e Review articles

Lens development and crystallin gene expression: many roles for Pax-6 Ale5 Cvekl and Joram Piatigorsky

Summary

The vertebrate eye lens has been used extensively as a model for developmental processes such as determination, embryonic induction, cellular differentiation, transdifferentiation and regeneration, with the crystallin genes being a prime example of developmentally controlled, tissue-preferred gene expression. Recent studies have shown that Pax-6, a transcription factor containing both a paired domain and homeodomain, is a key protein regulating lens determination and crystallin gene expression in the lens. The use of Pax-6 for expression of different crystallin genes provides a new link at the developmental and transcriptional level among the diverse crystallins and may lead to new insights

Accepted into their evolutionary recruitment as refractive proteins. 20 May 1996

Eye development and lens induction Development of a multicellular organism is orchestrated by the action of specific transcription factors and other regulatory proteins and molecules, which control the pro- gram of embryonic determination and differentiation. The mechanism of action of the majority of these factors is believed to rely on a synergism between multiple factors. The eye is an advantageous model for studies of transcrip- tion factors during development which control organogen- esis and tissue-specific gene expression. Vertebrate eye development involves a hierarchy of inductive interactions between the embryonic forebrain and surface ecto- derm(lr2). During the course of gastrulation, a region of dorsal ectoderm is induced to form the neural plate, which folds into the neural tube with anterior protrusions and gives rise to the future brain. At the end of gastrulation, retinal fields are specified as a thickened zone of the neu- roepithelium, which folds to form the optic sulcus. Enlarge- ment of the sulcus generates optic pits in the region of the future forebrain and with the closure of the neural tube, the optic pits are pushed outward. Deepening of the optic pit results in the formation of the optic vesicle, which is con- nected to the brain cavity by the primitive optic stalk. The first manifestation of lens induction is the appearance of a dish-shaped thickening of the surface ectodermal epi- thelium, the lens placode, closely apposed to the anterior surface of the optic vesicle (Fig. 1). The lens placode indents to form the lens pit and subsequently the lens vesi- cle, while the outer part of the optic vesicle collapses

inward to form the inner layer of the (secondary) optic cup. The optic cup gives rise to the neural retina (a thicker inner layer) and pigmented epithelium (a thin outer layer). The lens vesicle separates from the surface epithelium and contains a single layer of cells with columnar morphology that differentiate into the posterior lens fiber cells and ante- rior lens epithelial cells. Lens development is character- ized by high, preferential expression of soluble proteins called crystallins (ref. 3; see below). Lens differentiation is also regulated by growth factors, especially FGFs and secreted molecules coming from the retina, an area beyond the scope of this review.

Although the identities of transcription factors involved in eye morphogenesis are just beginning to be elucidated, it has been shown recently that Pax-6 plays an essential role, both in vertebrates and Dr~soph i /a (~ - ’~ ) . Pax-6 is a complex protein with a highly conserved paired domain and homeo- domain, as described below. Overexpression of Pax-6 from Drosophila [called eyeless (ey)], mouse [called small eye ( S e ~ ) l ( ’ ~ ) or squid (S. Tomarev, P. Callaerts, L. Kos, R. Zinovieva, G. Halder, W. Gehring and J.P., manuscript in preparation), resulted in the formation of ectopic compound eyes in the fly, indicating that Pax-6 may have a universal and critical role in eye development. The aim of the present review is to summarize recent findings concerning the role of Pax-6 in the development and disorders of the eye, in particular to lens induction and transcription of crystallin genes.

BioEssays Vol. 18 no. 8 621 QlCSU Press1996 pp. 621-630 810969

Review art ides

Transcription factors implicated in eye development The molecular events specifying different eye tissues are being studied by genetic techniques and various gene selection procedures, with both strategies producing an increasing number of candidate genes for involvement in eye development. A list of selected eye transcription factors, preferentially expressed in the developing lens and retina, is given in Table 1. Additional homeobox genes expressed in vertebrate ocular tissues are compiled elsewhere(11). Thus, while Pax-6 plays a prominent role in eye and lens develop- ment, it is but one of a growing list of factors that must inter- act in numerous ways.

Phenotypes and expression pattern of Pax-6 Pax-6 was cloned initially by four groups of investigators from human@), mouse(7), zebrafish@) and The high amino acid sequence conservation (more than 96Oh) of Pax- 6 indicated that the whole protein is critical for function, con- sistent with the idea that Pax-6 has a very fundamental and specialized role, like other paired domain proteins. There are distinct phenotypes associated with Pax-6. In the mouse, the heterozygous mutations in Pax-6 result in small eye (Sey), a microphthalmia phenotype(4). Homozygous Pax-6 mutations (Sey/Sey) are lethal at birth; in addition to brain defects, the eyes and nose are absent. In the human, a heterozygous Pax-6 phenotype, aniridia (AN), is charac- terized by various ocular malformations including the lens, iris, cornea and retina, leading to cataracts and glau- coma(6z8). Peters’ anomaly is another rare human disorder

associated with Pax-6 mutations, resulting in a central corneal opacity and physical connection of the lens and cornea(33). Other homozygous Pax-6 mutations have resulted in the absence of eyes and in brain defects(34). These phenotypes are characterized by severe defects in eye morphogenesis and, in homozygous cases, the absence of the eyes and nose indicate that Pax-6 is an essential factor acting early during development and that its loss cannot be readily compensated for by another function- ally related gene.

Lens development and Pax-6 During development of the mouse eye, a broad Pax-6 expression pattern appears in the head surface ectoderm and becomes restricted progressively to the area of the future lens and cornea(7). Pax-6 mRNA is then detected sequentially in the optic pit, the optic sulcus and the optic vesicles. The expression of Pax-6 in the optic vesicle is associated with development of the inner layers of the neural retina (Fig. 1). Pax-6 mRNA is also present in the pri- mary fiber cells and later in the secondary fiber cells (the cortical cells derived at the equatorial margin by division of the epithelial cells) of the embryonic l e n ~ ( ~ ~ ~ ~ ) . In addition to the lens, Pax-6 mRNA is found in the surface ectoderm giv- ing rise to the cornea and later in the corneal epithelium(7). A slightly different pattern of Pax-6 expression occurs in the beginning stages of eye development in the embryonic chicken, where Pax-6 mRNA is limited at first to the prospective lens ectoderm and only later is detected in the

Table 1. Examples of transcription factors expressed in the developing vertebrate eye Class/Name Major sites of expression (eye only) Reference

Paired domain Pax-6

Pax-2

Otx-2 Msx-1 MSX-2

Homeodomain

Proxl Xlim-3 ChxlO Emxl Six3 Optx-l Optx-2

Helix-loop-helix

Forkhead

Leucine-zipper

Nuclear receptors

mi

BF-l,2

sw3-3

RARP RXRa

sox-1 sox-2

HMG

Optic vesicle, presumptive lens ectoderm, lens, corneal epithelium,

Optic vesicle, optic cup, optic stalk

Optic cup, RPE, presumptive lens ectoderm Mesenchyme between the surface epithelium and the lens, optic cup Optic cup, lens, retina, iris, corneal epithelium Optic vesicle, lens, retina Inner nuclear layer of the retina Optic vesicle, neuroretina Lens Optic vesicle, neural retina, lens, optic stalk Neural plate, optic vesicle, retina Anterior ectoderm (prospective eye area), optic vesicle, lens/corneal

placode, retina, optic nerve

neuroretina, iris

Pigment layer of retina

Asymmetric expression in the retinal neuroepithelium

Optic cup, lens epithelium, neuroretina

Pigmented retina, vitreous body, mesenchyme around the eye Eye

Lens fibers Lens placode, lens, retina

4-7

12-14

15-17 18 18 19,20 21 22 23 24 25 25

26

27

28

29 30

31 31

622 Vol. 18 no. 8 BioEssays

e Review articles

D

. Newoectcderm

B Inner Layer - (Froswtlve Neuroretina)

Pigment Epithelium)

E

Pigmented Layer 'ofRetin0

Fig. 1. Highly schematic diagram of the early events in mouse eye development('*). The developing lens is shown in blue. (A) At embryonic day 9 to 9.5 (E9-9.9, the optic vesicle is attached to the ventral wall of the prosencephalon via the optic stalk. The lens placode (prospective lens) becomes apparent as a thickened area of the surface ectoderm. (6) At E9.5-10, the area of the lens placode has enlarged. (C) At E10.5, the central part of the lens placode indents to form the lens pit and the optic vesicle invaginates to form the optic cup. (D) At about E l 1.5, the lens pit is converted into the lens vesicle, which is surrounded by a capsule. (E) At E13.5, the lens comprises the anterior cuboidal epithelial cells and the posterior elongationg fiber cells. The neural retina layer behind the lens begins to differentiate and the primitive cornea develops in front of the lens.

neural tube(36). In contrast to the situation in mouse embryos, the olfactory placodes of chicken embryos express little, if any, Pax-6 mRNA.

Analysis of the mouse Sey/+ or Sey/Sey embryos has provided insights into the role of Pax-6 in the early steps of the lens induction(35). Mouse Sey/Sey embryos lack the lens placode, lens pit and lens vesicle, consistent with Pax-6 being necessary for lens placode formation. Early Sey/Sey embryos have abnormally shaped brains and optic vesicles, and later in development Sey/Sey optic vesicles form optic cups and optic stalks in which morphological abnormalities prevail. It is likely that these abnormalities are initiated by the absence of Pax-6 in the neural ectoderm and are enhanced later by the absence of the lens and other indirect phenomena.

The role of Pax-6 for lens induction was studied by com- bining the surface ectoderm and the optic vesicle of rat Sey (rSey) and wild-type embryos at the 20-somite stage of

The rSey/rSey surface ectoderm never formed lenses when it was cultivated with rSey/+ or +/+ optic vesicles. In contrast, rSey/rSey optic vesicles induced lens differentiation when they were cultivated with the wild type or heterozygous surface ectoderm explants. These observations indicate that the surface ectoderm requires Pax-6 for induction of the lens placode, while the signal coming from the optic vesicle does not appear to depend on functional Pax-6. This conclusion is supported by recent analyses of chimeric mouse embryos composed of +/+ and Sey/Sey cells, which provided evidence that Pax-6 acts directly and cell autonomously in the lens and optic cup(3a). The abnormalities in the optic cup of the chimeric embryo suggested that Pax-6 regulates expression of cell adhesion molecules or extracellular matrix proteins.

Other possible lens developmental control factors In addition to Pax-6, there has been a recent proliferation of

BioEssays Vol. 18 no. 8 623

c) Review articles

other transcription factors controlling eye development. Some of these are given in Table 1 and in ref. 11. The gene for a homeodomain protein, Otx2, is expressed very early during mouse development in the embryonic ectoderm and later in the neuroectoderm of the prosencephalon and the diencephalon, and eventually in the lens placode(15). The inactivation of Otx2 gene in -/- ‘knockout’ mouse embryos resulted in the absence of the lens and nasal placodes, regions of the forebrain and midbrain, and alterations of the

Six3, the murine homolog of Drosophila sine oculis, is another interesting factor that appears to be important for early eye and lens development(24). The expression pattern for the Six3 gene overlaps with many regions expressing Pax-6. Although not detected in the presumptive lens ecto- derm, Six3 mRNA is found progressively in the optic stalk, optic vesicle, neuroretina and lens. Six3 expression in the brain of Sey/Sey mouse embryos appears to be normal. A regulatory hierarchy or possible cross-talk between Six3 and Pax-6 remains to be determined. A recent report describes a novel family of homeobox genes, Optx-1 and 2, that are also related to sine oculis of Drosophila and that are selectively expressed in the developing eyes of vertebrates and Dro~oph i la (~~) . Optx-2 mRNA already appears in the chicken embryo at the gastrula stage and in proliferating lens, corneal and retinal tissues.

Msx-2, a homeodomain protein, is transiently expressed in the embryonic mouse eye(18), where its mRNA is detected only in the surface epithelium and in the invaginat- ing lens. The gene for Proxl, a homeodomain protein homologous to prosper0 in Drosophila, is expressed in the mouse embryo in the region of the optic vesicle and subse- quently in the elongating lens fiber cells(1g). In the chicken embryo Proxl mRNA is present in the lens placode, in the lens epithelial and fiber cells and in the horizontal cells of the retina(20). Emxl and Emx2, mouse homeobox genes related to Drosophila empty spiracles, are expressed early in the developing central nervous system, and Emxl is expressed later in the lens(23). Chicken sw 3-3, a basic leucine-zipper protein, seems to be important for the prolif- eratioddifferentiation transition of lens and retinal cells(28). sw 3-3 mRNA is found in the anterior lens epithelial cells but not in the elongating fiber cells. In the chicken, the mRNA for Sox-2, a HMG box containing protein, is expressed in the lens placode and developing lend3’). The present data thus indicate that Pax-6, as well as some other transcription fac- tors, are expressed in the presumptive lens ectoderm when lens-forming competence and determination o c ~ u r ( ~ 1 ~ ~ ) .

It has been known for a long time that retinoids are essen- tial for vision. Recent experiments generating a series of null mutants of retinoic acid receptors in the mouse revealed a broad role of retinoic acid transcription factors (RAR or RXR families) for eye d e v e l ~ p m e n t ( ~ ~ ~ ~ ~ ) . Some phenotypes of these null mutants were similar to those of the Sey/+ mouse. An RXRa-I- phenotype resembles Peters’ anomaly

node(16.17).

(see above); the lens remains attached to the surface ecto- derm and rotates When double mutants were examined, an increased severity of eye malformations was observed(40). A RXRa-I- and RARy-/- mouse lacked the ventral iris and had a persistent corneal-lenticular stalk. These similarities with Pax-6 mutants may be coincidental or they may indicate cross-talk between biochemical processes governed by Pax-6 and retinoic acid.

Paxd as a transcription factor It has been estimated that the formation of compound Drosophila eyes involves the action of about 2,500 genes(l0). It is thus likely that Pax-6 possesses a wide reper- toir of molecular mechanisms. Pax-6 may not only regulate downstream factors that generate embryonic fields and underlying patterns for development, but may also partici- pate directly in controlling genes of terminal differentiation, as indicated by its presence in adult tissues. In addition, multiple forms of Pax-6 have been detected in cell extracts (Fig. 2). The prevailing protein (Pax-6/p46) has a canonical 128-amino acid paired domain. A less abundant form, Pax- 6/p48, includes a 14-amino acid insertion (5a) in the paired domain as a result of alternative RNA splicing. Like other paired-domain proteins, Pax-6 may activate or repress tran- scription and probably can participate in autoregulatory I O O ~ S ( ~ ~ ~ ~ ~ ) . Another level of complexity is that the Pax-6 gene is transcribed from at least two promoters and may be activated and/or repressed in different cells by different sets of transcription factors(41). Finally, in addition to its C-termi- nal activation domain, Pax-6 contains two different DNA- binding domains, the N-terminal paired domain and an inter- nal homeodomain, suggesting that it may interact with a number of different proteins and DNA sequence^(^^^^^).

The 128-amino acid paired domain contains consecutive modules of a-helix, p-sheet and p-turn secondary structures which are, according to crystallographic studies, essential for its specific interaction with DNA(44). The paired domain interacts with 20-26 bp of DNA, which is larger than the typi- cal 6-1 0 bp recognition sequence for most DNA-binding pro- teins (Fig. 2B). The N-terminal half is more highly conserved than the C-terminal half of the paired domain of different Pax proteins(45). Alternative splicing of Pax-6 mRNA (see Fig. 2) disrupts the ability of the N-terminal paired subdomain to interact with DNA(46). Binding to DNA with a different sequence specificity thus depends on the C-terminal subdo- main of the paired d ~ m a i n ( ~ ~ - ~ ~ ) .

The isolated Pax-6 homeodomain cooperatively dimer- izes with DNA, recognizing tandem TAAT core motifs with a preferred spacing of 3 bp(48). The Pax-6 60-amino acid homeodomain diverges considerably from the consensus homeodomain ~equence(~3). The recognition specificity of Pax-6 is affected by the presence of Ser50 (ninth residue in the recognition a-helix) within the homeodomain instead of a consensus Gln residue, a substitution shared with Pax-3,

624 Vol. 18 no. 8 BioEssays

* Review art ides

A.

Fig. 2. Multiple forms of Pax-6. (A) At least four variants of Pax-6 (p46, p48, p43 and p33/32) have been detected in cellular extracts using specific an t i~era(~O-~~) . The horizontal brackets indicate regions of nuclear localization signals(4g). PD, paired domain, comprising N- (blue) and C- (red) terminal halves; HD, homeodomain; Snip, swine-, threonine- and proline-enriched activation domain. (B) ‘Optimal’ DNA- recognition sequences known for both isolated paired domain^(^^,^^) and for the isolated homeod~main(~~) of Pax-6. PDSa is the alternatively spliced PD in Pax-6ip48.

1.17 433 . _ 7

B. 1 20 1 1 11

PD:ANNTTCACGC$T~ANT?$N; ~~%:ATGCTCAGTGAATGTTCATTGA d k ! ; ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

4 and 7(43). The Pax-6 homeodomain may play at least three roles: it may recognize a class of binding sites different from the paired domain; it may have an effect on the conforma- tion of the other domains within the protein; or it may interact with other proteins. Pax-6 is targeted into the nucleus by two nuclear localization signals located in the paired domain and at the N terminus of the home~domain(~~). The tran- scriptional activation domain resides in the C-terminal por- tion of the protein, which is enriched in Ser, Thr and Pro residues(35). Pax-6 can be phosphorylated, although its bio- logical significance is not yet known(50).

In view of the bipartite structure of the Pax-6 binding sites recognized by the two flexible halves of the paired domain, the existence of at least two protein variants with different recognition specificities and the presence of an additional putative DNA-binding entity, the homeodomain, it was clear that the identification of target genes would help greatly in understanding the functions and DNA binding mechanisms of Pax-6. Recently in this connection Pax-6 binding sites that appear to be functional were found within its own dual promoters(41) and in the promoters and enhancers of sev- e ral cry stall in genes@’ -54).

Diversity and developmental expression of crystallin genes The soluble proteins present at high concentrations and responsible for lens transparency - the crystallins - are sur- prisingly diverse and vary quantitatively and qualitatively among s p e ~ i e s ( 3 , ~ ~ ~ ~ ~ ) . There are ubiquitous crystallins (the a and by-crystallins) that are found in all vertebrate lenses and taxon-specific crystallins that are present in selected species. The latter are either related or identical to meta- bolic enzymes and include lactate dehydrogenase Ble-crys- tallin (some birds, crocodiles), argininosuccinate lyase/b crystallin (birds, reptiles), a-enolaseh-crystallin (lamprey,

turtle, some fish, several birds) and quinone oxidoreduc- tase/c-crystallin (guinea pig, camel, degu, some other mam- mals), among others. The lens crystallins of invertebrates are also diverse, taxon-specific soluble proteins that are either novel proteins, or directly related to metabolic enzymes such as glutathione S-transferase/S-crystallin and aldehyde dehydrogenase/Q-crystallin in cephalop~ds(~~) . Like the enzyme-crystallins, the ubiquitous crystallins have been recruited from pre-existing proteins with non-refractive functions. For example, the two a-crystallins (aA and a6) were derived from small heat shock proteins that can both act as molecular chaperones; aB remains stress-inducible and provides thermotolerance in numerous tissues(57). Indeed, most if not all crystallins responsible for lens trans- parency appear to be multifunctional proteins and have been recruited for their refractive role from pre-existing pro- teins expressed outside the eye.

The developmental expression of crystallin genes is as complex as their diversity(55). There are differences in the temporal and spatial patterns of expression of the various crystallin polypeptides, both within and between the crys- tallin classes, in the lens as well as in non-lens tissues in certain cases. There are also significant species differences in crystallin gene expression during lens development. For example, the a-crystallins are the first to be expressed in mice, while the 6-crystallins (not present in mammals) are the first to be expressed in chickens and are already present in the lens placode, with the a-crystallins being synthesized last in this species. The regulated nature of crystallin gene expression during development results in differences in their spatial distribution throughout the lens, and this too may differ with species.

Pax-6 and crystallin gene regulation Many crystallin gene regulatory sequences have been iden-

BioEssays Vol. 18 no. 8 625

Review articles

Table 2. Examples of crystallin gene promoters and their specificities studied in transgenic mouse Crystallin Promoter fragment(s) Activity References

Mouse aA

Chicken aA Mouse a6

Mouse yF

Guinea pig 5

Chicken pB1

Chicken pA3/Al

-366 to +46, -1 11 to+46, and -88 to +46 -60 to +46 -242 to +77 -5000 to +44 -661 to +44 -164 to +44 and -1 15 to +44 -68 to +44 -759 to +45 -1 71 to +45 and -67 to +45 -756 to +70 -385 to +70 -434 to +30 -1 52 to +30 -382 to +22 -143 to +22

*R. Gopal-Srivastava, A.C. and J.P., manuscript in preparation.

Lens fibers None Lens Lens, heart, muscle, other tissues Lens, skeletal muscle, heart, spleen, lung Lens None Lens fibers Central lens fibers Lens Lens and brain Lens fibers Primary lens fibers Lens, eye Lens

see 57 see 57 see 57 59 see 57

60 60 54 see 54 61 61 62 62

tified by transient transfection and transgenic mouse exper- iments (see refs 55 and 57). A summary of transgenic mouse data obtained by using reporter genes fused to puta- tive regulatory sequences of crystallin genes is given in Table 2. In general, minimal lens-specific promoter sequences contain a TATA-box and reside relatively close to the transcription initiation site. Additional regulatory regions required for the spatial and temporal patterns of crystallin gene expression are frequently situated close to and upstream of the minimal lens-specific promoters. An exception to this arrangement is found in the chicken 6-crys- tallin genes, where high lens expression is governed by an enhancer in the third intron. These experiments have estab- lished that transcriptional control plays a major role in the highly enriched or specific and abundant expression of crys- tallin genes in the lens. Moreover, as shown in Table 2, pref- erential expression of crystallin genes in the lens is con- served across vertebrates in all cases examined. A striking example of this conservation of lens regulation is the high lens activity of the chicken 6-crystallin enhancer in trans- genic mice, despite the fact that mice lack this crystallin altogether.

A compilation of the transcription factors that have been implicated in crystallin gene expression is shown in Fig. 3. This area of investigation is evolving rapidly, with some of these factors having only been reported recently in scientific meetings. Since these factor binding sites are often tightly clustered or physically overlap, it is possible that similar regu- latory regions bind different factors at different times in devel- opment or in different regions of the lens. There is substantial evidence that the chicken aA (Fig. 3A)(51) and 61 (Fig. 3C)(53), mouse uA (Fig. 3B)(52) and a6 (R. Gopal-Srivastava, A.C. and J.P., manuscript in preparation), and guinea pig 5(54) crystallin genes all use Pax6 for lens expression. The evi- dence that Pax-6 is required for expression of the aA, uB and 61 crystallins in the lens of mice and chicken is based on a combination of DNA binding studies, immunological identifi- cation of proteins forming protein-DNA gel-shift complexes, loss of function after site-specific mutagenesis of the Pax-6

binding sites in transfected lens cells, and gain of function in co-transfection experiments using fibroblasts; the (-crystallin experiments involved DNA-protein binding assays coupled with loss-of-function tests in transgenic mice after deletion of the Pax-6 binding site. Multiple Pax-6 binding sites have been implicated for all the genes tested except the l;-crystallin gene, for which only a single Pax-6 binding site has been found so far. Current experiments (A.C., unpublished obser- vation) have revealed that the purified paired domains of Pax- 6 can interact with other possible regulatory sequences of the the crystallin genes (some of which are shown in Fig. 3), but these have not been tested yet for function or binding to the complete Pax-6 protein. These sites are located in the 5’- flanking promoter regions except for 61 -crystallin, where binding occurs in the third intron enhancer. Although Pax-6 has been associated with the activation of 5 different crystallin genes, it is noteworthy that there is no report yet that the lens- specific yF-crystallin gene utilizes this transcription factor for its expression(63).

Localization of Pax-6 binding sites in the critical regula- tory regions of the mouse aA and aB, chicken uA and 61, and guinea pig 5 crystallin genes (see Fig. 3) fits well with the transgenic data summarized in Table 2. We are also presently exploring the role of Pax-6 in the expression of p- crystallin genes in our laboratory. Recent data have indi- cated that Pax-6 unexpectedly represses the activity of the chicken pB1 (M. Duncan and J.P., unpublished) and PA3/Al (J. Haynes, II and J.P., unpublished observations) crystallin promoters in cotransfection tests. Possibly, then, Pax-6 is a negative regulator of the P-crystallin genes. This is consis- tent with the inverse spatial relationships between the rela- tive amounts of Pax-6 mRNA and the expression of P-crys- tallin genes within the developing

Other crystallin transcription factors As shown in Fig. 3, Pax-6 must cooperate with numerous other transcription factors that bind to the different crystallin genes. Indeed, functional protein interactions demonstrat- ing lens specificity can be created artificially by multimeriz-

626 Vol. 18 no. 8 BioEssays

m Review articles

Fig. 3. Schematic representation of the chicken aA-, 61-, mouse aA-, aB-, yF- and guinea pig c-crystallin regulatory regions. DNA-binding regions are shown in boxes, and activators (repressors) are shown above (under) the boxes, respectively. Functional binding of Pax-6 is colored dark blue for emphasis. Pax-6 binding by purified paired domains is indicated by light blue ovals; these sites have not been tested yet for function. (A) aA(c) is the chicken A- crystallin S-flanking region. Proteins C3 and E2 are undefined and have only been detected in gel-shift assays(5i). (B) aA(m) is the mouse aA-crystallin 5'-flanking region(5z). In addition to Pax-6, non-tissue- specific protein C2 binds the Pax-6 binding site; region PEl(64) also binds an additional undefined protein (not shown). (C) aB(m) is the mouse aB-crystallin 5'-flanking region, which contains a muscle/ headlens (MHL) enhancer(65). There are five regulatory elements in the MHL enhancer: E4 is a heart- specific SRF-like protein-binding site, and MRF (for muscle regulatory factor) binds MyoD-family members. The ? factor binding to LSRl is not identified. (D) 61(c) is

W

+ I

-. . TBP 1 .

aB(m) 3 E l I E4 I E2 I E3 LSRl I LSR2 ~TATA]

MHL Enhancer c. -7'

aCE2

-.. -. 83 I I Ilb I Ila ] 84 I6EF216EF1131 85

-55

E. E.

aCE2 1'

F.

i(!3P)

-150 +1 J -

AaCE21 ZPE I

rIrI- .150

~I I ,

the chicken 61 -crystallin 5-flanking region and the third intron enhancer(sl.53). Activator 6EF3 (a helix-loop-helix (HLH) protein) competes for binding with the repressor 6EF1(66). (E) yF(m) is the mouse -faystallin 5'-flanking regi~n(~*,~'-~*). (F) ((gp) is the guinea pig c-crystallin 5'-flanking region(54). The nCE2 sequence(69) has been reported recently to bind the activator L-maf (see text).

ing essential but insufficient enhancer regions of the chicken aA(6g) and 61 (31) crystallin genes. The interactions of crystallin transcription factors can lead to both activation and repression. For example, sites A and B situated just upstream of the two Pax-6 binding sequences in site C in the 5'-flanking region of the chicken aA-crystallin gene form a composite element(51). Identifications based upon immunoreactivity in gel-shift experiments have indicated that promoter activation in the lens is associated with USF binding to site A and CREB or CREM family members to site B, while promoter repression is associated with USF on site A interacting with AP-I family members (Fra2 and JunD) at site B in fibroblasts. Another site, D, interacts with USF in lens and fibroblasts to repress the chicken aA promoter in transfection tests. In the chicken 61 -crystallin enhancer, located in the third intron, a zinc finger/homeodomain pro- tein, 6EF1, competitively represses a bHLH activating pro- tein, called 6EF3@3. While the authentic 6EF3 has not been identified yet, it is noteworthy that USF has been shown to be able to protect the enhancer binding region from DNase 1 digestion(53). 6EF1 is expressed in many embryonic tissues, most notably in the notochord and myotomes, and can repress E2-box-mediated activation of different genes, sug- gesting that it has a general role in the regulation of embry-

onic differentiation and specific gene expression(66). yFBP is yet another negative regulatory factor that binds to the pro- moter of the mouse yf-crystallin gene(67).

Sox proteins have recently been shown to activate chicken 61- and mouse yF-crystallin genes in the lens(3l). These transcription factors are related to the sex-determin- ing proteins, SRY, and bend DNA by binding to the minor groove via HMG boxes, potentially allowing proteins bound to remote enhancer sequences to interact with proximal pro- moter regions. Several Sox proteins bind to the 61 -crystallin enhancer and appear to be the factors forming the 6EF2a-d complexes in gel-shift assays(31). Of the numerous Sox pro- teins, Sox 2 probably forms FEF2a, since it can activate the 61-crystallin enhancer, is expressed in the lens placode and is enriched in the epithelium and fibers of the embryonic chicken lens. 6EF2b appears to be Sox 1, which may be used for yf-crystallin promoter activity, since it is localized in the fiber cells of the mouse embryo where the y-crystallins are expressed. 6EF2c and 6EF2d predominate in non-lens cells and thus may bind other Sox family members.

Retinoic acid receptors bind to retinoic acid response elements (RAREs) and enhance the lens expression of crystallin genes. While the proximal promoter fragment uti- lizing Sox is sufficient for lens-specific expression of the

BioEssays Vol. 18 no. 8 627

Review articles

L-mar Prox-I

activin A RARiRXR shh

Unknown factors

1 Comoetence Bias Determination Differentiation

ECTODERM + PLACODE VESICLE + LENS

’I\(\,, // Induction (Neural Plate)

Fig. 4. Summary of vertebrate lens induction and possible roles for Pax-6. Lens induction consists of four phases: lens-forming competence, bias, determination and differentiation(”). The possible role of Pax-6 before the lens-determination phase is not known(35). Activin At7’) and sonic hedgehog, ~ h h ( ~ ~ , ~ ~ ) repress Pax-6 expression. Autoregulation of Pax-6 transcription (circular arrow) may be the mechanism used to a generate sufficient amount of p r ~ t e i n ( ~ ~ , ~ l ) . A, activators of Pax-6; IS, inductive signals.

mouse yf-crystallin gene(31160), an upstream enhancer con- taining a novel everted RARE with an 8-bp spacer is used for maximum activity (Fig. 3E)@). This yF-crystallin RARE binds RAR, RXR or RORa. The regulation of crystallin genes by retinoic acid is consistent with a role of this mor- phogen during lens differentiation (see above).

There are a number of exciting new studies implicating other transcription factors for crystallin gene expression cur- rently under investigation. One of these is L-maf, a lens- specific member of the maf oncogene family of basic leucine zipper proteins (K. Yasuda, H. Ogino, K. Ono, S. lshibashi and S. Kawauchi, presented at the Taniguchi Symposium on Developmental Biology VII, Osaka, Japan, January 16-1 9, 1996). L-maf appears in the chicken lens placode, binds the aCE2 sequence(6g) found in multiple crystallin genes, and activates the chicken aA and 61 enhancers and the mouse yF promoter in cotransfection experiments (see Fig. 3). Another potentially important factor for crystallin gene expression is HSF2, a heat-shock transcription factor(70). The chicken aA (Fig. 3A) and mouse yF (Fig. 3E) crystallin promoters contain a heat-shock-related dyad (HSRD) sequence that does not confer heat inducibility but does bind the heat-shock transcription factors, HSFl and HSF2 (P. Frederikse and J.P., manuscript in preparation). These HSRD sequences lie within critical regions of the regulatory sequences used for lens expression. Since HSF2 is involved in the developmental expression of stress proteins, it is con- sistent that HSF2 would be involved in expression of these crystallin genes with a stress-related ~ r i g i n ( ~ ! ~ ~ ) .

Crystallin recruitment: a role for Pax-6 Although the crystallins are water-soluble proteins that exist in high concentrations in the lens, their differences in struc-

ture, multifunctional properties and expression patterns make it unclear precisely what common features or which of their non-refractive roles have been critical for their selec- tion as lens refractive proteins. One connection among sev- eral, but not all, crystallins is that they are used in stress- related roles, with the small heat-shock protein/aB-crystallin being the prime example(57). This raises the possibility that their high developmental expression in the lens evolved originally from inductive events serving to protect the lens cells from environmental stress.

It is interesting to speculate briefly on the evolutionary mechanisms invoked to recruit ubiquitous proteins to become refractive lens crystallins. One possibility is that any gene activated by one or more transcription factors used for lens development, such as Pax-6 and/or other proteins (see Table 1 and Fig. 3), could become a candidate crystallin gene. Thus, the acquisition of a functional Pax-6 site during evolution would allow a gene to have its encoded protein tested for crystallin function in the lens. Synergistic interac- tions with other transcription factors that are also prevalent in the lens could, of course, enhance expression of the can- didate gene and improve the chances of its encoded protein being selected as a crystallin, which must accumulate to a relatively high concentration to give the transparent lens a proper refractive index. In addition to being subjected to the selective forces required for developmental events, it has been suggested that transcription factors used for crystallin gene expression may also be subjected to selective pres- sures required for particular constraints needed for lens transparency(56). For example, one possible selective force might be the redox state. In any case, the final stages for a candidate protein to be recruited as a crystallin would depend on it having a phenotype that optimizes the optical properties of the lens. These phenotyes would include the ability to remain soluble at high concentration and to pack properly within the lens.

Conclusions and perspectives Fig. 4 depicts an emerging view, which will certainly be mod- ified with additional information, of the role of Pax-6 during lens development in the vertebrate eye. The broad expression pattern of Pax-6 in the head surface ectoderm and its subsequent restricted expression in the lens placode, the Pax-6 requirement for lens formation from surface ecto- derm, and the correlation of Pax-6 expression with the potential for transdifferentiation of various tissues into lens- like cells, argue for a pivotal role of Pax-6 in lens determina- tion(2z7,35-38). Moreover, the presence of Pax-6 in the cell nuclei of lens epithelial cells and elongating fibers in neonatal and even adult lenses suggests a maintenance role for Pax- 6(7235s54). Pax-6 is not sufficient for lens differentiation since it is expressed in numerous tissues that do not form eyes, and it clearly must work together with other DNA-binding tran- scription factors, tissue-specific co-activators and growth

628 Vol. 18 no. 8 BioEssays

m Review art i c I e s

factors during eye development (see Table 1 and ref. 1 1); the studies identifying these lens and eye developmental factors are just beginning. Crystallin genes have been shown to be candidate target genes for P a ~ - 6 @ - ~ ~ ) . Multiple binding of Pax-6 to the promoters and enhancers may also induce changes in the chromatin structure of crystallin genes. The functions of the various isoforms of Pax-6 and the paired and homeodomains of Pax-6 require resolution. In addition, Pax- 6 may repress some genes (i.e. P-crystallins) while activating others in certain regions of the lens. Pax-6 does not act alone and interacts with other transcription factors that are highly enriched in the lens, such as Sox, and with numerous ubiqui- tous transcription factors, such as AP-I , USF, CREB/CREM and HSF among others, which may play both positive and negative regulatory roles. Certainly many more crystallin transcription factors, their mechanisms of action and possi- ble interaction with Pax-6, and their developmental involve- ment in the temporal and spatial expression of crystallin genes within the lens, remain to be discovered.

The regulation of Pax-6 itself in the lens and other tissues is another area of great importance. As indicated by the cir- cular arrow in Fig. 4, there is evidence that Pax-6 may regu- late its own p r ~ m o t e r ( ~ ~ , ~ ~ ) . In contrast to the yet-unknown activators of the Pax-6 gene, it can be down-regulated by activin A(71), sonic h e d g e h ~ g ( l ~ , ~ ~ ) and possibly Pax-2(13). The roles of these and other lens-inducing signals and repressors, which limit the initial diffuse expression pattern of Pax-6 in the surface ectoderm to the presumptive lens cells, remain to be established.

The recent investigations indicating that Pax-6, in collab- oration with other factors, may be used throughout the ani- mal kingdorn(l0) and furthermore, that it may be used as an important transcription factor for lens determination and crystallin gene expression in the lens, have brought exciting new avenues of research for exploring the eye and lens. In addition, the growing number of crystallin genes that depend upon Pax-6 for their lens-preferred expression may also provide new insights concerning the evolutionary mechanisms used for recruiting a diverse set of multifun- tional proteins to become the refractive crystallins of the transparent lens.

Acknowledgements We thank Drs M. Duncan, P. Frederikse, R. Gopal-Srivas- tava, J. Haynes, C. Sax and S. Tomarev from our laboratory and Dr K. Yasuda for sharing their unpublished data; and Drs S. Tomarev, P. Zelenka, C. Sax and M. Kantorow for critical reading of this manuscript. We thank Jeff Aarons and Martha Blalock for their help with preparation of figures.

References 1 Saha, M.S., Servetnick, M. and Grainger, R.M. (1992). Vertebrate eye development. Curr. Opin. Genet. Dev. 2, 582-588. 2 Grainger, R.M. (1992). Embryonic lens induction: shedding light on vertebrate tissue determination. Trends Genet. 8, 349-355.

3 Wistow, G.J. and Piatigorsky, J. (1988). Lens crystallins: the evolution and expression of proteins for a highly specialized tissue. Annu. Rev. Biochem. 57,

4 Hill, R.E. etal. (1991). Mouse Small eye results from mutations in a paired-like homeobox-containing gene. Nature 354, 522-525. 5 Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Zebrafish pax[zf-a]: a paired box-containing gene expressed in the neural tube EM60 J. 10, 3609- 3619. 6 Ton, C.C. etal. (1991). Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. CeN67, 1059-1074. 7 Walther, C. and Gruss, P. (1991). Pax-6, a murine paired box gene, is expressed in the developing CNS. Development113, 1435-1449. 8 Glaser, T., Walton, D.S. and Maas, R.L. (1992). Genomic structure, evolutionary conservation and aniridia mutations in the human Pax6 gene. Nature Genet. 2,232-239. 9 Quiring, R., Walldorf, U., Kloter, U. and Gehring, W.J. (1994). Homology of the eyeless gene of Drosophila to the Small eye gene in mice and aniridia in humans. Science 265,785-789. 10 Halder, G., Callaerts, P. and Gehring, W.J. (1995). Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science 267, 1788- 1792. 11 Beebe, D.C. (1994). Homeobox genes and vertebrate eye development. Invest. Ophthal. Vis. Sci. 35,2897-2900. 12 Dressier, G.R., Deutsch, U., Chowdhury, K., Nornes, H.O. and Gruss, P. (1990). Pax2, a new murine paired-box-containing gene and its expression in the developing excretory system. Development 109, 787-795. 13 Macdonald, R. et a/. (1995). Midline signalling is required for Pax gene regulation and patterning of the eyes. Development 121, 3267-3278. 14 Macdonald, R., Earth, K.A., Xu, Q., Holder, N., Mikkola, 1. and Wilson, S.W. (1 994). Regulatory gene expression boundaries demarcate sites of neuronal differentiation in the embryonic zebrafish forebrain. Neuron 13, 1039-1053. 15 Simeone, A. eta/. (1993). A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EM60 J. 12,2735-2747. 16 Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa, S. (1995). Mouse Otx2 functions in the formation and patterning of rostra1 head. Genes Dev.

17 Acampora, D. et a/. (1995). Forebrain and midbrain regions are deleted in Otx2’- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 121, 3279-3290. 18 Monaghan, A.P. et a/. (1991). The Msh-like homeobox genes define domains in the developing vertebrate eye. Developmentll2, 1053-1061. 19 Oliver, G., Sosa-Pineda, B., Geisendorf, S., Spana, E.P., Doe, C.Q. and Gruss, P. (1993). Prox-1, a prospero-related homeobox gene expressed during mouse development. Mech. Dev. 44,3-16. 20 Tomarev, S.I., Sundin, O., Banerjee-Basu, S., Duncan, M.K., Yang, J.-M. and Piatigorsky, J. (1996). A chicken homeobox gene Proxl related to Drosophila Prosper0 is expressed in the developing lens. Dev. Dynam. (in press). 21 Taira, M., Hayes, W.P., Otani, H. and Dawid, 1.6. (1993). Expression of LIM class homeobox gene Xlim-3 in Xenopus development is limited to neural and neuroendocrine tissues. Dev. Biol. 159,245-259. 22 Lieu, I.S.C. et a/. (1994). Developmental expression of a novel murine homeobox gene (CHx 10): evidence for roles in determination of the neuroretina and inner nuclear layer. Neuron 13,377-393. 23 Simeone, A., Gulisano, M., Acampora, D., Stornaiulo, A., Rambaldi, M. and Boncinelli, E. (1992). Two vertebrate homeobox genes related to the Drosophila empty spiracles gene are expressed in the embryonic cerebral cortex. EM60 J.

24Oliver, G., Mailhos, A., Wehr, R., Copeland, N.G., Jenkins, N.A. and Gruss, P. (1 995). Six3, a murine homologue of the sine oculisgene, demarcates the most anterior border of the developing neural tube and is expressed during eye development. Development 121,4045-4055. 25 Sundin, O., Toy, J., Leppert, G., Yang J.-M. and Kang, R. (1996). Optx: a novel family of homeobox genes selectively expressed in the developing eye. lnvest. Ophthal. Vis. Sci. 37 (Suppl.), 200. 26 Hodgkinson, C. eta/. (1993). Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix- zipper protein. Ce//74,395-404. 27 Hatini, V., Tao, W. and Lai, E. (1994). Expression of winged helix genes, BF-1 and BF-2, define adjacent domains within the developing forebrain and retina. J. Neurobiol. 25, 1239-1309. 28 Wang, S.-2. and Adler, R. (1994). A developmentally regulated basic-leucine zipper-like gene and its expression in embryonic retina and lens. Roc. NatlAcad. Sci. USA91,1351-1355. 29 Dolle, P., Rubeete, E., Leroy, P., Morris-Kay, G. and Chambon, P. (1990). Retinoic acid receptors and cellular retinoid binding proteins. I Systematic study of their differential pattern of transcription during mouse organogenesis. Development 11 0,1133-1 151.

479-504.

9,2646-2658.

11,2541 -2550.

BioEssavs Vol. 18 no. 8 629

Review articles

30 D o h , P., Fraulob, V., Kastner, P. and Chambon, P. (1994). Developmental expression of murine retinoid X receptor (RXR) genes. Mech. Dev. 45, 91-104. 31 Kamachi, Y., Sockanathaw, S., Liu, Q., Breitman, M., Lovell-Badge, R. and Kondoh, H. (1995). Involvement of SOX proteins in lens-specific activation of crystallin genes. EM60 J. 14,3510-3519. 32 Martin, P. e t a / . (1992). Characterization of a paired box- and homeobox- containing quail gene (Pax-QNR) expressed in the neuroretina. Oncogene 7, 1721 -1 728. 33 Hanson, I. et a/. (1994). Mutations at the PAX6 locuss are found in heterogenous anterior segment malformations including Peter's anomaly. Nature Genet 6 , 168-173. 34 Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J. and Maas, R.L. (1994). PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nature Genet 8,463-471. 35 Grindley, J.C., Davidson, D.R. and Hill, R.E. (1995). The role of Pax-6 in eye and nasal development. Development121 , 1433-1442. 36 Li, H.-S., Yang, J.-M., Jacobson, R.D., Pasko, D. and Sundin, 0. (1994). Pax-6 is first expressed in a region of ectoderm anterior to the early neural plate: implications for stepwise determination of the lens. Dev. Eiol. 162, 181-194. 37 Fujiwara, M., Uchida, T., Osumi-Yamashita, N. and Eto, K. (1994). Uchida rat (rSey): a new mutant rat with craniofocal abnormalities resembling those of the mouse Small eye mutant. Differentiation57,31-38. 38 Quinn, J.C., West, J.D. and Hill, R.E. (1996). Multiple functions for Pax6 in mouse eye and nasal development. Genes Dev. 10,435-446. 39 Kastner, P. e ta / . (1994). Genetic analysis of RXRa developmental function: convergence of RXR and RAR signalling pathways in heart and eye morphogenesis. Cell78,987-1003. 40 Lohnes, D. et ar. (1994). Function of the retinoic acid receptors (RARs) during development. (1) Craniofacial and skeletal abnormalities in RAR double mutants. Development 120,2723-2748. 41 Plaza, S., Dozier, C. and Saule, S. (1993). Quail PAX-6 (PAX-QNR) encodes a transcription factor able to bind and transactivate its own promoter. Cell Growth Differ. 4, 1041-1050. 42 Treisman, J., Harris, E and Desplan, C. (1991). The paired box encodes a second DNA-binding domain in the Paired homeo domain protein. Genes Dev. 5, 594-604. 43 Treisman, J., Gonczy, P., Vashishtha, M., Harris, E. and Desplan, C. (1989). A single amino acid can determine the DNA binding specificity of homeodomain proteins. Cell59, 553-562. 44 Xu, W.. Rould, M.A., Jun, S., Desplan, C. and Pabo, C. (1995). Crystal structure of a paired domain-DNA complex at 2.5A resolution reveals structural basis for Pax developmental mutations. Ce//80,639-650. 45 Epstein, J.A., Glaser, T., Cai, L., Jepeal, L., Walton, D.S. and Maas, R.L. (1994). Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev. 8,2022-2034. 46 Epstein, J., Cai, J., Glaser, T., Jepeal, L. and Maas, R.L. (1994). Identification of a Pax paired domain recognition sequence and evidence for DNA- dependent conformational change. J. Biol. Chem. 269,8355-8361. 47 Czerny, T., Schaffner, G. and Busslinger, M. (1993). DNA sequence recognition structure of the paired domain and its binding site. Genes Dev. 7,

48 Czerny, T. and Busslinger, M. (1995). DNA-binding and transactivation properties of Pax-6: three amino acids in the paired domain are responsible for the different sequence recognition of Pax-6 and BSAP (Pax-5). Mol. Cell. Biol. 15,

49 Carriere, C. ef a/. (1995). Nuclear localization signals, DNA binding, and transactivation properties of quail Pax-6 (Pax-QNR) isoforms. Cell Growth Diff. 6,

50 Carriere, C.S. ef a/. (1993). Characterization of quail Pax-6 (Pax-QNR) proteins expressed in the neuroretina. Mol. Cell. Biol. 13, 7257-7266. 51 Cvekl, A., Sax, C.M., Bresnick, E.H. and Piatigorsky, J. (1994). Complex array of positive and negative elements regulates the chicken aA-crystallin gene: involvement of Pax-6. USF, CREB and/or CREM, and AP-1 proteins. Mol. Cell. EIol. 14.7363-7367. 52 Cvekl, A., Kashanchi, F., Sax, C.M., Brady, J. and Piatigorsky, J. (1995). Transcriptional regulation of the mouse aA-crystallin gene: activation dependent on a cyclic AMP-responsive element (DEllCRE) and a Pax-6-binding site. Mol. Cell. Biol. 15,653-660.

2048-2061.

2858-2871.

1531 -1540.

53 Cvekl, A., Sax, C.M., Li, X., McDermott, J.B. and Piatigorsky, J. (1995). Pax- 6 and lens-specific transcription of the chicken 81 -crystallin gene. Proc. Natl Acad.

54 Richardson, J., Cvekl, A. and Wistow, G. (1995). Pax-6 is essential for lens- specific expression of (-crystallin. Proc. Natl Acad. Sci. USA 92,4676-4680. 55 Piatigorsky, J. and Zelenka, P.S. (1992). Transcriptional regulation of crystallin genes: cis elements, trans-factors, and signal transduction systems in the lens. Adv. Dev. Eiochem. 1,211-256. 56 Piatigorsky, J. (1 992). Lens crystallins. Innovation associated with changes in gene regulation. J. Efol. Chem. 267, 4277-4280. 57 Sax, C.M. and Piatigorsky, J. (1994). Expression of the a-crystallinlsmall heat shock proteinlmolecular chaperone genes in the lens and other tissues. Adv. Enzymol. Relat. Areas Mol. Eiol. 69, 155-201. 58 Tomarev, S.I. and Piatigorsky, J. (1996). Lens crystallins of invertebrates: recruitment from glutathione S-transferase, aldehyde dehydrogenase and other novel proteins. Eur. J. Eiochem. 235, 449-465. 59 Haynes, J.I., II, Duncan, M.K. and Piatigorsky, J. (1996). Spatial and temporal activity of the aB-crystallinlsmall heat shock protein gene promoter in transgenic mice. Dev. Dynam. (in press). 60 Goring, D.R.. Bryce, D.M., Tsui, L.-C., Breitman, M.L. and Liu, Q. (1993). Developmental regulation and cell type-specific expression of the murine 7- crystallin gene is mediated through a lens-specific element containing the yF-1 binding site. Dev. Dynam. 196, 143-152. 61 Duncan, M.K., Li, X., Ogino, H., Yasuda, K. and Piatigorsky, J. (1996) Developmental regulation of the chicken pel -crystallin promoter in transgenic mice. Mech. Dev. (in press). 62 McDermott, J.B., Cvekl, A. and Piatigorsky, J. (1 996). Lens-specific expression of a chicken aA3/A1 -crystallin promoter fragment in transgenic mice. Eiochem. Eiophys. Res. Commun. 221,559-564. 63 Dirks, R.P.H., Klok, E.J., van Genesen, S.T., Schoenmakers, J.G.G. and Lubsen, N.H. (1996). The sequence of regulatory events controlling the expression of the $-crystallin gene during fibroblast growth factor-mediated rat lens fiber differentiation. Dev. BIOl. 173, 14-25. 64 Sax, C,M. et a/. (1995). Lens-specific activity of the mouse aA-crystallin promoter in the absence of TATA box: functional and protein binding analysis of the mouse aA-crystallin PEI region. NucleicAcids Res. 23,442-451. 65 Gopal-Srivastava, R., Haynes, J.I., II , and Piatigorsky, J. (1995). Regulation of the murine aB-crystallinlsmali heat shock protein gene in cardiac muscle. Mol. Cell. Biol. 15,7081-7090. 66 Sekido, R. e ta / . (1994). The S-crystallin enhancer-binding protein 6EF1 is a repressor of E2-box-mediated gene activation. Mo/. Cell. Biol. 14, 5692-5700. 67 Liu, Q., Shalaby, F., Puri, M.C., Tang, S. and Breitman, M.L. (1994). Novel zinc finger proteins that interact with the mouse yF-crystallin promoter and are expressed in the sclerotome during early somitogenesis. Dev. Biol. 165, 165- 177. 68 Tini, M., Fraser, R.A. and Giguere, V. (1995). Functional interactions between retinoic acid receptor-related orphan nuclear receptor (RORo.) and the retinoic acid receptors in the regulation of the yF-crystallin gene. J. Biol. Chem. 270,

69 Matsuo, I. and Yasuda, K. (1992). The cooperative interaction between two motifs of an enhancer element of the chicken aA-crystallin gene, aCEl and aCE2, confers lens-specific expression. Nucleic Acids Res. 20,3701-3712. 70 Frederikse, P.F. and Piatigorsky, J. (1 994). Normal and heat-inducible binding of HSF proteins to a-crystallin regulatory sequences. lnvest. Ophthalmol. Visual. Sci. 35 (Suppl.), 2073. 71 Pituello, F., Yamada, G. and Gruss, P. (1995). Activin A inhibits Pax-6 expression and perturbs cell differentiation in the developing spinal cord in vitro. Proc. NatlAcad. Sci. USA 92,6952-6956. 72 Ekker, S.C. eta/ . (1 995). Patterning activities of vertebrate hedgehog proteins in the developing eye and brain. Curr. Biol. 5,944-955.

Ale6 Cvekl and Joram Piatigorsky are at the Laboratory of Molecular and Developmental Biology, National Eye Institute, National Institutes of Health, Bethesda, MD 20892-2730, USA. E-mail: JoramQ helix.nih.gov and Cvekl@ncifcrf.gov

Scl. USA 92,4681 -4685.

20156-20161.

. ... .~ ~~

630 Vol. 18 no. 8 BioEssavs