primer (AUAP) for thesecond-run PCR (Fig. 1). The PCR reaction conditions were the same as that described above, except forthe annealing temperature (55 �C) of second-run PCR. For 3#-RACE, the reverse transcription wasperformed by PT1 primer. Two successive PCRs were carried out with the primer cM1F and PT1, andcM2F and PT2 for first and second run, respectively (Table 1). Again, the PCR reaction condition was thesame as that described above.

2.6. Subcloning

The PCR fragments were subjected to electrophoresis on 1.5% agarose gel for length differences, andamplified cDNA fragments were cloned into the pGEM-T Easy vector following the instructions provided(Promega Corporation, Madison, WI, USA). Recombinant bacteria were identified by blue/white screening

AAAAA

5’ 3’

cytMn-SOD mRNA

RT

MA 138 bp

PCR, cloningOligo d(T)18

AAAAAMacrobrachium rosenbergii cytMn-SOD: 1339 bp

Overlapping

M1F M1R

cytMC 492 bp

5’-RACEcM1RcM2R

cytMB 943 bp AAAAA

3’-RACEcM1F cM2F

Fig. 1. Schematic diagram showing the relative positions of forward and reverse primers of M. rosenbergii cytMn-SOD. Primers M1F

and M1R are degenerate primers. Primers cM1F, cM2F, cM1R and cM2R are specific primers.

442 W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

and confirmed by PCR. Plasmids containing the insert were purified (Promega minipreps) and used asa template for DNA sequencing.

2.7. Nucleotide sequence analysis

Nucleotide sequence analysis was performed using the dideoxynucleotide chain termination method [23]on a DNA sequencer (Model 373A, Applied Biosystems, Lincoln, USA). Plasmid DNA at 1 mg was usedfor sequencing with a Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Lincoln, USA) andsubjected to electrophoresis on 6% denaturing gels. Clones were sequenced with the M13 forward andreverse primers. The SOD gene sequence was analyzed and compared by using the BLASTX and BLASTPsearch programs (http://blast.genome.ad.Jp) with GenBank database search. The multiple sequencealignment of prawn SOD gene was created by using the Clustal W analysis program (http://searchlauncher.bcm.tmc.edu).

2.8. Expression of SOD expression in L. garvieae-injected prawn

M. rosenbergii (15 g) in the intermoult stage were injected with 20 ml bacterial suspension(1! 107 cfu ml�1) of L. garvieae into the ventral sinus, resulting in 2! 105 cfu prawn�1. After injection,the prawns were placed in PVC aquarium tank containing 100 l of aerated freshwater at 28 �C. Prawnsinjected with 20 ml saline (0.85% NaCl) served as control. After 0, 3, 6, 12 and 24 h, haemocytes weresampled for total RNA isolation as described above. The extracted total RNA was quantitativelydetermined, and 5 mg and 2.5 mg of total RNA from haemocytes and hepatopancreas were used for reversetranscription, respectively. Gene expression of cytMn-SOD was determined by quantitative real-timeRT-PCR.

2.9. Preparation of standard curve for SOD mRNA

The absolute real-time standard curve of SOD gene was prepared according to the method described byBustin [24]. Briefly, using the plasmid vector containing M. rosenbergii cytMn-SOD cDNA as a template,and addition of SP6 RNA polymerase (Promerga, USA) in vitro, cytMn-SOD RNA was transcribed. Aftertranscription, the sample was digested by the addition of RNAseefree DNAse and the RNA was quantifiedwith a spectrophotometer. The RNA diluted in different concentrations with DEPC-water was used asRNA standard. The RNA was reverse transcribed as described above and stored at �20 �C until use forquantitative real-time RT-PCR.

2.10. Quantification of SOD gene expression by real-time RT-PCR

The mRNA expression of the prawn cytMn-SOD in haemocytes and hepatopancreas of saline-injectedprawn and L. garvieae-injected prawn was measured by quantitative real-time RT-PCR. The cDNA andSOD standards were used for the assay of quantitative real-time RT-PCR. The SYBR Green I real-timeRT-PCR assay was carried out in an ABI PRISM� 7900 Sequence Detection System (Applied Biosystems,Foster City, CA, USA). The amplifications were performed in a 96-well plate in a 25 ml reaction volumecontaining 12.5 ml of 2X SYBR Green Master Mix (PE Applied Biosystems), 2.5 ml (each) QMnC-F2 andQMnC-R2 primers (10 mM), 1 ml of template (1 mg and 0.5 mg cDNA of haemocytes and hepatopancreas,respectively, or different concentration SOD standard) and 9 ml of DEPC-water. The thermal profile forSYBR Green real-time RT-PCR was 50 �C for 2 min and 95 �C for 10 min followed by 40 cycles of 95 �Cfor 15 s and 60 �C for 1 min. In a 96-well plate, each sample was conducted in duplicate. DEPC-water forthe replacement of template was used as negative control.

443W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

Data analysis of RT-PCR was performed with the SDS software V2.0 (Applied Biosystems, Foster City,CA). The linear relationships between Ct, threshold PCR cycle and different log concentrations of cytMn-SOD RNA standard was tested using the General Linear Model Procedure and the Regression Procedure,version 6.03, SAS (Statistical Analysis System) computer software. The different Ct values of cytMn-SODwere calculated to actual concentrations of cytMn-SOD mRNA in total RNA based on the SOD standardcurve.

2.11. Tissue expression analysis

Expression of cytMn-SOD mRNA in tissues was demonstrated by RT-PCR. A sample of total RNA at5 mg from haemocytes, hepatopancreas, muscle, ovary and gill was reverse transcribed with oligo-d(T)18primer, respectively. The specific primer pair MnCSP1 and MnCSP2 was used, and the primers b-actinFand b-actinR were used to amplify b-actin fragment that was used as a positive control. The PCR reactionwas the same as that described above.

2.12. Statistical analysis

A multiple comparison (Tukey) test was conducted to compare the significance of differences amongcytMn-SOD gene expression between saline-injected prawn and L. garvieae-injected prawn using a SAScomputer software (SAS Institute Inc., Cary, NC, USA). A significance level of pZ 0.05 was chosen.

3. Results

3.1. cDNA cloning of cytMn-SOD

The degenerate primer pair M1F and M1R was used to amplify 138 bp fragment of partial cytMn-SODcDNA from hepatopancreas of M. rosenbergii, and the fragment showed significant similarity to the SODof other crustaceans in GenBank database. Using similar approaches, 492 bp and 943 bp cDNA fragmentswere amplified by 5#- and 3#-RACE, respectively.

The full-length cytMn-SOD cDNA fragment ofM. rosenbergii was obtained by overlapping three cDNAfragments. The full-length cytMn-SOD cDNA comprised of 1339 bp, containing 47 bp in the 5#-untranslatedregion (UTR), 858 bp in the open reading frame (ORF) and 434 bp in 3#-UTR with a poly (A) tail (Fig. 2).The ORF encodes a polypeptide of 286 amino acids. The calculated molecular mass of the mature protein(286 amino acids) is 31 kDa with an estimated pI of 5.52. The cDNA sequence and deduced amino acidsequence has been submitted to the NCBI GenBank as accession number DQ073104. Comparison of theM.rosenbergii cytMn-SOD deduced amino acid sequence showed similarity of 77%, 54% and 29% to that ofblue crab C. sapidus cytMn-SOD (AAF74771), tiger shrimp P. monodon cytMn-SOD (B1784454), and yeastSaccharomyces cerevisiae SOD (CAA26092), respectively. Two putative N-glycosylation sites: NXT andNXS are found suggesting that the prawn cytMn-SOD is a glycoprotein. Manganese superoxide dismutasesignatures were observed from 243 to 250 (DVWHHAYY) (Fig. 2). Multiple alignment of M. rosenbergiicytMn-SODwith cytMn-SODof different crustaceans showed conservation ofmotifs including four putativemanganese binding sites (H110, H158, D243 and H247) (Fig. 3).

3.2. Expression of cytMn-SOD gene expression in saline- and L. garvieae-injected prawn

The cytMn-SOD mRNA transcript in hepatopancreas decreased significantly 3 h after challenge. Inhepatopancreas, the Ct of L. garvieae-injected prawn was significantly higher than that of saline-injected

444 W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

Fig. 2. Nucleotide sequence of the cDNA encoding cytMn-SOD from M. rosenbergii hepatopancreas and its deduced amino acid

sequence. Potential N-glycosylation sites are underlined. The putative cytMn-SOD signature is shown in white letters with back

background. The putative manganese binding sites are bold (H110, H158, D243 and H247). The polyadenylation signal is doubly

underlined.

445W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

prawn after 3 h, but not at later sample times (Fig. 4A).The cytMn-SODexpressionofL. garvieae-injectedprawndown-regulated to2.32G 0.56 pgpermg totalRNA,which is significantly lower than that of saline-injectedprawn(11.25G 4.6 pg per mg total RNA) after 3 h (Fig. 4B). No significant difference in cytMn-SODmRNA transcriptin haemocytes was found between L. garvieae-injected prawn and saline-injected prawn (Fig. 5).

Fig. 3. Alignment of Mn-SOD amino acid sequence ofM. rosenbergii with that of other decapod crustaceans. Identical residues among

those are in black reverse print. Amino acids are numbered from the putative amino-terminal of the mature proteins. The putative

manganese binding sites are shown in asterisk. Mr-cyt: M. rosenebrgii cytMn-SOD; Pm-cyt: tiger shrimp Penaeus monodon cytMn-

SOD (B1784454); Cs-cyt: blue crab Callinectes sapidus cytMn-SOD (AAF74771); Cf-mt: crab Charybdis feriatus mtMn-SOD

(AAD10640); Cs-mt: blue crab C. sapidus (AAF74770).

446 W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

3.3. Tissue expression of cytMn-SOD

In a RT-PCR study, specific primers (MnCSP1 and MnCSP2) were used to amplify a 863 bp fragmentwith cDNA from haemocytes, hepatopancreas, muscle, ovary and gill using b-actin as a positive control.The RT-PCR showed that the cytMn-SOD was detected in haemocytes, hepatopancreas, muscle, ovary andgill.

4. Discussion

In invertebrates, several enzymes are involved in participation in the release of reactive oxygenintermediates (species): NADPH-oxidase, SOD, peroxidase and catalase. It is known that SOD catalysesthe rapid two-step dismutation of the toxic superoxide anion to molecular oxygen and hydrogen peroxide

0

4

8

12

16

20

24

28

32

36

cytM

n-SO

D m

RN

A (p

g µg

tota

l RN

A-1)

a

a a

ab

aa

aa

a

Time elapsed (h)

Ct

0

5

10

15

20

25

30A

B

aaaa

aa

baa

a

Saline-injected prawn

Lactococcus garvieae-injected prawn

Saline-injected prawn

Lactococcus garvieae-injected prawn

2412630

Time elapsed (h)2412630

Fig. 4. Analysis of cytMn-SOD expression in hepatopancreas of saline-injected prawn and L. garvieae-injected prawn by SYBR Green

real-time RT-PCR at 0, 3, 6, 12 and 24 h. (A) The Ct value of cytMn-SOD expression of saline-injected prawn and L. garvieae-injected

prawn at different time periods. (B) The real concentration of cytMn-SOD mRNA per microgram total RNA in hepatopancreas of

saline-injected prawn and L. garvieae-injected prawn at different time periods (h).

447W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

through the alternate reduction and oxidation of the active-site metal ion [25e27]. It is also known thathydrogen peroxide is toxic to the pathogen and the host itself, since it is uncharged and diffuses freelyacross cell membranes [27,28].

SODs play an important role in antioxidant defense pathways in response to oxidative stress [29]. Indecapod crustaceans, cytMn-SOD and mtMn-SOD molecules showed a manganese SOD signature(DVWEHAYY at amino acid positions starting from 243 to 250) with four manganese binding sites atamino acid positions of 110, 158, 243 and 247.

In invertebrates, previous studies have demonstrated that hepatopancreas and haemocytes are the maintissue involved in the immune response, and are the major site for the synthesis of immune defencemolecules and involved in eliminating the pathogens or other particulate matter [30e32]. The RT-PCRanalysis showed a 863 bp cDNA cytMn-SOD partial cDNA fragment detected in haemocytes,hepatopancreas, muscle, ovary and gill suggesting that cytMn-SOD of M. rosenbergii is synthesized inall these tissues.

0

5

10

15

20

25a

aaaaaa

aa

a

30A

B

0

4

8

12

16

20

24

28

32

36

a

aa

a

a

a

aa

a

a

40

Saline-injected prawnLactococcus garvieae-injected prawn

Saline-injected prawnLactococcus garvieae-injected prawn

cytM

n-SO

D m

RN

A (p

g µg

tota

l RN

A-1)

Time elapsed (h)2412630

Time elapsed (h)2412630

Ct

Fig. 5. Analysis of cytMn-SOD expression in haemocytes of saline-injected prawn and L. garvieae-injected prawn by SYBR Green

real-time RT-PCR at 0, 3, 6, 12 and 24 h. (A) The Ct value of cytMn-SOD expression of saline-injected prawn and L. garvieae-injected

prawn at different time periods. (B) The real concentration of cytMn-SOD mRNA per microgram total RNA in haemocytes of saline-

injected prawn and L. garvieae-injected prawn at different time periods (h).

448 W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

It is known that once a bacterial and fungal pathogen invades the host, the activity of SOD decreases.For example, a significant decrease in SOD activity occurred when shrimp Palaemontes argentinus wasinfected by Probopyrus ringueleti [33]. The present study indicated that in M. rosenbergii which had beeninjected with L. garvieae there was decreased cytMn-SOD RNA expression in hepatopancreas after 3 h, andthis recuperated thereafter. There was no change in cytMn-SOD expression in haemocytes.

In conclusion, a 1339 bp cytMn-SOD cDNA cloned from hepatopancreas of M. rosenbergii indicatesthat cytMn-SOD is synthesized in hepatopancreas, haemocytes, muscle, ovary and gill. It encodes 286amino acids with 31 kDa and pI of 5.52. The cytMn-SOD deduced amino acid sequence ofM. rosenbergii issimilar to that of blue crab C. sapidus cytMn-SOD (77%), and tiger shrimp P. monodon cytMn-SOD (54%).The cytMn-SOD transcript in hepatopancreas of M. rosenbergii was down-regulated, when challenged withL. garvieae at 2! 105 cfu prawn�1 after 3 h.

Acknowledgements

This study was supported by grants from the National Science Council (NSC 93e2313eB-020-024 andNSC 92e2313eB-019-042), Republic of China.

References

[1] New MB. History and global status of freshwater prawn farming. In: New MB, Valenti WC, editors. Freshwater prawn culture:

the farming of Macrobrachium rosenbergii. Oxford, UK: Blackwell Science; 2000. p. 1e11.

[2] Hsu JP, Liu CI. Studies on yeast infection in cultured giant freshwater prawn (Macrobarchium rosenbergii). Fish Disease Research

1994;15:55e68.

[3] Lu CC, Tang FJ, Yoichiro U, Kou GH, Chen SN. Yeast infection in prawns Macrobrachium rosenbergii (De Man). Acta

Zoologica Taiwanica 1997;8:33e45.

[4] Cheng W, Chen JC. Isolation and characterization of an Enterococcus-like bacterium causing muscle necrosis and mortality in

Macrobrachium rosenbergii in Taiwan. Diseases of Aquatic Organisms 1998;34:93e101.

[5] Chen SC, Lin YC, Liaw LL, Wang PC. Lactococcus garvieae infection in the giant freshwater prawn Macrobrachium rosenbergii

confirmed by polymerase chain reaction and 16S rDNA sequencing. Diseases of Aquatic Organisms 2001;45:45e52.

[6] Cheng W, Chen JC. Enterococcus-like infections in Macrobrachium rosenbergii are exacerbated by high pH and temperature but

reduced by low salinity. Diseases of Aquatic Organisms 1998;34:103e8.

[7] Cheng W, Chen JC. Effects of pH, temperature and salinity on immune parameters of the freshwater prawn Macrobrachium

rosenbergii. Fish and Shellfish Immunology 2000;10:387e91.[8] Cheng W, Wang CH. The susceptibility of the giant freshwater prawn Macrobrachium rosenbergii to Lactococcus garvieae and its

resistance under copper stress. Diseases of Aquatic Organisms 2001;47:137e44.

[9] Cheng W, Wang CH, Chen JC. Effect of benzalkonium chloride stress on immune resistance and susceptibility to Lactococcus

garvieae in the giant freshwater prawn Macrobrachium rosenbergii. Diseases of Aquatic Organisms 2003;53:223e9.[10] Cheng W, Wang CH, Chen JC. Effect of potassium permanganate stress on immune resistance and susceptibility to Lactococcus

garvieae in the giant freshwater prawn Macrobrachium rosenbergii. Diseases of Aquatic Organisms 2003;57:151e5.

[11] Hose JE, Martin GG, Gerard AS. A decapod hemocyte classification scheme integrating morphology, cytochemistry, and

function. Biological Bulletin 1990;178:33e45.

[12] Bachere E, Miahle E, Rodriguez J. Identification of defence effectors in the haemolymph of crustaceans with particular reference

to the shrimp Penaeus japonicus (Bate): prospects and application. Fish and Shellfish Immunology 1995;5:597e612.

[13] Roch P. Defense mechanisms and disease prevention in farmed invertebrates. Aquaculture 1999;172:125e45.

[14] Castellanos-Gonzalez A, Jimenez L, Landa A. Cloning, production and characterization of a recombinant Cu/Zn superoxide

dismutase from Taenia solium. International Journal for Parasitology 2002;32:1175e82.

[15] Holmblad T, Soderhall K. Cell adhesion molecules and antioxidative enzymes in a crustacean, possible role in immunity.

Aquaculture 1999;172:111e23.[16] Campa-Cordova AI, Hernandez-Saaverdra NY, De Philippis R, Ascencio F. Generation of superoxide anion and SOD activity in

haemocytes and muscle of American white shrimp (Litopenaeus vannamei) as a response to b-glucan and sulphated

polysaccharide. Fish and Shellfish Immunology 2002;12:353e66.

449W. Cheng et al. / Fish & Shellfish Immunology 20 (2006) 438e449

[17] Brouwer M, Brouwer TH, Grater W, Brown-Peterson NB. Replacement of a cytosolic copper/zinc superoxide dismutase by

a novel cytosolic manganese superoxide dismutase in crustaceans that use copper (haemocyanin) for oxygen transport.

Biochemistry Journal 2003;374:219e28.[18] Orbea A, Fahimi D, Cajaraville MD. Immunolocalization of four antioxidant enzymes in digestive glands of mollusks and

crustaceans and fish liver. Histochemistry and Cell Biology 2000;114:393e404.

[19] Johansson MW, Holmblad T, Thornqvist PO, Cammarata M, Parrinello N. A cell-surface superoxide dismutase is a binding

protein for peroxinectin, a cell-adhesive peroxidase in crayfish. Journal of Cell Science 1999;112:917e25.[20] Brouwer M, Brouwer TH, Grater W, Enghild JJ, Thogersen IB. The paradigm that all oxygen-respiring eukaryotes have cytosolic

CuZn-superoxide dismutase and that Mn-superoxide dismutase is localized to the mitochondrion does not apply to a large group

of marine arthopods. Biochemistry 1997;36:13381e8.

[21] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanateephenolechloroformextraction. Analytical Biochemistry 1987;162:156e9.

[22] Higgins DG, Sharp PM. CLUSTAL: a package for performing multiple alignment on a microcomputer. Gene 1988;73:237e44.

[23] Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of

Sciences of the United States of America 1997;74:5463e7.

[24] Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. Journal of

Molecular Endocrinology 2000;25:169e93.

[25] Smith MW, Doolilttle EF. A comparison of evolutionary rates of the two major kinds of superoxide dismutase. Journal of

Molecular Evolution 1992;34:175e84.

[26] Falconi M, O’Nell P, Stroppolo ME, Desideri A. Superoxide dismutase kinetics. In: Parker L, editor. Methods in enzymology,

vol. 349. USA: Elsevier; 2002. p. 38e49.

[27] Zelick UE, Janje B, Schneider O. Superoxide dismutase expression and H2O2 production by hemocytes of the trematode

intermediate host Lymnaea stagnalis (Gastropoda). Developmental and Comparative Immunology 2005;29:305e14.

[28] Adema CM, Deutekom-Mulder EC, vdKnaap WPW, Meuleman EA, Sminia T. Generation of oxygen radicals in hemocytes of

the snail Lymnaea stangalis in relation to the rate of phagocytosis. Developmental and Comparative Immunology 1991;15:17e26.[29] Fridovich I. Superoxide radical and superoxide dismutases. Annual Review Biochemistry 1995;64:97e112.

[30] Johnson PT. A review of fixed phagocytic and pinocytic cells of decapod crustaceans with remark on hemocytes. Developmental

and Comparative Immunology 1987;19:679e704.

[31] Vogt G. Cytopathology of Bay of Piran shrimp virus (BPSV), a new crustacean virus from the Mediterranean Sea. Journal of

Invertebrate Pathology 1996;68:239e45.

[32] Gross PS, Bartlett TC, Browdy CL, Chapman RW, Warr GW. Immune gene discovery by expressed sequence tag analysis of

haemocytes and hepatopancreas in the Pacific white shrimp, Litopenaeus vannamei, and the Atlantic white shrimp, L. setiferus.

Developmental and Comparative Immunology 2001;25:565e77.[33] Neves CA, Santos EA, Biany ACD. Reduced superoxide dismutase activity in Palaemontes argentinus (Decapoda, Paleminedae),

infected by Probopyrus ringueleti (Isopoda, Bopyrindae). Diseases of Aquatic Organisms 2000;39:155e8.