Intron characterization and their potential as molecular markers for population studies in the...

Intron characterization and their potential as molecular markersfor population studies in the scallops Aequipecten opercularisand Mimachlamys varia

ALBERTO ARIAS, RUTH FREIRE, JOSEFINA MENDEZ and ANA INSUA

Departamento de Biologıa Celular y Molecular, Universidade da Coruna, A Coruna, Spain

Arias, A., Freire, R., Mendez, J. and Insua, A. 2008. Intron characterization and their potential as molecular markers for

population studies in the scallops Aequipecten opercularis and Mimachlamys varia. * Hereditas 146: 46�57. Lund, Sweden.

eISSN 1601-5223. Received April 30, 2008. Accepted July 14, 2008

Exon-primed intron-crossing PCR was used on the European commercial scallops Aequipecten opercularis and Mimachlamys

varia to characterize introns of four nuclear genes and to identify DNA markers useful for population studies. The primers

used yielded the expected product, except those for the lysozyme gene that failed to work in M. varia and amplified a

fragment of a proteasome subunit gene (APSM) in A. opercularis. According to the sequences characterized, A. opercularis

has at least four calmodulin genes, one of arginine kinase and two of b-tubulin, and M. varia five, one and one, respectively.

Length polymorphism or/and restriction fragment length polymorphism was detected at two loci of A. opercularis (arginine

kinase and APSM) and four of M. varia (calmodulin and b-tubulin), distinguishing in each case two or three alleles. The

polymorphic loci were not closely linked. The population survey included four localities from Spain and one from Northern

Ireland for A. opercularis and two Spanish localities for M. varia. Observed heterozygosity (Ho) per locus was 0.276 and

0.296 in A. opercularis. The Northern Ireland sample had the lowest Ho value (0.200) and the Mediterranean Spanish sample

the highest (0.350). In M. varia, Ho per locus ranged from 0.172 to 0.391 and the two localities showed similar Ho values

(0.255 and 0.293). All population-locus combinations were in agreement with Hardy-Weinberg equilibrium, except two loci

of M. varia that showed a strong heterozygote deficit in the two localities examined. Evidence for genetic differentiation

among samples was not found.

Ana Insua, Departamento de Biologıa Celular y Molecular, Universidade da Coruna, A Zapateira s/n, ES-15071 A Coruna,

Spain. E-mail: [email protected]

Aequipecten opercularis and Mimachlamys varia are

two scallops of the bivalve family Pectinidae found

widely distributed along the European coasts

(WAGNER 1991) occurring from Norway to northwest

Africa and also in the Mediterranean. Aequipecten

opercularis is commercially fished in Ireland, UK,

France and Spain and M. varia in French Atlantic

waters (BRAND 2006). Population genetics studies on

these species were undertaken using electrophoresis of

allozymes which detects genetic variation at protein

level (BEAUMONT 2006). In a survey of genetic

variation carried out by BEAUMONT and BEVERIDGE

(1984), A. opercularis exhibited lower genetic variation

than M. varia, yet the values were similar to or higher

than those reported for other bivalve species. A few

works using samples collected mainly around the

British Isles were focused on spatial differentiation

among populations and temporal variation within

populations. No significant differences in allele fre-

quencies were found between two samples of M. varia

from Ireland (MATHERS 1975) or five localities around

the Isle of Man of A. opercularis (MACLEOD et al.

1985), but significant geographic differentiation was

reported for other localities from the British Isles both

in M. varia (GOSLING and BURNELL 1988) and in A.

opercularis (MATHERS 1975; BEAUMONT 1982b;

LEWIS and THORPE 1994). Although LEWIS and

THORPE (1994) indicated allele frequency stability

through time within A. opercularis populations

sampled from around the UK, BEAUMONT (1982a)

reported significant variation in heterozygosity at two

loci related to specific year-class in Scottish samples,

and MACLEOD et al. (1985) found one allele of a locus

restricted to a particular year-class in samples from the

Isle of Man. Taking into account the commercial

importance of the two species and the existence to

some degree of independent genetic entities at least in

the areas examined, further studies on population

genetics covering their distribution range are desirable.

Current studies on population genetics use mostly

DNA-based markers instead of allozyme markers.

However, in A. opercularis and M. varia only restric-

tion fragment length polymorphism (RFLP) of mito-

chondrial genes have been examined (FERNANDEZ-

MORENO et al. 2008). One strategy used to identify

new DNA-based markers consists in the examination

of intron polymorphisms. Unlike exons, the intron

sequence seems to be little constrained functionally

and accumulates mutations rapidly, displaying high

genetic variation (PALUMBI 1996). In non-model

organisms where little genome information is available,

introns can be easily PCR-amplified and subsequently

Hereditas 146: 46�57 (2009)

DOI: 10.1111/j.1601-5223.2008.02075.x

characterized using primers designated in conserved

flanking exons (LESSA 1992; PALUMBI and BAKER

1994). This approach, called exon-primed intron-

crossing PCR (EPIC-PCR), has provided usefulmarkers in different organisms (PALUMBI and BAKER

1994; FUJITA et al. 2004; ROLLAND et al. 2007)

including invertebrates (CORTE-REAL et al. 1994;

DAGUIN and BORSA 1999; SOKOLOVA and BOULDING

2004; FOLTZ 2007). Given introns are noncoding

regions, high levels of neutral variation are expected.

Furthermore, they are of codominant nature and

Mendelian inheritance. Intron polymorphism canbe detected directly by sequencing (COOKE and

BEHEREGARAY 2007) or indirectly by different meth-

ods such as agarose or polyacrylamide gel electro-

phoresis (HOAREAU et al. 2007), analysis of RFLPs

(HE and HAYMER 1999), or analysis of single-strand

conformational polymorphisms (SSCPs, GARRICK

and SUNNUCKS 2006). Thus, both sequence- and

frequency-based statistical analyses can be applied.In this study, the EPIC-PCR approach was used in

A. opercularis and M. varia to analyze introns of the

genes encoding for calmodulin, arginine kinase, b-

tubulin and lysozyme. After characterizing the PCR

products yielded by EPIC-PCR, intron variation was

explored and molecular markers identified, these

being used to assess genetic diversity and population

differentiation.

MATERIAL AND METHODS

Specimen collection and DNA extraction

Specimens of A. opercularis were collected from O

Grove (Gr), Cambados (Ca) and San Simon-Rande(SS) in northwest Spain, Fuengirola (Fu) in southern

Spain and Antrim (An) in Northern Ireland. Samples

from M. varia came from O Grove and Fuengirola.

Total genomic DNA was extracted according to

FERNANDEZ-TAJES and MENDEZ (2007).

PCR amplification

Calmodulin introns were PCR-amplified using the

primers designed by CORTE-REAL et al. (1994) and the

nested PCR procedure described by the authors, with

modifications including the use of 1% of a 20-cycle

CAD3/CAD2 primary PCR as the template for a 20-cycle CAD1/CAD2 secondary PCR and 1 mM of

primers. Arginine kinase and b-tubulin introns were

amplified using primers designed by PALUMBI and

BAKER (1994) and PALUMBI (1996), respectively.

Amplification reactions were carried out in a volume

of 25 ml containing �80 ng of template DNA, 1 unit

of Fastart Taq DNA polymerase (Roche Molecular

Biochemicals), 0.25 mM of each dNTP, 0.3 mM ofeach primer and the buffer provided by the polymerase

supplier (with 2 mM MgCl2). The thermalcycler

protocol consisted of an initial denaturation of 2

min at 958C, followed by 35 cycles of 958C for 45 s,

558C for 45 s, and 728C for 2 min, and a final

extension of 728C for 10 min.

Available protein sequences of bivalve lysozyme

(NILSEN and MYRNES 2001; BACHALI et al. 2002)were used to design degenerated primers for intron

amplification. Because multiple PCR products were

often obtained with the primers indicated previously,

specific primers for several PCR products were also

designed (Table 1) after cloning and sequencing the

corresponding PCR product (below). Amplification

reactions with primers designed in this study were

performed according to the procedure describedabove, using 1 unit of Taq DNA polymerase (Roche

Molecular Biochemicals) and the buffer provided by

Table 1. Sequence and annealing temperature (T) of the primers designed in this study.

Locus Primer Primer sequence (5?�3?) T (8C)

MCaM2 MCAM2F AACGAGGTGGACGAAGATGG 60MCAM2R CGCATTATCATTTGTCGTCAC

MCaM4/6 MCAM4F GCGGATGGTAAGTCTGTA 55MCAMR1 CAATCGTGCCGTTTCCTG

MCaM5 MCAM5F GTCCCAAACGAATCCCATC 55MCAMR1 CAATCGTGCCGTTTCCTG

AAK3 AAK3F GGTGGTGACTTGGCTGAGGT 60AAK3R GCACTGTCTTTGGCGAACTT

MAK MAKF ACAGTTTCACATCGGGGTC 58MAKR GGGCAGAAAGTGACGAAGC

Lysozyme Clh5 AAATGTATGRGVTGTATYTGTMWGG 50Clh3 GTGGATHCKRGCATAGCTYTCAC

APSM APSMF TGCTTGCTTATTTGFTGC 50Clh3 GTGGATHCKRGCATAGCTYCCAC

Hereditas 146 (2009) Intron characterization and molecular markers in scallops 47

the polymerase supplier (with 1.5 mM MgCl2). The

thermalcycler protocol was as described previously,

with the annealing temperature corresponding to each

set of primers (Table 1) and an extension time of 60 sper kilobase pairs. In the case of lysozyme primers, the

thermalcycler protocol included an additional step of

5 min at 808C after the initial denaturation for

polymerase incorporation. Amplification products

were separated by electrophoresis through horizontal

2% agarose gels and stained with ethidium bromide.

Cloning and sequencing

The PCR products obtained from two individuals (one

from O Grove and the other from Fuengirola) were

cloned and subsequently sequenced. Each PCR pro-

duct of interest was cut out from the gel, purified using

the Geneclean kit (Qbiogene), and cloned into

pGEM†-T Easy or pCR†2.1-TOPO† plasmids usingthe kits pGEM†-T Easy Vectors system II (Promega)

or TOPO TA cloning† (Invitrogen), respectively. The

recombinant colonies were selected by conventional

techniques and the plasmid DNA purified by the

alkaline lysis method (SAMBROOK and RUSSELL

2001). Sequencing was performed at the sequencing

facilities of the Univ. of A Coruna (Spain) and the

corresponding nucleotide sequences have been depos-ited in the EMBL database under accession numbers

AM989485�AM989514.

Sequence analysis

The identity of the PCR products obtained was

determined with the BLAST tool (ALTSCHUL et al.1997), using initially the BLASTn program and then

BLASTx and/or BLASTp when necessary. The exon/

intron boundaries were established according to the

gene organization of other organisms, the character-

istic intron sequence motifs at the 5? (GT) and 3? (AG)

ends (BREATHNACH et al. 1978) and the different

BLAST searches. The sequences were aligned using

ClustalX software (THOMPSON et al. 1997) and thealignments edited by GeneDoc (NICHOLAS et al.

1997). Differences between pairs of sequences were

expressed as number of variable sites (substitutions

plus indels)/length of alignment, with indels counted

as one variable site independently of the number of

nucleotides involved, and also as the number of non-

synonymous substitutions/length of alignment.

Polymorphism analysis

Size-polymorphism of the PCR products was resolved

on gels of 2% agarose or 10% polyacrylamide and

visualized by ethidium bromide or silver staining,

respectively. In the absence of length variants, PCR

products of a subsample of 10 individuals were

initially digested with several restriction enzymes to

select those showing polymorphism, and then these

were used on the whole sample. Digestions were

carried out according to FREIRE et al. (2005). Therestriction fragment sizes are described according to

the position of restriction sites on the sequences

examined.

Population genetic analysis

For each sample, genotype and allele frequencies were

calculated. Genetic diversity within populations was

estimated by the number of alleles at each locus, the

observed heterozygosity (Ho) and unbiased expected

heterozygosity (He) of NEI (1978) using the Genetix

software (BELKHIR et al. 2004).Hardy-Weinberg equilibrium was tested for each

locus and population with an exact test (GUO and

THOMPSON 1992) implemented in Genepop ver. 3.4.

software (RAYMOND and ROUSSET 1995). The magni-

tude of deviation from equilibrium was measured by

FIS fixation index calculated according to Weir and

Cockerham’s estimator f (WEIR and COCKERHAM

1984). Linkage disequilibrium between pairs of lociwithin each population was tested with the same

software. Exact tests for differences in genotype and

allele frequencies between samples were performed

using the Genepop software. Genetic differentiation

was also estimated with the FST estimator (u) of WEIR

and COCKERHAM (1984). The significance of u values

was assessed by 10 000 permutations using an

approach implemented in the software Genetix(BELKHIR et al. 2004). Distribution of genetic varia-

tion within and among localities was determined by

the analysis of molecular variance (AMOVA) with

Arlequin 3.11 (EXCOFFIER et al. 2005), testing the

significance of fixation indices by a non-parametric

permutation approach (10 000 permutations). When

multiple tests were performed the significance values

were adjusted with the sequential Bonferroni correc-tion (RICE 1989).

RESULTS

Characterization of DNA fragments obtained by

EPIC-PCR

The use of four sets of primers designed to amplifyintrons in conserved nuclear genes yielded mostly

several PCR products both in A. opercularis and M.

varia. Table 2 summarizes the results obtained. Four

and six PCR products, showing similarity with calmo-

dulin or calmodulin-like genes, were characterized in

A. opercularis (ACaM1�4) and M. varia (MCaM1�6),

respectively (Fig. 1A). The two clones examined of

each PCR product had identical exon sequences,

48 A. Arias et al. Hereditas 146 (2009)

except those of ACaM4 that showed a synonymous

substitution. In the intron the differences were be-

tween zero and 0.041, with MCaM2 displaying an

indel of 23 bp within a repetitive stretch. When the

PCR product exons were compared, some showed an

identical deduced amino acid sequence (ACaM2,

ACaM3 and ACaM4, MCaM3 and MCaM5) but

nearly all revealed nucleotide differences. The intron

sequences did not show significant similarity in

BLAST 2 Sequences comparisons and the sequence

alignment was unreliable. Evidence of homology was

only found for MCaM4 and MCaM6 that shared the

coding region and showed a reliable alignment of the

intron sequences, with 16 substitutions and three

indels, one of them of �460 bp. Taking into account

the magnitude of the differences observed at the

different levels examined (i.e. among clones, PCR

products and species) each PCR product of each

species is interpreted as an independent gene, except

MCaM4 and MCaM6 that seem to represent alleles of

a single locus (MCaM4/6).

One PCR product of A. opercularis (AAK3) and M.

varia (MAK) displayed homology with the arginine

kinase gene of other organisms. Figure 1B shows the

corresponding sequences. The two clones of AAK3

and those of MAK presented variation only in the

intron. AAK3 and MAK differed in the coding region

and markedly in the intron. Two PCR products of A.

opercularis (ATUB1 and ATUB2) and one of M. varia

(MTUB) displayed high homology with b-tubulin

genes of different species. While MTUB and ATUB2

showed three exonic regions separated by two introns,

the whole sequence of ATUB1 corresponded to the

coding region (Fig. 1C). Differences between clones(determined for MTUB and ATUB1) were found in

the exon and intron. ATUB1 and ATUB2 displayed

synonymous and non-synonymous differences be-

tween them and with MTUB. As in the previous

cases, no significant similarity was found for intron

sequences.

Primers designed to amplify an intron of the

lysozyme gene yielded one product in A. opercularis

(APSM) but the amplification in M. varia was

unsuccessful. APSM showed high homology with the

gene of the proteasome subunit alpha type 6 of

different organisms instead of the lysozyme gene,

containing an exon surrounded by two intronic

regions (Fig. 1D). The two clones showed differences

in the exon and in the intron.

Polymorphism analysis

Most of the sequenced DNA fragments were amplified

individually by PCR using specific primers and then

examined for length polymorphism and/or variablecleavage sites. In A. opercularis, digestion of AAK3

with HinfI produced three different patterns defined

by fragments of 196�425 (allele 1), 196�360 (allele 2)

and 260�360 bp (allele 3) and others smaller (B100

bp) unresolved on the agarose gel (Fig. 2A). The

APSM locus showed two length variants of �580 bp

(allele 1) and �600 bp (allele 2) and after digestion

with EcoRI, a polymorphic restriction site on the

Table 2. Summary of the products yielded by the primers used and differences observed between clones, PCR

products or species.

Primers/Species MultiplePCR products

Productsshowing the

expected identity

Differences observed

Clones PCR products Species

Exon Intron Exon Intron Exon Intron

CalmodulinA. opercularis Yes (ACaM1�4) ACaM1�4 0�0.022 0�0.004 0.109�0.326

(0�0.065)n.a. 0.130�0.348

(0�0.109)n.a.

M. varia Yes (MCaM1�6) MCaM1�6 0 0.007�0.041 0�0.370(0�0.130)

n.a.

Arginine kinaseA. opercularis Yes (AAK1�4) AAK3 0 0.006 0.369 (0.180) n.a.M. varia Yes (MAK) MAK 0 0.008

b-tubulinA. opercularis Yes (ATUB1�2) ATUB1�2 0.017 (0.002) n.d. 0.264�0.249

(0.064�0.067)0.131�0.249(0.005�0.064)

n.a.

M. varia No (MTUB) MTUB 0.009 (0.005) 0.018

LysozymeA. opercularis No (APSM) None 0.006 0.011M. varia No amplification

In parentheses PCR products obtained or non-synonymous differences. n.a.: non-alignable sequences; n.d.: not determined.


Fig. 1. Partial sequences of DNA fragments obtained with primers for introns of calmodulin (A), arginine kinase (B), b-tubulin (C) and lysozyme (D). The position of the original primers is underlined. The putative coding region is represented incapital letters. Amino acid consensus sequence or alternative amino acids are indicated by single-letter code above thenucleotide sequence. Asterisk denotes a highly variable amino acid position (K, H or I). In brackets, length of the omittedsequence of the two clones examined. Dots represent identical residues. Substitutions are indicated by the corresponding baseand indels by a dash. Differences between clones are in parentheses or indicated by IUPAC symbols.


�580 bp variant defined an additional allele (allele 3)

consisting of a �530 bp fragment plus one of �50 bp

undetectable on agarose gels (Fig. 2B). In M. varia, the

MCaM2 locus displayed three length variants of �

140, 150 and 160 bp (alleles 1, 2 and 3, respectively)

(Fig. 3A). For the MCaM4/6 locus, two bands of �

470 (alleles 1) and 930 bp (allele 2) were observed (Fig.

3B). After digestion of MCaM5 with AluI, two

patterns with fragments of �100�225�375 (allele

1) and 100�600 bp (allele 2) were distinguished (Fig.

3C). The digestion of MTUB with CfoI generated

fragment patterns of �200�350�1050 (allele 1) and

200�1400 bp (allele 2) (Fig. 3D). Other characterized

PCR products digested with several restriction en-

zymes gave patterns that were monomorphic or too

complex to interpret.

Population genetic analysis

The sample size, number of individuals of eachgenotype, allele frequencies and genetic variation

measures for the loci scored in all localities are

presented in Table 3 and 4. In A. opercularis, the two

loci examined showed similar values of Ho and He.

Antrim was the locality displaying the lowest hetero-

zygosity and Fuengirola the highest. The mean overall

values of Ho and He in this species were 0.286 and

Fig. 2. Agarose gels with PCR products of AAK3 digested with HinfI (A) and APSM digested with EcoRI (B). M: 100 bpladder, C: PCR product as undigested control (�580 bp variant on gel B). Numbers above lanes are genotype designations.

Fig. 3. Polyacrylamide gel with PCR products of MCaM2 (A) and agarose gels with PCR products of MCaM4/6 (B), MCaM5digested with AluI (C) and MTUB digested with CfoI (D). M: 100 bp ladder; M*: 20 bp ladder, C: negative PCR control orPCR product as undigested control. Numbers above lanes are genotype designations.


0.251, respectively. In M. varia Ho per locus ranged

from 0.172 to 0.391 and He from 0.329 to 0.503. The

level of heterozygosity was similar in the two localities

and the mean overall values of Ho and He were 0.275

and 0.413, respectively.Of the five and 12 tests for linkage disequilibrium

performed for A. opercularis and M. varia, respec-

tively, only one was significant at PB0.05 (loci

MCaM2 and MCaM4 at Fuengirola) and none after

sequential Bonferroni correction, suggesting that the

loci are not closely linked and can be treated as

independent variables. In A. opercularis all popula-

tion-locus combinations were in agreement with

Hardy-Weinberg equilibrium as indicated by the P-

values of the exact test (Table 3). However, in M. varia

four out of eight Hardy-Weinberg tests deviated from

equilibrium at PB0.05, remaining significant after

sequential Bonferroni correction (Table 4). Significant

tests were found for the loci MCaM4/6 and MCaM5,

which showed a strong heterozygote deficit (f-values

�0.5). Weir and Cockerham’s f for the other popula-

tion-locus combinations was always negative, except

for MCaM2 in Fuengirola.

The exact tests for heterogeneity of allele andgenotype frequencies in A. opercularis did not show

significant differences. In M. varia heterogeneity of

allele and genotype frequencies at PB0.05 was

detected for the locus MCaM2 but not after sequential

Bonferroni correction. Weir and Cockerham’s u per

locus ranged from �0.003 (APSM) to �0.001 (AAK-

2) in A. opercularis and from �0.027 (MCaM5) to

0.034 (MCaM2) in M. varia. The global u value was�0.002 for A. opercularis (P�0.802) and

�0.011 for M. varia (P�0.709), not significantly

different from zero. AMOVA did not detect significant

differentiation between localities either, nearly all the

variance (�99%) was distributed between individuals

within localities.

DISCUSSION

The use of species nonspecific primers to amplify

introns of calmodulin, arginine kinase, b-tubulin and

lysozyme genes allowed the isolation and character-

ization of 11 DNA fragments in A. opercularis and

eight in M. varia. Most of these fragments showed

Table 3. Aequipecten opercularis. Genotype and allele frequencies, genetic variation statistics, f-values and P-value

of the test for conformity to Hardy-Weinberg expectations.

Locus Locality Overall

An Ca Gr SS Fu

AAK3 Genotype 12 6 7 8 7 9 3722 24 21 23 21 21 11023 0 3 0 2 0 5

N 30 31 31 30 30 152Allele 1 0.100 0.113 0.129 0.117 0.150 0.122

2 0.900 0.839 0.871 0.850 0.850 0.8623 0.000 0.048 0.000 0.033 0.000 0.016

He 0.183 0.286 0.229 0.267 0.259 0.243Ho 0.200 0.323 0.258 0.300 0.300 0.276f �0.094 �0.130 �0.132 �0.125 �0.160 �0.130P-value 1 1 1 1 1

APSM Genotype 11 24 23 20 22 18 10712 0 3 2 1 2 813 6 5 8 8 10 37

N 30 31 30 31 30 152Allele 1 0.900 0.871 0.833 0.855 0.800 0.852

2 0.000 0.048 0.033 0.016 0.033 0.0263 0.100 0.081 0.133 0.129 0.167 0.122

He 0.183 0.236 0.292 0.257 0.337 0.260Ho 0.200 0.258 0.333 0.290 0.400 0.296f �0.094 �0.093 �0.146 �0.134 �0.192 �0.139P-value 1 1 1 1 0.7002

OverallHe 0.183 0.261 0.260 0.262 0.298 0.251Ho 0.200 0.290 0.296 0.295 0.350 0.286f �0.094 �0.113 �0.140 �0.130 �0.178 �0.1345

N: Sample size. Ho, He: observed and expected heterozygosities, respectively.


homology to the expected genes, corroborating the

conservation of the intron position and the utility of

primers in bivalve species that are poorly studied from

a molecular point of view as is the case of A.

opercularis and M. varia. Only primers designed to

amplify an intron of the lysozyme gene failed to

generate amplification (M. varia) or yielded an

unexpected product (A. opercularis). Although it

cannot be discarded that these failed to work for

technical reasons, the failure to yield the appropriate

product could be due to the fact that the available

sequences of the bivalve lysozymes preclude the

Table 4. Mimachlamys varia. Genotype and allele frequencies, genetic variation statistics, f-values and P-value of the

test for conformity to Hardy-Weinberg expectations.

Locus Locality Overall

Gr Fu

MCAM2 Genotype 11 23 18 4121 5 531 7 6 1332 1 133 2 2

N 30 32 62Allele 1 0.883 0.734 0.807

2 0.094 0.0483 0.117 0.172 0.145

He 0.210 0.429 0.329Ho 0.233 0.375 0.307f �0.115 0.128 0.069P-value 1.000 0.487

MCAM4/6 Genotype 11 12 13 2512 7 7 1422 11 11 22

N 30 31 61Allele 1 0.517 0.532 0.525

2 0.483 0.468 0.475He 0.508 0.506 0.503Ho 0.233 0.226 0.230f 0.545 0.558 0.546P-value 0.004 0.003

MCAM5 Genotype 11 16 17 3312 4 7 1122 10 10 20

N 30 34 64Allele 1 0.600 0.603 0.602

2 0.400 0.397 0.398He 0.488 0.486 0.483Ho 0.133 0.206 0.172f 0.730 0.580 0.646P-value 0.000 0.001

MTUB Genotype 11 18 20 3812 13 12 2522 1 1

N 31 33 64Allele 1 0.790 0.788 0.789

2 0.210 0.212 0.211He 0.337 0.339 0.336Ho 0.419 0.364 0.391f �0.250 �0.073 �0.170P-value 0.296 1.000

Overall He 0.386 0.440 0.413Ho 0.255 0.293 0.275f 0.343 0.339 0.340

N: Sample size. Ho, He: observed and expected heterozygosities, respectively.


obtaining of efficient primers, that the intron position

is not conserved and/or that the intron size is not small

enough to be amplified efficiently (PALUMBI 1996).

Most of the primer sets yielded several PCR pro-

ducts, which may represent different loci, pseudogenes

and/or unspecific products. For calmodulin primers, all

the PCR products characterized corresponded to

calmodulin or calmodulin-like genes. From the differ-

ences observed, it is assumed that A. opercularis and M.

varia display at least four and five loci, respectively.

This is in contrast to the one or two copies described in

other invertebrates, including the mollusk Aplysia

californica (SWANSON et al. 1990) or the echinoderm

Arbacia punctulata (HARDY et al. 1988), but according

to the multiple PCR amplification pattern obtained

with the same set of primers in eight mollusk genera

(CORTE-REAL et al. 1994), and the occurrence of

three or more copies in the gastropod Littorina

(SIMPSON et al. 2005) and vertebrates (FISCHER et al.

1988; FRIEDBERG and TALIAFERRO 2005). Then, one

PCR product of each species showed similarity to

arginine kinase genes. Until now one arginine kinase

gene was characterized in bivalve species such as

Crassotrea gigas (UDA et al. 2006), Solen strictus or

Corbicula japonica (SUZUKI et al. 2002) and also in the

genera Drosophila (COLLIER 1990). Although in in-

vertebrates multiple genes can also exist (MATTHEWS et

al. 2003), it seems that both A. opercularis and M. varia

could have a single gene. While in M. varia the b-

tubulin intron primers yielded a single PCR product, in

A. opercularis they yielded multiple products. The three

fragments characterized showed homology to b-tubu-

lin genes, suggesting that M varia displays a single copy

of b-tubulin gene and A. opercularis at least two copies.

Although some invertebrate species show a single gene

(BENNETT et al. 1999), b-tubulin genes are usually

members of small multigene families. Bombyx mori

(KAWASAKI et al. 2003) or the sea urchin Strongylocen-

trotus purpuratus (HARLOW and NEMER 1987), for

example, have four and 9�12 b-tubulin genes, respec-

tively. Therefore, it cannot be discarded that additional

copies may exist in M. varia and A. opercularis; if they

are significantly divergent the primers used may be

specific for one of them and fail for others. Note that

one of the b-tubulin genes of A. opercularis does not

possess introns. b-Tubulin genes without introns have

been previously reported, as is the case of the trematode

Fasciola hepatica (ROBINSON et al. 2001), but the norm

is the occurrence of several introns. It is likely that the

absence of introns in the A. opercularis copy represents

a processed pseudogene as occurs with several members

of the human b-tubulin gene family (LEWIS and

COWAN 1990). Although primers designed to amplify

lysozyme introns failed to yield the corresponding

product, they led to the characterization in A. oper-

cularis of a DNA fragment containing an exon

surrounded by two intron regions of a gene coding

for the subunit alpha type 6 of the proteosome. Despite

the fact that the deduced amino acid sequence is

conserved across species, as evidenced by BLAST

analysis, the existence of differences at the nucleotide

level probably precluded primer functioning in M.

varia. Because a single PCR product was obtained, it

can be postulated that in A. opercularis the subunit

alpha type 6 of the proteosome is encoded by a single

gene, in consonance with that observed in other

organisms where a few genes, one or two, are typically

found (MA et al. 2002).

Intron polymorphism often includes length varia-

tion (OHRESSER et al. 1997; HASSAN et al. 2002;

GOMULSKI et al. 2004) and this was the case of

MCaM2, MCaM4/6 and APSM. But in contrast to

other studies, only two or three alleles were detected.

Discrepancies may come from the type of electrophor-

esis gel (agarose or polyacrylamide) used to detect the

variants but also from the gene class examined.

CORTE-REAL et al. (1994) for example also reported

two alleles for a calmodulin intron locus of the mussel

Mytilus edulis, however, GOMULSKI et al. (2004), using

a similar detection method, identified 18 alleles for a

gene of alcohol dehydrogenase (Adh1) in the fruit fly

Ceratitis capitata. In the absence of length variants,

the analysis of restriction fragments on agarose gels is

a practical, reliable and low cost method to screen

samples for sequence variation but the amount of

variation detected may be low, as observed here. Other

methods such as direct sequencing or analysis of

SSCPs can be applied in the future to reveal all the

potential variation. Judging from the differences

detected among clones, the introns examined seem to

harbor more variation than those detected in this

work.

The mean overall observed heterozygosity found in

this study, 0.286 for A. opercularis and 0.275 for M.

varia, is within the range described in scallops after the

analysis of allozyme loci, 0.016 for Lyropecten nodosa

(CORONADO et al. 1991) and 0.321 for Chlamys

distorta (BEAUMONT and BEVERIDGE 1984), but

lower than the values inferred from the high poly-

morphic microsatellite loci which usually exceed 0.80

(GJETVAJ et al. 1997; KENCHINGTON et al. 2006;

ZHAN et al. 2007). The level of genetic diversity

reported here for the two scallops was similar,

contrasting with the data provided by allozyme loci

(BEAUMONT and BEVERIDGE 1984) and mtDNA

(FERNANDEZ-MORENO et al. 2008) that revealed

higher levels in M. varia than in A. opercularis. It is


probable that the discrepancy results from the analysis

of few loci.

All the population-locus combinations in A. oper-

cularis and those involving MCaM2 and MTUB loci

in M. varia showed conformance with Hardy-Wein-

berg predictions, suggesting Mendelian inheritance

and neutrality of the identified polymorphisms. On

the contrary, MCaM4/6 and MCaM5 displayed a

strong deficit of heterozygotes in all samples. This is a

common phenomenon in bivalve mollusks, first ob-

served in allozymes and then in DNA markers

(ZOUROS and FOLTZ 1984; GAFFNEY et al. 1990;

DEL RIO-PORTILLA and BEAUMONT 2001;

LAUNEY et al. 2002; ARNAUD-HAOND et al. 2003).

Several explanations have been given to this deficit,

including population causes (inbreeding, Wahlund

effect), selection and technical artefacts (e.g. null

alleles). Inbreeding can be ruled out given that M.

varia is a successive hermaphrodite with external

fecundation, larval planktonic stage of several weeks

and, apparently, random settlement of larvae. More-

over, inbreeding would increase the observed homo-

zygosity at all loci, which is not the case in M. varia.

The fact that the allele frequencies do not differ

between samples made the existence of population

sub-structure highly improbable, discarding the Wah-

lund effect. Another possibility is that the heterozy-

gote deficiencies could be caused by technical

artefacts. Polymorphism at the priming site could

affect the amplification efficiency of the different

alleles or even prevent it, producing a null allele.

Furthermore, when alleles of different sizes are

amplified, as is the case of MCaM4/6, the longest

ones tend to amplify with less efficiency. To explain the

large heterozygote deficits observed here a relatively

high number of null homozygote individuals would be

expected, however, this was not found in the samples

examined. The action of natural selection cannot be

discarded although nuclear introns are noncoding and

essentially neutral. Both background selection based

on directional selection against harmful mutations and

hitchhiking favoring advantageous alleles may de-

crease the heterozygosity at linked neutral loci

(CHARLESWORTH et al. 1993). Indirect selection seems

to operate at microsatellite loci in oysters (BOUDRY et

al. 2002). If selective forces influence the heterozygote

deficiency at the loci MCaM4/6 and MCaM5 they

could be the same for the two localities studied.

The estimate of Weir and Cockerham’s u, the exact

tests of allele and genotype differentiation and

AMOVA suggested that in A. opercularis and in M.

varia the samples examined form a homogenous

group. This is in line with the results obtained by

FERNANDEZ-MORENO et al. (2008) using a genetic

marker from the mitochondrial DNA in A. opercularis

but contrasts with the genetic differentiation reported

in M. varia, despite the fact that the samples analyzedin the two works come from the same localities. This

discrepancy is not unexpected taking into account that

each locus may contain an independent history of the

population depending on the amounts of random

drift, mutation and migration that have occurred.

BEAUMONT (1982a), for example, distinguished at

least four relatively genetically isolated populations

of A. opercularis around the British Isles on the basisof four nuclear loci but not all of them contribute

equally to the population differentiation. Then,

mtDNA has a smaller effective population size than

nuclear markers and, as such, it is more sensitive to the

effects of genetic drift, and consequently often affords

greater sensitivity for detecting genetic differences in

population studies (BENZIE et al. 2003). The analysis

of a large number of nuclear loci should also revealgenetic differentiation between the localities examined

of M. varia.

Acknowledgements � We thank Dr. Guillermo Roman, Dr.Antonio Hervas and the Cangas and Cambados Associationof Fishermen for supplying the scallop samples, and JoseGarcıa Gil for his technical assistance. This work wassupported by Ministerio de Ciencia y Tecnologıa throughproject AGL2003-07430.

REFERENCES

Altschul, S. F., Madden, T. L., Schaffer, A. A. et al. 1997.Gapped BLAST and PSI-BLAST: a new generation ofprotein database search programs. � Nucleic Acids Res.25: 3389�3402.

Arnaud-Haond, S., Bonhomme, F. and Blanc, F. 2003. Largediscrepancies in differentiation of allozymes, nuclear andmitochondrial DNA loci in recently founded Pacificpopulations of the pearl oyster Pinctada margaritifera.� J. Evol. Biol. 16: 388�398.

Bachali, S., Jager, M., Hassanin, A. et al. 2002. Phylogeneticanalysis of invertebrate lysozymes and the evolution oflysozyme function. � J. Mol. Evol. 54: 652�664.

Beaumont, A. R. 1982a. Geographic-variation in allelefrequencies at three loci in Chlamys opercularis fromNorway to the Brittany Coast. � J. Mar. Biol. Ass. U. K.62: 243�261.

Beaumont, A. R. 1982b. Variations in heterozygosity at twoloci between year classes of a population of Chlamysopercularis (L.) from a Scottish sea-loch. � Mar. Biol.Lett. 3: 25�33.

Beaumont, A. 2006. Genetics. � In: Shumway, S. E. andParsons, G. J. (eds), Scallops: biology, ecology andaquaculture. Elsevier, p. 543�594.

Beaumont, A. R. and Beveridge, C. M. 1984. Electrophore-tic survey of genetic variation in Pecten maximus,Chlamys opercularis, Chlamys varia and Chlamys distortafrom the Irish Sea. � Mar. Biol. 81: 299�306.


Belkhir, K., Borsa, P., Chikhi, L. et al. 2004. GENETIX4.05, logiciel sous Windows TM pour la genetique despopulations. Laboratoire Genome, Populations, Interac-tions, CNRS UMR 5171, Univ. de Montpellier II,Montpellier, France.

Bennett, A. B., Barker, G. C. and Bundy, D. A. 1999. A beta-tubulin gene from Trichuris trichiura. � Mol. Biochem.Parasitol. 103: 111�116.

Benzie, J. A. H., Smith, C. and Sugama, K. 2003. Mitochon-drial DNA reveals genetic differentiation between Aus-tralian and Indonesian pearl oyster Pinctada maxima(Jameson 1901) populations. � J. Shellfish Res. 22:781�787.

Boudry, P., Collet, B., Cornette, F. et al. 2002. High variancein reproductive success of the Pacific oyster (Crassostreagigas, Thunberg) revealed by microsatellite-based paren-tage analysis of multifactorial crosses. � Aquaculture 204:283�296.

Brand, A. R. 2006. The European scallop fisheries for Pectenmaximus, Aequipecten opercularis and Mimachlamysvaria. � In: Shumway, S. E. and Parsons, G. J. (eds),Scallops: biology, ecology and aquaculture. Elsevier, p.991�1058.

Breathnach, R., Benoist, C., O’Hare, K. et al. 1978.Ovalbumin gene: evidence for a leader sequence inmRNA and DNA sequences at the exon-intron bound-aries. � Proc. Natl Acad. Sci. USA 75: 4853�4857.

Charlesworth, B., Morgan, M. T. and Charlesworth, D.1993. The effect of deleterious mutations on neutralmolecular variation. � Genetics 134: 1289�1303.

Collier, G. E. 1990. Evolution of arginine kinase within thegenus Drosophila. � J. Hered. 81: 177�182.

Cooke, G. M. and Beheregaray, L. B. 2007. Extremely highvariability in the S72 intron of the Amazonian cardinaltetra (Paracheirodon axelrodi). � J. Fish Biol. 71: 132�140.

Coronado, C., Gonzalez, P. and Perez, J. E. 1991. Geneticvariation in Venezuelan molluscs Pecten ziczac andLyropecten nodosa (Pectinidae). � Caribb. J. Sci. 27:71�74.

Corte-Real, H. B. S. M., Dixon, D. R. and Holland, P. W. H.1994. Intron-targeted PCR: a new approach to surveyneutral DNA polymorphism in bivalve populations.� Mar. Biol. 120: 407�413.

Daguin, C. and Borsa, P. 1999. Genetic characterisation ofMytilus galloprovincialis Lmk. in North West Africausing nuclear DNA markers. � J. Exp. Mar. Biol. Ecol.235: 55�65.

Del Rio-Portilla, M. A. and Beaumont, A. R. 2001.Heterozygote deficiencies and genotype-dependentspawning time in Mytilus edulis. � J. Shellfish Res. 20:1051�1057.

Excoffier, L., Laval, G. and Schneider, S. 2005. Arlequin ver.3.0: an integrated software package for populationgenetics data analysis. � Evol. Bioinform. Online 1: 50.

Fernandez-Moreno, M., Arias-Perez, A., Freire, R. et al.2008. Genetic analysis of Aequipecten opercularis andMimachlamys varia (Bivalvia: Pectinidae) in severalAtlantic and Mediterranean localities, revealed by mito-chondrial PCR-RFLPs: a preliminary study. � Aquac.Res. 39: 474�481.

Fernandez-Tajes, J. and Mendez, J. 2007. Identification ofthe razor clam species Ensis arcuatus, E. siliqua, E.directus, E. macha, and Solen marginatus using

PCR-RFLP analysis of the 5S rDNA region. � J. Agric.Food Chem. 55: 7278�7282.

Fischer, R., Koller, M., Flura, M. et al. 1988. Multipledivergent mRNAs code for a single human calmodulin.� J. Biol. Chem. 263: 17055�17062.

Foltz, D. W. 2007. An ancient repeat sequence in the ATPsynthase beta-subunit gene of forcipulate sea stars.� J. Mol. Evol. 65: 564�573.

Freire, R., Insua, A. and Mendez, J. 2005. Cerastodermaglaucum 5S ribosomal DNA: characterization of therepeat unit, divergence with respect to Cerastodermaedule, and PCR-RFLPs for the identification of bothcockles. � Genome 48: 427�442.

Friedberg, F. and Taliaferro, L. 2005. Calmodulin genes inzebrafish (revisited). � Mol. Biol. Rep. 32: 55�60.

Fujita, M. K., Engstrom, T. N., Starkey, D. E. et al. 2004.Turtle phylogeny: insights from a novel nuclear intron.� Mol. Phylogenet. Evol. 31: 1031�1040.

Gaffney, P. M., Scott, T. M., Koehn, R. K. et al. 1990.Interrelationships of heterozygosity, growth-rate andheterozygote deficiencies in the coot clam, Mulinialateralis. � Genetics 124: 687�699.

Garrick, R. C. and Sunnucks, P. 2006. Development andapplication of three-tiered nuclear genetic markers forbasal Hexapods using single-stranded conformationpolymorphism coupled with targeted DNA sequencing.� BMC Genet. 7: 11.

Gjetvaj, B., Ball, R. M., Burbridge, S. et al. 1997. Amountsof polymorphism at microsatellite loci in the sea scallopPlacopecten magellanicus. � J. Shellfish Res. 16: 547�553.

Gomulski, L. M., Brogna, S., Babaratsas, A. et al. 2004.Molecular basis of the size polymorphism of the firstintron of the Adh-1 gene of the Mediterranean fruit fly,Ceratitis capitata. � J. Mol. Evol. 58: 732�742.

Gosling, E. M. and Burnell, G. M. 1988. Evidence forselective mortality in Chlamys varia (L) transplantexperiments. � J. Mar. Biol. Ass. UK 68: 251�258.

Guo, S. W. and Thompson, E. A. 1992. Performing the exacttest of Hardy-Weinberg proportion for multiple alleles.� Biometrics 48: 361�372.

Hardy, D. O., Bender, P. K. and Kretsinger, R. H. 1988. Twocalmodulin genes are expressed in Arbacia punctulata: anancient gene duplication is indicated. � J. Mol. Biol. 199:223�227.

Harlow, P. and Nemer, M. 1987. Developmental and tissue-specific regulation of beta-tubulin gene expression in theembryo of the sea urchin Strongylocentrotus purpuratus.� Genes Dev. 1: 147�160.

Hassan, M., Lemaire, C., Fauvelot, C. et al. 2002. Seventeennew exon-primed intron-crossing polymerase chain reac-tion amplifiable introns in fish. � Mol. Ecol. Notes 2: 334.

He, M. and Haymer, D. S. 1999. Genetic relationships ofpopulations and the origins of new infestations of theMediterranean fruit fly. � Mol. Ecol. 8: 1247�1257.

Hoareau, T. B., Bosc, P., Valade, P. et al. 2007. Gene flowand genetic structure of Sicyopterus lagocephal us in thesouth-western Indian Ocean, assessed by intron-lengthpolymorphism. � J. Exp. Mar. Biol. Ecol. 349: 223�234.

Kawasaki, H., Sugaya, K., Quan, G. X. et al. 2003. Analysisof alpha- and beta-tubulin genes of Bombyx mori usingan EST database. � Insect Biochem. Mol. Biol. 33:131�137.


Kenchington, E. L., Patwary, M. U., Zouros, E. et al. 2006.Genetic differentiation in relation to marine landscape ina broadcast-spawning bivalve mollusc (Placopecten ma-gellanicus). � Mol. Ecol. 15: 1781�1796.

Launey, S., Ledu, C., Boudry, P. et al. 2002. Geographicstructure in the European flat oyster (Ostrea edulis L.) asrevealed by microsatellite polymorphism. � J. Hered. 93:331�351.

Lessa, E. P. 1992. Rapid surveying of DNA sequencevariation in natural populations. � Mol. Biol. Evol. 9:323�330.

Lewis, S. A. and Cowan, N. J. 1990. Tubulin genes: structure,expression, and regulation. � In: Avila, J. (ed.), Micro-tubule proteins. CRC Press, p. 37�66.

Lewis, R. I. and Thorpe, J. P. 1994. Temporal stability ofgene-frequencies within genetically heterogeneouspopulations of the queen scallop Aequipecten (Chlamys)opercularis. � Mar. Biol. 121: 117�126.

Ma, J., Katz, E. and Belote, J. M. 2002. Expression ofproteasome subunit isoforms during spermatogenesis inDrosophila melanogaster. � Insect Mol. Biol. 11: 627�639.

Macleod, J. A. A., Thorpe, J. P. and Duggan, N. A. 1985. Abiochemical genetic study of population structure inqueen scallop (Chlamys opercularis) stocks in the north-ern Irish Sea. � Mar. Biol. 87: 77�82.

Mathers, N. F. 1975. Environmental variability at thephosphoglucose isomerase locus in the genus Chlamys..� Biochem. Syst. Ecol. 3: 123�127.

Matthews, B. F., MacDonald, M. H., Thai, V. K. et al. 2003.Molecular characterization of arginine kinases in thesoybean cyst nematode (Heterodera glycines). � J. Nema-tol. 35: 252�258.

Nei, M. 1978. Estimation of average heterozygosity andgenetic distance from a small number of individuals.� Genetics 89: 583�590.

Nicholas, K. B., Nicholas, H. B. J. and Deerfield, D. W. I.1997. GeneDoc: analysis and visualization of geneticvariation. � EMBNEW News 4: 14.

Nilsen, I. W. and Myrnes, B. 2001. The gene of chlamysin, amarine invertebrate-type lysozyme, is organized similar tovertebrate but different from invertebrate chicken-typelysozyme genes. � Gene 269: 27�32.

Ohresser, M., Borsa, P. and Delsert, C. 1997. Intron-lengthpolymorphism at the actin gene locus mac-1: a geneticmarker for population studies in the marine musselsMytilus galloprovincialis Lmk. and M. edulis L. � Mol.Mar. Biol. Biotechnol. 6: 123�130.

Palumbi, S. R. 1996. Nucleic acids II: the polymerase chainreaction. � In: Hillis, D. M., Moritz, C. and Mable, B. K.(eds), Molecular systematics. Sinauer, p. 205�247.

Palumbi, S. R. and Baker, C. S. 1994. Contrasting popula-tion structure from nuclear intron sequences and mtDNAof humpback whales. � Mol. Biol. Evol. 11: 426�435.

Raymond, M. and Rousset, F. 1995. Genepop (ver. 1.2):population-genetics software for exact tests and ecumeni-cism. � J. Hered. 86: 248�249.

Rice, W. R. 1989. Analyzing tables of statistical tests.� Evolution 43: 223�225.

Robinson, M. W., Hoey, E. M., Fairweather, I. et al. 2001.Characterisation of a beta-tubulin gene from theliver fluke, Fasciola hepatica. � Int. J. Parasitol. 31:1264�1268.

Rolland, J. L., Bonhomme, F., Lagardere, F. et al. 2007.Population structure of the common sole (Solea solea) inthe Northeastern Atlantic and the Mediterranean Sea:revisiting the divide with EPIC markers. � Mar. Biol. 151:327�341.

Sambrook, J. and Russell, D. W. 2001. Molecular cloning: alaboratory manual. � Cold Spring Harbor LaboratoryPress.

Simpson, R. J., Wilding, C. S. and Grahame, J. 2005. Intronanalyses reveal multiple calmodulin copies in Littorina.� J. Mol. Evol. 60: 505�512.

Sokolova, I. M. and Boulding, E. G. 2004. Length poly-morphisms in an intron of aminopeptidase N provide auseful nuclear DNA marker for Littorina species (Cae-nogastropoda). � J. Molluscan Stud. 70: 165�172.

Suzuki, T., Sugimura, N., Taniguchi, T. et al. 2002. Two-domain arginine kinases from the clams Solen strictusand Corbicula japonica: exceptional amino acid replace-ment of the functionally important D-62 by G. � Int. J.Biochem. Cell Biol. 34: 1221�1229.

Swanson, M. E., Sturner, S. F. and Schwartz, J. H. 1990.Structure and expression of the Aplysia californicacalmodulin gene. � J. Mol. Biol. 216: 545�553.

Thompson, J. D., Gibson, T. J., Plewniak, F. et al. 1997. TheCLUSTAL_X windows interface: flexible strategies formultiple sequence alignment aided by quality analysistools. � Nucleic Acids Res. 25: 4876�4882.

Uda, K., Fujimoto, N., Akiyama, Y. et al. 2006. Evolution ofthe arginine kinase gene family. � Comp. Biochem.Physiol. Part D Genomics Proteomics 1: 209�218.

Wagner, H. P. 1991. Review of the European Pectinidae.� Vita Marina 41: 1�48.

Weir, B. S. and Cockerham, C. C. 1984. Estimating F-statistics for the analysis of population-structure.� Evolution 38: 1358�1370.

Zhan, A., Bao, Z., Hu, X. et al. 2007. Isolation andcharacterization of 150 novel microsatellite markers forZhikong scallop (Chlamys farreri). � Mol. Ecol. Notes 7:1015�1022.

Zouros, E. and Foltz, D. W. 1984. Possible explanations ofheterozygote deficiency in bivalve mollusks. � Malacolo-gia 25: 583�591.


Intron characterization and their potential as molecular markers for population studies in the...

Documents

Transcript of Intron characterization and their potential as molecular markers for population studies in the...