Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques...
-
Upload
adele-walsh -
Category
Documents
-
view
218 -
download
0
Transcript of Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques...
![Page 1: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/1.jpg)
Lecture 2: Biology Review II
Date: 8/29/02Overview/Review of:
Mapping Molecular techniques Markers
![Page 2: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/2.jpg)
Genetic Mapping
Definition: A genetic map is an ordering of genes and markers in a linear arrangement corresponding to their physical order along the chromosome. Based on linkage.
Definition: A physical map is an ordering of landmarks on DNA, regardless of inheritance. Measured in base pairs.
![Page 3: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/3.jpg)
Marker
Definition: A marker is a gene or piece of DNA with easily identified phenotype such that cells or individuals with different alleles are distinguishable.
e.g. a gene with known function e.g. a single nucleotide change in DNA
![Page 4: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/4.jpg)
Polymorphism
Definition: A polymorphism is a detectable and heritable variation at a locus.
Definition: A marker is polymorphic if the most abundant allele comprises less than X% of all alleles, usually 95%.
Definition: A mapping population is a population used to map genes.
![Page 5: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/5.jpg)
Natural Populations
Definition: Natural populations are those where mating is not controlled by the experimenter, though the experimenter can choose who to observe.
Only phenotype observable, genotype sometimes unknown, phase is unknown.
Knowns: allele frequencies, genotype frequencies, amount of disequilibrium.
![Page 6: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/6.jpg)
Hardy-Weinberg Equilibrium I
Refers to the equilibrium achieved at a single locus.
Hardy-Weinberg Equilibrium (HWE) is achieved when the allele frequencies and genotype frequencies do not change from generation to generation.
![Page 7: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/7.jpg)
Hardy-Weinberg Equilibrium II
Let pA and pB be the frequencies of allele A and B in the population. Let pAA be the frequency of genotype AA. Similarly, pAB and pBB are genotype frequencies.
Then HWE implies that
pAA = pA2
pAB = 2pApB
pBB = pB2
![Page 8: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/8.jpg)
P(heterozygote) =
Definition: Polymorphism Information Content (PIC)
Measures of Polymorphism
l
ii
pH1
21
l
i
l
ijji
l
ii pppPIC
1 1
22
1
2 21
![Page 9: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/9.jpg)
Uninformative Matings
1 AA : 2 AB : 1 BB
AB ABX
uninformative informative
½ are informative
![Page 10: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/10.jpg)
Classical Linkage Analysis
A few markers. Must have detectable variation. Must be substantially variable in study
population.
Controlled crosses: testcross, backcross, double- haploid
Well-defined parental lines.
![Page 11: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/11.jpg)
Three-Point Testcross Design
X X
F1 F2
testcross
X XASY
btz
ASY
btz
bSz
ASY
btz
dominant recessive
btz
btz
btz
![Page 12: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/12.jpg)
Three-Point Testcross Results
Count the number of recombinant haplotypes produced by F1 parent. Calculate the recombinant fraction for each pair of genes.
1 2 3
1 -- 0.19 0.03
2 -- -- 0.15
3 -- -- --
![Page 13: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/13.jpg)
Map for Three-Point Testcross
1 3 2
0.03
0.19
0.15
![Page 14: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/14.jpg)
Backcross Design
F2
self
no more changes
new recombinant
self
![Page 15: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/15.jpg)
Large-Scale Mapping
Many genetic markers Steps of analysis:
pairwise linkage analysis group into linkage groups order markers in each linkage group
![Page 16: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/16.jpg)
Comparative Mapping
Compare maps of different species. Due to similarities, information can be
transferred between species. Information about how genomes evolve. Uses conserved loci rather than highly
variable loci.
![Page 17: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/17.jpg)
Molecular Techniques: probes
5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’3’ – …TTCGGATCTCGGGAATCGGTTTTC… – 5’
3’ – *ATCTCGGGAATC – 5’add probe
5’ – …AAGCCTAGAGCCCTTAGCCAAAAG… – 3’*ATCTCGGGAATC
denature
hybridization
![Page 18: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/18.jpg)
Molecular Techniques: restriction enzymes
Definition: An endonuclease is an enzyme (protein that acts as a catalyst to speed up the rate of a biochemical reaction) thatcleaves nucleic acid strands at internal sites (phosphodiester bond).
Definition: A restriction endonuclease is an enzyme that cuts DNA at specific sites that it recognizes.
EcoRI 5’ GAATTC 3’ 3’ CTTAAG 5’
number of cutsites = N/4b
![Page 19: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/19.jpg)
Molecular Techniques: gel electrophoresis
DNA is negatively charged. Proteins can also be charged.
An electric current is passed through a porous medium (agarose, acrylamide) and molecules in the medium respond by moving in electric field, but at different rates based on size and charge.
![Page 20: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/20.jpg)
Electrophoretic Gel
![Page 21: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/21.jpg)
Molecular Technique: PCR I
Denaturation and hybridization
5’
5’
5’
5’
Elongation & denaturation
5’
5’
![Page 22: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/22.jpg)
Molecular Technique: PCR II
![Page 23: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/23.jpg)
Physical Maps
Banding patterns on chromosomes In-situ hybridization
Denature metaphase chromosomes Add radioactive or fluorescent probe Visualize chromosomes
DNA fragmentation DNA sequence: still not practical for all
organisms
![Page 24: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/24.jpg)
DNA Fragmentation
• Larger fragments better (rare cutters; partial digestion)• Find overlap by sequencing or hybridization.
![Page 25: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/25.jpg)
DNA Vector I
Definition: A cloning vector is a DNA molecule that is capable of self-replicating. Insert the fragment of foreign DNA to make recombinant DNA.
![Page 26: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/26.jpg)
DNA Vector II
phage: virus that infects bacteria (5-25 kb). cosmid: Packaged in lambda phage and infects E.
coli (35-45 kb). yeast artificial chromosome (YAC): has telemere,
centromere, and replication origin (200-2000 kb). bacterial artificial chromosome (BAC) plasmid: extrachromosomal circular DNA
nonessential for cell survival.
![Page 27: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/27.jpg)
How Many Clones?
Let N be the number of clones made.
Let NS be the number of nonoverlapping clones needed to cover the full genome.
N
S
S
N
N
1libraryin not cloneP
SN
P
11log
1logN
More: M. S. WatermanIntroduction to Computational Biology: Maps, Sequences, and Genomes
![Page 28: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/28.jpg)
Genetic Mapping Still Needed
Even if the full sequence is known, mapping is still necessary.
There must be some way to correlate a trait/phenotype with something on the sequence.
![Page 29: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/29.jpg)
Physical Mapping Still Needed
Linkage maps lack resolution Sample more people Better statistics Let recombination accumulate over many
generations.
Even with most precise linkage map can identify a gene to 1 cM (1 Mb in humans).
![Page 30: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/30.jpg)
Morphological Markers
Differences in shape, color, size, etc. Must have one-to-one correspondence with a
controlling gene.
![Page 31: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/31.jpg)
Protein Markers
Definition: An isozyme are proteins with same enzymatic function but different structural, chemical, or immunological characteristics.
Differences: amino acid composition, size, modifications (e.g. phosphorylation).
Differences visualized: gel electrophoresis, mass spectrometry, etc.
![Page 32: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/32.jpg)
DNA Marker: RFLP I
Definition: RFLP is Restriction Fragment Length Polymorphism.
DNA digested with endonuclease. Separate fragments by electrophoresis. Denature strands. Transfer single-stranded DNA to durable membrane
and immobilize (Southern blot). Hybridize labeled probe to the blot. Visualize probe.
![Page 33: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/33.jpg)
DNA Marker: RFLP II
DNA polymorphisms that RFLP identifies: mutation in the restriction site mutation elsewhere to create restriction site insertion/deletion of DNA
RFLP markers are codominant
![Page 34: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/34.jpg)
Mini- and Micro-Satellite Markers
Definition: minisatellites or VNTR (Variable Number of Tandem Repeats) are tandem repeates of sequences 9-100 bp long. Detected by hybridization or PCR.
Definition: microsatellites or SSR (Simple Sequence Repeat) are direct tandem repeated sequences of DNA of 1-6 bp.
![Page 35: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/35.jpg)
STS and EST
Definition: Sequence tagged sites (STS) is a short unique fragment of DNA.
Definition: Expressed sequence tags (EST) are subsets of STSs from cDNA clones. Represent transcribed genes (e.g. usually proteins).
![Page 36: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/36.jpg)
Single-Strand Conformational Polymorphism (SSCP)
Detects changes as small as 1 nucleotide in more than 1000 bp.
Single-stranded DNA is electrophoresed on gel and migrates based on size and shape.
Visualized by Southern blot with specific fragment probe or PCR specific fragment and visualize directly.
![Page 37: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/37.jpg)
Random Amplified Polymorphic DNA (RAPD)
PCR with short probes that bind randomly to sites in the genome.
Good for genomes where little sequence information is available.
Band-present is dominant. Expected number of products = 2fN/16b
![Page 38: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/38.jpg)
Amplified Fragment Length Polymorphism (AFLP)
Cut DNA with frequent- and rare-cutting endonuclease
Anneal adapters to the ends of the frequent-cutter cut sites.
Amplify off adapters with PCR. Use various specific primers to amplify subsets of total.
Visualize on denaturing polyacrylamide gel.
![Page 39: Lecture 2: Biology Review II Date: 8/29/02 Overview/Review of: Mapping Molecular techniques Markers.](https://reader035.fdocuments.in/reader035/viewer/2022062409/5697bfca1a28abf838ca939e/html5/thumbnails/39.jpg)
Choosing Markers
High polymorphism. Clear interpretation. Quick typing and easy automation. Personal preference.