MANUAL-UB 100.pdf.part

EEEE-mail: [email protected]

Website: www.oxygenplants.comwww.universalboschi.com;

1

`

OPERATION MANUAL

UB-100 OXYGEN PLANT



2

PPRREEFFAACCEE

UUNNDDEERRTTAAKKIINNGG AASS TTOO SSAAFFEETTYY

We have ensured that our equipment is safe and without risk to the health of the workers when properly used in accordance with the information and advice relating to its use contained in the Instruction Book/Operator’s Manual. It will be, therefore, of utmost importance that you use our equipment only after going through the Book/Manual thoroughly, which has detailed instructions, information and advice for the safety of operators and workers in your factory. The equipment is sold and supplied to you on the basis of your express undertaking that you will take the steps specified in the Book/Manual in order to ensure that the equipment sold and supplied by us will be safe and without risk to the health of your works when properly used.

The purpose of this manual is to provide the owner with the necessary instruction to properly operate and maintain the oxygen gas plant of capacity 100 m3/h It is the responsibility of the owner to thoroughly review the instructions contained herein and to become acquainted with the methods of operation and maintenance suggested. Should questions arise concerning the working of the plant feel free to contact us.



3

-U.S. TO METRIC-

The metric conversion equipments listed below represent the more

commonly used measuring units in the engine.

MultiplyMultiplyMultiplyMultiply ByByByBy TTTTo obtaino obtaino obtaino obtain Inches (in) 25.4 millimeters (mm) Pounds (lbs) 0.454 kilograms (kg) Gallons (gals) 3.785 liters (l) Horsepower (hp) 0.746 kilowatts (kw) British Thermal Units (BTU) 1055 joules (J) Degrees Fahrenheit (˚F) 0.556 (˚F-32) degrees Celsius (˚C) Pounds per square inch (psi) 0.0703 kilograms per square

6.895 Kilopascal (kPa) 0.069 bar Cubic feet per minute (cfm) 0.0283 cubic meters per

Minute (1/min) Gallons per minute (gpm) 3.785 liters per minute

(l/min) Torque in foot-pounds (ft-lbs) 1.356 Newton meters (N.m) 0.138 kilogram meters

(kg-m) Saybolt Universal Viscosity (SSU)Saybolt Universal Viscosity (SSU)Saybolt Universal Viscosity (SSU)Saybolt Universal Viscosity (SSU) Less than 100 seconds 0.226 SSU-195/SSU Kinematic

viscosity (CS) Greater than 100 seconds 0.22 SSU-135/SSU Kinematicviscosity (CS)

MMEETTRRIICC CCOONNVVEERRSSIIOONN EEQQUUIIPPMMEENNTTSS



4

1.1 CAPACITY: This plant is capable of producing gaseous oxygen of 99.5% to

99.6% at the rate of 100m3/h (when converted into design suction

conditions) and can be compressed up to 150 bars within specified

tolerance. The above product capacities are based on ambient

conditions of 15/27 Deg c temperature, 760 mm of Atmospheric

Pressure and 50% relative humidity and 0.03% of carbon dioxide

max. allowed as impurity (or specified).

1.2 OTHER SPECIFICATION:

Air Pressure (Starting) : 45 Bar

Air Pressure (Normal) : 40 Bar

Starting Time (After Defrost) : 8 Hours

Defrosting Cycle at normal conditions : 8 Hours

Cooling Water requirement : 40 CM / Hr.

Inlet Cooling Water Temperature : 25 Degree Celcius

Assembly Height : 9.2 Meter

Area Required for plant abt.( Without

filling Platform)

: 20m X 15m

Power Supply required

Check what

: 400-415 Volts &

200Volts

1.3 POWER REQUIREMENT:

CONNECTED K.W.

AIR Compressor 133

Drier heater 15

Expansion Engine 5.5

Section

1 PPPPPPPPLLLLLLLLAAAAAAAANNNNNNNNTTTTTTTT SSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCIIIIIIIIFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS



5

L.O. Pump 3.7

Defrost Heater 5

Freon Unit 6

Please refer to Air Compressor manual for motor power of Air Compressor.

Note:

The estimated power consumption depends on the efficient working of Air

Compressor as most of the power load is on it. Also, the oxygen out put

depends on FAD of compressor ambient temperature. R.H. operating conditions

and may other factors.

Our Company cannot take any guarantee for specific power consumption for the

reasons but production and purity within specified tolerance.



6

Atmospheric air used to produce Oxygen and Nitrogen, in most industrial processes.

Atmospheric air mainly contains the following elements:-

Element Percentage Composition

by volume

Boiling Point at atmospheric

Pressure

Nitrogen (N2) 78.03% -195.5 Deg.C.

Oxygen (O2) 20.99% -182.7 Deg.C.

Argon (A) 0.9323% -185.5 Deg.C.

Carbon Dioxide (CO2) 0.03% -78.5 Deg. C.

It solidified from gas.

The other constituents of air are Hydrogen and rare gases. Such as, Neon. Helium

Krypton and xenon in rates.

The process adopted here to produce oxygen and Nitrogen is called liquefaction and

fractional distillation of Air.

Air is mixture of mainly of Oxygen and Nitrogen and its physical properties lie between

the two but closer to those of Nitrogen. In its normal atmospheric conditions air is

composed principally of Oxygen and Nitrogen and its physical properties lie between the

two but closer to those of Nitrogen. In its normal atmospheric condition, air is a colorless

odorless gas. Air which is normally in gaseous state can be liquefied, as steam from

gaseous state can be condensed to form water in liquid state.

Air is liquefied in our process by expansion in an Expansion Engine and in a Joule

Thompson Expansion Valve. As we use an Expansion Engine, the air is to be

Section

2 GGGGGGGGEEEEEEEENNNNNNNNEEEEEEEERRRRRRRRAAAAAAAALLLLLLLL BBBBBBBBAAAAAAAASSSSSSSSIIIIIIIICCCCCCCC PPPPPPPPRRRRRRRRIIIIIIIINNNNNNNNCCCCCCCCIIIIIIIIPPPPPPPPLLLLLLLLEEEEEEEESSSSSSSS



7

compressed only to a medium pressure of 40 Kgs. Cm2 whereas other processes need

about 150 to 200 Kgs/Cm2 air pressure. Expansion Engine is a single acting

reciprocating engine with Inlet and Outlet valves, set to open at a particular time intervals

of stroke cycle. Thus, air entering expansion engine through Inlet valve with a high

pressure is expanded during the downward stroke of piston. The expanded air will be

drawn out through the outlet valves during upward stroke of piston. During such

expansion, air gets cooled.

The expanded air from expansion engine and expansion valves will enter the lower part

of distillation column.. This air will mostly be liquid.

Distillation is an operation of separating two components having two different boiling

points. Thus at a particular temperature in between the two boiling points, one component

will be volatile (Thus vapor) and the other component will be liquid. Thus, the component

which is more volatile can be drawn out of a distillation column as vapor. The component

which is less volatile can be drawn out as liquid. Oxygen and Nitrogen have a difference

of about 13 Deg.C. In boiling points and therefore can be separated in a distillation

column. Nitrogen will be drawn out as per vapor or partially collected from the liquid

tapping outlet valve(optional). Oxygen will be collected as liquid and can be pumped up to

150 Kg/Cm2 for filling cylinders also by a Liquid Oxygen Pump.



8

Air is drawn from atmosphere through Suction Air Filter. (1).Air is drawn from atmosphere

through Suction Air Filter to prevent dust from getting into the system.

The air is then compressed in a four stage Air

Compressor (2) with after cooler (3) mounted

on the process skid to a maximum pressure of

40 TO 45 Kgs./Cm2 for plant starting

conditions and a pressure of 38 – 40 Kgs./Cm2

for best results normal running conditions.

Depending on ambient conditions and good

operations the operating pressure of the Air

Separations Unit is brought down to 40 Kg/Cm2 as per past experience. Air Compressor

has inter-coolers between stages and an After-Cooler after 4th stage. For further details

on Air Compressor, please refer to Air Compressor Manual supplied by the Air

Compressor manufacturer. The air compressor should be maintained properly in good

condition as it is the main source of air supply to the plant.

PROCESS SKID

This consists of the following items:

1. After cooler with Tank 2. Nitrogen Cooler with Tank 3. Moisture Separator (PURGER) 4. Chilling Unit with Freom Unit 5. Oil Absorber filled with Alumina 6. Molecular Sieve Battery on skid 7. Defrost Heater

PPPPPPPPRRRRRRRROOOOOOOOCCCCCCCCEEEEEEEESSSSSSSSSSSSSSSS DDDDDDDDEEEEEEEESSSSSSSSCCCCCCCCRRRRRRRRIIIIIIIIPPPPPPPPTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN

Section

3



9

8. Gas / Air Lines as per standard Layout on skid/platform.

9. Water Pump

10. Inlet & Outlet Water Lines

11. Drain Manifold complete with Ball Valves for draining Moisture.

PROCESS SKID (PARTS IN DETAIL)

Oil Adsorber

Coil Cooler

M.S. Battery

Drier Heater

Chilling Unit

Moisture Separator

After Cooler

Oil Adsorber



10

All the above equipments are neatly mounted on a skid/ platform complete with interconnecting piping and ready for installation. 1 Set

The air then enters into cascade an Evaporating Cooler (5) on the process skid where it

gets cooled to about 20 Deg.C. This unit is optional. The cooler is a cubical vessel where,

there is pipe coil and is inter connected. The coils are half submerged in water in the

vessel Dry Nitrogen will be bubbled through this water to become wet gas. As the water

vaporizes, it requires latent heat which is absorbed from water itself. So, water gets

cooled. Thus, air inside the pipe coil will get cooled. Compressed air, cooled in

evaporation cooler will enter into a Moisture Separator (4 & 8).

Moisture condensed as water will be separated and drained

once in an hour. It is important to drain moisture from the bottom

of the Oil Absorber (9) at regular intervals and also change the

Alumina every 6 to 12 months. After this the air will pass through

an additional cooler called Chilling Unit (7).

After this the air will pass through Oil Adsorber. (9) Packed with Alumina

balls. Here the Oil Vapor carried over from Air Compressor will be removed. If this

oil vapor is not removed sufficiently, due to spent carbon or due to high

temperature of process air, the oil vapor will damage the Molecular Sieves. To

obtain a long life of Molecular Sieve ensure the Alumina is well maintained.

Caution: Check any discoloration of alumina every three months. Ensure that oil and moisture is drained minute is set correctly as per the manual supplied by the air compressor manufacturer and no access oil is sent to the cylinder by the lubricator.

The air then enters one of the Molecular Sieve vessels/battery (11). The moisture and

carbon dioxide in the air will be removed in this drier. If they are not removed before entry

to Cold Box, they will form Ice and dry Ice which will choke the Heat Exchanger Tubes and other equipments. There are two driers. One (drier A) will be (on line with the process air) in operation

Moisture separator (4)

After cooler (3)

Oil Adsorber (9)



11

for around 10 hours and the other (drier B) will be under regeneration. Regeneration is

done by heating and cooling with not-going Nitrogen. An electric regeneration gas

heater (12) is used for regeneration. For further details, refer separate chapter on

Molecular Sieve Driers.

Caution: Proper working of the molecular sieve drier/battery is very important for proper removal of

carbondioxide and moisture from the process air. Ensure that the heating and cooling cycle are proper and

quality of molecular sieves as per international standards.

The dry air is again filtered in a Dust Filter (13) before entry to Cold

Box to avoid any dust entry to Cold Box. In some plants the air is

further cooled through special coils provided in the Chilling Unit

Tank (6), which is called an equalizing coil (optional) as it equalizes

the temperature after the Molecular Sieve drier before Air enters the Cold Box.

N1 Nitrogen

vent valve N2 outlet to skid (N2)

Air V1/1 Air inlet from Dust filter

VII/1 to defrost heater

O3 Oxygen outlet to manifold

VII(Vent valve air)

Air, Nitrogen and Oxygen inlet and outlet piping photo



12

COLD BOX

The compressed air, cooled to about 15 to 20 Deg.C free of moisture and carbon dioxide

will enter the Cold Box (15). It initially passes through a Heat Exchanger No.1 (16); the

incoming air will be cooled by the outgoing Oxygen and Nitrogen. The air will be cooled to

around –100 Deg.C. In this Heat Exchanger. This can be single or divided two parts in

series.

Automatic Oxygen liquid level indicator(350 TO 400mm)

High pressure oxygen indicator( max150 BAR)

Upper column Pressure (0.55 TO 0.65 KG/CM2) indicator

Lower column pressure indicator(5.5 TO 6 KG/CM2)

Air inlet pressure indicator (45 to 40 kg/cm2

Digital temperature scanner

V5 PL valve

V4 RL valve

V3 Air expansion valve

V1 by-pass (exta cooling to exchangers ) valve



13

The air will then be into two streams. The main air stream will enter Expansion Engine

(14) at 40 Kgs./Cm2(P7) AT T1 TEMP -90 TO -110 ( THIS WILL VARY AGAIN AS PER

THE PRODUCT MIX) and will be expanded to 5 to 6 bar depend upon the product mix of

gas /liquid Kgs./Cm2 and T2 (ENGINE OUT LET)–150 to 160 Deg.C the rest of the air

will pass through Heat Exchanger No. 2 (17) to be cooled to about T3–170 Deg.C. by

the outgoing Oxygen and Nitrogen. This air will then be expanded by an Expansion Valve

V3 to form liquid air. Both the air streams will now enter bottom portion of the Lower

Column (19). AIR Operating pressure of the AIR ENTERING THE column R17 (is

around 40 kg/cm2 under normal operating conditions.

SUMMARY OF TEMP AND PRESSURE OF COLD BOX OPERATION

T1 (-1000 to -1150) inlet of expansion

engine

P7 Air inlet pressure expansion engine

T2 (-145 to -155) out let of expansion

engine

P8 Air Out let pressure expansion engine

T3 (-160 to -170) before V3 R17 Air pressure cold box

T4 (- 180 to -185) west nitrogen after pl

sub cooler

R18 Lower column pressure

R19 Upper column pressure

Exp Engine

Motor

Column Panel

Safety Valve

Lox Pump-optional

E-mail:[email protected] Website:www.oxygen-plants.com;www.oxygengasplant.net

14

Expansion Engine

Expansion Engine

SCOPE OF SUPPLY

Complete with Motor with hydraulic valve control bursting disc for safely, complete with

Fly wheel pressure gauge, Motor pulley V- Belt, Belt Guard slide Rails inter connecting

(Inlet and Out let)

Note: See chapter on Expansion Engine

Engine Duct

Expansion Engine

Engine Wheel


15

PROCESS

As the air enters the Lower Column, after the Expansion Engine and after Expansion Engine

valve V3, a part of this air condenses into liquid and falls at the bottom of the column. This liquid

is about 40% Oxygen and 60% Nitrogen and is usually called the “Rich Liquid” and as Nitrogen

is more volatile it rises to top of the lower column where it gets cold from the condenser and

become liquefied. This liquid nearly free of oxygen collected in the (Pockets in the condenser)

trap. As this liquid poor in oxygen is called poor liquid.

Final separation of the two fractions is achieved in the upper column. Both the poor liquid are

carried into the upper column by two Expansion Valves and the pressure drops from 5.0/6.0

Kgs. /Cm2 in the lower column(R18) to 0.5 Kgs. /Cm2(R19)in the upper column. The rich liquid

enters the middle of the Upper column and as it flows down, Nitrogen evaporates and Oxygen

continues as liquid. The Liquid Nitrogen (Poor Liquid) enters the top of the column and as it is

flows down the column, it comes in contact with any evaporating Oxygen and condenses the

same into liquid, while the Nitrogen itself becomes a Gas as it is more volatile. This process

takes place in each Gas as it is more volatile. This process takes place in each tray. The entire

gaseous Nitrogen is piped out from the top of the column through Heat Exchangers.


16


17


18

Cylinder filling manifold/station

Similarly the Liquid Oxygen at the bottom of the column is carried away to a Liquid Oxygen

Pump from which it is compressed and again passed through the Heat Exchangers into the Gas

Cylinders in the cylinder filling station. As the Liquid Oxygen travels through the Heat

Exchangers, it evaporates into gaseous oxygen filling the cylinder with gas and giving up its cold

to the incoming air

Generally the purity of Oxygen will be 99.5% and Nitrogen about 96%, when the plant is

operated exclusively for oxygen production.

The Plant operation should be such that it is not too cold or too warm. If the cold box is too cold,

the Nitrogen will condense into Liquid Oxygen and the Oxygen Purity will fall.

If the plant is too warm oxygen will evaporate with the Nitrogen and the quantity of Oxygen

produced will go down substantially and the waste nitrogen will carry more and more oxygen. To

obtain optimum result of the plant, therefore check the purity of the waste Nitrogen which should

not fall below 96%.


19

When the plant works continuously for a few months, it tends to accumulate Carbon Dioxide and

moisture in its internal parts. These are to be removed once in about four months. For details,

refer chapter on Defrosting of Plant.

Similarly, the L.O. Pump alone can be defrosted in case of trouble in pumping (Refer L.O. Pump

chapter).

It is advised to give Carbon Tetra Chloride wash to the Cold Box equipments once in a year to

ensure protection against Hydro Carbon contamination. But when starting during commissioning

CTC wash is a must.

Before starting plant, it is generally defrosted and blown out. That the cooling/starting is done

which will take about 7 to 8 hours. When the plant is stopped for short intervals, the plant need

not be defrosted, but all the cold line valves are to be closed to prevent outside moisture from

entering the Cold Box.


20

Motor

Lox Pump Duct

Lox Pump

Lox Pump Pulley


21

Despite air purification by Molecular Sieve, some amount of water vapour and Carbon Dioxide

will get past the Molecular Sieve Driers and enter the Cold Box. In due course, any Carbon

Dioxide or water vapour that gets past through Molecular Sieve Driers will be deposited as solid

Carbon Dioxide (Dry Ice – Sublimation temperature of – 80 Deg. C.) or Ice (water ice – freezing

temperature 0 Deg.C.) within the tubes of Heat Exchangers, inside the Valves, Expansion Valve,

L.O. Pump Filter and inside the holes in sieve trays. These solid deposits will restrict the flow of

air and will be evidenced by gradual increasing difference between Air Compressor discharge

pressure PC-4 and Air Pressure before V3, R17. In case of excess Carbon Dioxide the L.O.

Pump Suction Filter will get chocked. Other symptoms of frosting are fluctuations of Pressure

and an increasing difficulty in maintaining the required purity and rate of production. Ultimately

the pipes become so restricted that even when the compressor is working at its rated pressure

and flow, the amount of air that can enter the plant is not sufficient to maintain production and

purity. When the above occurs, the plant must be defrosted which is the process of melting out

all of these accumulated deposits.

4.1 Complete Defrost of Plant:

1. Initially drain all the liquid from the Plant through R21, R22, R26, R27, R28, R29 and R31.

2. Check that one of the molecular sieves dryer is completely reactivated. This reactivated

dryer, ‘A’ or ‘B’ should be kept as standby for final cooling and production of Plant after

defrost. The other spent drier is to be used for complete defrosting.

3. Air circulation for defrosting should be started at least 3 – 4 hours after liquid drain in

order to avoid sudden temperature change causing thermal shock.

4. Valves stem of expansion valves (V3, V4, and V5) are taken out.

5. By pass valve (V1) is closed.

Section

4 DDDDDDDDEEEEEEEEFFFFFFFFRRRRRRRROOOOOOOOSSSSSSSSTTTTTTTTIIIIIIIINNNNNNNNGGGGGGGG OOOOOOOOFFFFFFFF PPPPPPPPLLLLLLLLAAAAAAAANNNNNNNNTTTTTTTT


22

6. In Expansion Engine, lift the inlet and outlet valve push rods by a lever. Place a metallic

piece of about 4mm. thickness in between Pistol plunger and push rod. AT X see drawing

No. UB/EXP/101

7. Close air inlet valve to the column (V1/1).

8. Open all drain and analysis cocks (V6, V7 and R21, R22, R26, R27, R 28, R29, R31)

9. Open valves (VII/1) of air supply to defrosting heater (now off) and open valves D1 and

D2.

10. Start the Air Compressor after ensuring cooling water circulation as per Air Compressor

manual and adjust air pressure to about 20 to 30 Kgs. /cm2.

11. Air is made to circulate for about for about one hour or as long as frosting on the

expansion valves (V3, V4, V5) disappears.

12. The water level in defrosting heater is checked and if necessary, water is added up to the

required level and the defrosting heater is put on. Temperature should never be allowed

to reach more than 700C.

13. At this point, the warm air should come out smoothly through all the drain and sampling

ports. The process continues till the outlet air from all the points are hand warm, at no

point of time the pressure at the (HP), (MP) and (LP) gauge should cross 15 kg/cm2, 3

kg/cm2, 0.3 kg/cm2 respectively.

14. Bypass valves (VI) is also now opened and cleaned.

15. When the air coming out the entire opening is clean and dry, the heater is put off and the

valve (VII/1) is closed and (VI/1) is opened and flanges (D4) and (D3) are loosened for

cleaning the HP circuit. The process is continued till the air coming out of (V6, V7, D4,

and D3) is clean and dry.

16. At this point it is advisable to defrost the HP circuit by opening valves (VII/1) AND (D3)

and loosen connection at (D4) and open valves (V6 AND V7) and operate for half and

hour in this mode.

17. At this point the defrosting is considered over. Pressure lock test of the column is

conducted to check that there is no leakage and the distance piece between the pastel

plunger and the push rod of the expansion engine is removed. The column is now ready

to start.


23

1. Ensure availability of electricity at normal voltage and enough water levels.

2. Check oil levels of all running machineries are normal.

3. Start cooling water circulation to Air Compressor and ensure continuous water flow at all

outlets.

4. Rotate flywheel of all running machineries by hand at least one full run for free rotation.

Ensure Expansion Engine Inlet Valve A13 is closed.

5. Keep the following valve settings:- (Assume drier ‘A’ on line)

5.1 VALVE OPEN:

A-1, A-2, A-5, A-14, N-1, N-3, N-6, N-8, N-9, N-10, D-4 V4 and V5 to be kept 10 turns open.

5.2 VALVES CLOSE:

V3, A-3, A-4, A-6, A-7, A-8, A-9, A-10, VI/1, VI/2, A-12 (optional), A-13, D2, D1

N-2, N-4, N-5, N-7, V8, V8A, 0-3, 0-5, 0-6,D6, Drain valves & D-3 & D-4.

All pressure gauge isolation valves should be kept slightly open. Level Gauge Isolation

Valves are to be kept closed.

6. Start the Air Compressor as per Compressor Manual. After attaining full speed, close the

inter-stage separator drain valves. Close A-2 completely. Close A-1 partially, watching Air

Pressure in P-4, to be about 40 kg. /cm2. Ensure that oil feed to each cylinder is as

prescribed in compressor manual. If oil is feed more than required, it will form

hydrocarbon and cause explosion of distillation column. Excess air temperature in

cylinders also can cause hydrocarbon formation.

SSSSSSSSTTTTTTTTAAAAAAAARRRRRRRRTTTTTTTT UUUUUUUUPPPPPPPP AAAAAAAAFFFFFFFFTTTTTTTTEEEEEEEERRRRRRRR DDDDDDDDEEEEEEEEFFFFFFFFRRRRRRRROOOOOOOOSSSSSSSSTTTTTTTT Section

5


24

7. Gradually pressurize Molecular Sieve Drier, which is ready for operation (Assume ‘A’)

through pressurizing Valve, watching. When P-5 is almost near P-4, open Air Inlet A-3 to

Drier. Due to sudden pressurizing and depressurizing Molecular Sieve pellets become

powder and its life will reduce.

8. Now air ready to be admitted to Cold Box. Open VI/1 slowly watching pressure. Now air

will be blown through drains V6 and V7. Blow the airlines a few times by closing and

opening a VI/1.

9. By Pass valve VI has been provided to give extra cooling and is gradually closed after the

cooling of the engine starts when T2 reaches (-) 135˚ C.

10. Thereafter close VI/1, VII/1, V11, V6 and V7.

11. Now again open VI/1 slowly watching Air Pressure in P-1. After pressurizing, open VI/1

fully.

12. Now the Expansion Engine should be started electrically. Keep the Inlet Valve hydraulic

system lever in ‘Stop’ position. Oil Pressure in P-15 should be at least 1 Kgs./cm2. Then

release all air locks in hydraulic system. Keep the Inlet cam in positions. Now put Inlet

Valve to run positions. Now both inlet and outlet valve pestles should work. Open the air

inlet valve A-13, slowly watching P-7 and P-8 pressure gauges. Then A-13 should be

opened fully.

13. The lower column pressure P-2 also will go up. During initial start up, the pressure will be

about 3 to 4 kgs./cm2 in P-2 and about 0.4 to 0.5 kgs./cm2 in P-3, upper column

pressure.

14. After reaching a steady upper column pressure in P-3, regeneration should be started to

regenerate off the line drier. After checking drier cycles, heating should be started.

15. The Nitrogen to the evaporating cooler should be admitted by opening valve N-2. Valve

N-3 must be closed watching upper column pressure. If there is excess water in

evaporation cooler, it will generate a back pressure on upper column P-3, which should

not exceed 0.6 to 0.7 kgs./cm2. Ensure the Nitrogen Pipe just dips into water.

16. Now watch air pressure in P-1, P-2, P-3 and in P-4. They should be steady. Slowly

increase air pressure in P-4 by closing A-1 gradually, so that, discharge pressure in P-4,

is about 45 to 50 kgs. /cm2. Take care that P-2 and P-3 does not go up. Also watch heat

of


25

17. expansion engine cylinder if new piston rings have been used. If it is warm, reduce air

pressure slightly.

18. Now watch temperature, Expansion Engine Outlet T-2 and Expansion Engine Inlet T-1.

These will start cooling. After about 2 ½ to 3 hours T-1 will reach –90to 100 Deg.C. And

T-2 will reach –140 to 150 Deg. C. (Upto -165˚C is OK)

19. By now, we would have advanced the Expansion Engine cam position from 7 to about 5

or 4 depending upon the increase in air pressure in P-2 and P-3. When we reduce Cam

position, the Inlet pressure will go up and the outlet pressure will come down and vice-

versa. But in higher cam position, more air will be handled by Expansion Engine but the

temperature drop will be less and vice-versa. When starting the plant, even when the

Expansion engine is operated in cam 7, the pressure will be very high. The pressure at P-

1 will be high (45 to 50 Kgs. /cm2) as the warn air volume is large. As air contracts due to

cooling after the first Heat Exchanger, the pressure at P-1 will drop gradually and the

Cam position is adjusted to, maintain a high P-1 pressure. After about 3 - 4 hours

operation, the liquid will appear in Lower Column and P-1 pressure will continue to drop.

The Cam is then shifted to positions 3, 2 ……….etc. to sustain high pressure at P-1 and

obtain maximum purity, when the plant is sufficiently cool.

20. When T-1 is –90 Deg.C. To –100 Deg.C. And when T-2 is –140 Deg.C. Open V3 valve

slightly. Then watch T-3 temperature. This will start cooling down. By the time V1 should

have been closed to 1 then watching the pressure of the lower column

21. When T-3 temperature before V3 reaches –140 Deg.C. / -150 Deg.C. Open V3 slightly

more without upsetting T-3. Half an hour after this, liquid air will start forming in Lower

Column.

22. 1 or 1 ½ hours after this, liquid oxygen will start forming in main condenser. Now close the

By Pass Valve V1 - half turn.

23. It is a good practice to drain a little amount of R.L. and L.O. initially to flush lines by

opening R26 and R27.

24. Now open isolation valves R13 & R14 and close equalizing valve of level gauge RE. (L2).

The level of Liquid Oxygen will start increasing which will show in the DP level gauge

manometer on the main panel of the cold box. When L2 25 cms increased and closed

fully V1.


26

25. When Upper Column level in L2 had increased to about 50 cm. Start closing V4 and V5

valves. Level will fall down and again arise.

26. When V4 is about 2 to 3 turns open and V5 is about 1 to 2 turn open, Oxygen Purity is to

be analyzed collecting a sample from R27.

27. Oxygen Purity should be more that 99% before starting the L.O. Pump.

28. To increase Oxygen Purity, V5 & V4 to be slightly closed.

29. After attaining good Oxygen Purity and having level at 48 cm, open oxygen valve V8A

and then V8 valve gradually. Now Liquid Oxygen is allowed to enter L.O. Pump.

30. When level had again risen after a drop, we are ready to start L.O. Pump

MODE: LIQUID OXYGEN PUMP START- FOR OXYGEN CYLINDER FILLING

(For plants with gas cylinder filling FACILITY)

1. When level had again risen after a drop,we are ready to start L.O. pump this will provide

for cooling to exchangers.

2. Open valve D6.

3. Before starting L.O. Pump, check free rotation by hand. Clean the L.O. Pump Piston with

C.T.C.

4. Start the L.O. Pump and check oil pressure for crank lubrication in P-16 pressure gauge.

It should be above (P16)0.5 kgs. /cm2

5. Now check for flow of Oxygen in vent.

6. Then open O-5, O-6 and loosen all bull nose connections to cylinders. Now, product

Oxygen lines will be purged.

7. Thereafter close D6, O-6 and tighten bull nose connections. Keep open cylinders valves,

individual’s connection valves and open O-5. Safety valve at the manifold is set at 165

kg/cm2 and should be checked prior.

8. Keep constant close watch on the oxygen pressure gauge on cold box panel and

manifold. Rate of production can be checked by time taken for filling a set of known

capacity cylinders after the trail runs are over. The ambient conditions vary from place to

place and also the relative humidity. The FAD of the compressor will therefore vary and

the production of oxygen is dependent on the amount of air entry the column as it is the

main feed stock. For calculating the rated production the output has to be converted into

design suction conditions which are normally 15 to 24 deg C, 760 mm Hg and 50% RH.


27

Liquid oxygen pump has appeared in condenser ON the L.O. Pump Provide cooling to

Heat exchanger 1 ,2 & liquefier

The temperature T1 ,T2 & T3 will drop. Either Blow / vent Oxygen gas at manifold for

15to 20 min & check purity

When T1= (-100) . T2 = (-150) & T3 (-170 ) minimum

Slowly start Open Lox valve V11 the flush Liquid Oxygen Line

SETTINGNS OF VALVE

V1 VALVE (Bypass ) will always be open ¼ round to allow air after

expansion engine to return to the liquefier for Extra cooling


28

When Plant is stopped for short time, either due to electricity or maintenance or cooling water

failure, the start up is not very lengthy as earlier.

Keep the following starting conditions: (Assume Drier ‘A’ on line)

6.1 VALVES OPEN:

A-1, A-5, A-13, A-14, N-1, N-3, N-6, N-8, N-9, N-10, V8, V8A, V4 and V5 3 to 4 turns

open depending on length of shut down.

6.2 VALVES CLOSE:

V3, A-2, A-3, A-4, A-6, A-7, A-8, A-9, A-10, VII/1, V1/2, A-13, A-14, D2, N-4, N-5, N-7, V8,

V8A, D-5, D-6 Drain Valves D-1 to D-4.

(A-2 valve may be provided in higher capacities only)

All pressure gauges isolation valves should be a lightly opened and level gauge valves

are to be opened, start the Air Compressor after ensuring cooling water supply. Close

inter-stage drain valves and adjust air pressure in P-C to about 40 kgs. /cm2 by valve A-1

& A -2

Pressurize drier which was on operation (Assume ‘A’ by opening A-7. After pressurizing

open A-3 fully and close A-7.After pressurizing Drier gradually open V1/1 and pressurize

Heat Exchanger watching P-1 pressure. After pressurizing open V1/1 completely.

Start Expansion Engine. Set hydraulic system and pressure properly. Keep cam around 3

positions. Open air inlet valve A-13 & A-14

Section

6 SSSSSSSSTTTTTTTTAAAAAAAARRRRRRRRTTTTTTTT UUUUUUUUPPPPPPPP AAAAAAAAFFFFFFFFTTTTTTTTEEEEEEEERRRRRRRR SSSSSSSSHHHHHHHHOOOOOOOORRRRRRRRTTTTTTTT SSSSSSSSHHHHHHHHUUUUUUUUTTTTTTTT

DDDDDDDDOOOOOOOOWWWWWWWWNNNNNNNN


29

Watch P-2 and P-3 pressures. When pressures are normal start drier regeneration. Start

drier heater if required.

Admit Nitrogen to evaporation cooler by opening N-2 and closing N-3.

Watch temperatures T-1 and T-2 when they are –100 Deg.C. / -90 Deg.C. And –140

Deg.C. Respectively and open V3 valve.

Close V4 and V5 valves watching Upper Column level in L-2 to be within limits.

Check Oxygen Purity after setting V3, V4, V5 valves and Expansion Engine cam settings

When purity is normal start L.O. Pump and start filling cylinders as mentioned earlier.


30

Plant can be shut down under various circumstances.

Therefore the same is instructed under different categories, such as, (a) Normal (planned) Shut

Down (b) Emergency Shut Down in case of Power Failure, Cooling Water failure or Air

Compressor trouble or any other Running Machinery failure and (c) Shut Down in case of only

Expansion Engine failure.

7.1 NORMAL PLANNED SHUT DOWN:

Stop Oxygen Cylinder filling when a particular batch is over and vent Oxygen close valves, O-5,

and open O-6 valve.

Stop L. O. Pump and close V8 and V8A valves and open D6.

Open Nitrogen vent N-1 and then close N-2.

Stop drier heater.

Reduce air pressure by opening A-1 by about ½ to 1 turn.

Close A-13 or also by the ball valve (hydraulic) provided by the starter and switch on control

panel and stop Expansion Engine.

Close V1/1 air inlet valve.

Close air drier inlet and outlet valve.

Open all separator drains A-1, A-2 and interstage drains of Air Compressor.

PPPPPPPPLLLLLLLLAAAAAAAANNNNNNNNTTTTTTTT SSSSSSSSHHHHHHHHUUUUUUUUTTTTTTTT DDDDDDDDOOOOOOOOWWWWWWWWNNNNNNNN Section

7


31

Stop the Air Compressor.

When Air Pressure in P-1 had come down close V3 valve and isolate level gauge valves R13,

R14 by equalizing valve.

Stop Cooling Water circulation after 15 minutes.

7.2 EMERGENCY SHUT DOWN:

Stop Drier Heater and Nitrogen Blower.

Open Valve N-1 and close N-2.

Stop Expansion Engine electrically and bring hydraulic system lever to stop position. Open A-1

valve.

Stop L.O. Pump electrically and close O-3 and open O-4.

Open air drain valves VII, A-1 and A-2 and stop air compressor.

Close valves VI/1, A-13, V3, Drier Air valves & Level Gauge Valves

7.3 SHUT DOWN IN CASE OF TROUBLE IN EXPANSION ENGINE:

Shut down in case of trouble in Expansion Engine

Open Air Drain valve A-1, by one turn.

Stop drier heater and Nitrogen Blower.


32

Open N1 and close N-2.

Stop L.O. Pump electrically.

Expansion Engine Inlet valve hydraulic system lever is to be brought to stop position.

Stop Expansion Engine electrically.

Watch air pressure not to exceed limits.

Close V3 Valve

In case of short maintenance VI/1 and Drier Air Valves need to be closed and air compressor

can be kept running. Otherwise they are to be shut.


33

In case of operation of any Oxygen Plant, it is better not to disturb operation much. Normal

operation of Plant is best known by experience in individual Plants. However, the following are

guidelines:

Air Compressor Inlet stage separator drains and moisture separator drains are to be opened and

closed, 30 minutes, to let out condensed moisture. All reading should be noted in a prescribed

Log Sheet. A format of the same is enclosed with the manual. Molecular Sieve Drier Heating and

cooling cycles are to be taken care (Refer M.S. Drier Chapter).

The rare gas vent valve R-22 should be kept slightly open to allow non-condensed rare gases to

escape from Lower Column. It is better to be bubbled through water kept in a bottle or through a

small rot miter.

After starting the Plant, the air pressure to be brought down slowly to about 40 Kgs./cm2 , by

further opening V3 or by bringing up the Inlet cam position of Expansion Engine to 3 or 2, from 1.

This will increase production slightly. However, the upper column level L-2 and purities should

be maintained. The Plant can be maintained steadily if the Upper Column liquid level, column

pressure, air pressure are maintained properly. Every half an hour products Oxygen Purity

should be checked by drawing sample gas from R-27 & R-28.

Section

8 NNNNNNNNOOOOOOOORRRRRRRRMMMMMMMMAAAAAAAALLLLLLLL RRRRRRRRUUUUUUUUNNNNNNNNNNNNNNNNIIIIIIIINNNNNNNNGGGGGGGG OOOOOOOOFFFFFFFF PPPPPPPPLLLLLLLLAAAAAAAANNNNNNNNTTTTTTTT


34

.

S.NO NAME DESCRIPTION

1 T1 ENGINE INLET

2 T2 ENGINE OUTLET

3 T3 BEFORE V3

4 T4 WN2 AFTER P.L SUB COOLER

5 T5 L O BEFORE V8

6 T6 WM2 AFTER LIQUID FAIR

7 T7 N2 AFTER TOP COLUMN

8 T8 R.L BEFORE V4

9 T9 DEFROSTING COLUMN

10 T10 AIR INLET EXCHANGER -1

11 T11 OXYGEN MANY FOLD

12 T12 NITROGEN OUT ATMOSFARE

If any hydrocarbon (particularly Acetylene) is present, in the atmospheric air, or is found due to

excessive heating of the Air Compressor oil, the Acetylene will settle as solid crystal, in the

condenser liquid. Acetylene crystals in liquid oxygen can explode spontaneously, casing serious

accidents. Therefore, once in 8 hours, Liquid Oxygen and liquid air should be drained a little in

order to avoid accumulation of Acetylene. Excess presence of Acetylene in liquid oxygen can

cause explosion. In 5 –liters of liquid oxygen, presence of more the 5 milligrams of Acetylene

(C2H2) or 200 mgs. Of other Hydrocarbons are hazardous. Analysis for presence of Acetylene

in explained separately, and analysis should be done in each shift.

If Acetylene is found to be present, the liquid is to be drained to reduce contamination. If

Acetylene still persists in the liquid oxygen, the plant must be stopped immediately. All liquid

should be drained and the Plant should be defrosted.

The standard operating conditions are the following, but they differ from Plant to Plant.

R-17 40-45 KGS./ CM2 T-1 90 Deg. C. TO – 110 Deg. C (Inlet to Expansion

Engine.)


35

R18 5 KGS./ CM2 T-2 -150/ -165 Deg. C. (Outlet to Expansion Engine)

R19 0.5 KGS./ CM2 T-3 -155/165 Deg. C. (Before V3)

R-17A 75-155 KGS./ CM2 T-10 +15 Deg. C. (Air Inlet)

P-9 42-47 KGS./ CM2 T-7 -190 Deg. C. (Nitrogen from Top Column)

P-13 1.5 KGS./ CM2 T-8 -170 (R1 before V4)

P-14 0.2 KGS./ CM2 EXPANSION ENGINE INLET CAM – 1 TO 3

V3 VALVE 4/17

V4 VALVE 1 + 10/17

V5 VALVE 10/17

If the liquid levels drop and if the Plant is getting warmed up, throttle V3 valve and bring down

Expansion Engine Cam position to increase cold production. When the cam position is brought

down from upper number to lower number, the air inlet pressure will go up and outlet pressure

will come down. The air through Expansion Engine will go up. Similarly, if inlet cam number is

brought up to higher number, air inlet pressure will come down and outlet pressure will go up. Air

throughout will go up but temperature drop across Expansion Engine will be less.

Cylinder filling should be checked. There should not be any gas leaks. Avoid using only waste or

oil in the filling procedure.

Water level should be maintained at half in evaporation cooler.


36

9.1 TECHNICAL DATA:

Type of Absorbent : Molecular Sieve Type 13

Quantity of air handled : 735 m3/hr.

Heating Time : 3 - 4 hours

Cooling time : 5 hours

Changeover Time : 1 ½ hours

Heating Inlet Temperature : Min. 250 Deg.C. To Max. 300 Deg.C.

Heating Outlet Temperature : Min. 150 Deg.C. To Max. 170 Deg.C.

Cooling Outlet Temperature : Min. 30 Deg.C. To Max. 50 Deg.C.

Main Air Inlet Temperature : Min. 8 Deg.C. to Max. 15 Deg.C.

Air Pressure : Min. 35 Kgs./cm2 to Max. 45 Kgs./cm2

Max. Permissible Carbon dioxide in Atm. Air : 0.03 %

Max. Moisture content : 50 % to 70 %

Allowable in Atm. Air relative humidity At 15 Deg.C.

Heater capacity : 15 KW

Heater voltage supply : 400 V.

MMMMMMMMOOOOOOOOLLLLLLLLEEEEEEEECCCCCCCCUUUUUUUULLLLLLLLAAAAAAAARRRRRRRR SSSSSSSSIIIIIIIIEEEEEEEEVVVVVVVVEEEEEEEE DDDDDDDDRRRRRRRRIIIIIIIIEEEEEEEERRRRRRRRSSSSSSSS Section

9


37

9.2 DESCRIPTION:

Each vessel of the Molecular Battery is filled with Molecular Sieve of 1.5 mm. Type 13-X.

As the process air passes through Molecular Sieve the Molecular Sieve will absorb water

vapor and CO2 from the air. After some 10 hours, the Molecular Sieve becomes

saturated, and it will have to be regenerated.

If hot air at low pressure is passed through the saturated Molecular Sieve, the Molecular

Sieve will discharge the CO2 and water vapor and is ready for use again. The absorbing

capacity of the Molecular Sieve drops rapidly if the process air is warm. Therefore, ensure

that the compressed air entering into the Molecular Sieves below 15 Deg.C. And that the

Molecular Sieve is thoroughly cooled after regeneration, before the process air is passed

through it again.

9.3 REGENERATION:

The waste Nitrogen from the Cold Box is passed through an Electrical Heater and then

passed through the vessel to be regenerated. The temperature at the inlet of the vessel

rises rapidly, while the outlet temperature wills rise very slowly. If the outlet temperature

reaches 170 Deg.C. (For about one hour) the Molecular Sieve is regenerated. This

process is known as the heating cycle, which will take 2 /3 hours. At this stage, if the inlet

temperature exceeds 300 Deg.C. The heater must be put off and put on again after 10

minutes. When the outlet put off, but the Cold Nitrogen will continue to pass through the

vessel cooling the Molecular Sieve. This process is known as the cooling cycle which will

last about 4 hours. After cooling, the vessel is ready for use when required for purifying

the process air.

Oil vapor will destroy the Molecular Sieve and therefore ensure that the carbon filter is in

good condition and the process air is as cool as possible, that maximum oil and moistures

condenses out before the air enters the vessel.

While changing from one vessel to the other, pressurize the vessel very slowly, by

opening the valve A-7 or A-8. It may take half a for the vessel to pressurize. If the main


38

valves are opened rapidly, the Molecular Sieve may break up, due to high pressure air

propelling the Molecular sieve in the vessel.

When charging fresh Molecular sieve, lower the same slowly through a pipe, so that it

does not break on falling at the bottom.

Most of the Plant operating problems are caused by the carry over of CO2 into the Cold

Box and its blocking the Heat Exchangers. Satisfactory working of the Molecular Sieve

will avert all these problems. Therefore, maintain and operate this equipment carefully.

The drier valve seats should be in prefect condition and if the air passes through valve

seat both production of plant and regeneration of driers will be affected.

9.4 IMPORTANT:

The Heater should immediately be shut down either in case of Plant shut down or

Expansion Engine shut down. Otherwise, water and water vapor will be drawn from

evaporation cooler by the Blower and will flood the Heater and the drier with water.

9.5 DRIER CHANGE OVER:

When cooling is complete, the regenerated drier is to be lined up, as the other drier would

have become saturated by now. First, the Nitrogen blower is to be switched off. The

Nitrogen valves of regenerated drier are to be closed. Then the regenerated drier will first

be pressurized through pressurizing valve. The pressuring should not be sudden and

hence not through main air inlet valve. The Molecular Sieve pallets will get disintegrated

soon if pressurizing and depressurizing is sudden.

After pressurizing open air inlet valve completely. Open air outlet valve gradually,

watching the outlet air temperature. This temperature will initially go up and thereafter will

cool down. Then open the outlet valve completely. Start closing the outlet valve of the

drier on line, taking care of common air outlet temperature. Then close air outlet and inlet

valves of drier, which was on line tightly. Depressurize the drier by depressurizing valve.


39

The open the Nitrogen valves of the drier to be regenerated. Start the Nitrogen Blower.

Check flow of the gas at the regeneration Nitrogen vent. The switch on the drier heater for

starting heating cycle of drier. Check for proper performance of drier heater.

9.6 DRIER CHANGEOVER (In Short):

Imagine No. 1 drier is ready after regeneration. (In case of No. 2 Drier adjusts the valves

given in brackets.)

1. Stop Heater.

2. Close N-5 and N-7. (N-6 & N-8)

3. Close A-9 and open A-7 and A-8

4. Watch P-5 to increase gradually for ½ an hour. (P-6)

5. When P-5 and P-6 are almost equal, open A-3. (A-4)

6. Close A-7, A-8 and A-9.

7. Open A-5 slowly watch T-4. (A-6)

8. After 15 minutes open A-5 fully and start Closing A-6 slowly. (A-6, A-5)

9. After 15 minutes close A-6 and A-4 Completely. (A-5, A-3)

10. Open A-9 and A-8 (A-9, A-7)

11. P-6 will come down (P-5)

12. When P-6 reads minimum, open N-6 & N-8 (P-5, N-5, N-7)


40

Start heater and check the amperes in each phase

To ensure that no heater is burnt.

All Starting Drier Heater and watch T-13.

9.7 REPLACEMENT OF MOLECULAR SIEVE:

Molecular Sieve is to be replaced if:

It becomes powder.

If it gets contaminated by oil; or

If it looses its adsorption capacity:

The above will be known by frequent checking of Cold Box Equipments.

To change Molecular Sieve, open the top and bottom flanges of drier vessels. Remove

the filter at the bottom. Collect the old Molecular Sieve, which will fall down. Clean the

filters blow the drier vessel.

Fit the bottom filter. Charge about 3 kgs. of Alumina. Then charges Molecular Sieve Type

13X, size 1.5 mm., size 1.5 mm. about 90 kegs. The Molecular Sieve should be sieved

and

be free of all smaller size particles. It is better to charge through a long funnel so that

Molecular Sieve does not fall with a force and break. Charging is normally done by hand.

When level of Molecular Sieve is just at the brim of dished end of drier vessel, stop

charging. Then fill up the doomed portion with alumina. Fit the top filter after cleaning.


41

10.1 TECHNICAL DATA:

Type of Expansion Engine : Vertical – Dry Type

: SEM 0.5/1

No. of Cylinders : 1

Diameter of Cylinder bore : 80 mm.

Piston Stroke : 125 mm.

Speed : 220 R.P.M.

Inlet Air Pressure : 40 – 45 Kgs. /cm2

Outlet Air Pressure : 5 Kgs. /cm2

Inlet Valve opening time Cam setting position : 8

Power required or supplied : 7.5 H.P.

Piston Head clearance : 1.2 + 0.2 mm.

Inlet valve Pestle clearance (app.) : 0.5 TO 0.6 mm.

Outlet valve Pestle clearance (app.) : 0.6 TO .7 mm.

EEEEEEEEXXXXXXXXPPPPPPPPAAAAAAAANNNNNNNNSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEENNNNNNNNGGGGGGGGIIIIIIIINNNNNNNNEEEEEEEE

Section

10


42

10.2 DESCRIPTION:

The Expansion Engine is a vertical single – acting reciprocating type engine. This

produces the cold required for operating the Plant. The high pressure air enters through

inlet valve at the start of downward stroke of the piston. On further downward motion, the

inlet valve closes and entrapped air expands. During upward stroke, outlet valve remains

open and inlet valve remains closed.

Therefore, in downward stroke air enters the cylinder and expands. In the upward stroke

the expanded air is pushed out side. The electric motor is used initially to start the

machine. Thereafter the engine is moved by the air pressure itself and during which time,

the engine motor retains the flywheel it loses its heat content (enthalpy). Thus the air gets

cooled. This cooling is more than that of an expansion in and expansion valve.

An elementary factor for function of Expansion Engine is to use dry and Carbon Die-oxide

free air, as otherwise, ice and dry ice will form or valve seats, causing mal-function.

The approximate temperature drop across Expansion Engine is 50 to 70 Deg.C.

Depending upon inlet air pressure, temperature and inlet cam position.

The Expansion Engine can be considered as three major units:

The drive unit, the cylinder unit for air expansion; and the hydraulic system for operating

the valves.

The drive unit is similar to any reciprocating machine with usual parts, such as, crank

case, crank shaft, connecting rod, crosshead etc. The Expansion Engine has an extended

crankshaft to enable to accommodate the cams for valve lifting and is housed by a cam

box. The moving parts are lubricated through a hole in crank shaft. Oil scrapper rings are

provided to prevent oil escape to cylinder unit.


43

The cylinder unit handling process air consists of cylinder, piston, inlet and outlet isolation

valves. Pressure gauges and the ball valve assemblies. The ball valves are actuated

mechanically by a push rod as per the timing transmitted by the came. The push rods are

housed in a stuffing box to avoid air leakage and are outdated by the hydraulic system.

The hydraulic system is the control system. As per schematic sketch enclosed the

hydraulic oil is fed by a pump to (a) pressurized oil container for valve actuation (b) to

lubricate crankshaft and drive unit parts and (c) to lubricate the rolled holders. Oil

pressure at P-15 should be 1.5 to 2 Kgs. /cm2 and can be adjusted by a value mounted

on the pump. The oil specification should be viscosity 6.5 Deg.C. Angler at +50 Deg.C.

And specific gravity 0.91 kgs. /cm2. Flash point of at least +175 Deg.C.. Solidifying point

of at least –5 Deg.C. This requires an addition of Silicon Deforming agent of 1 – 2 drops

per liter of oil.

Oil from pressurized oil container is fed to two control oil push pumps for inlet and outlet.

The outlet valve cam rigid with one cam position creates a to-and-fro motion on the roller

holder of the push pump. This motion is received by the pistons of the push pump and

develops an oil pressure pulsation. This pulsation is transmitted to valve piston through a

piping. This piston in valve pestle again transmits the pressure pulsation into a

mechanical to and fro suction. As the piston of valve pestle is in line with the push rod, the

ball valves are operated. Similarly, the inlet valve push pump operates the inlet ball valve

as per the cam setting. The inlet valve cam has 8 different cam settings and the required

cam setting is set by the selector arrangement. To change cam position : (a) release

locking device of cam setting; (b) unload Expansion Engine by unloader valve; (c) change

cm position by turning cam selector wheel; (d) check cam position by noting the pointer

on cam number; (e) load Expansion Engine and (f) lock cam setting device by tightening

lock handle on cam selector. The effects of different cam settings mentioned in the Plant

start up procedure.

The Expansion Engine inlet ball valve is brought to close position by bypassing oil

pressure pulsation/displacement from inlet push pump to pressurized oil container by an

unloaded ball valve provided in the Top Box.


44

There are air release valve at each valve pestle. During initial start up, air should be

released; (a) at air release plug of oil pressure container;

There should be no leaks in hydraulic system for best performance of engine. The oil

pressure of 1.5 kg/cm2 should be maintained.

10.3 SAFETY:

In case of the power failure to the engine its braking mechanism will fail and this

accelerating speed of the machine. To prevent this air supply to the engine should be cut

– off.

a. A leaver load/unload valve is provided in the expansion engine, which can be operated

by hand. This too will close the air inlet o the engine and can be operated by the operator

when required.

A safety valve (bursting disc) is provided in the air outlet line before air out isolation Valve

A-14. This safety is set to blow at 8 Kgs. /cm2.

Nitrogen purge is provided in distance piece below cylinder and in valve pestle housing to

prevent atmospheric moist air to form frost on colder parts.

10.4 OPERATION:

10.5 START UP:

Check oil level in crank case, cam case and pressure oil container.

Open air outlet valve, Nitrogen purge valve and oil feed valve to control push pump.

Start the motor and check direction of rotation.


45

Observe oil pressure and release air locks.

Check outlet valve lifting and inlet valve lifting by changing lever of ball valve.

Open air inlet isolation valve slowly.

10.6 NORMAL RUN:

Check for oil levels, oil pressure, oil leaks, air lock in oil system and multifunction of

hydraulic system and set right.

Check if valve lifting is normal.

If stuffing box of valve push rods is leaking, the Engine is to be stopped and attended to.

Avoid temperature less than –165 Deg.C.

Check that the cooling is proper by seeing temperatures T1 & T2.

Change inlet valve cam position, if necessary, as detailed in plant start up.

10.7 SHUT DOWN:

Unload inlet valve pestle by operating load/unload valve in hydraulic system.

10.8 Stop Motor:

Close air inlet valve.

10.9 Maintenance:

10.10 Change of Piston Rings:

Normally the Expansion Engine Piston rings wear out in about 4/6 months time but during

the first year it is advisable to change earlier due to running in other cylinders lines. They

have to be changed. The rings wearing out can be noticed by excessive air leak, at the


46

bottom of the engine cylinder. If the cover plate of the distance piece is removed the leak

can be felt.

Isolate Engine by closing the main inlet and outlet isolation valves (A-13 & A-14). Open

the cylinder head on top of the Engine. Remove the oil scraper rings. Its housing is to be

dismantled from the crank case, and is to be kept lifted up. Rotate the flywheel to attain

top dead center. Remove the stud nuts of the piston rod bottom mounting flange. Hold the

piston in position by lever and rotate the flywheel, so that the cross head gets

disconnected from piston rod. Unscrew the piston rod mounting flange from piston and

also remove the oil scraper housing. Now, the piston can be lifted from the top using eye-

bolt threaded to the top of the piston. The piston rings and the guide rings are to be

changed if worn out. While placing the new rings, take care that the play between bud

joints of a ring is about 0.4 to 0.5 mm. The ring gaps are to be staggered at a degree of

120. Tension rings are provided on the inner for proper working of the rings. Now the

piston with piston rings should be inserted in a liner provided for the purpose of

maintenance. This liner with piston ring assembly inside is to be placed on top of cylinder,

such that, the liner is in line with the cylinder. Now push the piston rod along with the

rings, so that, the rings slide from the liner to main cylinder without distortion or

expansion. After the piston has been pushed completely inside the main cylinder, the liner

provided for the purpose of ring insertion is to be removed.

Insert the scraper ring housing inside the piston rod and then thread in the mounting

flange on the piston. Tight the flange with stud bolts of the cross head. Fix the oil scrapper

ring housing and oil scrapper rings.

Rotate the flywheel and check for free rotation. Place the small piece of lead on top of the

piston and fix the cylinder head. Now rotate the flywheel for at least two rotations.

Remove the cylinder head; check the thickness of lead which indicates the head end

clearance. This should be above 1 mm. and less than 2 mm.

10.11 Valve Maintenance:

The inlet and outlet ball valve should be maintained properly for efficient performance of

the Expansion Engine. The valves can be opened by opening the cap nut of the press


47

screw. Then loosen the press screw. Remove the valve top block by unscrewing. The ball

valve assembly can now be taken out by using a small eye-bolt. The ball valve assembly

is to be dismantled. Check for spring tension, for no scratches either on the ball or on the

ball seat. Reassemble the valve after cleaning with C.T.C. The whole assembly can be

assembled as it was opened.

The clearance between the valve hydraulic pestle and the push rod of the ball valve

should be such that it has around 0.4 mm. in inlet and 0.3 mm. in outlet or as per plant

engineer. To check the same, remove the spring in the ball valve assembly and fix a solid

wooden piece and tighten the valve assembly. Also tighten the valve top block. Using a

lever, lift the push rod and the piston of the hydraulic valve pestle, using a feeler gauge.

To vary the clearance, the check nut of the screw on top of the piston of the hydraulic

valve pestle is to be loosened. Then either by tightening the screw or loosening the

screw, the clearance can be varied. After setting the clearance, the check nut of the

screw is to be tightened. After every maintenance of the ball valve, it is better to check the

clearance of the push rod.


48

11.1 TECHNICAL DATA:

Type of Pump : Reciprocating

Number of Cylinders : 1

Cylinder diameter : 24mm.

Piston Stroke : 100 mm.

Speed : 125/150 R.P.M.

Suction Pressure : 0.5 Kgs./cm2

Discharge Pressure (Final Max.) : 150 Kgs./cm2

Operating Temperature : -183 Deg. C.

Normal Delivery : 100 m3/hr.

LLLLLLLLIIIIIIIIQQQQQQQQUUUUUUUUIIIIIIIIDDDDDDDD OOOOOOOOXXXXXXXXYYYYYYYYGGGGGGGGEEEEEEEENNNNNNNN PPPPPPPPUUUUUUUUMMMMMMMMPPPPPPPP Section

11


49

11.3 DESCRIPTION:

The Liquid Oxygen Pump is a single stage, single acting piston pump. It is used for filling

oxygen into cylinders up to a pressure of 150 Kgs./cm2.

The pump is designed for assembly in air separation unit that works by pumping liquid

oxygen and gasifying the same in Heat Exchangers for final filling as gas in cylinders.

Control of liquid feed is not necessary, because the pump is designed in accordance with

the plant size and the liquid produced is constantly pumped off.

The drive unit is similar to any reciprocating machine with the crank shaft, flywheel,

connecting rod, cross head etc. as can be seen from the drawing supplied with the

manual.

The Liquid Oxygen Pump consists of a stainless steel inside liner with liquid in-let and

evaporated gas outlet port. There are no valves on theses ports, which are closed by the

piston itself on the pressure stroke. The third outlet is the main discharge outlet with the

two non-return ball valves. The two valves remain firmly closed during suction stroke due

to high pressure in partly filled cylinders.

To ensure that these valves are fully closed, a positive pressure of about 40-60 kgs/cm2

must be maintained on it. When a fresh batch of cylinders is taken for filling open the

manifold valve slowly or uses a spare batch of cylinders to ensure a positive pressure on

these valves. Most mul functions of the pump are due to these valves not closing

properly.

When the pump is operated liquid oxygen from the main condenser enters the outer

jacket of the pump. Some of this liquid evaporates due to heat produced in pumping and

the vapor is passed out through the upper port back into the upper column as gas. The

main stream of liquid oxygen is taken into the pump cylinder and compressed out by

piston in the pressure stroke. This high pressure liquid oxygen passes through two non-

return valves into the heat exchangers and then to the cylinder filling rack.


50

If the molecular sieve is not working properly, some carbon dioxide and moisture will

condense into the condenser and will travel to the L.O Pump inlet where a filter is

provided. The solid CO2 may block the filter and the pump will not operate efficiently.

In such an event the L.O. Pump should be defrosted. This way, the solid carbon dioxide

will be removed and the pump will now work satisfactorily unless there is a continuous

carry over of CO2. Drain a little L.O in a double walled Dewar’s flask and check against

light. If the liquid is turbid, there are CO2 crystals in it. If it is clear the fault is elsewhere.

11.4 ERECTION:

During dispatch of the plant, the drive unit along with the inside pump is detached from

cold box. The drive unit should be placed on its foundation. The bolts connecting the drive

unit mounting flange to the cold box should be loosely tightened. This piston rod is to be

rightly connected to the cross head. Now, the alignment should be such as the piston rod

in the dead center of stuffing box. This can be checked by means of a feeler gauge,

around the piston rod in stuffing box casing. This clearance should be same for any

forward and backward position of piston. When this is centralized, the piston moves

smoothly. The connecting bolts can be tightened without upsetting alignment and the

drive unit is to be grouted.

11.5 LUBRICATION:

Before starting the crank close is to be filled with oil at two thirds (2/3) of oil level gauge

through the breather in the back side. The oil specification are : Viscosity 6.5 , at +50

DegC, specific gravity 0.91 kgs/cm2 , flash point +175 DegC and solidification point max

5 DegC. The oil should be changed in 1000 hours.

Oil is sucked from crank case through filter by gear oil pump, which is directly driven by

crank shaft. There is a pressure regulating valve in the pump. The pressurized oil enters a

pressure chamber and enters oil holes drilled through crank shaft, big and bearing,


51

connecting rod, cross head. An oil pressure gauge P-16 is provided which should

normally be 0.5 to 1.0 kg/cm2.

The end bearing of crank shaft main bearing is lubricated by splash of oil by the crank

shaft. To avoid any escape of lubricating oil along the piston rod, a rubber ‘0’ ring is

provided around the piston rod. This ‘0’ ring is held in position by a cover plate at front

side (Piston end side) of crank case.

In spite of this precaution, oil wetting of piston rod is to be checked often. Remove oil film

if any by spraying carbon tetrachloride. Any escape of oil from drive unit to pump side

should immediately be attended to. As a precaution before starting the pump, the piston

rod should be cleaned with CTC.

11.6 OPERATION:

Open return oxygen gas vent valve V8A gradually, watching upper column P3 pressure.

Open liquid oxygen inlet valve V8 gradually. The level in upper column will fall down

initially and then wait till it again builds up.

Check for liquid – flow by opening valve.

Check free rotation of flywheel by hand. Clean L.O Pump piston with CTC. Open Nitrogen

purge for stuffing box.

Start L.O pump motor, check for right direction of rotation. It should be anti – clockwise

when viewed from flywheel side.

Oil Pressure P-16 should build up to 1.0 kgs/cm2. If not release air through pressure

gauge valve P16.

Check for flow of oxygen in vent at manifold.

During normal run, check for any gland leaks of liquid oxygen in piston rod of stuffing box.

If it leaks, tighten gland nut after warming with warm water. If it further leaks, stuffing box

asbestos pickings are to be change.


52

11.7 CAUTION:

Always keep the L.O Pump parts of pump unit free from oil and grease. Refer chapter on

safety.

11.8 MAINTENANCE:

11.9 FILTER:

Remove cold box cover plate on right side in L.O. Pump housing. Remove slag wool, the

filter and cover can be removed by opening its outer nut. An insert made of sintered

bronze is fixed inside. It can be cleaned by initial blowing with high pressure nitrogen then

CTC washing and again blowing with nitrogen. While fixing back sure there are no gas

leaks, by conducting a pressure test.

11.10 CYLINDER PISTON AND PISTON RINGS:

The inside liner can be remove along with piston rod and rings. Detach piston rod from

cross head by opening cross head cap remove. Remove stuffing box cover nut, lantern

ring and pickings. Remove non-return valve on pump end side and cap nut. Pull out

inside liner with a small puller. The liner with piston rod will come out. Remove piston rod

from liner and inspect piston rings. There are four sets of Teflon rings and one guide ring.

If the rings are damaged, replace them. Clean all parts with CTC. Fix new Teflon

asbestos rope of 3 mm O.D, around liner. Push piston rod with rings inside liner. They

should not be cut by port holes in to-and-fro motion. Insert the assembly as it was

removed connect piston rod to cross head. Check head and clearance of pump to be not

less than 1 mm. Fix cap on pump end. Assemble stuffing box with new graphite

impregnated asbestos packings.

NOTE:IN CASE OF TYPINGERROR/MISTAKE IN COMPILING,PLEASE BRING TO OUR

NOTICE

PLEASE USE THE GENUINE SPARES ONLY


53

All personnel being employed for work in connection with oxygen/rich air should be cautioned

concerning the hazards involved and precautions to be observed.

12.1 WARNING:

Oil grease or similar substances must not be allowed to come into contact with

compressed oxygen or liquid oxygen. Contact of this substance with oxygen may result in

an explosion. Personnel working in an area of possible oxygen concentration, such as

near an oxygen vent or a liquid oxygen spillage, or in a trench where oxygen seepage

and concentration might occur, must ensure that their clothing is free from contaminations

of oxygen before lighting a cigarette or approaching a naked flames. It is essential that

the clothes be dries for at least 15 minutes before approaching a flame after any such

contamination.

The following precautions must be strictly observed at all times:

1. Thoroughly wash all oxygen fittings, valves and parts with clean Tricolor Ethylene /

carbon tetra chloride (CTC) before installation. Never use petrol, kerosene or other

hydrocarbon solvents for this purpose. All tubing, lines valves etc. to be used in oxygen

service, must be of an approved type and must be thoroughly degreased and blown out

with clean oil-free compressed air or Nitrogen before being placed in service.

2. Do not permit the release of Acetylene or other flammable gases in the vicinity of the

plant air intake. A concentration of Acetylene exceeding 5 parts per million in liquid

oxygen may explode with extreme violence. Strict supervision is essential to minimize the

possibility of contamination.

Section

12 SSSSSSSSAAAAAAAAFFFFFFFFEEEEEEEETTTTTTTTYYYYYYYY PPPPPPPPRRRRRRRREEEEEEEECCCCCCCCAAAAAAAAUUUUUUUUTTTTTTTTIIIIIIIIIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS FFFFFFFFOOOOOOOORRRRRRRR

AAAAAAAAIIIIIIIIRRRRRRRR SSSSSSSSEEEEEEEEPPPPPPPPAAAAAAAARRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN PPPPPPPPLLLLLLLLAAAAAAAANNNNNNNNTTTTTTTTSSSSSSSS


54

3. The plant and the plant vicinity must be kept clean and free from abstractions at all times.

Any oil leak within the plant surrounding must be rectified without delay. Oil spillage must

be cleaned up immediately using rag and carbon Tetra Chloride.

4. Do not lubricate oxygen valves, regulators, gauges or fitting with oil or any other

substance.

5. Ensure that insulation removed from the Air Separator jacket is not contaminated with oil

or other inflammable materials. Personnel carrying out maintenance on the Air Separation

Plant equipment must wear clean overalls and their hands and tools must be free of oil.

This ensures that the insulation and equipment within the jacket is not contaminated with

oil. Should contamination take place the affected materials must be discarded and

replaced by clean new material?

6. Do not fasten electric conduits to the plant or its pipelines.

7. Do not use oxygen as a substitute for compressed air, spark present in an atmosphere of

oxygen will immediately burst into flame.

8. Do not fill any container or pipe line with oxygen unless it has been thoroughly degreased

with clean CTC or TCE.

9. When discharging liquid oxygen or rich liquid from drains, valves or pipe lines, open

valves slowly to avoid the possibility of being splashed. In particular ensure that liquid

does not run into shoes or gloves. Contact with liquid oxygen rich liquid will cause

frostbite evidenced by paleness and numbness of the skin. The affected parts must be

batched at once in cold (not box) water and seek medical attention immediately.

10. Do not breathe cold oxygen vapor. The temperature of the vapor rising from liquid oxygen

is approximately – 181 Deg C. A deep breath of vapor at this temperature can result in

frost-bitten lungs with resultant serious illness and permanent disability or death.

11. Do not experiment with liquid oxygen by putting solids or liquids into it for the purpose of

watching the effect of the cold liquid. The object placed in the oxygen may catch fire or

explode.

12. Do not pour liquid oxygen on the floor of the shop or around any object that can catch fire.

As the liquid oxygen vaporizes, the cold vapors may be swept along ground into contact

with combustible material. The whole floor of an office is known to have caught fire when

oxygen vapors contacted a lighted cigarette butt. Spillage of liquid oxygen must be

avoided


55

13. especially in the vicinity of lubricated machinery, asphalt paving, concrete surface

containing bitumen joints or where the liquid oxygen can flow into drains or sewers.

14. Do not use any pipe jointing on oxygen pipe threads except approved for oxygen service.

Ordinary pipe jointing contains grease as a lubricant and will catch fire.

15. Compressor and Expander lubricating oil consumption must be regularly checked any

excessive consumption must be investigated immediately and the cause rectified.

16. The cold box atmosphere must be checked at least once in a week. If local frost spots

occur or if liquid level is unaccountably lost in the plant, and if any check indicates oxygen

concentration above 21%, immediate action should be taken to locate and rectify.

17. The use of a flame ( e.g. for welding or cutting) in the immediate vicinity of the Air

Separation Plant or oxygen piping must be permitted only when the plant has been shut

down and de frosted and when the oxygen content of the air within the equipment

concerned does not exceed the atmospheric normal of 21%. Do not attempt repair until all

pressure is released from the section to be dismantled.

18. Remember that pressure alone is not dangerous. A Boiler at 0.7 Kg/cm2g may be more

destructive in the event of an explosion than a small container at 220 kgs/cm2 owing to

the greater mass of metal involved. In general, fluid at high pressure and moving at a high

velocity are the most dangerous. Use a face shield or chemical type safety goggles when

using the oxygen or nitrogen test set to prevent possible injury to the operator in the event

of a blow-back of the reagent.


56

The purity of the oxygen product and the oxygen content of the crude nitrogen gas is measured

sample of gas and a highly activated form of copper contained in a saturated solution of

Ammonium chloride in Ammonium Hydroxide. The reaction is affected in a glass tube, which is

contained in a cylindrical reservoir. The sample of gas is passed into the burette and measured.

The sample is then drawn through the interconnecting rubber and glass tubing into the reaction

chamber where the oxygen reacts with copper to form copper oxide. The oxide formed is

immediately dissolved by the solution of Ammonium Chloride in Ammonium Hydroxide. When

the reaction is complete the residual gas is returned to the burette for measurement. The

apparatus is calibrated to give a direct reading for oxygen purity, in the region of 99.6%.

13.1 TEST APPARATUS:

The test apparatus is as per sketch enclosed:

There is a gas entry (I) at the right extreme where sample gas can be hosed. There is a

3- way stop cock ‘G’ to permit the gas to be bubbled through glass tube inserted in a

purging vessel ( or to the burette) as desired). There is a graduated burette ‘A’ in the

middle, connected on one side with the purging vessel and the other side with the

reaction chamber ‘D’ through a 3 – way stop cock ‘H’ the burette is connected with a

leveling bottle by a rubber pipe. The reaction chamber is enclosed by a reservoir ‘E’.

There is a rubber cork fitted in the bottom of the reservoir which also partly closes the

reaction chamber bottom to avoid the copper wire coming out of the chamber.

OOOOOOOOXXXXXXXXYYYYYYYYGGGGGGGGEEEEEEEENNNNNNNN TTTTTTTTEEEEEEEESSSSSSSSTTTTTTTT SSSSSSSSEEEEEEEETTTTTTTT Section

13


57

13.2 PREPARATION OF TEST:

Prepare the test solution by mixing one volume of Sp. Gr.0.90 Ammonium Hydroxide

(NH4OH) with two volumes of distilled water and add Ammonium Chloride until solid

crystals remain undisclosed at the bottom of the container.

Invert the reaction chamber set, remove the rubber cork ‘F’ and fill the reaction chamber

‘D’ with copper wire in spiral form replace the bung and return it in an upright position and

connect with the burette tubing.

Fill the reservoir and reaction chamber three quarter with fresh test solution with the

leveling bottle ‘B’ held below the level of the burette, half fill the bottle with the test

solution.

Draw the test solution from the reservoir in the reaction chamber by turning the burette

stop cock ‘H’ to connect the burette with the reaction chamber and then lowering the

leveling bottle. Squeeze the rubber pipe to expel all the air and then close the stop cock,

so that reaction chamber and the inter-connecting rubber pipe are completely filled with

test solution.

The purging vessel (lute) is half filled with water and the sample gas to be tested is

allowed to bubble through water to atmosphere. Fill the burette with fresh solution by

turning the stop cocks ‘G’ and ‘H’ to connect with the purging vessel, so that , all the air

gets expelled. Repeat it till all the air bubbles are removed. When solution commences to

flow from the burette to glass tube, close the stop cock ‘G’ close the cock it and replace

the leveling bottle in the holder.

13.3 TEST PROCEDURE:

Open the stop cock ‘G’ adjust the gas flow and allow the sample gas to babble through

the purging vessel for one or two minutes. Check that the burette and test connection

tubes are completely filled with solution. Turn the stop cock open to the burette

connection. Then slowly open the cock ‘H’ and allow the oxygen to pass into the burette

(not to the reacting


58

chamber), controlling the oxygen flow. When the burette is filled below the bottom mark,

close the stop cocks ‘H’ & ‘G’.

Adjust the level of the gas in the burette to the 100 cc mark by holding the leveling bottom

at the level of the liquid in the burette and carefully open the cocks ‘G’ and ‘H’ to bubble

through the purging vessel to atmosphere.

Pass the gas sample into the reaction chamber by turning the burette stop cock ‘H’ to

connect with the reaction chamber and raising the leveling bottle. The sample should be

passed between the burette and chamber several times.

On the first passage into the reaction chamber, the volumes of gas sample are greatly

diminished. The oxygen in the sample reacts with the copper to form an oxide which

dissolves in the solution. After the first passage of the sample, the volume diminution

becomes progressively less until all the oxygen has been absorbed by the copper and

only the uncreative impurities remain unabsorbed.

Transfer the unabsorbed gas from the reaction chamber to the burette by the lowering the

leveling bottle. Do it a few times to ensure that gas bubbles are not trapped in the tubing.

When all the unabsorbed gas has been passed into the burette and the leveling bottle

and observe the amount of unabsorbed gas which present the percentage of impurity of

the sample.


59


60

The oxygen test set can also be used as a nitrogen test set by using stick phosphorous in place

of copper wire and water in place of Ammonium Chloride solution. Yellow or white phosphorous

submerged in water is used for absorbing the oxygen (which is principle impurity in the nitrogen

gas) to form phosphorous pent oxide, which is soluble in water. The volume of remaining gas

nitrogen is then measured in the burette. A downward graduated burette may be used for easy

reading.

14.1 WARNING:

It is dangerous to pass gas containing more than 7% oxygen into the phosphorus test set.

Phosphorus is highly combustible when exposed to air. Always keep it completely

immersed in water both in the test set and in storage. Use tongs when handling

phosphorus. Do not handle with the fingers.

14.2 PREPARATION OF THE TEST SET:

Invert the reaction chamber, remove the rubber cork ‘F’ pinch the rubber tube to close it and fill the chamber and the reservoir with water. Using tong fill the chamber with 3/16 or ¼ inch diameter stick phosphorus.

Cork the reaction chamber and connect the chamber to the stop cock ‘H’ Fill the leveling

bottle and the purging vessel half with water. Turn the stop-cock to connect the reaction

chamber with the burette and lower the leveling bottle. The water from the reservoir will

rise in the reaction chamber and will flow down in the burette through stop-cock ‘H’ then

turn the stop cock ‘H’ to open to the purging vessel, at the same time, turn open cock ‘G’

also. Raise the leveling bottle so that water will raise through the burette, cock ‘H’, the

rubber tube connection and the cock ‘G’ and finally it will tickle down to the purging

vessel. By raising and lowering the leveling bottle a few times, all the air present in the

burette and the rubber tubing connections including the cocks ‘G’ & ‘H’ should be

expelled. After checking for air bubbles in the chamber and the burette, close the clock ‘H’

and turn open the cock ‘G’ for sample gas connection. The sample gas to be tested in

allowed to bubble through wate to atmosphere.

NNNNNNNNIIIIIIIITTTTTTTTRRRRRRRROOOOOOOOGGGGGGGGEEEEEEEENNNNNNNN TTTTTTTTEEEEEEEESSSSSSSSTTTTTTTT SSSSSSSSEEEEEEEETTTTTTTT Section

14


61

Crack the Nitrogen purity test valve , open the stop-cock ‘G’ , adjust the gas flow and allow the

sample gas to bubble through the purging vessel for one or two minutes. Check that the burette,

the reaction chamber and the test connection tube are completely filled with water. Turn the

stop-cock open to the burette connection. Then slowly open the cock ‘H’ to allow the oxygen to

pass into the burette (not the reacting chamber), controlling the nitrogen flow. When the burette

is filled below the bottom mark, close the stop – cocks ‘G’ and ‘H’ and disconnect the nitrogen

sample tube , close the test valve.

Adjust the level of the gas in the burette to the 100 cc mark by holding the leveling bottle at the level of the water in the burette and carefully opening the cocks ‘G’ & “H’ to bubble through the purging vessel to atmosphere. NOTE:

1. When first passed into the burette, the Nitrogen sample will be colder than the room

temperature and will expand as it warms. Therefore, the sample should be allowed to

warm to room temperature for several minutes before the level is adjusted to the zero

mark.

Pass the gas sample into the reaction chamber by turning the burette stop cock ‘H’ to

connect it to the reaction chamber, then raising the leveling bottle. Close the stop cock,

replace the leveling bottle in the holder and allow the oxygen in the sample to react with

the phosphorus. The reaction results in the emission of the white smoke consisting of

phosphorus pent oxide dissolve in water to form phosphoric acid. When reaction is

complete, as indicated by smoke ceasing to emit, open the cock and lower the leveling

bottle to pass the unabsorbed gas from the reacting tube into the burette, pinch the

rubber tube to ensure no bubbles are trapped in it.

Level the liquid in the burette and the leveling bottle and note the reading indicated on the

burette scale at the liquid level. This reading is equal to percentage of purity of the original

Nitrogen sample.

2. The gas sample may be warm due to the reaction of the oxygen purity with phosphorus.

Allow it cool to room temperature for several minutes before adjusting the level to the zero

mark.

TTTTTTTTEEEEEEEESSSSSSSSTTTTTTTT PPPPPPPPRRRRRRRROOOOOOOOCCCCCCCCEEEEEEEEDDDDDDDDUUUUUUUURRRRRRRREEEEEEEE Section

15


62

Water from whatever source it comes from contains (Ca++), Magnesium (Mg++) & Sodium (Na-) present as sulfates, chloride & bicarbonates of these ions. By hard water, we mean water that it contains calcium & magnesium salts in excess, which hinders formation of Soap, Lather during washing of clothes and which may form deposits in metal surfaces of equipments which carry this hard water.

� Example : Scale formation in boiler tube, Domestic piping & Geysers heaters, Coolers. The hardness therefore has to be removed or converted into a Soluble form. For removal of hardness (Ca & Mg Ions) Water Softening through ion exchanger resin is the ideal process to convert the hardness forming ions into soluble Sodium (Na) ions. The TDS being sum of Ca, Mg & Na is does not change but water becomes soft, that means it is fit for Laundry, Cooling water make up & Steam Production in Boilers.

� What is a Softening Resin : Ions Exchange Resin are Copolymers of Polystyrene Di-Vinyl Benzene & when these are charged (or brought into contact) with common salt (NaCl), they absorb Sodium ions on their surface as per following Equation : (Reactions during Charging) RCa + 2NaCl = R (Na) 2 + 2 CaCl2 RMg + 2NACl = R (Na)2 + MgCl2 Here ‘R’ denotes Resin. After charging water is passed through the Resin-bed to remove excess salt (Rinsing).

� Reaction During Service Run : R (Na)2 + Ca(HCO3)2 = RCa + 2NAHCO3 R (Na)2 + Mg(HCO3)2 = RMg + 2NAHCO3 R (Na)2 + CaCl2 = RCa + 2NaCl R (Na)2 + MgCl2 = RMg + 2NACl When all Sodium absorbed on resin surface is exhausted the resin does not accept any Ca, Mg and has to be recharged or regenerated with Common salt (as per above process). Before recharging it is necessary to backwashing i.e. by making the raw water enter the vessel from inlet side & flowing through the entire bed of resin to loose it for regeneration.

Section

16

SSSSSSSSOOOOOOOOFFFFFFFFTTTTTTTTEEEEEEEENNNNNNNNIIIIIIIINNNNNNNNGGGGGGGG OOOOOOOOFFFFFFFF HHHHHHHHAAAAAAAARRRRRRRRDDDDDDDD

WWWWWWWWAAAAAAAATTTTTTTTEEEEEEEERRRRRRRR((((((((TTTTTTTTHHHHHHHHEEEEEEEEOOOOOOOORRRRRRRRYYYYYYYY))))))))

((((((((TTTTTTTTHHHHHHHHEEEEEEEEOOOOOOOORRRRRRRRYYYYYYYY))))))))


63

� When to Regenerate : In a softener which is running to produce Soft Water if

1. Hardness shoots up from its steady value of less than 5 ppm. 2. If the theoretical outlet between two regenerations is already achieved.

Maintenance Instructions

In a portable Softener there are precautions only to be taken and no major maintenance is involved. However following components require replacement if these start leaking of get corroded.

� Inlet flexible pipe & nipple. � Multiport valve 3/4” size which has to be operated through a Single lever to do all

operations i.e. backwashing rinsing & lining up through same valve. � FRP Body if its gets cracked. � Softener Resin (Sodium Base) if it is badly fouled.

Important Instruction:

When changing the position of lever of multi-port valve, always close the water supply first & after changing the lever open the same.


64

MOUNTING AND OPERATING INSTRUCTION MANUAL


65

Differential pressure and flow meters Media:04/4/4Z/4A For : Differential pressure measurement. Liquid level measurement. Flow measurement. Flow rate counting. Transmitting.


66

1.MODE OF OPERATION 1.1 Indicating Mechanism The media indicator consist of a differential pressure cell with measuring Diaphragm and measuring spring,and the indicating unit with pointer mechanism and scale.

The differential pressure ∆P=P1-P2 produced,creates a force on the measuring diaphragm.Which is balanced by the measuring spring (1.5). The deflection of diaphragm (1.6).and the lever (1.11),which is proportional to the differential pressure,is transferred from the pressure cell to the flexible Gasket.(1.12) and transmitted to the gear mechanism via the range plate (2.7) and the adjustable feeler roll/Adjusting lever (2.3).The indication for differential pressure/level is linear and for flow rate it is quadratic because of the relationship of the flow rate Q and the differential pressure ∆P according to the equation. Q=K√∆P 1.Differential pressure cell. 1.1.Housing 1.2.High pressure head. 1.3.Low pressure head. 1.4.Spring. 1.5.Measuring spring. 1.6.Measuring Diaphragm. 1.7.Diaphragm plates. 1.8.Diaphragm shaft. 1.9.Guide springs. 1.10.Connection link. 1.11.Lever. 1.12.Gasket. 1.13.Disc. 1.14.Screw. 1.15.O. Ring. 1.16.Tension band. 1.17.Overangeable coupling. 1.18.Washer(S).


67

MEDIA 4.TOP VIEW SECTION 2.Indicating Unit. 2.1.Rear cover. 2.2.Closing cover. 2.3.Feeder roll(Adjusting lever) 2.4.Gear Mechanism. 2.5.Pointer. 2.6.Zero Adjustment. 2.7.Range plate.


68


69

3.Counting/Transmitting equipment. 3.1.Coding disc. 3.2.Optaelectronic pick –up. 3.3.Gray code digital converter. 3.4.Digital comparator. 3.5.Binary counter. 3.6.Pluse generator 3.7.Output stage. 3.8.Counting range plug. 3.9.Pluse counter. 3.10.Digital analog converter.

Fig.3.Media 04 ,Top View Section


70

Measuring range adjustment

1.2 COUNTING/TRANSMITTING MECHANISM. The counting equipment consist of a coding disc(3.1) an optoelectronic pick –up(3.2),an electrical unit. In media-4Z a pulse counter (3.9) is also included. The shaft of the pointer (2.5) carries the coding disc(3.1) containing more than 200 numbers stored in an a bit gray code. Each position of the coding disc corresponds to a code number in conformity with the flow rate(Optionally with differential pressure in Media-4A).The opt electric pick-up(3.2)consisting of an 8 bit infra-red diode line and the corresponding phototransistor line pick-up the code number frictionless.


71

Fig4. Functional diagram 04/4


72

Incase of Media 4A,a conversion unit(3.3) converts this number into a digital signal and into a corresponding analog signal of 0-20mA,4-20mA or 0-10V D.C. by the digital analog converter(3.10).

In case of Media 4Z,a conversion unit (3.3)converts this number to a digital signal which is fed to a comparator(3.4) starting with Zero ,the storage of binary counter (3.5) is incremented by the pluse generator (3.6) and fed to comparator(3.4).Within a certain period of time,this signal reaches the output signal of the conversion unit(3.3) and the comparator (3.4) produces. A pluse(Uk) which is proportional to the flow rate.The following output stage(3.7)resets the binary counter(3.5) to zero and converts the pulse Uk to a certain pulse signal Ui which depends on the arrangement of the diodes of the counting range plug(3.8).Optionally, this pulse signal can be designed for 70-300 pulse/Hr and it is fed directly to the pluse counter(3.9).Additionally, this signal sets a floating transistor contact for the connection of an external counter.


73

2.TECHNICAL DATA COMMON SPECIFICATIONS:

Measuring span Max. mm w.c.

600 1000 1600 2500 4000 6000 10000 16000 25000

Min. mm w.c. 400 600 1000 1600 2500 4000 6000 10000 16000

Nominal Pressure PN 40,unilateral over range able up to 40 bars Volume within the D.P. Cell

High pressure chamber approx 80 Cm3 Low pressure chamber approx 250 CM3

Displacement volume

Max. 9 Cm3(with minimum span 5 Cm3)

Scale Scale version Upon request

Circular 270º,scale length approx.300mm (0-100% direct reading,linear for D.P. or Sq. root for flow or both for any linear measured valve.for measured valves according to.

Characteristic Indication linear to differential pressure *Accuracy <±2% <±1%(inclusive of hystersis) Sensitivity <±0.5% <0.25% Effect in % of span Ambient temperature: <±0.03% º C

Static Pressure:< 0.03%/1Bar FLOW RATE COUNTER –MEDIA 4Z Counting Range ∆P=3.1-100%(∆ 17.7…..100% flow rate) Output & Display At flow Q=100% 70.33-3000 pluse/h or units/h on bottom

pluse counter(depending on the arrangement of the diodes of the counting range plug).Floating transistor limit contact for connecting an external counter(V max=30 V.d.c: I max=0.3A)

Characteristic Q=K√∆P

Pick-up frequency 13Hz(pick –up internals 75ms) Pick-up Accuracy 0.25% of the upper range valve Supply 24V.A.C./220 V.A.C./110 V.A.C. Optional with 24V.D.C. ELECTRIC TRANSMITTER-MEDIA 4A Output D.C. Current signal or d.c. voltage signal 0-20mA, 4-20mA,

(Permissible load<500 ohm) 0-10V (permissible load 10K ohm)

Characteristic Linear or Squared (σ= K√∆P)

Pick-up Accuracy ±0.25% of the upper range valve Supply 24 V.A.C./220 V.A.C./110 V.A.C. optional with 24 V.D.C.


74

3.Installation.

a. Arrangement of the equipment. The basic arrangement of the equipment used is shown in the schematics below. The decision whether the flow meter is to be fastened above or below the point of the measurement or whether condensate pots are to be installed ,depends on the type of process fluid and on the site conditions. The installation schematic shows the normal and the reversed installation position. Normal installation should be generally preferred and only when there is no other choice.(especially in steam measurements)reversed installation should be employed.


75

Fig7. Installation schematics.

b. Orifice plate assembly The direction of flow shall correspond to the inlet markings provided on orifice plate. An undisturbed length of straight pipe is required at upstream and downstream of the orifice assembly,(Approx. 20 D at upstream and 5D at downstream minimum, where D is inside diameter of pipe.) Control valves that vary continuously the condition of the process fluid, e.g. manually operated control valves or temperature controllers, should be avoided to be installed at upstream of the orifice assembly. Working conditions should correspond to the calculated conditions as closely as possible. The controllers that keep the conditions constant, e.g. pressure controller, have favorable influence on measuring accurately.


76

Arrangement of Orifice flange tapping /differential pressure lines is recommended as per fig 8.

Fig8.Arrangement of orifice flange tapping /differential pressure lines.

3.3 Differential pressure lines.

The recommended size of differential pressure lines is ½”. Arrangement to be carried out as per fig 7 & 8. There should not be any leakage in differential pressure line connection.

The horizontal differential pressure pipe lines shall be provided with a steady slope of 1:20,downwards. The minimum bending radius shall not be less than 50mm.


77

Before the differential pressure lines are connected to the instrument they shall be cleaned by flushing thoroughly. 3.4 Media indicator

Prior to installation, compare the operating data with those of the differential pressure pick-up. Make sure that the high pressure line is connected to the high pressure connection and that the low pressure line is connected to the low pressure Connection. 3.5 Electrical connection for 4Z and 4A. Connect wires for supply and out put via gland at terminals. 3.6 Optional Accessories. 3.6.1 Condensate pots. These are recommended for maintaining a constant liquid column and are mainly required in steam measurement. These must be installed at exactly the same level and at the centre line of the orifice assembly installed on horizontal pipe. 3.6.2 Isolation Valves. These are recommended for isolating the D.P. Indicator from the process for maintenance/repairs. 3.6.3 3-Way manifold block. This can be used to shut –off both pressure lines and for zero checking of the indicator. 4. Start-up


78

4.1.Steam flow measurement. The steam should not contact directly the measuring diaphragm of the instrument. Therefore fill up the water in condensate pots.D.P. indicator before start up. Or, upon start up of the plant (steam is on) and with the 3-Way block in closed position, wait until condensate is gathered in the pressure line above the 3-way block up to the orifice. Then first open the high pressure valve of 3-way block and close the middle equalizing valve And open the low pressure valve. To escape the air ,if necessary open vent/drain plugs of the indicator, also vent condensate pot. subsequently check zero adjustment as described in 5.1. 4.2. Liquid/Gas Flow Measurement. Place the instrument into service, by slowly opening first high pressure valve of 3-way block, then close the middle/equalizing valve and open low pressure valve. In case of liquid flow measurement open vent/drain plugs of instrument for escaping the air and tight the plugs again. Subsequently check zero adjustment as described in 5.1. 5.Operation. 5.1. Zero adjustment. First close the low pressure valve of 3- way manifold block and open the middle/equalizing valve and then close the high pressure valve. Correct for any deviation in zero by zero adjustment screw(2.6.)(putting back the instrument in operation, in reversed sequence)

5.2.Correction in the case of different operating conditions, using the correction tables for flow measurement. If the prevailing operating conditions of the process fluids deviate from these Condition on which the calculation is based, an appropriate correction must be made. For steam correction table shall be used, while for compressed gas, correction table 2 applies. The measuring span of the flow meter is determined by the measuring cell(three versions different measuring diapharagms(1.6) and guide spring (1.9) on the one hand,and by the measuring spring (1.5) installed on the other hand.


79

The instrument is set by the manufacture to the measuring range and the measuring range can be changed subsequently only within the range permitted by the measuring spring installed. The measuring span can be adjusted continuously up to approx. 60% of the maximum measuring span. when a different span is to be adjusted, the measuring spring (1.5) must be exchanged refer table 3 Measuring Cell Measuring spring Measuring Range (mm wc) 1. Diaphragm-1390-01391 Guide spring 0.5

1726 0---400 0---600 1727 0---600 0---1000

1728 0----1000 0---1600 1729 0----1600 0----2500

1730 0----2500 0---4000

1731 0----4000 0----6000

2. Diaphragm-1390-01391 Guide spring 0.8

1725 0----2500 0----4000

1732 0-----4000 0-----6000 1733 0----6000 0----10,000

1734 0----10,000 0----16,000

3. Diaphragm-1390-01391 Guide spring 0.8

1735 0-16000 0----25,000

6.1. Adjusting and changing the measuring range(fig 1.2.3) Adjustment should preferably be made on the test bench. Unscrew the casing front section and apply pressure to the + ve side of indicator corresponding to the required upper range valve. keep –ve side open to atmosphere. Then adjust the feeder roll (2.3) at the measuring range plate(2.7.)upwards and downwards until the pointer is on the full scale valve. Remove the pressure and correct zero point with the zero adjuster (2.6.).Repeat the adjustment procedure until zero point and end point correspond to the desired measuring valve. Attention : Particularly in media-4Z and 4A do not loosen pointer (2.5) from Gear mechanism in any case. Exact co-ordination to cording dish and with that for counting gets lost.


80

6.2 Changing the measuring range by exchanging the measuring spring (fig.9)

Fig.9 Adjusting must be made on test bench. If the measuring range is to exceeded that of the measuring spring required shall be selected from table3.Only the springs suiting the existing measuring cell can be exchanged. Unscrew closing cover and set zero point with zero adjuster. Unscrew plate(1.4).measuring spring(1.5)and washer(S)(1.18)from the low pressure side of the measuring cell install a new spring(1.5)and fasten spring plate with two screws. Check zero position, correct deviation by installing washers of different thickness. For this purpose spring plate must be removed each time. When zero position is obtained, screw on the spring plate firmly, check “o”ring(1.15) for proper position and if necessary replace. Adjust the measuring range as described in 6.1 to the desired valve. 6.3.Change of the adjuster pulse number in Media-4Z.


81

The pulse number (Pluses per hr at 100 % of flow rate) adjusted can be changed subsequently by changing the diodes set on counting range plug: For this purpose remove plug carefully from p.c. board electronic. By soldering of 1 up to max. 12 diodes pulse numbers of 70 to 3000 p/h are attainable. To coordinate the desired pulse number to the diodes set the given pulse number must be transformed to the datum pulse-time: Pulse-time (Ms)= 3600000/Pulse number(p/h) In following table the pulse-times are allocated to the corresponding places of diodes. The determined value for the pulse-time must be looked up from table 4.If it is not be found, so diode is to the diode place of the next following lower pulse-time. With the differential valve of determined valve and table value than the corresponding places are to be looked up subsequently in the table until the differential valve is o or < 12.5. 1.Example:Desired pulse number 1500 p/h Transformed to the pulse-time it follows. 2600000/1500=2400 ms. Look up this value from table-not available next following lower value is 1600- on corresponding place 7 solder in a diode. As differential value results 2400-1600=800. Look up value from table-available, on corresponding place 6 solder in next diode. 2.Example: Desired pulse number 100 p/h 3600,000 /100= 36000 ms


82

Look up this value from table-not available., next following lower value is 25600-on place 11 solder in a diode. As differential value results 36000-25600=10400. Look up this value from table-not available, next following lower is 3200- on corresponding place 8 solder in next diode. As differential value results 4000-3200=800 Look up this value from table-available, on corresponding place 6 solder in next diode.


83

PREFACE: This manual is intended for use by erectors and services/maintenance of the cooling tower. This

manual should be studied thoroughly and used as an aid to keep your cooling tower in good

operating condition through timely and proper preventive maintenance practices. User will also

gain an understanding of cooler towers principles of operation and get better equipped to

diagnose causes of problems and methods for effectively dealing with them as and when the

occur.

INSTRUCTION:

A cooling tower is a direct contact heat exchanger, generally used to dissipate the heat in

circulating water. The heat is dissipated to the ambient air via a process of heat and mass

transfer from the circulating water. The water thus cooled is re-circulated through the process,

heat exchanger or condenser. The heat is transferred to the water either in a condenser like

refrigeration or an air conditioning systems or chemical process or heat exchanger in cooling

process. Generating sets engines, furnaces etc. The cooling tower design has changed over the

years to incorporate new materials, as and when available. The purpose being to make the

tower.

� Perform to required specification

� Be compact

� Weigh less

� Consume least power

� Be long lasting and withstand corrosion and have good finish looks.

� With the introduction of Fibre glass Reinforced Plastics the above benefits are achieved in

the counter flow, FRP shell, PVC Fill, Induced Draft Cooling Towers.

OOOOOOOOPPPPPPPPEEEEEEEERRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN MMMMMMMMAAAAAAAANNNNNNNNUUUUUUUUAAAAAAAALLLLLLLL OOOOOOOOFFFFFFFF

CCCCCCCCOOOOOOOOOOOOOOOOLLLLLLLLIIIIIIIINNNNNNNNGGGGGGGG TTTTTTTTOOOOOOOOWWWWWWWWEEEEEEEERRRRRRRR

Section

17


84

3. COMPONENTS:

The various components of the FRP Tower are as under:

3.1 CASING:

The casing enclosing the PVC fill serves to isolate air stream, which passes over the fills.

The casing is bottle shaped to reduce frictional resistance of air and aid airflow pattern. It

is designed to with stand wind loads up to 75 km/hr and vibrations emanating from the

motor and other equipment. FRP casing has a high impact resistance when laminated

with Isenthalpic Resin and even if damaged is easily repaired at site. With proper surface

treatment using neopenta glycol and imported wax release agents, it retains colors for

long periods even when exposed to direct sunlight. The casing is in sections of easy to

handle sixes and is assembled at site using bolting joints. The bottle shape of casing is

ideal with regard to cooling efficiency and space economy.

3.2 SUMP:

The basin serves the purpose of collecting the water descending from the fills and

channeling it to the suction point. Further the basin also acts as a reservoir of water. The

basin is also made of FRP and has similar characteristics as that of casing.

3.3 SUCTION TANK/AUXILLIARY TANK:

The suction tank is located below the basin and in the centre of the sump and has all

connections for inlet/outlet, drain filling and overflow. The units at the lowest point and is

always flooded and thus ensuring no cavitations occurs on the pump suction. The suction

tank is fully moulded in FRP to prevent corrosion and subsequent leafages.

3.4 TOWER STRUCTURE:

The structure of the tower support the casing, basin and motor mounting frame for

sustaining and transmitting the loads to the foundations. These are of MS and are Hot

dipped Galvanized so as to resist corrosion.


85

3.5 PVC FILLS:

The fills suction is designed to bring intimate contact of water and air so as to facilitate

heat and mass transfer at the same time aiding in proper and even distribution of air and

water over the cross section, while maintaining minimum pressure drop. The fills are of

honeycomb section and are vacuum formed from virgin PVC for excellent resistance to

corrosion and give maximum area for wet surface.

3.6 SPRINKLER:

The gravity die cast Aluminum alloy sprinkler is used to distribute the water evenly over

the cross section of the water. An aluminum alloy rotary bead with redial PVC pipes

having drilled holes serves this purpose. The rotation of the assembly is accomplished

due to reaction of water jet being sprayed from the PVC pipes. The sprinkler head is

mounted on top of the central water supply pipe. To reduce frictional resistance and to

ensure free rotation even at the low flows the sprinkler has 2 sealed pre lubricated ball

bearing mounted on the central shaft. This sytem is followed up to 300 TR only, for the

larger towers the sprinkler becomes unwieldy and instead a stationary low pressure water

distributor with nozzles located on an FRP grid pipe is used for equal distribution of water.

3.7 FAN:

The LM6 aluminum alloy fan is gravity die cast. It is an axial flow, multi blade version with

foil blade section and adjustable blade pitch. The fans is designed to deliver large

volumes of air at low power consumption and low noise generation. The fans are

dynamically balanced for smooth operation longer bearing and more life including that of

the supporting structure.

3.8 FAN DRIVE MOTOR:

The fan drive motor is an IP55 weatherproof design. The fan is directly driven by the

special extended shaft motor made from EN8 steel mounted facing downward on a

mounting frame on the top of the cooling tower.

3.9 GRILLS:

Inlet grills and outlet grills in MS are provided to prevent contaminants like leaves, bird’s

etc. entering the cooling tower.


86

3.10 DRIFT ELIMINATORS:

Units with rotary sprinklers are designed to minimize carryover by judicious choice of

airflow velocities. The air distribution is aided by using a centrally located rotating

eliminator section to avoid high velocity area. Further the pipes are covered by airfoil

section of eliminator which helps arrest small droplets from escaping and for evenly

distributing the sprinkler water. For the towers using stationary sprinkler nozzles a full

width eliminator covering the full cross section is used. The shape of the eliminator is

chosen to minimize pressure loss of air and to strip the maximum amount of entrained

depletes.

4.0 PREPARATION FOR INSTALLATION:

Decorate all components, open all packages, and confirm nothing is damaged. Check all

components received as per packing slip (including mats, epoxy etc.) collect all tools and

tackles as needed.

• Spanners

• Drill &

• Pipe

• Screw driver

• Pliers

• Hammer

• Files

• Spirit

• Slitting

• Brush

• Ruler

Check concrete foundation is as per drawing.

Check levels of foundation legs and correct if required.

Install suction tank on central foundation with correct orientation as decided by client.

Install pipe legs on circumference of pad foundation & slip in foundation bolts. Level topside with

level pipe.

Install basin supporting ring and bolts together with supporting legs.


87

Bolt Basin FRP sections and places on top of Basin Ring.

Install mesh support upper Ring support legs on top of basin on edges.

Install upper Ring and bolt to legs.

Install casing section piece and bolt together to nest piece, to from complete cylindrical shape.

Install motor supporting ring/bracket

Install ladder

Install motors and fan assembly (for larger towers, for smaller tower these may be installed after

fills)

Connect inlet standpipe.

Bolt on sprinkler mounting pipe.

Install sprinkler head by screwing on the pipe

Screw in pipes and end caps and lock nut

Install clamp on central pipe

Install cross members for fill support

Place fill support grid and bolt in place to from ring.

Install fill by facing 150 mm x 600 mm face down on grid, starting with diametrically placed packs

fill upsets of grid.

Install next fills pack layer at right angles to 1st layer.

Seal basin flanges and suctions tank with mat and resin and allows setting before distribution.

Install motor/fan protection grid with hinged portion in alignment with ladder.

Install “mesh” (screen) for air inlet.

4.1 SPRINKLER PIPES:

The sprinkler pipes must be kept clean to prevent any blockage in holes. When cleaning

the sprinkler pipes, loosen the lock nut shown in Fig. 1 to unscrew and remove the

sprinkler pipes. On assembly, be sure the alignment screws (round head) are positioned

at the top centre. (see Fig.1)

OCT-250E, ES and OCT-2-40ESS have type A and B sprinkler pipes which have different

sprinkler hole positions, so be sure these are installed as against A and B against B.

4.2 SPRINKLER HEAD:

Scale or sludge attached to the narrow space shown as A & B in Fig. 2 impedes

revolution. If the sprinkler rotation slow down or even stops despite normal water flow

from the sprinkler pipes or at the beginning of the season, if the head does not rotate


88

even though the water is flowing at the same rate at the last season, dismantle the rotary

head for cleaning and checking. For dismantling the small model plastics sprinkler head

refer to fig. 2 and proceed as follows:

Remove the screw (4) and the threaded cap (1).

Remove the nut (2) and then lift off (3) and (5). This completes the dismantling

Clean parts with water

For dismantling and reassembling the aluminum sprinkler head for the larger towers, refer

Fig. 3 and proceed as follows:

Remove the cap (1) and take the nut (2) off. Pull the rotary part off from the fixed section.

This permits checking, cleaning and if necessary, replacement of sector A and B. To

replace the lower bearing (6) or oil seal (7), unscrew set scre w(8) and remove (4) from

(9), which allows replacement of parts. When reassembling, do not wet the bearing

portion with water and apply ample anti-corrosion lubricant (water proof, lithium soap-

radical grease, JIS No. 3 or 2 if available) on bearing and oil seal over the centre pole (5)

to not to damage the lips of the oil seal. Since oil seal is effective for a limited period, it is

desirable to dismantle and replace it every two or three years.

4.3 “NORMAL” CONDITIONS:

Water quality and environmental conditions on the vast majority of HVAC Cooling Tower

applications permit acceptable service life from standard cooling tower construction using

the material previously described. Significant deviation from these “normal” conditions

often demands alternate material choice. For most purposes, the following criteria define

“normal” conditions.

Standard tower design assumes a maximum of 120-degree F hot water to the tower,

including system upset conditions. Temperature over 120-degree F, even for short

duration, may impose damaging effects on PVC Fills, many thermoplastic components,

galvanizing and plywood.

Those rare applications demanding hot water in excess of 120-degree F usually benefit

from the standard configuration are included in the initial purchase specification.

“Normal” circulating water chemistry falls within the following limits (note the distinction

between circulating water and make-u water):

pH between 6.5 and 8.0 although pH down to 5.0 is acceptable if no galvanized steel is

present.


89

Low pH attacks galvanized steel, concrete cement products, fiberglass and aluminum.

High pH attacks wood, fibre glass and aluminum.

Chlorides (expressed as NaCl) below 750 ppm

Calcium (as CaCO3) below 1,200 ppm-except in arid climates where the critical level for

scale formation may be much lower.

Sulphates below 1 ppm.

Silica (asSiO2) below 150 ppm

Iron below 3 ppm

Manganese below 0.1 ppm

Langelier saturation index between – 0.5 and +0.5

Negative LSI indicates corrosion likely; positive indicates CaCO3 scaling likely.

Suspended solids below 150 ppm if slides are abrasive –avoid film-type fills, if solids are

fibrous, greasy, fatty or tarry woods, PVC is usually is the material of choice.

Oil and grease below 10 ppm or loss of thermal performance will occur.

No organic solvents.

No organic nutrients, which could promote growth of slime.

Chlorine (from water treatment) below 1 ppm free residual for intermittent treatment;

below 0.4 ppm free residual for continuous chlorination.

These condition define normal circulating water, including the chemical concentrating

effects caused by re-circulating the water to some pre-determined number of

concentrations.

5.0 POST ERECTION CHECKS/PRE-COMMISSIONING CHECKS

5.1 Checks elevation of sump and fan ensure they are parallel to ground

5.2 Check central pipe is vertical and sprinkler arms are all leveled, at right angles to

central pipe.

5.3 Ensure no drift/other foreign particles are present in sump, suction tank sweep

clean/wash clean.

5.4 Rotate sprinkler with hand and ensure it is free

5.5 Ensure fill top is even.

5.6 Ensure sprinkler arms are at a contact level above the fills and that the arms do not

rub against /uneven fills, casing, etc.

5.7 Ensure fan & motor assembly is free


90

5.8 Check all bolts are right and no loose parts are noticed.

5.9 Fill water in sump and check and eliminate water leaks, if any.

5.10 Connect correct power (i.e.415V, 50 Hz, 3 Phase AC) supply to fan and check.

5.11 Direction of rotation of fan is correct and are being sucked through screen above

sump and discharged vertically upwards.

5.12 Vibrations are negligible.

5.13 Fan cable connections are made with lugs & terminal cover gasket, is right.

5.14 Establish water flow and check sprinkler rotates and check any unregulated by pass

from sprinkler pipes.

6.0 CHECKS AFTER COMMISSIONING

6.1 CHECK MOTOR SPEED TO BE AS SPECIFIED IN Technical data for particulars

model.

6.2 Check airflow rate is as per specification

6.3 Check water flow rate is as per specification

6.4 Check power/current drawn by fan motor is within limits and as specified.

6.5 Check for abnormal noise/vibration during operation.

6.6 Check sprinkler rotates freely at 5 to 8 rpm or adjust holes to angle so as to achieve

correct rpm.

6.7 Sprinkler Revolution Table (assumed at full flow)

� MODEL :

� RPM :

6.8 Ensure water is being distributed evenly over the FRP eliminator plates and there is

no carry over from below the eliminator plate & falls down below evenly, and does not

pass out.

6.9 Eliminator plate adjustment to be checked to ensure equal distance between fill top

and plate bottom.

6.10 Measure temperatures at following location.

6.11 Water inlet

6.12 Water outlet/sump

6.13 Make up water inlet

6.14 Wet bulb/dry bulb temp of air at inlet to tower at 4 locations equally spaced around

tower.


91

6.15 Wet bulb / dry bulb temperature at outlet of tower above fan.

6.16 Adjust drain valve to give adequate blow down.

6.17 Set float to ensure proper operation and to avoid over flow when plant stops.

7.0 MAINTENACE SCHEDULE

EVERYDAY: 1. Check if vibrations are normal / noise normal. 2. Water distribution proper. 3. Fan motor current normal. EVERY WEEK: 1. Clean inlet sieve to remove entrained matter. 2. Clean inlet water filter. 3. Clean growth of Algae etc. and remove from sump. EVERY MONTH: 1. Drain Tank, flush out and remove any sediment. 2. Check fills if clogged due to algae, sediment / salts, etc. 3. Check structural/FRP casing and Basin damage and repair if necessary. 4. Clean from outside with soap and water. 5. Check and tighten all bolts. 6. Smear Bolts with grease to facilitate easy opening the next time. EVERY SIX MONTHS: 1. Grease all bearing of motor. 2. Grease all bearing of sprinkler. 3. Check run out no fan motor shaft.

4. Clean fills if damaged and replace. 5. Replace Bearing of sprinkler assembly after 2 years and fill with grease.

8.0. TROUBLE SHOOTING

TROUBLE CAUSE REMEDY Lowering of cooling capacity. 1. Motor stoppage Electric blackout Contact Power Company fuse burnout Get proper fuse Insufficient switch Change to proper switch Capacity Bad Switch contact Adjust contact 2. Sudden lowering of STARDELTA improper Correct connection motor rpm Connection of rotary and according to nameplate fixed section. Send out to repair shop.


92

Rotary wiring single Phase short circuit Send out to repair shop. 3. Fan stoppage Bad bearing Exchange bearing temperature rise

motor temperature too heavy load Lighten load too proper level rise High surrounding temp. Send out to repair shop. Connect between rotary Change bearing or And fixed section supplement grease. Either damage in bearing Of lack of grease OIL LEAKAGE OTHERS

TROUBLE CAUSE REMEDY In case of gear speed too much oil Lower the oil face to proper Reducer oil leakage level (15, 30 TR model only). Loose bolt Tighten properly. RISE IN WATER Water flow above Regular incorrect flow rate TEMPERATURE Specified flow Airflow below Adjust blade angle check Specified flow and clean sieve Load higher than design Adjust load to current level

Fill checked or coated Clean/replace fills. Use Proper water makeup Quality Fresh air intake out Improve ventilation and Sufficient of area ensure exhaust air does not Sufficient of area around get recycled.

WBT high Check design conditions and ensure no recycling of

Exhaust air Water bypassing fills Check sprinkler head and Sprinkler jammed/water pipe leakage. Not being sprinkled and Repair sprinkler and Distributed Distribution system.


93

TROUBLE CAUSE REMEDY

WATER FLOW LESS Filter choked Clean water filter Sprinkler pipe choked Clean pipes and holes. Level of water low in sump Adjust float/inlet flow ensure Proper make up.

Pump small Replace for correct flow Volume

Air flow low Fan speed low Check bearing/motor Fan blade angle incorrect correct blade angle to Inlet jail choked required setting Clean air path. Noise & Vibration Fan mounting loose Tighten mounting bolts and Correct/replace if needed. Fan blocks loose Tighten blade in hub Fan unbalanced Rebalance and adjust Motor bearing fault Check and grease or replace Bearing of motor Hub mounting on motor Tighten and use end plate

Shaft loose and shims if required. Many parts rub against Give proper clearances and Tower components adjust/align components Water carry over Sprinkler rotation too fast Adjust sprinkler angle as to Much the specified rotation. Blocking of filter Clean up any blockage part Defective eliminator Renew eliminator Sprinkler too high above Adjust as specified. Filter 25 mm 7.5 to 30 TR 30 mm 40 to 80 TR 75 mm 100 TR onwards

9.0 CIRCULATING WATER MAKE – UP Loss of water from the cooling tower consists of evaporation f circulating water. Which removed the heat, and carry over minute water droplets scattered about as drift by the fan. Continued evaporation of the circulating water results in condensation if water which may invite corrosion of the circulating system or may even causes the formation of algae or scale. For this reason a so-called blow-down becomes necessary which bleeds of a part of the circulating water.


94

9.1 EVAPORATION LOSS (E) Evaporation loss (E) can be calculated with the following equation. E kg/h = G x (X2 – X1) = Q/600 = dt XL/600 Where : G : air flow in kg/h Q : calories cooled kcal/h T : temperature difference of water inlet and outlet degree C. L : circulating water flow kg/h 600 : latent heat of evaporation in kcal/kg X1, X2 absolute humidity of air at inlet and outlet in kg/kg.

9.2 Carry over volume ( C )

It is very small in volume; normally below 0.02 % of the volume of the circulating water flow through it slightly varies with tower structure.

9.3 Blow down volume (B)

In order to replace part of the circulating water periodically. It is effective to leave the drain valve slightly open during operation, or to let the water overflow constantly by raising the operation water level or to change the water periodically when the water basin is cleaned. The blow down volume differs depending on the quality of the water or the degree to hardness. In case of air conditioning about 0.3% blow down is usually necessary in order to make the blow down more effective. It is best to use tap water instead of underground of river water.

9.4 Make up water volume (M)

Make up water volume (M) is obtained from the equation. M = E + C + B If the evaporation loss is (E) = 0.83% Carry over loss ( C ) = 0.20% and Blow down volume (B) = 0.30% The make up water volume will be (M) = 0.83 + 0.20 + 0.30 = 1.33% Hence the make up water volume is estimated to be at about 1.5% of the circulating water flow.


95

9.5 Relationship between the condensation multiple (N) and water supply volume (M).

Blow down volume and make up water volume to maintain the circulating water a specified (condensation multiple during the operation) are obtained by the following equation. 2. Condensation multiple (N) N = {(E + C + B)}/[C + B] = M/(C + B) …(1) (M = E + C + B) 3. Blow down volume (B) B = {E/(N-1)} – C …(2) 4. Make up water volume (M)

M = {N/(N-1)} – E …(3)

Where N : condensation multiple E : Evaporation volume (%1 / min m3 / h) C : Carry over volume (%1 / min m3 / h) B : Blow down volume (%1 / min m3 / h) M : Make up water volume (%1 / min m3 / h) (Calculation Example) When given conditions are Cooling Tower Model Inlet water Temperature Tw1 = 36 degree C Outlet water Temperature Tw1 = 36 degree C Ambient Wet Bulb Temperature Tw2 = 31 degree C Circulating water volume L = 1060 1 / min From items 1 & 2 given above. Evaporation Loss E = {(36-31) X 1060 / 600 = 8.8 (1/min)} Carry over volume C = 1060 X 0.001 = 1.1 = (1/min) Where condensation Multiple N = 3 from equation 2 Blow down volume B = {8.8/(3.1)} – 1.1 = 3.3 (1 / min) From equation 3 Make up water volume M = {3/(3-1)} x 8.8 = 13.2 (1 / min)


96

INSTALLATION OF OUT DOOR UNIT Mode of discharge 1.Remove the cap of the gas/liquid valve and screw off the nut on the maintenance Opening(see the fig) 2.Loosen the two liquid valves a little with an inner hexagon spanner turn around 90° anticlockwise)and press the protruding part of the two gas valve Maintenance opening discharge the air for 10 sec. and then loosen.(after the air Is discharged.you see the fog like refrigerant run out),screw back and tighten the Maintenance opening nut back. 3.Open the two gas and liquid valves completely with inner hexagon sapanner Then put the bonnet back. 4.Check the leakage with soapsuds.

FFFFFFFFRRRRRRRREEEEEEEEOOOOOOOONNNNNNNN ////////CCCCCCCCOOOOOOOONNNNNNNNDDDDDDDDEEEEEEEENNNNNNNNSSSSSSSSIIIIIIIINNNNNNNNGGGGGGGG UUUUUUUUNNNNNNNNIIIIIIIITTTTTTTT Section

18


97

INSTALLATION OF FREON UNIT DRAIN PIPE Installation of Freon Unit drain joint in cooling mode on Freon Unit condense water From expansion valve or capillary produce during defrosting can be let to proper Place through drain pipe.


98


99

FREON GAS CHARGING (F-22)

The operation is done in the following steps: 1.Connect the refrigerant storage tank to the maintenance opening of the gas valve. 2.Wash the pipe(or hose)with the gas from the refrigerant storage tank. 3.Replenish the certain amount of refrigerant to keep the air conditioner in normal Operation.

Notes: 1.In gassing,do not turn the refrigerant storage tank up side down.

2.In order to keep the high pressure of storage tank,please heat with 40ºC warm Water in cold weather.But do not use fire or steam.


100

TEST RUNNING Note: 1. Before test running, please trail wire connection and pipe leakage

(use soap bubbles)

INSTRUCTIONS: 1.Flush the pipe with nitrogen to dehydrate. 2.Vaccumisation should be done from the both the valves. 3.Only Freon-22 should be used as a refrigerant. 4.Vaccumisation must be done completely (-30 Hg)


101

INSTALLATION INSTRUCTIONS

� Firmly fixed on the rack that does not increase vibration: � Ventilate well, little dust, no rain or straight sunlight: � The nose and heated air will not be a trouble for the neighborhood Elements � Do not block the entering and leaving air, � Avoid place where inflammable or composite gas leaks easily,

CONFIRMATION AND ANALYSIS OF TROUBLES

Caution:Do not repair the air conditioner by yourself,when trouble has occurred,please Contact the “authorized maintenance department”,before contacting for maintenance Please check the following items,which may save your time and expenditure. “Malfunction:Phenomenon

“Malfunction” analysis

The Freon Unit can not be operated

Is the Freon Unit connected to power supply?Does the Power Plug fall off?Is the fuse or breaker cut off?

Cooling effect of Freon Unit is not good.

Is the temperature properly set? Is the water Properly filled in the coiled drum? Is the air inlet or outlet of outdoor unit blocked?

The Freon Unit can not be operated, when it is restarted right away.

Timer delay system could be ON.(If Digital Model) This protects the Freon unit by microprocessor. Wait for 3 minutes before is runs.

Crack sound is heard

This sound is generated by the expansion or contraction of the panel,etc.due to changes of temperature.

Water flowing sound is heard

This is the sound of refrigerant flowing inside the Freon Unit.

A mechanical sound of “Da,Da..”or “Bush” is heard

“Da,Da….” Sound is from the switch truning (ON/OFF) of the fan of compressor. “Bush” sound is created when the flow of refrigerant inside the Freon unit is switched.

Water leaks from the outdoor unit During cooling operation,pipe or pipe connector section are cool and cause condensation of water.


102

Air Compressor Unit-2

Time Voltage Current

Cooling Water Pressure(Kg/Cm2) Pressure (Kg/Cm2)

Temperature (Degree Celsius)

Del. Stages Del Stages

I II III IV I II III IV


103

MS Battery Expansion Engine Valve Position

Time

Pressure (Kg/Cm2)

Temp. Pressure

Temp. CAM

Inlet

Pressure

Outlet Pressure

Oil Pressure

HP Air

Bottom

Column

Top Column

Main Exp.Valve(V2)

RL Up flow

valve(V4)

By pass valve(V1)

IN OUT IN OUT


104

Temperature

Time Air Inlet to EE (T1)

Air Outlet From EE(T2)

HP Air Before V3(T3)

WN2 Temp after PL Sub cooler(T4)

LO2 before LOX Pump(T5)

WN2 between Liquifier and pre-exchanger (T6)

WN2 Top Cap Column Exit (T7)

RL Temp before V4 (T8)

Def. Air Inlet (T9)

Air Inlet to Column(T10)

HPO2 Exit ASU (T11)

WN2 Exit ASU (T12)


105

Log Sheet Oxygen Plant Capacity------------M3/Hr Date Day

Air Separation Unit Liquid Ref. Unit LOX Pump Time O2

Purity O2 /Condensor Level

N2 Purity

Inlet Temp.

Outlet Temp.

Oil Pressure

Feed Valve

Running Hours


106

Nomenclature Description Pressure Gases PC Pressure gas after air compressor

R17 Air pressure of cool box before expansion valves R18 Lower column pressure

R19 Upper Column pressure

R17A Oxygen pressure after L.O. Pump

P5 Air Pressure drier A

P6 Air Pressure drier B P7 Air Pressure inlet expansion engine P8 Air Pressure inlet expansion engine

P11 Oxygen Pressure of filling manifold

P12 Oxygen Pressure of filling manifold

P13 Air pressure of defrosting air P15 Oil pressure expansion engine P16 Oil pressure LO pump

Valves A1 Drain valve moisture separator

A2 Drain valve oil absorber A3 Air valves drier A

A4 Air Valves drier B

A5 Air valve drier A outlet

A6 Air valve drier B outlet

A7 Pressure Equalizing valve Drier A A8 Pressure Equalizing Valve Drier B A9 Vent Valve A10 Dust filter plug

A13 Valve expansion engine inlet

A14 Valve expansion engine outlet N1 Nitrogen valve vent cold box N2 Nitrogen valve processed Skid N3 Nitrogen valve outlet cascade cooler

N5 Nitrogen valve inlet drier A N6 Nitrogen valve inlet drier B

N7 Nitrogen outlet drier A N8 Nitrogen outlet drier B

N9 N2 purge valve (needle) to expansion engine N10 N2 purge valve (needle) to L.O. pump

VI/1 Air inlet valves to cold box VII/1 Air inlet valves to defrost heater

VII Vent valve

V1 By pass valve


107

V3 Expansion valve V4 Valve for rich liquid V5 Valve for poor liquid V6 Hp drain before reboiler V7 Hp drain after reboiler

V8 Oxygen liquid valve L.O.Pump

V8A Vaporizer back analysis valve

V9 Lower Column safety valve V10 Upper Column safety valve

R13 Liquid level indicator lower needle valve R14 Liquid level indicator upper needle vavle

R17 HP Manometer valve Air R17A HP 02 Manometer valve (optional)

R18 Lower Column MP manometer valve

R19 Upper Column LP manometer valve R21 Poor Liquid analysis valve

R22 Inert analysis valve

R26 RL Bottom drain R27 O2 condenser bottom

R28 O2 condenser center

R29 Vaporizer back analysis

R31 Analysis N2 after liquefier valve D1 Defrosting Lower Column D2 Defrosting Upper Column D3 Defrosting V3 valve

D4 Defrosting before V3 valve Temperatures T1 Temp. Engine Inlet T2 Temp. Engine outlet

T3 Temp. Before V3

T4 Temp. WN2 after P.L. Sub Cooler T5 Temp. L.O. Before V8

T6 Temp. WN2 After liquid fair T7 Temp.N2 after top column

T8 Temp. R.L. before V4 T10 Temp. Air Inlet cold box T11 Temp. Oxygen out let cold box

T12 Temp. waste Nitrogen outlet


108


109

STANDARD TERMS AND CONDITIONS OF SUPPLY AND STANDARD WARRANTY/GUARANTEE AS APPLICABLE TO SUPPLY OF PLANTS AND MACHINERY AND RELATED EQUIPMENTS (ANNEXURE TO

ALL PROFOMA INVOICES/CONTRACTS , ETC.) I. A. PERFORMANCE GUARANTEE: The plant shall be deemed to have met the design performance when the basic

achieved performance in respect to output is within tolerance of plus minus (+/-10%) on output and plus minus 0.2 percent (+/-0.2%) on product purity when converted into design suction conditions. The trial runs will be conducted by our engineer and rated output and purity will be shown for one shift. The guarantee on output applies only when the output figures are covered to design suction conditions. UNIVERSAL INDUSTRIAL PLANT MFG. CO. (P) LTD.’s liability for a short fall in the quality/quantity of the product will be limited to the work necessary to rectify the conditions to meet the seller’s specification not any consequential losses or damages. No indemnity (Civil/Criminal) other than replacement or repair of defective equipment is given or implied. All compressors, motor etc. which are bought out items, whatever performance guarantees are given by the manufacturer will be passed on the buyer. The performance guarantee stipulated above is only applicable to plants installed and commissioned by UNIVERSAL INDUSTRIAL PLANT MFG. CO. (P) LTD. or Air Compressor manufacturers Engineers. Not applicable for Plants installed on war affected areas or other, where normal solution does not prevail.

B. WORKMANSHIP WARRANTY: The plant is guaranteed for workmanship to cover the plants & equipment (as per scope of supply) against any manufacturing defect for a period of 12 months from the date & commissioning whichever is earlier provided these are not caused due to improper handling or operation, deviation from instruction for erection & commissioning operation, inadequate constructions & foundation work, natural cause, improper storage, alterations or repairs not our by us & Force Majeure. 1. The seller shall replace/repair any items, which may fail due to manufacturing defect only. The part to be

replaced/repaired shall be done at the seller’s factory in case the same can be done at site, where the plant is installed. In such a case all expenses including freight, to and fro, boarding and lodging has to be paid by the buyer.

2. Before Erection/Commissioning the buyer must arrange all the items/Services not included in our scope of supply like power and water connections, trained manpower etc. of the best quality.

3. The seller obtains most favorably warranty for equipments delivered by any other supplier for bought out items like Air Compressor, Motors, Starters, etc. not manufactured by the seller.

4. This contract supersedes all previous agreements/contracts with the buyers company or its Directors. II. STANDARD TERMS AND CONDITIONS OF SUPPLY:

a. It is clearly understood by the buyer that advance and balance payments have to be made timely as above in view of the advances/investments/inventory to be invested by the seller for manufacturing the equipment of the oxygen plant & therefore order once placed cannot be cancelled and in the event of cancellation all the advance cannot be refunded under any circumstances. In case the Buyer cancels the order he shall have to pay additional 25% of the contract amount as cancellation charges or even higher to cover the loss incurred by the Seller.

b. The prices given in the Proforma Invoice/Contract are based on 1USD = Rs. 45. In case of decrease in value of suppliers or increase in prices of raw materials the Buyer shall have to pay additional charges at the time of realization in our account, the difference/shortfall shall be billed separately and have to be paid by the buyer. In case of delay or increase in price by the vendors new prices will be applicable.

c. ARBITRATION CLAUSE: That any and all disputes & controversies arising out of or in any manner related of the performance of the agreement which cannot be settled by manual consent of the parties. There shall be submitted to the sole arbitrator who shall be appointed by the Seller and give the award in New Delhi as per Indian laws whose decision shall be final & binding. Further only Delhi court will have the jurisdiction only for all purposes.

d. The buyer will have to send TT/ LC timely, exactly as per terms of the offer / proforma invoice / contract without deviation to enable the seller to make shipment without any difficulties. In case of cancellation of Order due to any reason whatsoever, the buyer shall agree to pay the damages and advance is non refundable.

e. In case of performance guarantee our complete liability is limited to the replacement/ repair of the parts as per ‘B’ above without any consequential loss & damages, civil /criminal liability and limited to performance guarantee & all matters / disputes only subject to Delhi Jurisdiction only as per Indian Law.

f. All matters whatsoever arising out of this contract, Delhi court shall only have the jurisdiction for all purposes. g. If the payments are not made on time as per this contract the seller is at full liberty for deliver the plant to another

party. In that case the prices ruling at the time shall be applicable. Also the buyer has to pay to the seller all such costs incurred by the Seller due to such delay.

h. Force Majeure clause is applicable including any act of God strike, war fire accident, delays by vendor or any reason beyond the control of the seller (As per the standard terms and condition of supply) shall be applicable.

Note: The above Standard Terms and Conditions of Supply will constitute standard part of all our Proforma Invoices/Contracts/Orders or any supplies whatsoever. Ref: 2010

MANUAL-UB 100.pdf.part

Documents

Transcript of MANUAL-UB 100.pdf.part