Lesson 5: Transcription & Translation
description
Transcript of Lesson 5: Transcription & Translation
![Page 1: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/1.jpg)
Lesson 5: Transcription & Translation
• LT: Be able to explain the process of DNA transcription.
![Page 2: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/2.jpg)
THE BIG PICTURE!!!
DNA RNA proteinTranscription Translation
![Page 3: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/3.jpg)
Notes from reading pgs. 425-426
• RNA = ribonucleic acid– Made of nucleotides– Sugar in nucleotides is ribose
• RNA uses uracil instead of thymine• RNA is single-stranded and not double stranded• mRNA = messenger RNA
• Carries the message of DNA from the nucleus to the cytoplasm to be made into a protein
• Transcription: the process by which DNA is copied into a complementary RNA molecule
![Page 4: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/4.jpg)
Process & Procedure: Modeling Transcription
• Create a double stranded DNA molecule that is 15 bases long
Our Code:RED = adenine (A)BLUE = thymine (T)
YELLOW = cytosine (C)GREEN = guanine (G)
BLACK = uracil (U)Work through step #3a-f
![Page 5: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/5.jpg)
Stop & Think
1. How is DNA transcription like DNA replication? How are the 2 processes different?
In this activity, you transcribed 2 different DNA strands. Each one was only 15 nucleotides long. That seems pretty short.a. How many different arrangements of nucleotides are possible in a strand of DNA that is 15 nucleotides long?
Same: complementary bases, DNA acts as a templateDifferent: transcription uses uracil, replication uses thymine
4^15 = 1,073,741,824 possibilities
![Page 6: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/6.jpg)
b. How would the number in 2a compare with the number of different arrangements of nucleotides possible in a real strand of DNA?
4^80,000,000 is a ridiculously HUGE number
![Page 7: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/7.jpg)
Notes on DNA transcription
![Page 8: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/8.jpg)
Do the cells in your eye and your tongue have the same functions?
Do the cells in your eye and your tongue have the same proteins?
![Page 9: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/9.jpg)
Do the cells in your eye and your tongue have the same DNA?
![Page 10: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/10.jpg)
What have we learned?
• Proteins determine most characteristics of a cell and organism
• Information stored in DNA determines which proteins can be made by a cell
• The environment influences which proteins are made by a cell
![Page 11: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/11.jpg)
Where is protein made in a cell?
![Page 12: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/12.jpg)
DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes
human cheekcell mitochondria
chloroplasts
nucleus
vacuole
Elodea leaf cell
(DNA here)(DNA here)
![Page 13: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/13.jpg)
DNA does not leave the nucleus of eukaryotic cells... but proteins are made outside of the nucleus by ribosomes
nucleus(DNA here)
(DNA here)
ribosomes
(proteins made here)
(proteins made here)
![Page 14: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/14.jpg)
DNA and ribosomes are at different locations in a prokaryoic cell.
E. coli bacteria cell
DNA
(proteins made here)ribosomes
![Page 15: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/15.jpg)
Information flow from DNA to trait
DNA protein Observed trait
Stored in nucleus
Made by ribosomes outside of nucleus
So how does DNA get turned into a protein if it can’t leave the nucleus???
![Page 16: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/16.jpg)
messenger RNA
• mRNA transfers information from the DNA in the nucleus to the ribosomes.
• mRNA is made in the nucleus and then travels to the cytoplasm through nuclear pores
• Ribosomes build proteins according to the mRNA information received.
![Page 17: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/17.jpg)
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
![Page 18: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/18.jpg)
DNA information mRNA information
Transcription is the process used to convert DNA information into mRNA information.
Note: DNA does not become RNA; the information in DNA is copied as RNA
DNA messengerRNA
![Page 19: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/19.jpg)
RNA is different than DNA
• Single strand of nucleotides
• Contains uracil (U) instead of thymine (T)
• Made of the 5-Carbon sugar Ribose instead of deoxyribose (DNA)
http://www.makingthemodernworld.org.uk/learning_modules/biology/01.TU.03/illustrations/01.IL.09.gif
![Page 20: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/20.jpg)
Difference between DNA and RNA
DNA RNA
5-Carbon Sugar: deoxyribose
5-Carbon sugar:Ribose
A,T,C,G A,U,C,G
Double stranded Single stranded
![Page 21: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/21.jpg)
Different Sugars
DNA
RNA
Can you spot the difference?
![Page 22: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/22.jpg)
Different Bases
Can you spot the difference?
![Page 23: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/23.jpg)
DNA- double stranded
RNA- single stranded
![Page 24: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/24.jpg)
RNA and DNA Nucleotides
DNA
RNA
![Page 25: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/25.jpg)
RNA IS COPIED FROM DNA
COPIED
RNA(single strand -
mobile)
DNA(double stranded original, protected
in nucleus)
![Page 26: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/26.jpg)
mRNA: the messengerRNA is how the body gets information from the nucleus (DNA) to the place where protein gets made (ribosomes)
![Page 27: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/27.jpg)
3 Types of RNA
mRNA: messenger RNA
tRNA: transfer RNA
rRNA: ribosomal RNA
![Page 28: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/28.jpg)
THE BIG PICTURE!!!
DNA RNA proteinTranscription Translation
![Page 29: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/29.jpg)
http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg
![Page 30: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/30.jpg)
Transcription• Molecule of DNA is copied into a
complimentary mRNA strand
http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg
![Page 31: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/31.jpg)
RNA Polymerase
• RNA polymerase is an enzyme• Attaches to promoters (special sequences
on the DNA)• Unzips the two strands of DNA• Synthesizes the mRNA strand
https://publicaffairs.llnl.gov/news/news_releases/2005/images/RNA_polymerase309x283.jpg
![Page 32: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/32.jpg)
Steps of Transcription
Step 1: RNA polymerase attaches to DNAStep 2: RNA polymerase unzips DNAStep 3: RNA polymerase hooks together the
nucleotides as they base-pair along the DNA template
Step 4: Completed mRNA strand leaves the nucleus
![Page 33: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/33.jpg)
Transcription
http://fig.cox.miami.edu/~cmallery/150/gene/c7.17.7b.transcription.jpg
![Page 34: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/34.jpg)
If the DNA code is this:
UACGAGUUACAUAAA
TACGAGTTACATAAAATGCTCAATGTATTT
What is the mRNA code?Use the bottom strand as the template for mRNA
![Page 35: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/35.jpg)
Which proteins are made in a cell?
• Controlled by activator molecules• Bind to enhancers (segments of DNA)• “Turns on” transcription of the geneExample: Arabinose and araC protein
![Page 36: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/36.jpg)
![Page 37: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/37.jpg)
![Page 38: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/38.jpg)
Information flow from DNA to trait
DNA protein Observed trait
Stored in nucleus
Made by ribosomes outside of nucleus
![Page 39: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/39.jpg)
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
Transcription
Transcription Video
![Page 40: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/40.jpg)
Part II: Translation
LT: Be able to explain the process of translation.
![Page 41: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/41.jpg)
THE BIG PICTURE!!!
DNA RNA proteinTranscription Translation
![Page 42: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/42.jpg)
Information flow from DNA to trait
DNA protein Observed trait
Stored in nucleus
Made by ribosomes outside of nucleus
![Page 43: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/43.jpg)
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
Transcription
![Page 44: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/44.jpg)
Information flow from DNA to trait
DNA messengerRNA protein Observed
traitStored in nucleus
Made by ribosomes outside of nucleus
Translation
![Page 45: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/45.jpg)
mRNA information protein
Translation is the process used to convert mRNA information into proteins.- also known as “protein synthesis”
Note: mRNA does not become a protein, the information on mRNA is “read” and ribosomes assemble proteins from this code
messengerRNA protein
![Page 46: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/46.jpg)
Translation
• Ribosomes use mRNA as a guide to make proteins
http://fajerpc.magnet.fsu.edu/Education/2010/Lectures/26_DNA_Transcription_files/image006.jpg
![Page 47: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/47.jpg)
4 Components used in Translation1. mRNA- the message to be translated into protein.
2. Amino acids- the building blocks that are linked together to form the protein.
3. Ribosomes- the “machines” that carry out translation.
4. tRNA (transfer RNA)- brings an amino acid to the mRNA and ribosome.
![Page 48: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/48.jpg)
The message
• mRNA is a strand of nucleotides– Ex. AUGCCGUUGCCA…
• Each combination of three nucleotides on the mRNA is called a codon
![Page 49: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/49.jpg)
tRNA• Transfer RNA• Single strand of RNA that loops back on itself• Has an Amino Acid attached at one end
– Amino Acids are the building blocks of proteins• Has an anticodon at the other end
http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif
![Page 50: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/50.jpg)
What is an anticodon?
• The anticodon is a set of three nucleotides on the tRNA that are complimentary to the codon on the mRNA
http://www.wiley.com/legacy/college/boyer/0470003790/structure/tRNA/trna_diagram.gif
![Page 52: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/52.jpg)
Steps of Translation
Step 1: mRNA binds to ribosomeStep 2: tRNA anticodon attaches to the first mRNA
codonStep 3: the anticodon of another tRNA binds to the next
mRNA codonStep 4: A peptide bond is formed between the amino
acids the tRNA molecules are carrying.
![Page 53: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/53.jpg)
Translation
![Page 54: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/54.jpg)
Steps of Translation cont.
Step 5: After the peptide bond is formed, the first tRNA leaves. The ribosome moves down to the next codon.
Step 6: This process continues until the ribosome reaches a stop codon.
Step 7: The chain of peptides (protein) is released and the mRNA and ribosome come apart.
![Page 55: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/55.jpg)
Translation
http://www.medicine.uottawa.ca/Pathology/devel/images/text_figure8.gif
![Page 56: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/56.jpg)
mRNA nucleotides are translated in groups of 3 called codons.
AUGCACUGCAGUCGAUGA
CODONS
Remember…
![Page 57: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/57.jpg)
Decoding the message…Each codon codes for a specific amino acid. 20
different amino acids can be used in different combinations to form a protein.
For example:mRNA codon amino acid
AAU asparagineCGC arginineGGG glycine
![Page 58: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/58.jpg)
The Genetic Code
http://www.cbs.dtu.dk/staff/dave/roanoke/fig13_18.jpg
![Page 59: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/59.jpg)
Simulation!
• I need 6 volunteers who don’t mind holding hands.
• And then one more volunteer.
Translation Video
![Page 60: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/60.jpg)
Amino Acid sequence determines the 3-D protein shape
• Interactions between amino acids cause folding and bending of the chain
Examples: – positive (+) and negative (-) parts of amino acids are
attracted to each other.– hydrophobic regions are attracted to each other
• Foldinghttp://www.stolaf.edu/people/giannini/flashanimat/proteins/hydrophobic%20force.swf• Structure levelshttp://www.stolaf.edu/people/giannini/flashanimat/proteins/protein structure.swf
![Page 61: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/61.jpg)
How is the amino acid sequence determined?
• The mRNA• Each codon is a code for one amino acid
DNA sequence: T A C C G A G A T T C AmRNA sequence: A U G G C U C U A A G Uamino acid sequence: Met -- Ala -- Leu -- Ser
Whole Process Video
![Page 62: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/62.jpg)
Special Codons
• Start codon: AUG• Stop codons: UAA, UGA, UAG
![Page 63: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/63.jpg)
Your turn:
• For each of the codons below, determine the amino acid it corresponds with:– AUG: Methionine (Met)– CCA: Proline (Pro)– UUG: Leucine (Leu)– GCA: Alanine (Ala)– UAG: STOP!
![Page 64: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/64.jpg)
The Activity
• My desk: NUCLEUS• Your desk space is the CYTOPLASM• In your group of 3, decide who will be:
– mRNA: transcribes the DNA template and delivers the message to the cytoplasm
– rRNA: makes up the ribosome and interprets the message in codons
– tRNA: brings correct amino acids to the ribosome using anticodons
![Page 65: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/65.jpg)
Steps:1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.
![Page 66: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/66.jpg)
Share sentences in order
![Page 67: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/67.jpg)
Repeat steps, but change roles for round 2.
1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.
![Page 68: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/68.jpg)
Share sentences in order
![Page 69: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/69.jpg)
Repeat steps, but exchange roles for round 3.
1: mRNA comes to desk to transcribe the message (can’t just copy the DNA sequence)2: Take message back to cytoplasm & ribosome.3: rRNA: breaks message into codons4: tRNA: use the codons to find the amino acids – look for the ANTICODONS that are complementary to the codons.5: Bring back the card with the correct anticodon.6: Record the word that is on the back of the card in your notebook.7: Make sure to take the card back to where you got it so other teams can use it!8: Continue finding the correct anticodon cards and record the sequence of words in order. Check your end result with me.
![Page 70: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/70.jpg)
Share sentences.
![Page 71: Lesson 5: Transcription & Translation](https://reader035.fdocuments.in/reader035/viewer/2022062315/5681665e550346895dd9e31f/html5/thumbnails/71.jpg)
Follow-up Questions:
• What do the following analogies from the simulation represent in a real cell?– Words– Sentence
• What may have happened in round 3 of the simulation to give us the outcomes we got?
• Do you think this happens in nature?
Amino Acids
Proteins (polypeptides)