Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from...
Transcript of Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from...
![Page 1: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/1.jpg)
The world leader in serving science
Incorporating SeqStudio™ Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017
![Page 2: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/2.jpg)
2
• To study gene function • To target gene mutation • To target transgene addition for
heritable modification
• To label endogenous genes • Stable integration • For tissue & cell engineering to
produce novel functions
Key Applications for Genome Editing Research
Transgenic crop research
Gene therapy research
Stem cell research
Tissue disease research
Animal disease model research
![Page 3: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/3.jpg)
3
CRISPR/Cas Overview
Types of genomic changes possible: • Single nucleotide changes (SNPs) • Precise deletions and insertions • Imprecise deletions (for knock-outs) • Deletions at multiple loci
![Page 4: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/4.jpg)
4
Genome Editing Workflow & Thermo Fisher Products
Design Guide RNA
Transfect Cells
Determine Editing
Efficiency (Population)
Establish Single Cell
Clones
Screen Clones for
Edit
Characterize Successful
Edits
• GeneArt CRISPR Search and Design Tool
• GeneArt TALEN search and design tool
• Gibco Transfection Reagents
• Gibco Cell Growth media
• GeneArt CRISPR-Cas9 molecular tools
• GeneArt Enzymatic Cleavage Detection kit
• TOPO cloning & Sanger sequencing
• Sanger Sequencing & TIDE
• IonTorrent NGS Sequencing
• qPCR/dPCR
• Gibco Media • TOPO cloning & Sanger sequencing
• Sanger Sequencing + MVF
• IonTorrent NGS Targeted Sequencing
• qPCR/dPCR
• IonTorrent NGS Whole Genome Sequencing
• Any other phenotypic analyses
![Page 5: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/5.jpg)
5
• The new SeqStudio™ Genetic Analyzer provides an integrated experience to put you back in control of your lab life
• all-in-one cartridge for easy set up and reduced hands-on time
• with the flexibility for both sequencing and fragment analysis in a single run.
• cloud-based connectivity options for remote monitoring, data transfer and analysis.
• run time of as little as 1 hour with fast turnaround time
• Get an all-new, state of the art experience in an incredibly affordable package.
Experience the New SeqStudio™ Genetic Analyzer
![Page 6: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/6.jpg)
6
Thermo Fisher Scientific – Facilitating Genome Editing Designs
Pre-defined KO libraries Custom gRNA libraries (KI and others: gRNA per target)
Single targets or 96 well format Single targets or 96 well format
Custom GCD primer design
Identify the gene; place orders through the CRISPR/TAL design tool
Pre-designed GCD primer database
CRISPR cloud design-to-order tool
Proof-of Concept experiment – knockout mutations in HPRT gene • Designed guide RNA to human HPRT and other genes • Transfected HEK293 cells with gRNA and Cas9, grew primary culture. CE Sequenced to
determine efficiency of editing. • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out single HEK293 colonies, CE sequenced DNA from single colonies
![Page 7: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/7.jpg)
7
CRISPR Workflow with Sanger Sequencing – Primary Screen
Sequencing cultures or colonies with more than one sequence confirms edit, but difficult to confirm sequence of edit
![Page 8: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/8.jpg)
8
CRISPR Workflow with Sanger Sequencing – Primary Screen
Brinkman et al., Nucl. Acids Res. (2014)
![Page 9: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/9.jpg)
9
SeqStudio is compatible with TIDE software
HPRT Forward strand RELA Forward strand
HPRT Reverse strand RELA Reverse strand
Efficiency of editing: around 80% Efficiency of editing: around 20%
Mixed culture containing unpurified edited cells sequenced around site of edit
![Page 10: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/10.jpg)
10
SeqStudio results are equivalent to legacy platforms
RELA Forward - 3130
RELA Forward - 3500
RELA Forward - SeqStudio
HPRT Forward - 3130
HPRT Forward - 3500
HPRT Forward - SeqStudio
![Page 11: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/11.jpg)
11
CRISPR Workflow with Sanger Sequencing – Primary Screen
2.
4.
CRISPR/Guide
RNA Complex
1.
3.
5.
Transfect cells with editing complex Establish primary culture
Extract DNA from primary culture, PCR amplify locus and subclone
Extract DNA from individual subclones
Sanger sequence individual subclones
![Page 12: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/12.jpg)
12
SeqStudio sequencing data is equivalent to legacy platforms
SeqStudio traces
3130 traces
Data analyzed using Sanger QC application in the Thermo Fisher Cloud
![Page 13: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/13.jpg)
13
Examples of Edits in Primary Transformant Culture
GTAAACATTGAAGGGAGATGGAAGAAGGAACTCTAGCCAGAGTCTTGCATTTCTCAGTCCTAAACAGGGTAATGGACTGGGGCTGAATCACATGAAGGCAAGGTCAGATTTTTATTATTA
![Page 14: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/14.jpg)
14
CRISPR/Cas Workflow – Examples from Secondary Screen
Sequence is homogeneous and monoclonal
Sequence is heterogeneous and not derived from a single clone
![Page 15: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/15.jpg)
15
SNP Detection in a Secondary Clone
![Page 16: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/16.jpg)
16
Minor Variant Finder: a key innovation for detecting rare variants
Minor Variant Finder software: 1. Determines background peaks in control sample run concurrently with test sample 2. Compares and removes background peaks from the test sample 3. Looks for variants at identical position in forward and reverse sequencing reactions 4. Calculates area under the peak to determine allele frequency
![Page 17: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/17.jpg)
17
Conclusions
• Sanger sequencing by capillary electrophoresis can be used to determine efficiency of successful genome edits in primary transformation cultures.
• Sanger sequencing is an efficient method used to confirm successful genome edits in transformed cultures, as well as screening secondary clones for successful editing events.
• Minor variant finder software can be leveraged to determine frequency of SNP changes in clones isolated from secondary cultures
• Thermo Fisher Scientific has integrated the tools necessary for genome editing and downstream analysis
![Page 18: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out](https://reader035.fdocuments.in/reader035/viewer/2022071408/610140a20e03ed705a09e624/html5/thumbnails/18.jpg)
18
Namritha Ravinder, Ph.D and her team Kamini Varma, Ph.D
Acknowledgements
The GeneArt™ CRISPR design tool, Invitrogen™ reagents, Gibco™ reagents, and TOPO™ cloning kit described in this Presentation are for research use only. Not for use in diagnostic procedures. © 2016 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.