Integrated Genomic and Functional microRNA Analysis ... · and clinical features. Contributing...

Translational Cancer Mechanisms and Therapy

Integrated Genomic and Functional microRNAAnalysis Identifies miR-30-5p as a TumorSuppressor and Potential TherapeuticNanomedicine in Head and Neck CancerAnthony D. Saleh1,2, Hui Cheng1, Scott E. Martin3, Han Si4, Pinar Ormanoglu3,Sophie Carlson1, Paul E. Clavijo1, Xinping Yang1, Rita Das1, Shaleeka Cornelius1,Jamie Couper1, Douglas Chepeha5, Ludmila Danilova6,7, Thomas M. Harris8,Michael B. Prystowsky8, Geoffrey J. Childs8, Richard V. Smith9, A. Gordon Robertson10,Steven J. M. Jones10, Andrew D. Cherniack11, Sang S. Kim12, Antonina Rait12,Kathleen F. Pirollo12, Esther H. Chang12, Zhong Chen1, and Carter Van Waes1

Abstract

Purpose: To identify deregulated and inhibitory miRNAsand generate novel mimics for replacement nanomedicine forhead and neck squamous cell carcinomas (HNSCC).

Experimental Design: We integrated miRNA and mRNAexpression, copy number variation, and DNA methylationresults from The Cancer Genome Atlas (TCGA), with a func-tional genome-wide screen.

Results: We reveal that the miR-30 family is commonlyrepressed, and all 5 members sharing these seed sequencesimilarly inhibit HNSCC proliferation in vitro. We uncover apreviously unrecognized inverse relationship with overex-pression of a network of important predicted target mRNAsderegulated in HNSCC, that includes key molecules involvedin proliferation (EGFR, MET, IGF1R, IRS1, E2F7), differenti-ation (WNT7B, FZD2), adhesion, and invasion (ITGA6, SER-PINE1). Reexpression of the most differentially repressedfamily member, miR-30a-5p, suppressed this mRNA pro-

gram, selected signaling proteins and pathways, and inhib-ited cell proliferation, migration, and invasion in vitro. Fur-thermore, a novel miR-30a-5p mimic formulated into atargeted nanomedicine significantly inhibited HNSCC xeno-graft tumor growth and target growth receptors EGFR andMET in vivo. Significantly decreased miR-30a/e family expres-sion was related to DNA promoter hypermethylation and/orcopy loss in TCGA data, and clinically with decreased disease-specific survival in a validation dataset. Strikingly, decreasedmiR-30e-5p distinguished oropharyngeal HNSCC with poorprognosis in TCGA (P ¼ 0.002) and validation (P ¼ 0.007)datasets, identifying a novel candidate biomarker and targetfor this HNSCC subset.

Conclusions: We identify the miR-30 family as an impor-tant regulator of signal networks and tumor suppressor in asubset of HNSCC patients, which may benefit from miRNAreplacement nanomedicine therapy.

IntroductionDeregulation of miRNA expression contributes to the aber-

rant expression of mRNAs that mediate the complex malignantphenotypes of cancers (1). Recent efforts support the conceptof replacing deficient miRNA expression using syntheticmiRNA mimics (2). Because a single miRNA can target mul-tiple mRNAs, miRNA-based therapeutics could help mitigateintrinsic or acquired resistance observed using more selective

small molecule or biologic therapies that target a singleoncogene.

Genome-wide expression profiling studies have demonstratedbroad deregulation and heterogeneity in miRNA and mRNAexpression in primary tumors. This underscores the complexityand challenge in identifying miRNAs and mRNAs of criticalimportance to the malignant phenotype and therapeutic resis-tance from among hundreds of candidates. Deregulation of

1Tumor Biology Section, Head and Neck Surgery Branch, National Instituteof Deafness and Other Communication Disorders, NIH, Bethesda, Maryland.2miRecule, Inc. Rockville, Maryland. 3RNAi Screening Facility, National Centerfor Advancing Translational Sciences, NIH, Bethesda, Maryland. 4MolecularCharacterization & Clinical Assay Development Laboratory, Frederick NationalLaboratory for Cancer Research, Leidos Biomedical Research, Inc., Frederick,Maryland. 5Department of Otolaryngology-Head and Neck Surgery, Universityof Michigan, Ann Arbor, Michigan. 6Department of Medical Oncology, JohnsHopkins University School of Medicine, Baltimore, Maryland. 7Vavilov Instituteof General Genetics Russian Academy of Science, Moscow, Russia. 8Departmentof Pathology, Einstein School of Medicine, Bronx, New York. 9Department ofOtorhinolaryngology-Head and Neck Surgery, Montefiore Medical Center,Bronx, NewYork. 10Canada's Michael Smith Genome Sciences Centre, BCCancer

Agency, Vancouver, British Columbia, Canada. 11Cancer Program, Broad Instituteof Harvard andMIT, Cambridge, Massachusetts. 12Departments of Oncology andOtolaryngology at the Lombardi Comprehensive Cancer Center, GeorgetownUniversity Medical Center, Georgetown, Washington DC.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

CorrespondingAuthors:Carter VanWaes, NIDCD/NIH, Building 10, Room7N240,10 Center Drive, Bethesda, MD 20892. Phone: 301-402-4216; Fax: 301-402-1140;E-mail: [email protected]; and Zhong Chen, [email protected]

doi: 10.1158/1078-0432.CCR-18-0716

�2019 American Association for Cancer Research.

ClinicalCancerResearch

Clin Cancer Res; 25(9) May 1, 20192860

on November 24, 2020. © 2019 American Association for Cancer Research.clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst February 5, 2019; DOI: 10.1158/1078-0432.CCR-18-0716

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-18-0716&domain=pdf&date_stamp=2019-4-12

http://clincancerres.aacrjournals.org/

mRNAs and miRNAs has been observed in head and neck squa-mous cell carcinomas (HNSCC; ref. 3). Insights gained throughgenome-wide analyses have uncovered candidate transcriptionfactors andmiRNAs that regulate broadermRNA programs impli-cated in cancer (4, 5). However, until the recent publication of thehead and neck and pan-cancer analyses from The Cancer GenomeAtlas (TCGA; refs. 6, 7), comprehensive data from multiple plat-forms have not been available to compare and identify the mostsignificantly altered miRNAs, inversely expressed mRNA targets,and the contributions of genomic alterations driving theirexpression.

While functional screens have provided an alternativemeans toidentifymiRNAsof interest in vitro (8), prioritization is difficult, asmany candidatemiRNAs do not translate to therapeutic activity invivo. Few studies on the tumor suppressor function of miRNAshave comprehensively linked genomic alterations to changes inmiRNA expression, regulation of a broad pathway of oncogenicmRNAs, and their functional relationship to the cancer phenotypeand clinical features. Contributing factors include a prior lack ofcomprehensive multiplatform data from large tumor datasets,tumor heterogeneity in miRNA and mRNA expression and func-tion, and differences in conditions affecting cancer cell growth inthe tumor microenvironment versus culture (9, 10).

To identify miRNAs of potential regulatory, biologic, andtherapeutic importance in HNSCC, we integrated analysis ofmiRNA expression with functional screening for antiproliferativemiRNAs, and inversely correlated predicted target mRNAs fromTCGA and a validation dataset of HNSCC tumors. Intriguingly,this approach uncovered overlap of 9 underexpressed and anti-proliferative miRNAs, of which four weremembers of themiR-30family. Remarkably, decreased miR-30a-5p was inversely relatedto overexpression of a program of growth, differentiation, andmetastasis-related mRNAs that are implicated in the biology andclinical features of HNSCC. We confirmed the role of miR-30family in regulation of several classical oncogenes centering oncell growth, differentiation, and adhesion molecules. We devel-oped a novel synthetic miR-30a-5p mimic nanomedicine thatdelayed tumor growth and inhibited expression of growth recep-tors when delivered into xenograft tumor models of HNSCC.Furthermore, decreasedmiR-30 family expressionwas linkedwithDNA copy loss and promoter hypermethylation, and patientoutcome, identifying themiR-30-5p family as a tumor suppressorand potential therapeutic target in HNSCC subsets.

Materials and MethodsIntegrative analysis of TCGAmiRNAandmRNAexpressiondata

TCGA HNSCC tumor and control specimens were collectedunder Institutional review board (IRB)-approved protocols withinformed consent (6, 7). The characteristics and miRNA, mRNA,data for 279 HNSCC, and 16 normal mucosa previously reportedwere accessed from Level 3 data (REF ¼ TCGA Network, thesupplementary information S7.43). Reads were aligned to NCBIGRCh37-lite reference genome, and annotated on the basis ofmiRBase v16. Although all identifiedmiRNAs (mature strand, starstrand, precursor miRNA , etc.) were counted and normalized toRPM, only mature miR-5p and 3p strands were used for analysis.The miRNAs were ranked by reads per million mapped reads(RPM) variance across the samples, and the most variable 50%with a minimum expression of at least 50 RPM were used forintegrated analysis. mRNA expression was calculated from RNA-SeqdatawithRSEMv1.1.132 (11). Themost-variant 50%of geneswere used for integrated analysis. BothmiRNA andmRNA expres-sion data were log2 transformed. To generate a high confidencedataset of global miRNA–mRNA interactions, we identified pair-wise negative correlations of miRNA with target mRNA expres-sion, using linear regression in conjunction with available pre-diction tools from miRNA target databases.

miRNA expression validation in HNSCC samplesAn independent validation set of 13 HNSCC tissue and 9

mucosa samples were collected by the University of MichiganMedical Center (Ann Arbor, MI) as part of an IRB-approvedprotocol UM2002-0691, with informed consent. The collectedtissues were snap frozen and mounted in optimal cutting tem-perature freezing media (Thermo Fisher Scientific), cut into 7-mmsections, and stained by hematoxylin and eosin (H&E) standardmethods. The stained slides were scanned using a Scanscope(Aperio), to ensure the presence of tumor or mucosa squamousepithelium. The stained slides were used to macrodissect tissueblocks to attain a minimum of 70% desired squamous tumor orepithelium cells in each sample. Small RNA were purified using amirVana miRNA isolation Kit (Life Technologies). Small RNA-sequencing librarieswere constructed using the SOLiDTotal RNA-Seq Kit (Life Technologies). Sequencing was performed on theSOLiD 5500 next-generation sequencer and the SOLiD SmallRNA SP Kit (Life Technologies), using manufacturer's protocols.miRNA expression was analyzed as described above.

HNSCC cell linesA panel of 10 HNSCC cell lines was obtained from the Uni-

versity of Michigan squamous cell carcinoma (UM-SCC) seriesfrom Dr. T.E. Carey. The origin of these UM-SCC cell lines wasauthenticated in 2010 by genotyping with 9 markers as describedin SupplementaryMethods, and frozen stocks verified to be free ofMycoplasma by RT-PCR were established. Preserved frozen stocksof lines were used within 3 months of culture. UM-SCC cell linesand human primary oral keratinocytes (HOK) from oral gingivalmucosa purchased from Lonza, were cultured in medium asdetailed in Supplementary Methods.

Functional miRNA mimic viability screenUM-SCC-1 cells were maintained in minimum essential

medium (MEM) containing 10% heat-inactivated FBS supple-mented with nonessential amino acids and sodium pyruvate.

Translational Relevance

Through an integrated genomic profiling and functionaldrug screening approach, we successfully identified miRNAmimics as potential therapeutics for cancer. This analysisidentified themiR-30 family as tumor suppressors in HNSCC,and a previously undefined network of mRNA targets thatunderlie its function. It also identified the subset of patientswith genomic deletion, or methylation that correlate withrepression of miR-30a/e-5p expression and prognostic out-come, who could most likely benefit from treatment withmiR-30-5p replacement therapy. We have demonstrated theproof of concept for a therapeutic miR-30-5p mimic–basednanomedicine in xenograftmodels ofHNSCCwith no observ-able toxic side effects.

miR-30 as Tumor Suppressor and Therapeutic Target in Cancer

www.aacrjournals.org Clin Cancer Res; 25(9) May 1, 2019 2861




Transfections were performed in 384-well plates (Corning3570). For transfections, 20 mL of serum-free media containingLipofectamine RNAiMax was added to wells containing miRNAmimic (0.8 pmol). Lipid and miRNA mimic were allowed tocomplex for 45 minutes at ambient temperature before addi-tion of 1,500 cells in MEM, 20% FBS to yield final transfectionmixtures containing 20 nmol/L miR mimic in MEM, 10% FBS.Screening was conducted with a miRNA mimic library (Qiagen)based on Sanger miRBase 13.0 and consisting of approximately800 mimics. Viability (CellTiter Glo, Promega) was assayed72 hours posttransfection on a PerkinElmer Envision 2104Multilabel plate reader. Ambion Silencer Select Negative Con-trol #2 was incorporated on all screening plates for normali-zation (16 wells per plate; the median negative control value oneach plate was used to normalize sample wells). All screenplates exhibited assay z'-factors greater than 0.6. Negativecontrol normalized viability data was converted into robustz-scores by median absolute deviation (MAD; ref. 12).

RT-PCR, Western blot analysis, and luciferase reportervalidation of mRNA targets

These standard assays are detailed in Supplementary Methods.

Migration, Matrigel, and colony formation assaysThese standard assays are detailed in Supplementary Methods.

Development of miR-30a-5p nanocomplex targeted totransferrin receptor expressed by tumor cells

Fluorescent siRNA to test nanoparticle delivery, amodifiedmir-30a-5-pmimetic, and controlmiRNAmimetic was synthesized byTrilink Biotechnologies. The miR-30a double-stranded mimiccontained a guide strand sequence of 50UGUAAACAUCCU-CGACUGGAAGCU 30 and a passenger strand sequence of 50

AGCUUCCAGUCGGAUGUUUACACG 30, chemically capped onthe 50end to prevent phosphorylation and loading via RISC,and mutated to enhance duplex formation, thereby favoringstability and function of the 5-p strand. The annealed and nano-particle complexed miR-30a mimic is referred to as miR-30a-scL.The control miRNA mimic had a guide strand sequence of 50

UUGUACUACACAAAAGUACUG 30 and a passenger strandsequence of 50 CAGUACUUUUGUGUAGUACAA 30, which isbased on C. elegans cel-miR-239b, a miRNA that has minimalsequence identity with miRNAs in human and mouse. The for-mulation of oligonucleotides into a liposomal nanodeliverysystem (scL) targeted by anti-transferrin receptor single-chainantibody Fragment was performed as described previously (13),and detailed in Supplementary Methods.

In vivo tumor growth and target immunofluorescence assaysAll animal experiments were carried out under protocols

approved by the Animal Care and Use Committee of the NIDCD,and were in compliance with the Guide for the Care and Use ofLaboratory Animal Resource (14). Six-to 8-week-old athymic nu/nu femalemice (obtained from the Frederick Cancer Research andDevelopment Center, NCI) were injected subcutaneously (s.c.)with 2.5� 106 UM-SCC-46 or UM-SCC-47 cells in 100 mL of 30%Type 3 BME Cultrex (Trevigen)/MEM on the right leg. Oncetumors reached approximately 150 mm3, mice were randomizedinto treatment groups of (n ¼ 5 mice each); control 5% sucrose(vehicle), control miR-scL, and miR-30a-scL. Nine doses of 3 mg/kg miR-30a-scL were administered via tail vain injection onMWF

over three weeks for a total of nine doses. Tumor size wasmeasured on MWF with external calipers and volume calculatedwith the formula V ¼ 1/2 L � W2. Tumor growth was reported asmean volume with SEM. Kaplan–Meier survival analysis wasperformed inGraphPad Prism software (v6.05). Survival statisticswere performed using the log-rank (Mantel–Cox) test, and HRcalculated via log-rank test.

An expanded description of all methods is included in theSupplementary Information.

Validation study of mir-30a/e-5p expression with disease-freesurvival

The Einstein study was described previously (15) and includedglobal miRNA expression profiling, clinicopathologic, and long-term disease-specific survival data from 148 prospectivelyenrolled patients with histologically confirmed primary HNSCCundergoing curative treatment at Montefiore Medical Center(Bronx, NY) since 2002. The study protocol was approved by theIRB, and all patients provided written informed consent. Thesurvival analyses were performedwith R package (16). The overallsurvival curves were obtained using Kaplan–Meier method andwere compared using the log-rank test. The Cox proportionalhazards model was used to estimate HRs with 95% confidenceintervals (CI). Subjects were dichotomized as lowmiRNA expres-sion (< median) and high miRNA expression (� median), usingthe median expression of each miRNA as a cutoff. To compareoverall survival time by CNV, subjects were categorized as havingMIR30E/A deletion if their GISTIC copy number value was lessthan �0.1, otherwise they were considered to have no deletion.

ResultsGenome-wide miRNA expression analysis identifies decreasedexpression of miR-30-5p family members in HNSCC tissues

To identify miRNAs of potential therapeutic importance inHNSCC, we employed an integrated approach that combinedstructural and functional genomic analyses (Supplementary Fig.S1). To identify miRNAs that were differentially expressed inHNSCC tissues, we analyzed TCGA miRNA sequencing data for279 HNSCC with 16 squamous control specimens (6). Thisanalysis identified 129 significantly deregulated miRNAs, includ-ing 77 increased and 53 decreased miRNAs (the cutoff for signif-icance is an FDR adjusted q-value of 0.2, as listed in Supplemen-tary Table S1A; Supplementary Fig. S2A). We validated theseobservations by miRNA sequencing and expression analysis ofan independent panel of 13 HNSCC specimens from the oralcavity and 9 matched mucosa samples from the University ofMichigan (UMSC, Ann Arbor, MI; Supplementary Table S2;Supplementary Fig. S2B). Pair-wise comparison of significantlyaltered miRNAs in the smaller dataset (cutoff q-value of 0.2)supported the novel finding of broad repression of several mem-bers of the miR-30 family, as well as other miRNAs identified inprior studies of HNSCC (Fig. 1A and B; Supplementary Table S1).Notably, miR-30a and -30e family members exhibited at least a2-fold decreased expression in >70% of the specimens in bothcohorts.

Integrative functional genomics screening reveals that miR-30family members inhibit HNSCC proliferation

To identify candidate miRNAs that inhibit proliferation, weperformed a functional genomic screen after transfecting a library

Saleh et al.

Clin Cancer Res; 25(9) May 1, 2019 Clinical Cancer Research2862




Figure 1.

Integrative genome-wide analysis identified decreased expression of miR-30 family members with anti-proliferative activity in HNSCC tissues and cell lines. NinemiRNAs that were differentially abundant between tumor and normal mucosa control samples (q-value <0.2) in in TCGA (A) and independent UMSC (B) HNSCCtumor cohorts. Genome-wide mature miRNA profiling was performed using high-throughput sequencing of human HNSCC tissues. TCGA: tumor¼ 279,mucosa¼ 16; samples from UMSC: tumor¼ 13, mucosa¼ 9. Left, median fold change between tumor andmucosa, presented on a linear scale. Right, expressiondistribution of mucosa and tumor presented as log10 RPM (reads per million mapped reads). Medians, thick black lines; bars, 25th and 75th percentiles; outliersare displayed as individual points. Relationship of proliferation score to log2 miRNA tumor-mucosa expression ratio of TCGA (C) and UMSC (D) differentiallyexpressed miRNAs (log2 tumor compared with mucosa in y-axis) versus proliferation score (MAD). Antiproliferative activity was determined in an in vitrogenome-wide RNAi screening in the HNSCC cell line UM-SCC-1 as described in Materials and Methods. The green box denotes miRNAs that are repressed intumor tissue and exhibit antiproliferative activity. miR-30-5p family members are highlighted in red. E, Antiproliferative effect of miRNAmimics, 96 hours aftertransfection into UM-SCC-1, as percentage of control miRNAmimic. F, Expression of miR-30 family members in mucosa and tumor specimens from the TCGAcohort. Bars represent SEM and � , q < 0.2 as reported by SAMseq. miR-30a-5p andmiR-30e-5p display the highest expression in mucosa specimens and thegreatest reduction in tumor specimens.






of approximately 800 miRNAs into the human HNSCC line UM-SCC-1 (Supplementary Table S3). To enrich screening hits formiRNAswith relevance to disease biology,miRNAs that displayedhigh antiproliferative activity (MAD score < �1) were filteredagainst miRNAs that display reduced expression in both TCGAand the UMSC validation datasets. We identified 9 miRNAs withdecreased expression in tumor specimens (Fig. 1C and D) anddisplay significant inhibitory activity when reexpressed (Fig. 1E).Strikingly, several members of the miR-30 family were againpresent among this highly selected class of miRNAs, supportingthe biologic and functional importance of miR-30 family mem-bers in HNSCC. Next we validated the antiproliferative screeningresults for each miR-30-5p family member in UM-SCC-1 and anadditional HNSCC cell line UM-SCC-46 (Supplementary Fig.S3A), which all displayed similar activity in both lines. Amongthese, miR-30a-5p followed by miR-30e-5p were the most highlyexpressed in mucosa samples and strongly decreased across thetumor specimens (Fig. 1F). In two HNSCC cell line models andprimary human oral keratinocytes, miR-30a-5p displays higherrelative expression (Supplementary Fig. S3B). Thus, as these andother miR-30 family members share the same seed sequences fortargets, we included themost differentially expressedmiR-30-a/e-5p family members in selected genomic, functional, and clinicaloutcome studies below.

miR-30a-5p is inversely correlated with target transcriptsimplicated in cancer growth signaling and metastasis

To identify thenetworkof targetmRNAs regulatedbymiR-30 inHNSCC that underlie its function(s), we explored whether thereduced expression of the most differentially expressed familymember, miR-30a-5p, is anticorrelated with mRNAs of potentialbiologic importance in cancer. Linear regression analysis wasperformed betweenmiR-30a-5p and genome-widemRNAexpres-sion levels obtained fromRNA-seq tumor specimens in the TCGAdataset. Ninety-one mRNAs were inversely expressed to miR-30a-5p with FDR < 0.05, and also contained predicted or verifiedbinding sites formiR-30a-5p in the 30 UTR, based on the IngenuityPathway Analysis (IPA) microRNA target filter (SupplementaryTable S4). The significant anticorrelations of miR-30a-5p withseveral representative candidate cancer-related target genes arepresented in Supplementary Fig. S3C. Interestingly, miR-30a-5pexpression displayed an inverse relationship to several oncogenespreviously shown to be overexpressed in HNSCC, includingEGFR, MET, IGF1R, ITGA6, and SERPINE1 (17–25). The twomost statistically significant cancer disease functions identified byfunctional pathway analysis of inversely expressed target geneswere cell proliferation (21 mRNAs, P ¼ 8.95 � 10�10) andmetastasis (23 mRNAs, P ¼ 9.54 � 10�12; Supplementary TableS5). Remarkably, these networks harbor a diverse repertoire ofmolecules critically implicated in cancer growth (EGFR, MET,IGF1R, PDGFRB, IRS1, SOCS1, CCNA1); adhesion, migration,and invasion (MET, ITGA6, NT5E, SERPINE1); and differentia-tion (WNT7B/5A, FZD2, CELSR3, CTHRC1).

Most of themRNAs identified above are novel targets ofmiR-30family and not previously characterized. To functionally validatemiR-30a-5p regulation of inversely expressed mRNAs, we firstexamined the effects of ectopic expression of miR-30a-5p orantisense-miR30a-5p on potentially targeted mRNAs in twoHNSCC cell lines, HPV(�) UM-SCC-46 (Fig. 2A, left), andHPV(þ) UM-SCC-47 (Supplementary Fig. S4A). After transfec-tion of miR-30a-5p, a reduction in mRNA expression was

observed for 11 selected mRNAs by qRT-PCR, involved in growthandproliferation (Fig. 2A, left), anddifferentiation, adhesion, andinvasion (Fig. 2A, right). Thus, both bioinformatic analyses andexperimental data support the hypothesis that miR-30a-5p con-tributes to regulation of several target mRNAs implicated inpathogenesis of HNSCC.

Functional validation of miR-30a-5p direct regulation of targetgene expression

We further functionally validated direct regulation of a subsetof 4 selected growth signaling related target genes by miR-30family members, utilizing luciferase constructs containing the 30

UTRs of EGFR, MET, IGF1R, and IRS-1, which contain the pre-dicted target binding sites for miR-30 family members (Fig. 2B).We also constructedDmiR-30 vectors inwhich the sequence that iscomplementary to the seed sequence of miR-30a-5p was deleted.miR-30a-5p, but not anti-miR30a-5p, suppressed reporter activ-ity, and this was abrogated by deletion of the complimentarysequence (Fig. 2B and C). The inhibitory effects ofmiR-30a-5p onprotein expression of a subset of the molecules implicated ingrowth signaling (EGFR, MET, IGF1R, IRS1), adhesion (ITGA6),and differentiation (FZD2) were also confirmed byWestern blotsin two cell lines (Fig. 2D; Supplementary Fig. S4B). As thesegrowth factor receptors stimulate several oncogenic signalingpathways, we examined the functional effect of miR-30a-5p onsignal phosphorylation on PI3K/mTOR-AKT (19), SRC (20), andSTAT3 signaling (21). miR-30a-5p decreased downstream phos-phorylation of these signalingmolecules (Fig. 2E; SupplementaryFig. S4C). Our data support the direct regulatory effects of miR-30a-5p on the several overexpressed molecular targets implicatedin aberrant signaling of HNSCC.

miR-30a-5p inhibits cell proliferation,motility and invasion byHNSCC cells

As several of the miR-30a-5p targets identified can modulatecell growth, we next surveyed the antiproliferative effects ofmiR-30a-5p and potential correspondence with mRNA expres-sion in normal primary oral keratinocytes (HOK), and a panelof HNSCC cell lines that includes UM-SCC lines derived from 9primary tumors and 2 paired recurrences. Four HNSCC cellslines (UM-SCC-11A, 11B, 46, 47) treated with miR-30a-5pdisplayed significantly decreased cell density of <50% whencompared with normal controls, while nonmalignant HOKsdisplayed smaller or no inhibitory effects (Fig. 3A). This corre-sponded with significantly lower expression of miR-30a-5pobserved in the HPV(�) lines UM-SCC-11A, B, UM-SCC-46,and the HPV(þ) line UM-SCC-47 (Fig. 3B, P < 0.05). Both miR-30a-5p and miR-30e-5p were expressed at lower levels in therelatively more responsive UM-SCC-46 line, compared withHOK and the less responsive UM-SCC-1 line (SupplementaryFig. S3B), similar to the pattern of decreased expression in asubset of TCGA tumors relative to normal epithelia. Further-more, we confirmed that miR30a/e-5p, and other family mem-bers sharing the same seed sequence, had similar inhibitoryeffects on proliferation in these two lines (Supplementary Fig.S3A), further supporting studies using the more abundant miR-30a-5p. Further studies confirmed that miR-30a-5p suppressedproliferation, colony formation, and exhibited additive activitywith chemotherapy drug cisplatin used for the treatment ofHNSCC, in UM-SCC-46 and/or UM-SCC-1 cells (Fig. 3C and D;Supplementary Fig. S5A–S5D). To confirm the potential of a

Saleh et al.





miR-30a-5p target to partially rescue HNSCC from the anti-proliferative effect of miR-30a-5p, we examined the effect ofstably expressing EGFR without its regulatory 30UTR in UM-SCC-46. Forced EGFR expression significantly attenuated andrescued cells from the antiproliferative effect of miR-30a-5p(Supplementary Fig. S5E and S5F).

Several of the mir-30-5p family targets in HNSCC are alsoimplicated in cellmotility and invasiveness, including EGFR (19),MET (22, 23), ITGA6 (17, 24), and Serpine1 (25). Ectopic expres-sion ofmiR-30a-5p significantly slowed cell motility inmigrationassays in two HNSCC cell lines that spread as monolayers anddisplay wound closure in controls (Fig. 4A and B). miR-30a-5p

Figure 2.

Validation of miR-30a-5p predicted targets in an HNSCC line. A, Selected miR-30 target genes were validated by qRT-PCRmeasurement in UM-SCC-46 cellstransfected with miRNA negative control (neg Con), miR-30a, or anti-miR-30a-5p oligonucleotide for 72 hours. The mean of three independent experiments,� SEM; � , P < 0.05 by Student t test. B, Base pairing of miR-30a-5p with 30 UTR of target mRNAswas predicted by Mfold (http://unafold.rna.albany.edu/?q¼mfold). Bases in red depict binding of miR-30a-5p seed sequence. Horizontal lines with delta symbols mark bases in the mRNA 30 UTR that were deleted incloned 30-mutant UTR vectors to ablate miR-30-5p regulation. C, Relative luciferase activity after cotransfection of UM-SCC-46 cells with miR-30a-5p or anti-miR30a-5p and vectors containing wild-type 30-UTR (left) or 30-mutant UTR (right) cloned behind a Renilla luciferase reporter gene. Results for positive controlvector (Pos Con) containing 5�miR-30-5p binding sites and a negative GAPDH 30-UTR control are also displayed. All data represent the mean of threeindependent experiments and error bars, SEM. � , P < 0.05 by Student t test. Protein expression for selected miR-30 targets (D) and downstream phospho- andtotal signal protein expression examined byWestern blot analysis (E) using whole-cell lysates isolated from primary human oral keratinocytes (HOK) and UM-SCC-46 cells 72 hours after transfection with miR-30a-5p or anti-miR30a-5p oligonucleotides. b-Tubulin is a loading control.





http://unafold.rna.albany.edu/?q = mfold

http://unafold.rna.albany.edu/?q = mfold


Figure 3.

AmiR-30a-5p mimic inhibited HNSCC cell proliferation, colony formation, and enhanced cisplatin sensitivity in vitro. A, Proliferation measured by XTT assay in 6replicates on day 5 after transfection with control or miR-30a-5p mimic across primary human oral keratinocytes (HOK) and ten HNSCC cell lines. B, Basal level ofmiR-30a-5p expression measured by qRT-PCR in HOKs and ten HNSCC cell lines in log-growth phase. Relative miR-30a-5p expression was normalized to themean expression of the cell lines. � denotes P < 0.05 by a Student t test compared with HOK cells. C, Colony formation assay of UM-SCC-46 cells was performedfollowing 48-hour transfection with miR-30a-5p or anti-miR30a-5p oligonucleotides. Colonies were counted in three wells and repeated in three independentexperiments.D, UM-SCC-46 cells were transfected with miR-30a-5p mimic for 48 hours, and treated with 2 mmol/L cisplatin for 3 hours and then washed withwarmmedia and cell density was measured by XTT assay 72 hours after cisplatin treatment. Values represent the mean of at least three experiments� SEM;� , P < 0.05 by a Student t test.

Saleh et al.





also significantly reduced EGF-stimulated invasiveness in trans-well migration assays (Fig. 4C and D). In summary, increasedexpression of miR-30a-5p significantly inhibited cell prolifera-tion, colony formation, migration, and invasion, as well asenhanced chemosensitivity of HNSCC.

A novel miR-30-5p mimic delivered by targeted nanoparticlessuppresses tumor growth

To examine the therapeutic potential of miR-30a-5p inHNSCC in vivo, we formulated a miR-30a-5p mimic with novelmodifications into a nanodelivery system (scL) bearing anantibody fragment (TfRscFv) that targets transferrin receptoron tumor cells (26, 27). We confirmed that the scL carriercontaining FITC-conjugated control oligonucleotide under-goes preferential uptake in HNSCC xenografts, when com-

pared with lung or liver (Fig. 5A). We next examined thetherapeutic effect and general systemic toxicity of scL particlescomplexed with a miR-30a-5p mimic (miR-30a-scL) or with acontrol miR-scL (60mg or �3 mg/kg) given in 9 doses intra-venously on MWF for 3 weeks in mice bearing UM-SCC-46xenograft tumors (Fig. 5B-E). A significant tumor growth delayand prolongation of survival was observed with miR-30a-scLtreatment (Fig. 5B, C and E). Treatment with miR-30a-scL didnot cause any visible toxicity, or significant reduction in weightto indicate decreased intake, mucosal, or general systemictoxicity (Fig. 5C and D). In addition, we tested miR-30a-scLnanoparticles in a second HPVþHNSCC xenograft model, UM-SCC-47. We observed a similar inhibitory effect on tumorgrowth in vivo (Fig. 5F). We performed quantitative RT-PCRof 6 miR-30a-5p target genes and observed substantially

Figure 4.

Ectopic expression of miR-30a-5p reduces HNSCC cellmigration and invasion. A, Representative lightmicroscopy images (100�) for wound closure in a cellmigration assay. UM-SCC-1 (left) and UM-SCC-6 cells(right) were transfected with miR-30a-5p or anti-miR-30a-5p oligonucleotides for 48 hours before woundscratch creation. Cell migration was observed untilwound closure in controls. UM-SCC-1, left, time 0; right,time 20 hours. UM-SCC-6, left, time 0; right, time 60hours. B, Cell invasion assay. UM-SCC-1 and UM-SCC-6cells were transfected with negative control,miR-30a-5p, or anti-miR-30a-5p oligonucleotidesfor 48 hours, then trypsinized and placed in Matrigel-coated transwell migration chambers. 50 ng/mL rEGFwas placed in the bottomwells as a chemoattractant.After a 20- or 60-hour incubation, invasionmembranes were fixed and stained to quantifyinvading cells. C, Representative light microscopyimages (100�) of invasionmembranes are shown forUM-SCC-1. D, Relative quantitation of invading cells forUM-SCC-1 (left) and UM-SCC-46 (right). All datarepresent the mean of at least three experiments anderror bars represent SEM. � , P < 0.05 by a Studentt test for statistical comparison with either negativecontrol or anti-miR-30a.






Figure 5.

Anti-tumor activity of miR-30a-5p mimic delivered via nanoparticles in HNSCC xenograft tumors in vivo. A, Detection of FITC-labeled-scL in tumor and selectedorgan tissues. UM-SCC-46 cells were subcutaneously injected into athymic nu/nu female mice, and mice were randomized when tumors reached approximately300mm3. Mice were administered 100 mg (�5 mg/kg) of complexed FITC-labeled control oligonucleotide or control vehicle intravenously (IV). Twenty-fourhours later, mice were sacrificed for tumor and organ harvest. Dissected organs were then imaged. Left, bright field; right, fluorescence microscopy, wheretissues with FITC nanoparticles are on the left with green fluorescence and control vehicle on the right. B, Effect of miR-30a-5p mimic on tumor xenografts. Micebearing approximately 150 mm3 UM-SCC-46 xenograft tumors were randomized into groups of five animals and injected intravenously with nine doses of 60 mg(�3 mg/kg) of miR-30a-5pmimic nanoparticles (miR-30a-scL) or control nanoparticles on Monday,Wednesday, and Friday (MWF) for 3 weeks. Mean tumorvolume for each group� SEM; statistically significant size difference between the two groups was achieved by day 16 (P < 0.05, Student t test). C,Representative images of tumor size at the end of treatment on day 24. D,Mouse weight (grams) over course of the experiment. E, Kaplan–Meier analysis plotshowing significant improvement in survival betweenmice treated with miR-30a-scL versus control. F,Mice bearing HPVþ UM-SCC-47 xenograft tumors grownto approximately 150 mm3, were randomized into groups of four, and then the mice were injected intravenously with 60 mgmiR-30a-scL or control on an MWFschedule for 25 days. Tissue was collected 36 hours after the final dose. Mean tumor volumeþ SEM, � , P < 0.05, Student t test on day 25 after tumor implant.

Saleh et al.





decreased gene expression after treatment by four doses ofmiR-30a-scL nanoparticles (Supplementary Fig. S6A). Con-firming miR-30a-5p family's antiproliferative effect, we alsoobserve a decrease in Ki-67 staining (Supplementary Fig. S6Band S6C). We also observed decreased expression of EGFR andMET by immunofluorescence staining in frozen sections har-vested from UM-SCC-46 and 47 xenograft tumors after treat-ment in vivo (Supplementary Fig. S7A–S7C). With confirma-tion both in vitro and in vivo of several target genes of miR-30a-5p, a pathway model predicted by Ingenuity Pathway Analysiswas constructed connecting reported interactions and func-tions of anticorrelated targets identified above in relation toproliferation and migration (Supplementary Fig. S8).

Genetic alterations of miR-30 family members are associatedwith clinical features of HNSCC

We hypothesized that if loss of expression of miR-30 familymembers is important in pathogenesis of HNSCC, there may beselective pressure for deletionor epigenetic silencing.Weanalyzedcopy number variation of miR-30 family members from theHNSCC TCGA datasets. For the MIR30A and MIR30C2 genes onchromosome 6, and the MIR30E and MIR30C1 on chromosome1, 19.7 % and 14.7% display at least heterozygous copy numberloss at these genetic loci, with infrequent overlap (Fig. 6A and B).Integrative analysis supported a trend or significant correlation ofheterozygous loss with decreased expression formiR-30a-5p (P¼0.15; Fig. 6A andC), andmiR-30e (P¼ 0.0006, Fig. 6B andD).Wefurther analyzed if the broader decreased expression ofmiR-30a/eobserved is associated with methylation of putative promoters,along theMIR30A/C2 promoter and coding regions (Supplemen-tary Table S7).Weobserved a correlation between increasingDNAmethylation of MIR30A promoter and lower expression in asubset of tumor specimens (Spearman correlation ¼ �0.22 andP¼ 0.00057; Fig. 6C). We observed that a high percentage of oralcavity tumors (n ¼ 87) display a significant correlation withhypermethylation of CpG sites in the MIR30A promoter, andwith reduced miR-30a-5p expression (Fig. 6C; SupplementaryTable S8-1, P ¼ 6.15e�07 and 0.0082, respectively). ReducedexpressionofmiR-30e-5pwas significantly correlatedwith currentsmoking among a subset of oral cancers (Supplementary Table S8-2, P ¼ 0.022), but did not reach significance for oropharyngealcancers or HNSCC overall. Copy number deletion and reducedexpression of miR-30e-5p is correlated with HPV� HNSCC(Fig. 6D; Supplementary Table S8, P ¼ 0.0053 and 0.0001,respectively), including laryngeal subsites.

Next, we examined whether miR-30a/e-5p expression is asso-ciated with differences in prognosis. As overall survival (OS) datafor TCGA is incomplete and showed no or borderline significance(miR30a-5p, P ¼ 0.36; miR-30e-5p, P ¼ 0.046; SupplementaryFig. S9A and S9B), we analyzed disease-specific survival data formiR-30a/e-5p available from a miRNA profiling study of 148primary HNSCC tumors from patients with over 10 years ofclinical follow-up (15, 30). This dataset displays a significantcorrelation between low miR-30a-5p expression with poorerdisease-specific survival (P ¼ 0.024, Fig. 6E), and a similar trendfor miR-30e-5p (P ¼ 0.113, Fig. 6F). A trend toward reduced OSwas also observed in the subset of patients that display copynumber loss of the MIR30E loci, supporting the contribution ofgenomic copy alteration to decreased miR-30e-5p expression in asubset of tumors (Supplementary Fig. S9B). Strikingly, OS anddisease-specific survival (DSS) for tumor anatomic subsites

revealed that low expression of miR-30e-5p is most significantlyassociated with worse prognosis for oropharyngeal carcinomas inboth the TCGAandEinsteindatasets (Supplementary Fig. S9B andS9C).Moreover, patients showing low expression formiR-30e-5pand displaying worse prognosis were both HPVþ and HPV�

(Supplementary Table S8), providing a candidate marker forprognosis not previously available for this site that warrantsfurther investigation. These data suggest that reduced miR-30a/e-5p expression may be associated with genetic or epigeneticalterations, HNSCC tumor subsites, HPV status, and prognosis,which are of clinical relevance in HNSCC.

DiscussionTo identify miRNAs of potential therapeutic importance in

HNSCC, we employed an integrated approach that combinedstructural and functional genomic analyses. We observed thatseveralmiR-30 familymembers display at least a 2-fold decreasedexpression in >70% of specimens in TCGA, and among a valida-tion set of tumors. While the miR-30 family has not been recog-nized nor extensively studied in the context of HNSCC, analysisof Supplementary Data files from previous studies profilingmiRNA expression independently support our finding of miR-30-5p repression in HNSCC (15, 28–30). We also observedderegulated expression of several miRNAs that have previouslybeen reported as altered in HNSCC, including increased expres-sion of miR-21-5p (31), miR-31-5p (32), and reduced expressionof miR-375 (15, 29, 30) and themiR-100 family (33). IntegratingmiRNA expression results with a functional antiproliferationscreen in vitro identifiedninemiRNAs that are frequently repressedin tumors and inhibit HNSCC cell proliferation. Strikingly, thisanalysis also identified four members of the miR-30 family, miR-30a/b/d/e-5p, as well as miR-26a/b-5p, miR-145-5p, miR-375,and miR-338-3p. This overlap in structural and functional anal-yses identified the miR-30a/e-5p to be of potential biologic andclinical significance in HNSCC.

To identify which mRNAs are targeted by miR-30 in HNSCCand underlie its function as a putative tumor suppressor, weperformed linear regression analysis of mRNA expression dataagainst the highest expressed miR-30 family member, miR-30a-5p, across the TCGAdataset. This unexpectedly revealed anetworkof candidate miR-30a-5p targets of established biologic andclinical importance inHNSCC. Significant among these predictedmiR-30a-5p targets are several receptor tyrosine kinase genesEGFR, MET, IGF1R, and the previously validated miR-30b targetPDGFRb (18–24). These receptors orchestrate growth and migra-tionofHNSCC in response todiverse autocrineorparacrine signalligands in tumors (19, 23, 35). We also identified other cellsignaling receptors such as ITGA6, SERPINE1, and FZD2, whichhave been implicated in proliferation, adhesion, migration, anddifferentiation of HNSCC both in vitro and in vivo (17, 24, 36, 37).

Interestingly, overexpression of EGFR,MET, ITGA6, and severalother of these receptors is reported inHNSCC, but is inadequatelyexplained by regulation via gene amplification or transcriptionalactivation alone (6, 38). We also show that ectopic miR-30a-5psuppresses multiple mRNAs and proteins implicated in growthsignaling networks in cancer, including IRS-1, which potentiallyenhances activation of PI3K–AKT–mTOR signal pathways down-streamof these receptors.Ourfindings for several of these proteinsare consistent with data from a study that used pSILAC to studyglobal changes in protein expression when HeLa cervical






squamous cell carcinoma cells were transfected with a miR-30a-5pmimic. Analysis of primary data files (http://psilac.mdc-berlin.de/) indicated that transfection of miR-30a-5p reduced EGFR,MET, IGF1R, ITGA6, and WNT5A protein expression, althoughthese data were not recognized or further validated. Together, ourdata suggest decreased miR-30a-5p is associated with the over-expression of a diverse set of mRNAs and proteins that areimplicated in promoting the malignant phenotype in HNSCC.

We report ectopic expression of miR-30a-5p reduces prolifer-ation and colony formation in HNSCC cell lines in vitro.Regulation of these targets both in vitro and in vivo likely underliesthis effect. This is supported by partial rescue of miR-30a-5pantiproliferative effect by stable overexpression of EGFR. PriorTCGA analysis suggested that clusters with lower miR-30a/e alsodisplay higher EMT scores and are associated with mesenchymaland basal mRNA clusters. RTK signaling through EGFR (18, 39)

Figure 6.

Genomic deletion, methylation,and expression of miR-30 familymembers, and associated clinicalfeatures. DNA copy numbervariation (CNV) for MIR30A/C2(A) and MIR30E/C1 (B). IntegratedGenome Viewer plots forchromosomes 6 and 1 shown onthe top, with CNV for MIR30 genesat 6q13 and 1p34.2 shown on thebottom for 279 HNSCC tumorsfrom TCGA. Blue indicatesreduced copy number and redindicates increased copy number.C and D, Relation of miRNAexpression with copy number andmethylation for 244 HPV(�) and35 HPV(þ) HNSCC samples fromTCGA. Samples are ordered byDNAmethylation for MIR30A andby CNV for MIR30E. Samples areannotated with clinicalcharacteristics (site, smoking, andstage) and HPV status. Discretegene copy number values areobtained from GISTIC. Clinicalfeatures (colored bars, top fourrows) and genetic characteristics(heatmaps, bottom three rows)are assorted accordingly. Survivalanalysis for 148 HNSCC from theEinstein University dataset (15, 30)for miR-30a-5p (E) andmiR-30e-5p (F) segregated intohigh and low bymedianexpression. Kaplan–Meier plotsand log-rank test P valuescomparing disease-specificsurvival are plotted for low (solidlines) versus high (dashed lines)tumor expression based on amedian cut-off point. Censoredsubjects are indicated by verticalhash marks.

Saleh et al.




http://psilac.mdc-berlin.de/

http://psilac.mdc-berlin.de/


andMET (22, 23) have been implicated in an aggressivemigratoryphenotype in HNSCC. Here we show that miR-30a-5p slowsHNSCC cell migration and suppresses EGF-induced invasionin vitro. miR-30a-5p target ITGA6 encodes the integrina6 subunit,which we previously established as a marker of poor prognosis,and mediator of adhesion and migration in HNSCC (17). SER-PINE1 is downstream of TGFb signaling and has been implicatedin an aggressive migratory phenotype in HNSCC (40). Othershave reported thatmiR-30 familymembers can inhibit additionalmolecules that mediate cell migration and invasion in othercancers, including MMP19 in NSCLC (41), and VIM and Metad-herin in breast cancer (42, 43). Furthermore, repression of miR-30e-5p has been shown to induce EMT in pancreatic cell devel-opment (44). As our studies were limited to effects on migrationand invasion, we believe that further in vivo studies are needed toexamine the role and potential therapeutic significance ofmiR-30in metastatic models of HNSCC. In conjunction with our obser-vation ofmiR-30a-5p targeting ofWNT7B and FRZD2 inHNSCC,miR-30 family members have previously been shown to repressWNT pathway activation through regulation of BCL9 in multiplemyeloma cells (45). We believe that interaction of miR-30with the WNT pathway regulation of cancer stemness deservesfurther study.

The significant response and prolonged survival that we reportfor treatment of HNSCC xenograft tumor bearing mice by intra-venous administration of nanocomplex containing a therapeuticmiR-30a-5pmimic validates our findings and highlights is poten-tial in cancer therapy. The broader significance and therapeuticpotential of our novel nanomedicine is supported by previousexperimental studies reporting inhibitory activity of miR-30 inother cancer types. Stable overexpression of miR-30 reducedtumor take and slowed tumor growth in breast cancer modelsthrough targeting UBC9, ITGA3 (46), and AVEN (47), and pros-tate cancer models through targeting the TMPRSS2-ERG fusiongene (48). In multiple myeloma, intraperitoneal administrationof liposomal miR-30c-5p mimic displayed preclinical anticanceractivity (45).

The potential of miRNA-based therapeutics to simultaneouslytarget multiple mRNAs could help mitigate intrinsic or acquiredresistance that has beenobservedusing smallmolecule or biologictherapies that target a single oncogene or pathway in cancer.Interestingly, resistance to EGFR signal inhibition in HNSCC hasbeen shown to involve overexpression and/or coactivation ofother growth factor receptor tyrosine kinases (RTK), such as theoncoproteins c-MET, IGFR1 (22, 23), and IRS-1, shown here to bederegulated targets of miR-30. These and other signal moleculescan cross-activate the MAPK, PI3K, and STAT pathways, to pro-mote cancer cell growth, survival, and therapeutic resistance.Although these miR-30 family targets are also transcriptionallyregulated and incompletely inhibited by miR-30a-5p alone, ourfindings support the capability of miR-30a-5p to inhibit theexpression of key growth signaling molecules, phosphorylationof signal network components, and phenotypic features uponwhich they converge. miR-30a-5p may hold greatest potential foractivity when combined with inhibitors targeting these pathways,downstream transcription factors, and with standard chemo- andradiotherapy.

Of the miR-30 family members we found, miR-30a-5p andmiR-30e-5p were the most highly expressed in normal specimensandmost frequently repressed in tumors. To understandmechan-isms that drive decreased expression, we analyzed copy number

variation andDNAmethylation results fromTCGA.Approximate-ly 20% tumors exhibited genetic deletion of MIR30A/C2 onchromosome 6, which has been reported as a significantly deletedsite in HNSCC (6), while approximately 15% tumors exhibiteddeletion of MIR30E/C1 on chromosome 1p, another region ofrecurrent copy number alterations in HNSCC. In addition,increased DNA methylation at the MIR30A/MIR30C promoterwas significantly correlated with decreased expression in approx-imately 24 % of samples. The observed deletion andmethylationof MIR30A/E genes suggests selective pressure for their loss bygenetic or epigenetic mechanisms. Furthermore, a subset of sam-ples that display reduced expression were not deleted or meth-ylated, suggesting that other transcriptional mechanism(s) mayunderlie repression. Indeed, previous studies have implicatedEGF/SRC signaling (48), and TGFb signaling (49) in repressionof miR-30 family member expression, suggesting these mechan-isms deserve further study in HNSCC.

The association we identify between low expression of miR-30a/e-5p and sensitivity to a mir-30a-5p mimic in vitro raises thepossibility of identifying patients who are likely to respond tomiR-30a-5p therapy. Furthermore, the observation that hyper-methylated or deleted MIR30A and MIR30E are associated withdifferences in tobacco or HPV-related subsites and prognosis inHNSCC, supports further investigation of these alterations aspotential biomarkers for loss of expression and identification ofpatients that may benefit from treatment with a miR-30 family-based therapy. The prognostic association we identified betweenMIR30E deletion and poor survival in patients with oropharyn-geal cancer, the TCGA data further support this possibility. In aprevious report, the prognostic value of low miR-30 familyexpression predicted low survival and resistance to chemotherapyinbreast cancer (50). Taken as awhole, our results support the roleof themiR-30 family as a tumor suppressor and validate its furtherstudy as a therapeutic agent for cancer and HNSCC.

Disclosure of Potential Conflicts of InterestA.D. Salehholds ownership interest (including patents) inmiRecule, Inc. S.E.

Martin is an employee of Genentech. A.D. Cherniack reports receiving com-mercial research grants from Bayer AG. S.S. Kim is an employee of and holdsownership interest (including patents) in SynerGene Therapeutics, Inc. A. Rait isan employee of and consultant/advisory board member for SynerGene Ther-apeutics, Inc. K.F. Pirollo reports receiving other commercial research supportfrom SynerGene Therapeutics, Inc., and holds ownership interest (includingpatents) in Georgetown University. E. H. Chang reports receiving speakersbureau honoraria from Northwestern University, and is a consultant/advisoryboard member for and holds ownership interest (including patents) in Syner-Gene Therapeutics, Inc. Z. Chen reports receiving other remuneration frommiRecule. C. VanWaes reports receiving other remuneration frommiRecule. Nopotential conflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design: A.D. Saleh, G.J. Childs, E.H. Chang, Z. Chen, C. VanWaesDevelopment of methodology: A.D. Saleh, H. Si, P. Ormanaglu, X. Yang,R. Das, M.B. Prystowsky, S.J.M. Jones, A. Rait, E.H. Chang, C. Van WaesAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A.D. Saleh, S.E. Martin, P. Ormanaglu, S. Carlson,P.E. Clavijo, S. Cornelius, D. Chepeha, T.M.Harris,M.B. Prystowsky, R.V. Smith,S.S Kim, K.F. Pirollo, Z. ChenAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): A.D. Saleh, H. Cheng, S.E. Martin, H. Si, P.E. Clavijo,R. Das, L. Danilova, T.M. Harris, A.G. Robertson, A.D. Cherniack, E.H. Chang,Z. Chen, C. Van Waes






Writing, review, and/or revision of the manuscript: A.D. Saleh, H. Cheng,D.B. Chepeha, M.B. Prystowsky, G. Robertson, A.D. Cherniack, E.H. Chang,Z. Chen, C. Van WaesAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S. Carlson, X. Yang, R. Das, J. Coupar,D. Chepeha, R.V. Smith, E.H. Chang, Z. ChenStudy supervision: Z. Chen, C. Van Waes

AcknowledgmentsThis study is supported byNIDCD intramural Project nos. ZIADC000016, 73

and 74 (to C. Van Waes), and Extramural grant NCI P30 CA006973

(to L. Danilova). Con miR-scL and miR-30a-scL were provided by SynerGeneTherapeutics. We thank Dr. Jianhong Chen and Clint Allen for reading of themanuscript.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received March 2, 2018; revised November 2, 2018; accepted January 24,2019; published first February 5, 2019.

References1. Stahlhut C, Slack FJ. MicroRNAs and the cancer phenotype: profiling,

signatures and clinical implications. Genome Med 2013;5:111.2. van Rooij E, Purcell AL, Levin AA. Developing microRNA therapeutics.

Circ Res 2012;110:496–507.3. Sethi N, Wright A, Wood H, Rabbitts P. MicroRNAs and head and neck

cancer: reviewing the first decade of research. Eur J Cancer 2014;50:2619–35.

4. Yan B, Li H, Yang X, Shao J, Jang M, Guan D, et al. Unraveling regulatoryprograms for NF-kappaB, p53 andmicroRNAs in head and neck squamouscell carcinoma. PLoS One 2013;8:e73656.

5. Yan B, Yang X, Lee TL, Friedman J, Tang J, Van Waes C, et al. Genome-wideidentification of novel expression signatures reveal distinct patterns andprevalence of binding motifs for p53, nuclear factor-kappaB and othersignal transcription factors in head and neck squamous cell carcinoma.Genome Biol 2007;8:R78.

6. Cancer Genome Atlas Network. Comprehensive genomic characterizationof head and neck squamous cell carcinomas. Nature 2015;517:576–82.

7. Hoadley KA, Yau C, Wolf DM, Cherniack AD, Tamborero D, Ng S, et al.Multiplatform analysis of 12 cancer types reveals molecular classificationwithin and across tissues of origin. Cell 2014;158:929–44.

8. Lindenbergh-van der Plas M, Martens-de Kemp SR, de Maaker M, vanWieringen WN, Ylstra B, Agami R, et al. Identification of lethal microRNAsspecific for head and neck cancer. Clin Cancer Res 2013;19:5647–57.

9. HogenEsch H, Nikitin AY. Challenges in pre-clinical testing of anti-cancerdrugs in cell culture and in animal models. J Control Release 2012;164:183–6.

10. Yang D, Sun Y, Hu L, Zheng H, Ji P, Pecot CV, et al. Integrated analysesidentify a master microRNA regulatory network for the mesenchymalsubtype in serous ovarian cancer. Cancer Cell 2013;23:186–99.

11. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seqdata with or without a reference genome. BMC Bioinformatics 2011;12:323.

12. Chung N, Zhang XD, Kreamer A, Locco L, Kuan PF, Bartz S, et al. Medianabsolute deviation to improve hit selection for genome-scale RNAi screens.J Biomol Screen 2008;13:149–58.

13. Yu W, Pirollo KF, Yu B, Rait A, Xiang L, Huang W, et al. Enhancedtransfection efficiency of a systemically delivered tumor-targeting immu-nolipoplex by inclusion of a pH-sensitive histidylated oligolysine peptide.Nucleic Acids Res 2004;32:e48.

14. Council NR.Guide for the care and use of laboratory animals.Washington,DC: The National Academies Press; 1996. p. 140.

15. Harris T, Jimenez L, Kawachi N, Fan JB, Chen J, Belbin T, et al. Low-levelexpression of miR-375 correlates with poor outcome and metastasis whilealtering the invasive properties of head and neck squamous cell carcino-mas. Am J Pathol 2012;180:917–28.

16. Therneau TM. A package for survival analysis in S, R package version 2.38;2015. Available from:http://CRAN.R-project.org/package¼survival.

17. VanWaes C, SurhDM, Chen Z, KirbyM, Rhim JS, Brager R, et al. Increase insuprabasilar integrin adhesion molecule expression in human epidermalneoplasms accompanies increased proliferation occurring with immortal-ization and tumor progression. Cancer Res 1995;55:5434–44.

18. Van Waes C, Allen CT, Citrin D, Gius D, Colevas AD, Harold NA, et al.Molecular and clinical responses in a pilot study of gefitinib with paclitaxeland radiation in locally advanced head-and-neck cancer. Int J Radiat OncolBiol Phys 2010;77:447–54.

19. Freudlsperger C, Burnett JR, Friedman JA, Kannabiran VR, Chen Z, VanWaes C. EGFR-PI3K-AKT-mTOR signaling in head and neck squamous cellcarcinomas: attractive targets for molecular-oriented therapy. Expert OpinTher Targets 2011;15:63–74.

20. Egloff AM, Grandis JR. Targeting epidermal growth factor receptor andSRC pathways in head and neck cancer. Semin Oncol 2008;35:286–97.

21. Mali SB. Review of STAT3 (Signal Transducers and Activators of Transcrip-tion) in head and neck cancer. Oral Oncol 2015;51:565–9.

22. Dong G, Chen Z, Li ZY, Yeh NT, Bancroft CC, Van Waes C. Hepatocytegrowth factor/scatter factor-induced activation of MEK and PI3K signalpathways contributes to expression of proangiogenic cytokines interleu-kin-8 and vascular endothelial growth factor in head and neck squamouscell carcinoma. Cancer Res 2001;61:5911–8.

23. Dong G, Lee TL, Yeh NT, Geoghegan J, Van Waes C, Chen Z. Metastaticsquamous cell carcinoma cells that overexpress c-Met exhibit enhancedangiogenesis factor expression, scattering and metastasis in response tohepatocyte growth factor. Oncogene 2004;23:6199–208.

24. Carey TE, Nair TS, Chern C, Liebert M, Grossman HB, Wolf GT,et al. Blood group antigens and integrins as biomarkers in head andneck cancer: is aberrant tyrosine phosphorylation the cause ofaltered alpha 6 beta 4 integrin expression? J Cell Biochem Suppl1993;17F:223–32.

25. Karbiener M, Neuhold C, Opriessnig P, Prokesch A, Bogner-Strauss JG,Scheideler M. MicroRNA-30c promotes human adipocyte differentiationand co-represses PAI-1 and ALK2. RNA Biol 2011;8:850–60.

26. Pirollo KF, Zon G, Rait A, Zhou Q, Yu W, Hogrefe R, et al. Tumor-targetingnanoimmunoliposome complex for short interfering RNA delivery.Hum Gene Ther 2006;17:117–24.

27. Pirollo KF, Chang EH. Targeted delivery of small interfering RNA:approaching effective cancer therapies. Cancer Res 2008;68:1247–50.

28. ChildsG, FazzariM,KungG, KawachiN, Brandwein-GenslerM,McLemoreM, et al. Low-level expression of microRNAs let-7d and miR-205 areprognostic markers of head and neck squamous cell carcinoma. Am JPathol 2009;174:736–45.

29. Kong KL, Kwong DL, Chan TH, Law SY, Chen L, Li Y, et al. MicroRNA-375inhibits tumour growth and metastasis in oesophageal squamous cellcarcinoma through repressing insulin-like growth factor 1 receptor. Gut2012;61:33–42.

30. Hui AB, Lenarduzzi M, Krushel T, Waldron L, Pintilie M, Shi W, et al.Comprehensive microRNA profiling for head and neck squamous cellcarcinomas. Clin Cancer Res 2010;16:1129–39.

31. Bourguignon LY, Earle C,Wong G, Spevak CC, Krueger K. Stem cell marker(Nanog) and Stat-3 signaling promote MicroRNA-21 expression andchemoresistance in hyaluronan/CD44-activated head and neck squamouscell carcinoma cells. Oncogene 2012;31:149–60.

32. Liu CJ, Tsai MM, Hung PS, Kao SY, Liu TY, Wu KJ, et al. miR-31 ablatesexpression of the HIF regulatory factor FIH to activate the HIF pathway inhead and neck carcinoma. Cancer Res 2010;70:1635–44.

33. Chen Z, Jin Y, Yu D,Wang A, Mahjabeen I, Wang C, et al. Down-regulationof the microRNA-99 family members in head and neck squamous cellcarcinoma. Oral Oncol 2012;48:686–91.

34. Tanaka S, Suto A, Ikeda K, Sanayama Y, Nakagomi D, Iwamoto T, et al.Alteration of circulating miRNAs in SSc: miR-30b regulates the expressionof PDGF receptor beta. Rheumatology 2013;52:1963–72.

Saleh et al.




http://CRAN.R-project.org/package=survival

http://CRAN.R-project.org/package=survival


35. Schmitz S, Kaminsky-Forrett MC, Henry S, Zanetta S, Geoffrois L, BompasE, et al. Phase II study of figitumumab in patients with recurrent and/ormetastatic squamous cell carcinoma of the head and neck: clinical activityand molecular response (GORTEC 2008–02). Ann Oncol 2012;23:2153–61.

36. Zhang E, Li Z, Xu Z, DuanW, SunC, Lu L. Frizzled2mediates themigrationand invasion of human oral squamous cell carcinoma cells through theregulation of the signal transducer and activator of transcription-3 signal-ing pathway. Oncol Rep 2015;34:3061–7.

37. Freytag J,Wilkins-Port CE,Higgins CE, Carlson JA, Noel A, Foidart JM, et al.PAI-1 regulates the invasive phenotype in human cutaneous squamous cellcarcinoma. J Oncol 2009;2009:963209.

38. He Y, Zeng Q, Drenning SD, Melhem MF, Tweardy DJ, Huang L, et al.Inhibition of human squamous cell carcinoma growth in vivo by epider-mal growth factor receptor antisense RNA transcribed from the U6 pro-moter. J Natl Cancer Inst 1998;90:1080–7.

39. Pectasides E, Rampias T, Sasaki C, Perisanidis C, Kouloulias V, Burtness B,et al. Markers of epithelial to mesenchymal transition in association withsurvival in head and neck squamous cell carcinoma (HNSCC). PLoS One2014;9:e94273.

40. Pavon MA, Arroyo-Solera I, Tellez-Gabriel M, Leon X, Viros D, LopezM, et al. Enhanced cell migration and apoptosis resistance mayunderlie the association between high SERPINE1 expression andpoor outcome in head and neck carcinoma patients. Oncotarget2015;6:29016–33.

41. YuG,Herazo-Maya JD,Nukui T, RomkesM, Parwani A, Juan-Guardela BM,et al. Matrix metalloproteinase-19 promotes metastatic behavior in vitroand is associated with increased mortality in non-small cell lung cancer.Am J Respir Crit Care Med 2014;190:780–90.

42. Zhang N, Wang X, Huo Q, Sun M, Cai C, Liu Z, et al. MicroRNA-30asuppresses breast tumor growth and metastasis by targeting metadherin.Oncogene 2014;33:3119–28.

43. Cheng CW, Wang HW, Chang CW, Chu HW, Chen CY, Yu JC, et al.MicroRNA-30a inhibits cell migration and invasion by downregulatingvimentin expression and is a potential prognostic marker in breast cancer.Breast Cancer Res Treat 2012;134:1081–93.

44. Joglekar MV, Patil D, Joglekar VM, Rao GV, Reddy DN, Mitnala S, et al. ThemiR-30 family microRNAs confer epithelial phenotype to human pancre-atic cells. Islets 2009;1:137–47.

45. Zhao JJ, Lin J, Zhu D, Wang X, Brooks D, Chen M, et al. miR-30–5pfunctions as a tumor suppressor and novel therapeutic tool by targetingthe oncogenic Wnt/beta-catenin/BCL9 pathway. Cancer Res 2014;74:1801–13.

46. Yu F, Deng H, Yao H, Liu Q, Su F, Song E. Mir-30 reductionmaintains self-renewal and inhibits apoptosis in breast tumor-initiating cells. Oncogene2010;29:4194–204.

47. Ouzounova M, Vuong T, Ancey PB, Ferrand M, Durand G, Le-Calvez KelmF, et al. MicroRNA miR-30 family regulates non-attachment growth ofbreast cancer cells. BMC Genomics 2013;14:139.

48. Kao CJ, Martiniez A, Shi XB, Yang J, Evans CP, Dobi A, et al. miR-30 as atumor suppressor connects EGF/Src signal to ERG and EMT. Oncogene2014;33:2495–503.

49. Liu L, Lin W, Zhang Q, Cao W, Liu Z. TGF-beta induces miR-30d down-regulation and podocyte injury through Smad2/3 and HDAC3-associatedtranscriptional repression. J Mol Med 2016;94:291–300.

50. Bockhorn J, Dalton R, Nwachukwu C, Huang S, Prat A, Yee K, et al.MicroRNA-30c inhibits human breast tumour chemotherapy resistanceby regulating TWF1 and IL-11. Nat Commun 2013;4:1393.






2019;25:2860-2873. Published OnlineFirst February 5, 2019.Clin Cancer Res Anthony D. Saleh, Hui Cheng, Scott E. Martin, et al. Nanomedicine in Head and Neck CancermiR-30-5p as a Tumor Suppressor and Potential Therapeutic Integrated Genomic and Functional microRNA Analysis Identifies

Updated version

10.1158/1078-0432.CCR-18-0716doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2019/02/08/1078-0432.CCR-18-0716.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/25/9/2860.full#ref-list-1

This article cites 48 articles, 9 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/25/9/2860To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-18-0716

http://clincancerres.aacrjournals.org/content/suppl/2019/02/08/1078-0432.CCR-18-0716.DC1

http://clincancerres.aacrjournals.org/content/25/9/2860.full#ref-list-1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/25/9/2860


Integrated Genomic and Functional microRNA Analysis ... · and clinical features. Contributing...

Documents

Transcript of Integrated Genomic and Functional microRNA Analysis ... · and clinical features. Contributing...