immune selection in vitro reveals human immunodeficiency virus-1 ...
Transcript of immune selection in vitro reveals human immunodeficiency virus-1 ...
![Page 1: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/1.jpg)
Lewis et al 1 Mapping Nef MHC-I downregulation with Immune Selection
1
2
3
IMMUNE SELECTION IN VITRO REVEALS HUMAN 4
IMMUNODEFICIENCY VIRUS-1 NEF SEQUENCE MOTIFS 5
IMPORTANT FOR ITS IMMUNE EVASION FUNCTION IN 6
VIVO 7
8
9
Martha J. Lewis#1,2, Patricia Lee 1,2, Hwee L. Ng 1,2,3, Otto O. Yang 1,2,3 10
11
12
1Department of Medicine, Division of Infectious Diseases; 2UCLA AIDS Institute; 3Department 13
of Microbiology, Immunology, and Medical Genetics, Geffen School of Medicine at UCLA, Los 14
Angeles, CA, USA. 90095. 15
16
#Corresponding author: 10833 LeConte Ave., CHS 37-121, Los Angeles, CA, 90095. 17
[email protected]. (310) 825-0205 (office); (310) 825-3632 (fax). 18
19
Running title (54 characters): Mapping Nef MHC-I downregulation with Immune Selection 20
Word count: abstract – 226; Text – 5,949 21
Key words: HIV-1, MHC Class I Genes, Cytotoxic T-Lymphocyte, Nef, molecular evolution22
Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.00878-12 JVI Accepts, published online ahead of print on 2 May 2012
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 2: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/2.jpg)
Lewis et al 2 Mapping Nef MHC-I downregulation with Immune Selection
ABSTRACT 23
Human Immunodeficiency Virus-1 (HIV-1) Nef downregulates Major Histocompatibility 24
Complex class I (MHC-I), impairing clearance of infected cells by CD8+ cytotoxic T 25
lymphocytes (CTLs). While sequence motifs mediating this function have been determined by 26
in vitro mutagenesis studies of laboratory adapted HIV-1 molecular clones, it is unclear whether 27
the highly variable Nef sequences of primary isolates in vivo rely on the same sequence motifs. 28
To address this issue, nef quasispecies from nine chronically HIV-1-infected persons were 29
examined for sequence evolution and altered MHC-I downregulatory function under Gag-30
specific CTL immune pressure in vitro. This selection resulted in decreased nef diversity and 31
strong purifying selection. Site-by-site analysis identified 13 codons undergoing purifying 32
selection, and one undergoing positive selection. Of the former, only 6 have been reported to 33
have roles in Nef function, including 4 associated with MHC-I downregulation. Functional 34
testing of naturally occurring in vivo polymorphisms at the 7 sites with no previously known 35
functional role revealed 3 mutations (A84D, Y135F and G140R) that ablated MHC-I 36
downregulation, and 3 (N52A, S169I, and V180E) that partially impaired MHC-I 37
downregulation. Globally, the CTL pressure in vitro selected functional Nef from the in vivo 38
quasispecies mixtures that predominately lacked MHC-I downregulatory function at baseline. 39
Overall, these data demonstrate that CTL pressure exerts a strong purifying selective pressure for 40
MHC-I downregulation and identifies novel functional motifs present in Nef sequences in vivo. 41
42
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 3: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/3.jpg)
Lewis et al 3 Mapping Nef MHC-I downregulation with Immune Selection
INTRODUCTION 43
The HIV-1/SIV accessory protein Nef, an abundantly expressed 27kDa myristoylated 44
protein, is not essential for viral replication but is central to pathogenesis (reviewed in (21, 48)). 45
This protein plays a key role in viral persistence and virulence. In humans, infection with Nef-46
defective HIV-1 has been associated with low-to-undetectable levels of viremia with vigorous 47
antiviral immunity and delayed disease progression (14, 18, 19, 31, 32, 34, 44). Similarly, 48
experimental infection of rhesus macaques with SIV in which Nef has been deleted 49
(SIV239Δnef) results in low-to-undetectable levels of viremia, asymptomatic infection, and 50
protection from subsequent challenge with wild type virus (17). This model system has been 51
considered the gold standard for a disease-attenuating vaccine model. 52
Although numerous functions have been attributed to Nef, the mechanisms whereby Nef 53
exerts these dramatic clinical effects appear to involve its ability to direct immune evasion. 54
While Nef initially was misunderstood as a negative transcriptional activator (2, 45), further 55
work has shown that it contributes to viral pathogenesis through multiple functions that enhance 56
viral infectivity, such as downregulation of CD4 on the surface of infected cells (24, 37) and 57
modulation of cellular activation (8, 9, 56, 58, 61). Furthermore, it is well established that Nef 58
downregulates Major Histocompatibility Complex class I (MHC-I) cell surface proteins (12, 13, 59
60). In vitro models demonstrate that Nef-mediated MHC-I downregulation impairs cytotoxic T 60
lymphocyte (CTL) recognition and clearance of infected cells (1, 13, 63, 68), suggesting that it 61
plays a central role in immune evasion. 62
In vivo evidence also suggests that this function is important for immune evasion. 63
Rhesus macaques infected with SIV containing Nef rendered specifically defective in MHC-I 64
downregulation function via difficult-to-revert mutations showed trends for higher CTL levels 65
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 4: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/4.jpg)
Lewis et al 4 Mapping Nef MHC-I downregulation with Immune Selection
and lower viremia in the first 14 weeks of infection followed by viral rebound accompanied by a 66
striking pattern of Nef evolution to reconstitute this function via new sequence motifs resembling 67
those in HIV-1 (62). In chronically HIV-1-infected humans, Nef has been shown to lose 68
function in persons with severely depressed cellular immunity due to very young age (25, 65) or 69
late stage AIDS (11, 33), and more specifically, its MHC-I downregulatory function correlates to 70
the breadth of the HIV-1-specific CTL response during chronic infection (40). These data 71
strongly suggest the importance of this function in the immunopathogenesis of infection by 72
reducing CTL clearance of virus-infected cells. Moreover, the variability of Nef function during 73
chronic infection suggests that it evolves to optimize its balance of different functions to 74
maximize viral persistence in the face of changing selective pressures in vivo (40). 75
Mutational studies of Nef in laboratory strains of HIV-1 have defined key amino acid 76
sites and functional domains involved in downmodulation of MHC-I (reviewed in (26, 47)). 77
However, the sequence of Nef is highly variable in primary isolates of HIV-1. It is likely that 78
Nef can adapt to downregulate MHC-I through altered or distinct motifs depending on its 79
sequence context, as seen in the SIV model (62). However, few studies have addressed the 80
ability of Nef from primary isolates of HIV-1 to downregulate MHC-I (46), and there is almost 81
no information about whether the functional motifs of primary isolates of Nef match those 82
identified by mutagenesis of laboratory adapted strains of HIV-1. 83
To address this issue, we investigated the interplay between the MHC-I downregulatory 84
function of primary isolate quasispecies Nef proteins and sequence evolution under 85
experimentally imposed selective pressure to evade Gag-specific CTLs. This selective pressure 86
caused a clear pattern of purifying selection coincident with the optimization of MHC-I 87
downregulation to allow viral persistence in the presence of CTL selective pressure. Sequence 88
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 5: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/5.jpg)
Lewis et al 5 Mapping Nef MHC-I downregulation with Immune Selection
analysis of this adaptive evolution identified key amino acid sites important for Nef-mediated 89
immune evasion in primary HIV-1 isolates, demonstrating the close reciprocal relationship 90
between Nef and CTL-mediated immunity in pathogenesis, and suggesting vulnerable regions 91
that could be targeted beneficially by vaccines or pharmacologic blockade. 92
93
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 6: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/6.jpg)
Lewis et al 6 Mapping Nef MHC-I downregulation with Immune Selection
MATERIALS AND METHODS 94
Isolation of plasma nef quasispecies and insertion into recombinant reporter viruses. The nef 95
gene was amplified from the plasma of 9 chronically HIV-1 infected subjects and cloned into an 96
NL4-3 based reporter virus as previously published (40). Briefly, cDNA was made from viral 97
RNA using the gene-specific primer Nef 9589R 5’ TAGTTAGCCAGAGAGCTCCCA. Then nef 98
was amplified using the following primers: Nef 9589R 5’ TAGTTAGCCAGAGAGCTCCCA, 99
Nef 8670F 5’AATGCCACAGCCATAGCAGTG, Nef 8675F 5’ 100
GCAGTAGCTGAGGGGACAGATAGG, Nef 8687F 5’ 101
GTAGCTCAAGGGACAGATAGGGTTA, Nef 8736F 5’ AGAGCTATTCGCCACATACC. A 102
nested PCR was performed with the following primers: Nef 8787 XbaIF 5’ 103
GCTCTAGAATGGGTGGCAAGTGCTCAA and Nef 9495R 5’ 104
TTATATGCAGCATCTGAGGGC. Following amplification overhanging A’s were added to the 105
ends of the PCR products then cloned in bulk by the TA method into pCR2.1-TOPO vector 106
(Invitrogen). Ligation mixtures were grown in liquid culture and not subject to individual colony 107
selection on solid media in order to preserve the quasispecies mixture of cloned PCR products. 108
Plasmid DNA was digested with XbaI and BspEI (New England Biolabs) and subsequently 109
subcloned into the nef position of the half-genome construct p83-10 (4). Ten μg of each half 110
genome plasmid, p83-10 with nef and the reporter p83-2-HSAxVpr (4), was digested with EcoRI 111
(New England Biolabs). Both plasmids electroporated into 10 million T1 (174 x CEM.T1) cells 112
(57) using a GenePulser Electroporator (BioRad). Recombinant reporter virus stocks were 113
collected in the supernatant 7-10 days after electroporation. Control viruses carrying the Nef 114
mutant M20A unable to downregulate MHC-I (3) or standard NL4-3 Nef were made in parallel. 115
116
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 7: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/7.jpg)
Lewis et al 7 Mapping Nef MHC-I downregulation with Immune Selection
In vitro immune selection. One million T1 (HLA-A*02-positive) lymphocytes (see above) were 117
infected with virus stock containing 12.5 ng of p24. This is equivalent to an MOI of 118
approximately 0.05-0.1 based on previous titers. After infecting for 4 hours at 37oC cells were 119
washed and split into two wells of 0.5 x 106 each. Then either 0.5ml of RPMI supplemented 120
with 10%FCS and 50 units/ml IL-2 (R10-50) or 0.5ml of R10-50 with an HLA-A*02-restricted 121
CTL clone specific for the p17 Gag epitope SL9 was added to the infected cells at an effector to 122
target ratio of 1:4. Culture supernatant was collected on days 5 and 7 post-infection and virus 123
growth was quantified by p24 antigen ELISA. These p24 levels were used to set up a second 124
round of infections again with 12.5ng of p24 and 1 x 106 fresh T1 cells, and selection was 125
performed as before with the same CTL clone. The first round virus cultured in the presence of 126
the CTL clone was again cultured with the clone, and as a control for genetic drift the viruses 127
cultured without CTL selection were also cultured again without CTL selection. Again, culture 128
supernatants containing the selected quasispecies were collected on day 5 and 7 post-infection 129
and quantified by p24 ELISA to confirm viral growth. 130
131
RNA isolation, RT-PCR and nef sequencing. Viral RNA was isolated from either the viral stock 132
(i.e. – the input virus) or culture supernatant after 2 rounds of culture with or without the CTL 133
clone. RNA was isolated using the QiaAMP Viral RNA Mini Kit (Qiagen) according to the 134
manufacturer’s protocol then used as a template for cDNA synthesis using SuperScript III 135
Reverse Transcriptase (Invitrogen) and the gene-specific primer Nef 9589R 5’ 136
TAGTTAGCCAGAGAGCTCCCA. The resulting cDNA was used as template for nef 137
amplification using the high fidelity polymerase Phusion (New England Biolabs) and the 138
following primers: Nef 8787 XbaIF 5’ GCTCTAGAATGGGTGGCAAGTGCTCAA and Nef 139
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 8: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/8.jpg)
Lewis et al 8 Mapping Nef MHC-I downregulation with Immune Selection
9495R 5’ TTATATGCAGCATCTGAGGGC. PCR reactions were carried out using the 140
following conditions: 5 min. at 980C, 35 cycles of 980C for 10s, 570C for 30s, 720C for 30s, 141
followed by a final extension at 720C for 10 min. A 20 minute incubation at 720C with standard 142
Taq polymerase (New England Biolabs) and dNTPs added the necessary overhanging A’s, and 143
PCR products which were then cloned in bulk by the TA method into pCR2.1-TOPO vector 144
(Invitrogen). A minimum of 10 nef clones per subject were selected for sequencing using the 145
standard vector primers M13F and M13R and the Big Dye Terminator Reaction Kit 3.1(Applied 146
Biosystems). Cycle sequencing products were run on an ABI3130 Genetic Analyzer (Applied 147
Biosystems). 148
Sequence analysis. Nucleotide sequences were translated into amino acid sequences and 149
manually edited using the program BioEdit then aligned along with NL4-3 and the Los Alamos 150
HIV-1 database Clade B Consensus nef using CLUSTAL X. A neighbor-joining tree was 151
constructed using the DNADist and Neighbor programs of PHYLIP 3.64 (22). The tree was 152
statistically evaluated with 1000 bootstrap replicates. The sequences were then divided into 3 153
separate populations - input, with CTL, and without CTL selection - for the subsequent analyses. 154
Sequence diversity within the quasispecies swarm and overall divergence from Clade B 155
consensus sequence were determined using the program SENDBS with the Hasegawa model + 156
gamma and standard errors estimated from 500 bootstrap replicates. Change in diversity and 157
divergence was calculated by taking the value for the “with CTL” population minus the value for 158
the “no CTL” population. Difference between control and selected sequences were evaluated 159
with a two-tailed t test. Divergent sequences were examined for G to A hypermutation using 160
Hypermut 2.0 from the LANL HIV-1 database tools. Sequences with non-intact reading frames 161
due to frame shift or non-sense mutations were counted and excluded prior to the analysis for 162
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 9: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/9.jpg)
Lewis et al 9 Mapping Nef MHC-I downregulation with Immune Selection
adaptive evolution. Difference in the number of sequences containing stop codons between 163
control and selected sequences was evaluated by a two-tailed Χ2 test. All of the following 164
analyses were performed using HyPhy (50). The program MODELTEST (52) was used to 165
determine the best fitting model for the data was HKY85. The global dN/dS ratio along with its 166
95% confidence intervals were estimated after building and optimizing the maximum likelihood 167
function for each of the three data sets. Individual amino acid positions with evidence of adaptive 168
evolution were identified by three separate methods, ancestor counting (SLAC), relative-effects 169
likelihood (REL), and fixed-effects likelihood (FEL). A site was considered to be adapting 170
under CTL selective pressure if that site was identified by at least 2 of 3 methods with a 171
significance level of at least 95% and was only identified in the dataset with CTL and not in the 172
without CTL dataset. Additionally, only those sites with a dN/dS significantly > and < 1 were 173
considered positive. Selected sites were highlighted on the composite crystal structure of Nef 174
kindly provided by Dr. Art F. Y. Poon (Vancouver, B.C., Canada) using the program RasMol 175
http://www.umass.edu/microbio/rasmol/. Conservation of the selected sites was determined by 176
compiling an amino acid alignment of all complete, non-recombinant Nef sequences submitted 177
to the LANL HIV-1 Sequence Database through 2010, N=2114 including genotypes A-K. The 178
probability of each amino acid at the selected sites was plotted using WebLogo3 (16). 179
Creation of Nef Mutants by Site-directed Mutagenesis. The 7 sites undergoing purifying 180
selection with no previously known association with Nef function were selected for site-directed 181
mutagenesis. The following 8 mutations were created individually within the NL4-3 based p83-182
10 plasmid using the appropriate primers and the QuikChange XL-II Kit (Stratagene): N52A, 183
N52S, A84D, Y135F, G140R, S169I, H171A, V180E. The amino acid changes selected were 184
based on mutations observed at these sites in the primary isolates, except H171A. All mutations 185
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 10: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/10.jpg)
Lewis et al 10 Mapping Nef MHC-I downregulation with Immune Selection
were confirmed by sequencing. Recombinant reporter viruses were created by co-186
electroporation with p83-2 HSAxvpr as detailed above. 187
Assessment of MHC I downregulation by Nef. Levels of HLA A*02 on the surface of cells 188
infected by Nef recombinant reporter viruses was performed as previously described (40). 189
Briefly, T1 cells were infected with either the input virus stock or the supernatant containing the 190
quasispecies surviving after 2 rounds of CTL selection. All 9 input viruses were tested, and 5 of 191
9 samples after 2 rounds of culture with CTL yielded adequate samples for testing. Similarly, T1 192
cells were also infected with the 8 Nef mutants. On day 5 post-infection cells were stained with 193
FITC-anti-murine CD24 (HSA) (BD) to detect reporter positive infected cells and PE-anti-194
human HLA A*02 (ProImmune). At least 2x104 live cells were counted using a FACScan flow 195
cytometer, and data were analyzed using CellQuest software (Becton Dickinson). Maximum 196
levels of HLA A*02 were determined using the Mean Fluorescent Intensity (MFI) of the M20A 197
Nef mutant which is defective in MHC-I downregulation or Delta Nef virus. Percent HLA A*02 198
down-regulation was calculated using the MFI of M20ANef-infected cells as maximum and the 199
MFI of isotype stained cells as minimum. Infections and flow measurements were repeated at 200
least 3 times, except for the passafed viruses for which only one sample was available. A two-201
tailed t test was used to determine differences between NL4-3 and mutant viruses. 202
203
Sequence Accession numbers: available upon acceptance of manuscript.204
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 11: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/11.jpg)
Lewis et al 11 Mapping Nef MHC-I downregulation with Immune Selection
RESULTS 205
Isolation of in vivo HIV-1 nef quasispecies. 206
As previously described (40), full length nef sequences were isolated from plasma of nine 207
persons with chronic, untreated HIV-1 infection. All subjects had detectable viremia ranging 208
from 400 to >750,000 RNA copies/ml and peripheral blood CD4+ T lymphocyte counts ranging 209
from 0 to 900 cells/mm3 (data not shown). The bulk nef quasispecies from each subject (“input 210
sequences”) were cloned into a replication-competent NL4-3-based reporter virus for subsequent 211
selection experiments. 212
Genetic evolution of primary nef quasispecies under experimental selection by Gag-specific 213
CTLs. 214
The influence on Nef of immune pressure against HIV-1 was assessed by subjecting the 215
recombinant viruses to experimental selection by HIV-1 Gag-specific CTLs. The recombinant 216
viruses containing primary nef quasispecies were cultured either alone as a control for random 217
genetic drift (“control”), or in combination with CTLs recognizing the Gag epitope 218
SLYNTVATL (“selected”) for two passages of seven days each, followed by clonal nef sequence 219
analysis of the resulting viruses. These control and selected sequences were aligned with the 220
input nef sequences (n=231) to create a neighbor-joining phylogenetic tree that was statistically 221
evaluated with 1000 bootstrap replicates (Figure 1). Sequences from each subject clustered 222
independently (>99% bootstrap support) with the exception of Subjects 00035 and 00039, who 223
previously were identified to have related viruses suggesting a common infection source (40). A 224
few highly divergent sequences were observed in the control quasispecies of subjects 00034, 225
00039, and 00041, although only the sequence from 00034 had evidence of G-to-A 226
hypermutation (p=0.02). Generally, however, the persisting nef sequences after immune 227
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 12: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/12.jpg)
Lewis et al 12 Mapping Nef MHC-I downregulation with Immune Selection
selection were intermingled with the input and control sequences. The CTL-selected sequences 228
formed phylogenetically distinct clusters (bootstrap values >70%) in two of nine subjects (00022 229
and 00034). In both of these cases these sequences converged towards the Clade B consensus 230
sequence, suggesting evolution towards a more fit sequence. 231
Increased maintenance of the nef reading frame as a result of CTL selection. 232
The nucleotide alignments were translated into amino acid sequences to examine the 233
status of the reading frame (Figure 2A). At baseline, 6.5% (7/107) of input sequences from 234
plasma contained non-sense mutations including both premature stop codons and frame-shift 235
mutations. The control passaged population cultured without CTL exhibited an increase to a 236
non-sense mutations frequency of 14.8% (12/81), consistent with genetic drift in a setting where 237
changes in Nef have little or no fitness cost, i.e. in vitro culture in immortalized T cells (29). In 238
contrast, the CTL-selected quasispecies had a significantly lower than expected non-sense 239
mutation frequency of 4.9% (4/81) (Χ2 p=0.0351). Overall, the increase in reading frame 240
preservation with CTL selection versus decrease in the absence of CTLs suggest that CTLs exert 241
selective pressure on Nef to increase viral persistence. 242
Reduced diversity of primary nef quasispecies after CTL selection. 243
The change of variability within the nef quasispecies population in response to immune 244
selective pressure was assessed for each subject individually and across all subjects by 245
calculating changes in diversity and divergence from the Clade B consensus sequence in the 246
absence and presence of selection by the Gag-specific CTLs. As mentioned above, the 247
quasispecies from subjects 00022 and 00034 with immune selection clearly converged on the 248
Clade B consensus sequence (Figure 1). For all other subjects, whether analyzed individually or 249
grouped, there was no significant change in sequence divergence with immune selection (data 250
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 13: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/13.jpg)
Lewis et al 13 Mapping Nef MHC-I downregulation with Immune Selection
not shown). However, for 4 of 9 subjects there was a significant (t test p<0.05) decrease in the 251
diversity of the quasispecies after CTL selection (Figure 2B and C). The decrease in diversity 252
and the convergence toward the consensus sequence in the presence of CTL suggest that CTL 253
selection places constraints on evolution of the nef reading frame. 254
Global adaptive evolution of nef for viral persistence in the setting of CTL immune 255
selective pressure. 256
The subset of nef sequences with intact reading frames was codon-aligned and used to 257
calculate the ratio of the rate of non-synonymous to synonymous changes (dN/dS) for the entire 258
coding region for each of three sequence groups: input plasma sequences (n= 94), CTL selected 259
sequences (n=71) and control passaged sequences (n= 67) (Figure 3A). The dN/dS ratio of the 260
input plasma nef sequences demonstrated purifying selection at baseline in vivo (dN/dS = 0.59, 261
95% CI 0.53-0.65), similar to previously reported data (39). Control sequences passaged without 262
CTL selection had a similar ratio to the input sequences (dN/dS = 0.61, 95% CI 0.56-0.68). 263
However, the CTL-selected nef sequences had significantly greater purifying selection (dN/dS = 264
0.47, 95% CI 0.42-0.53) compared to control sequences as demonstrated by the non-overalpping 265
95% CIs of the control and selected dN/dS estimates. These results demonstrate that CTLs 266
exerted selective pressure for maintenance of Nef through a functional constraint. 267
Amino acids in Nef undergoing selection lie in important functional domains. 268
To identify key sites within Nef that were undergoing selection, dN/dS ratios were 269
calculated for each codon using ancestor counting (SLAC), relative-effects likelihood (REL), 270
and fixed-effects likelihood (FEL) methods (50). Codons were considered to be under 271
significant selection if they reached p <0.05 by at least two of these three methods for the CTL 272
selection and not the control sequences. Site-by-site analysis identified 13 sites subject to 273
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 14: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/14.jpg)
Lewis et al 14 Mapping Nef MHC-I downregulation with Immune Selection
purifying selection and 1 site undergoing positive selection (Figure 3B and Table 1). Of these 14 274
sites, 7 were previously reported to be associated with motifs important for Nef function, of 275
which 5 were linked specifically to MHC-I downregulation (Table 1). 276
The identified sites are located in key domains of Nef (Figure 4A), such as the N-terminal 277
α-helix (E18) and unstructured loops that bind cellular proteins (E62, L164, and D175) (27, 38). 278
Notably, site E62 lies within the EEEE acidic domain and site V74 lies at the “φ” position within 279
the PxφP motif, and both motifs are known to be required for MHC-I downregulation, although 280
V74 has not been tested specifically for its effect on downregulation independently of the 281
prolines (43, 49, 56, 67). Site D123 is required for dimerization of Nef and therefore all its 282
functions (7, 41, 67), including MHC-I downregulation. Site E18 is the “X” within the RXR 283
motif important for β-COP binding and necessary for maximal MHC-I downregulation, although 284
previously only the arginines within this motif specifically have been tested (59, 67). Site L164 285
lies within the dileucine motif required for CD4 downregulation by Nef and is also important for 286
infectivity and replication in PBMCs (15, 26, 54). Sites V74, A83, and D175 lie within motifs 287
implicated in modulation of cell signaling pathways by Nef (20). While site S169 has no 288
previously identified role in Nef function, a recent analysis showed that this site is co-evolving 289
with N157 and therefore likely to have some functional role (51). The remaining six other sites 290
under purifying selection (N52, A84, Y135, G140, H171, and V180) have no previously defined 291
associations with known functions of Nef. 292
CTL selected sites in Nef are highly conserved in primary isolates of all HIV-1 genotypes. 293
To determine whether these selected sites in the cohort tested here are broadly important 294
to Nef in general all complete Nef sequences in the Los Alamos National Laboratory (LANL) 295
HIV-1 Sequence Database were examined for amino acid sequence conservation at these sites. 296
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 15: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/15.jpg)
Lewis et al 15 Mapping Nef MHC-I downregulation with Immune Selection
A total of 2114 complete, non-recombinant Nef sequences representing genotypes A-K 297
submitted through 2010 were aligned and translated into amino acid sequences. The probability 298
of each amino acid at each of the 13 sites under purifying selection was plotted (Figure 4B). At 299
11 of the 13 sites there was >90% conservation of the amino acid with only Y135 and S169 300
showing significant variability. There was virtually 100% conservation of 7 of 13 sites (V74, 301
A84, D123, G140, L164, H171, and D175) of which, A84, G140, and H171 have no previous 302
association with Nef function. By comparison, the LANL Nef sequences were also examined for 303
conservation at other sites previously known to be associated with MHC-I downregulation: R17, 304
R19, M20, E(62-65), P72, P75, and P78 (Figure 4C). There was less conservation of these sites 305
relative to the 13 selected sites, with only the 3 prolines demonstrating near 100% conservation, 306
and R17, R19 and E62 showing >90% conservation (60 vs. 85% showing >90% conservation 307
and 30 vs. 54% with near 100% conservation). There was significant variability at E(63-65) and 308
significant numbers of M20I and M20L isolates of unknown functional significance. These 309
results highlight the amino acid residues of primary Nef isolates that are associated with a 310
survival advantage, confirm previously-identified motifs and suggest novel residues that are 311
important for Nef structure/function in the context of CTL pressure. 312
Functional testing of Nef polymorphisms at CTL selected sites. 313
In order to determine whether any of the newly identified sites under purifying selection 314
affected Nef’s ability to downregulate MHC-I a panel of mutants was created. Site-directed 315
mutagenesis of NL4-3 Nef was used to incorporate the following polymorphisms, all observed in 316
one or more of the primary plasma sequences and removed by CTL purifying selection (except 317
H171A): N52A, N52S, A84D, Y135F, G140R, S169I, H171A, and V180E. Cells infected with 318
recombinant reporter viruses with these Nef polymorphisms were assessed for levels of MHC-I 319
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 16: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/16.jpg)
Lewis et al 16 Mapping Nef MHC-I downregulation with Immune Selection
downregulation compared to control viruses (Figure 5). Six of 8 mutants had significant 320
reductions in MHC-I downregulation compared to “wild type” NL4-3 Nef (Figure 5A). Nef 321
with G140R had complete loss of function, and Nef with A84D had a phenotype comparable to 322
Nef with M20A, a mutant known to be deficient in MHC-I downregulation (3) (Figure 5A and 323
B). Nef with Y135F had an intermediate phenotype, about 50% the function of NL4-3 Nef, 324
while Nef with N52A, S169I, or V180E had significant although more modest reductions to 325
approximately 80% the level of NL4-3 Nef. Polymorphisms N52S and H171A had no affect on 326
Nef function. These data show that the Nef polymorphisms removed from the quasispecies by 327
CTL purifying selection are associated with deficiencies in MHC-I downregulation. 328
Gag-specific CTLs select for MHC-I downregulatory function within primary Nef 329
quasispecies. 330
Because Nef-mediated downregulation of MHC-I is known to reduce the susceptibility of 331
HIV-1-infected cells to CTLs, the primary nef quasispecies were tested for this function both 332
before and after selection with the Gag-specific CTLs (Figure 6). Cells infected with 333
recombinant reporter viruses carrying the nef quasispecies were assessed for MHC-I 334
downregulation in comparison to viruses containing NL4-3 Nef (“wild type”) and M20A Nef 335
(Figure 6A). Infection with virus carrying NL4-3 Nef downregulated A*02 by about 80%, and 336
this level of function was unchanged after after passaging this virus in the presence of CTLs. 337
Similarly, virus with nef quasispecies from Subject 00021 was functional at baseline and after 338
selection. However, Subjects 00030 and 00034 had Nef quasispecies with partial function at 339
baseline, which increased to full function after selection. Most strikingly, Nef from Subjects 340
00022 and 00037 (both with late stage untreated AIDS and minimal CTL responses in vivo) had 341
no ability to downregulate MHC-I at baseline, but CTL pressure selected functional populations 342
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 17: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/17.jpg)
Lewis et al 17 Mapping Nef MHC-I downregulation with Immune Selection
of Nef (Figure 5B). Except for subject 00021, the baseline plasma quasispecies of all subjects 343
had amino acid polymorphisms at the sites identified in this analysis that would predict impaired 344
function, and viruses with these polymorphisms were not present after selection (Table II). 345
Quasispecies sequences were also examined for mutations at other sites previously known to be 346
important for Nef MHC-I downregulation since these would also likely impair baseline function 347
(Table II). Although we were not able to test selected viruses from all subjects, we previously 348
reported partial impairment of Nef-mediated MHC-I downregulation by the baseline plasma Nef 349
quasispecies of all subjects included in this study, with the exception of subject 21 (40). Thus 350
the presence of these mutations was associated with impaired function of the quasispecies, while 351
reconstitution of function was associated with loss of these polymorphisms from the 352
quasispecies. These data indicate that the sites identified by CTL selection play an important 353
role in Nef-mediated MHC-I downregulation and consequent immune evasion and provide a 354
functional context for the sequence evolution of nef under CTL selection in vivo. 355
356
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 18: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/18.jpg)
Lewis et al 18 Mapping Nef MHC-I downregulation with Immune Selection
DISCUSSION 357
Human and animal model data suggest that Nef-mediated MHC-I downregulation plays a 358
key role in pathogenesis through promoting viral persistence in the presence of a vigorous CTL 359
response. We previously reported an in vivo correlation between the breadth of the HIV-1-360
specific CTL response and the capacity of circulating Nef quasispecies to downregulate MHC-I 361
(40). Furthermore, it has been demonstrated with a laboratory strain of HIV-1 that CTLs exert 362
selective pressure to maintain functional Nef (3, 5). The preservation of Nef-mediated MHC-I 363
downregulation in the presence of CTL and its loss in the absence of strong CTL selection is also 364
consistent with the observation of predominately defective Nef in neonates (25, 65) and persons 365
with late stage AIDS and strong pressure to maintain Nef-mediated MHC-I downregulation in 366
SIV-infected macaques (11, 33, 62). Here we demonstrate a selective advantage for primary in 367
vivo Nef quasispecies that can downregulate MHC-I that correlates with the presence of both 368
known and novel amino acid residues important for this function. 369
Examination of nef quasispecies sequence evolution across subjects due to immune 370
selection by Gag-specific CTLs pinpointed 13 sites where key amino acid residues are involved 371
in the optimization of Nef-mediated immune. Examination of more than 2000 Nef sequences in 372
the LANL HIV-1 Database revealed >90% conservation of the amino acid sequence at 11 of 373
these 13 selected sites, with near 100% conservation at 7 sites. This analysis also confirmed 374
several sites that were identified previously through point mutagenesis studies of laboratory 375
adapted HIV-1 nef sequences to be involved in multiple Nef functions. These included residues 376
in the motifs important for dimerization (41), MHC-I downregulation (43, 49, 67), trafficking via 377
Adaptor Proteins and β-COP binding (59, 67) , and enhancement of viral replication through cell 378
signaling (20). 379
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 19: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/19.jpg)
Lewis et al 19 Mapping Nef MHC-I downregulation with Immune Selection
Additionally, 7 amino acid sites were identified as experiencing strong purifying 380
selection by CTL pressure and previously had no known role in Nef function. Mutations at 6 of 381
these sites, reflecting polymorphisms in vivo, resulted in significant impairment of Nef-mediated 382
MHC-I downregulation. Two sites in particular, A84 and G140, were both virtually 100% 383
conserved across all genotypes and resulted in complete or near complete loss of MHC-I 384
downregulation when mutated. Although H171 was similarly 100% conserved, mutation at this 385
site to an alanine had no affect on this Nef function. However, H171A was not among the 386
observed polymorphisms at this site in vivo (i.e.- H171 N, P, and G), and perhaps testing these 387
may yield a different result. The MHC-I downregulation function by Nef with N52A, S169I, and 388
V180E was only modestly affected suggesting either that these mutations may work 389
cooperatively with other mutations to have a more crippling effect, or that they represent trade-390
offs to optimize other Nef functions. A recent analysis has shown that site S169 co-evolves with 391
N157 (51), perhaps hinting that these sites may contribute to Nef function cooperatively. The 392
exact mechanism whereby these mutations affect Nef function, how they interact with other 393
sites, and whether they affect other Nef functions such as CD4 downregulation are not known 394
but are currently being investigated. 395
It is also important to note that the 3’ portion of nef overlaps with the U3 region of the 396
3’LTR, and consequently this region is potentially subject to additional LTR-related constraints 397
(36). However, the critical domains including binding sites for NF- κB and Sp1, and the 398
TATAA box are all downstream of the region of nef overlap. Five selected sites with no 399
previously identified Nef function (Y135, G140, S169, H171, V180) lie within this overlapping 400
LTR region. Although it is possible that these sites may be under strong purifying selection due 401
to an LTR-associated function, the sites we identified were specific for CTL selection (i.e. not 402
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 20: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/20.jpg)
Lewis et al 20 Mapping Nef MHC-I downregulation with Immune Selection
identified in both selected and control sequences), and Nef polymorphisms at 4 of these sites had 403
significant impairment of MHC-I downregulation making selection due to an LTR function alone 404
unlikely. 405
The important functional role played by these selected sites is clearly demonstrated by 406
the reconstitution of MHC-I downregulation after CTL-mediated purifying selection by removed 407
these mutants from the quasispecies population. Except for subject 00021 Nef, which functioned 408
at “wild-type” levels at baseline, plasma quasispecies of all subjects contained amino acid 409
polymorphisms at the sites of purifying selection that would predict impaired function that 410
subsequently were not present after selection. The most dramatic examples of functional 411
reconstitution were the plasma Nefs of Subjects 00022 and 00037, who had late stage AIDS and 412
minimal or undetectable HIV-1-specific CTL responses ((40) and data not shown), consistent 413
with prior reports of loss of MHC-I downregulation in vivo in the absence of any CTL selective 414
pressure in persons with AIDS (11, 33). Experimental selection by Gag-specific CTLs enriched 415
for nef alleles with the capacity to downregulate MHC-I, suggesting a strong selective advantage 416
for reconstituting this function of Nef in the presence of an active CTL response. The distinct 417
phylogenetic clustering of CTL-selected nef genes from Subject 00022 indicated overgrowth 418
from a small subset of clones from within the baseline quasispecies population, and the 419
convergence of these sequences (as well as those of Subject 00034) towards the clade B 420
consensus sequence indicated evolution towards the most generally optimal sequence. 421
While MHC-I downregulation is likely to be the main mechanism by which Nef 422
promotes HIV-1 survival under selection by CTLs, it is important to note that Nef is a poly-423
functional protein with numerous effects on infected cells, including CD4 downregulation and 424
cellular activation. Our data do not exclude other functions that may be important for viral 425
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 21: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/21.jpg)
Lewis et al 21 Mapping Nef MHC-I downregulation with Immune Selection
persistence in the face of CTL pressure. Some functions are likely to be separable due to distinct 426
locations of important functional residues, while others may be inter-related (43). Several of the 427
functionally important areas identified here and in other studies, such as the acidic domain, PxφP 428
motif, and dileucine motif, lie in unstructured flexible loops of the protein (23, 38). This may 429
allow Nef to have functional flexibility to evolve and optimize different functions or 430
combinations of functions in response to different environmental constraints. It is unexpected to 431
see that L164 of the dileucine motif critical for CD4 downregulation by Nef was identified as a 432
residue under strong purifying selection for viral persistence under CTL pressure. It may be that 433
the function of this motif to bind Adaptor Proteins is important for both MHC-I and CD4 434
downregulation, but more essential for the latter. It is also possible that other functions 435
associated with this amino acid residue such as enhancement of infectivity and replication may 436
have played a role is its selection under CTL pressure. 437
Because Nef is an attractive target for pharmacologic or immunologic inhibition in vivo, 438
examining primary isolate Nef proteins for crucial functional sites that could serve as therapeutic 439
targets is important. Mathematical modeling has predicted that blocking MHC-I downregulation 440
by Nef has the potential to decrease viremia in chronically infected individuals by up to 2.4 logs 441
by reducing Nef-mediated evasion of CTLs (66), and thus inhibition of this function of Nef could 442
be an effective therapeutic approach. Small molecule inhibitors of Nef have been considered for 443
this purpose (53, 55). Alternatively, an appropriately directed vaccine response could achieve 444
this goal by putting immune pressure directly on Nef (3). Of note, two of the six vaccine-445
induced epitopes that predicted efficacy of vaccination in reducing set-point viremia in the 446
HVTN 502 (STEP) trial were the Nef epitopes B*57-restricted HW9 (HTQGYFPDW, Nef 116-447
124) and A*02-restricted LV10 (LTFGWCFKLV, Nef 137-146) (10). These epitopes contain 448
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 22: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/22.jpg)
Lewis et al 22 Mapping Nef MHC-I downregulation with Immune Selection
the D123 and G140 sites we identified to be under selective pressure. While D123 is known to 449
be important for Nef dimerization and both CD4 and MHC-I downregulation (41), G140 was not 450
previously known to have an important functional role but now we demonstrate that mutation at 451
this site critically impairs MHC-I downregulation. Thus, examining primary isolate sequences 452
may be important for identifying sites in Nef that are most relevant for its role in immune 453
evasion, and for which pharmacologic or immunologic targeting may be most effective due to 454
strict functional constraints. 455
Prior reports have demonstrated that direct CTL targeting of Nef yields positive selective 456
pressure that leads to loss of function (5, 35, 64, 69), complementing our finding of purifying 457
selection and reconstitution of Nef function in the setting of CTLs targeting Gag and not Nef 458
directly. While the evolution of Nef and other HIV-1 proteins in vivo appears to be dominated 459
overall by purifying selection reflecting strong functional constraints (39), there is clear positive 460
selective pressure exerted by direct CTL targeting of Nef. This has been demonstrated 461
experimentally; in vitro selection of laboratory adapted HIV-1 strains with Nef-specific CTL 462
clones resulted in a dramatic pattern of point mutations, deletions, and non-sense mutations due 463
to lack of fitness cost for Nef deletion in vitro (6, 69). Subsequently, these selected laboratory 464
strain viruses deficient in functional Nef were demonstrated to become more susceptible to non-465
Nef-specific CTLs (6, 64). It was further shown that simultaneous addition of Gag-specific 466
CTLs placed a functional constraint on viral escape from Nef-specific CTLs by Nef mutation (5). 467
Our data confirm and extend these findings with more relevant primary isolate Nef alleles, and 468
suggest that these principles may apply for therapeutic interventions in vivo. 469
In summary, these results highlight the close reciprocal relationship between the host 470
CTL immune response and Nef function. Nef quasispecies under CTL selection display a pattern 471
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 23: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/23.jpg)
Lewis et al 23 Mapping Nef MHC-I downregulation with Immune Selection
of strong purifying selection associated with optimization of MHC-I downregulation. Studying 472
circulating primary isolate Nef alleles revealed novel amino acid residues that are directly 473
important for HIV-1 persistence under immune pressure by the host CTL response. Better 474
defining functional sites within circulating plasma Nef quasispecies will be useful for the design 475
of pharmacologic or immunotherapeutic agents targeting functionally crucial regions of Nef 476
capable of disabling its ability to direct immune evasion. 477
478
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 24: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/24.jpg)
Lewis et al 24 Mapping Nef MHC-I downregulation with Immune Selection
ACKNOWLEDGMENTS 479
480
This work was supported by NIH AI068449 (MJL), AI083083 (MJL), and AI051970 (OOY). 481
Interleukin-2 was provided by the NIH AIDS Reagent Repository. We wish to thank Ms. Mabel 482
Ching Yee Chan for her technical assistance. 483
484
485
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 25: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/25.jpg)
Lewis et al 25 Mapping Nef MHC-I downregulation with Immune Selection
REFERENCES 486
1. Adnan, S., A. Balamurugan, A. Trocha, M. S. Bennett, H. L. Ng, A. Ali, C. Brander, 487
and O. O. Yang. 2006. Nef interference with HIV-1-specific CTL antiviral activity is 488
epitope specific. Blood 108:3414-9. 489
2. Ahmad, N., and S. Venkatesan. 1988. Nef protein of HIV-1 is a transcriptional 490
repressor of HIV-1 LTR. Science 241:1481-5. 491
3. Akari, H., S. Arold, T. Fukumori, T. Okazaki, K. Strebel, and A. Adachi. 2000. Nef-492
induced major histocompatibility complex class I down-regulation is functionally 493
dissociated from its virion incorporation, enhancement of viral infectivity, and CD4 494
down-regulation. J Virol 74:2907-12. 495
4. Ali, A., B. D. Jamieson, and O. O. Yang. 2003. Half-genome human immunodeficiency 496
virus type 1 constructs for rapid production of reporter viruses. J Virol Methods 110:137-497
42. 498
5. Ali, A., H. L. Ng, M. D. Dagarag, and O. O. Yang. 2005. Evasion of cytotoxic T 499
lymphocytes is a functional constraint maintaining HIV-1 Nef expression. Eur J Immunol 500
35:3221-8. 501
6. Ali, A., S. Pillai, H. Ng, R. Lubong, D. D. Richman, B. D. Jamieson, Y. Ding, M. J. 502
McElrath, J. C. Guatelli, and O. O. Yang. 2003. Broadly increased sensitivity to 503
cytotoxic T lymphocytes resulting from Nef epitope escape mutations. J Immunol 504
171:3999-4005. 505
7. Arold, S., F. Hoh, S. Domergue, C. Birck, M. A. Delsuc, M. Jullien, and C. Dumas. 506
2000. Characterization and molecular basis of the oligomeric structure of HIV-1 nef 507
protein. Protein Sci 9:1137-48. 508
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 26: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/26.jpg)
Lewis et al 26 Mapping Nef MHC-I downregulation with Immune Selection
8. Baur, A. S., E. T. Sawai, P. Dazin, W. J. Fantl, C. Cheng-Mayer, and B. M. Peterlin. 509
1994. HIV-1 Nef leads to inhibition or activation of T cells depending on its intracellular 510
localization. Immunity 1:373-84. 511
9. Bodeus, M., A. Marie-Cardine, C. Bougeret, F. Ramos-Morales, and R. Benarous. 512
1995. In vitro binding and phosphorylation of human immunodeficiency virus type 1 Nef 513
protein by serine/threonine protein kinase. J Gen Virol 76:1337-44. 514
10. Brumme, Z. L., M. John, J. M. Carlson, C. J. Brumme, D. Chan, M. A. Brockman, 515
L. C. Swenson, I. Tao, S. Szeto, P. Rosato, J. Sela, C. M. Kadie, N. Frahm, C. 516
Brander, D. W. Haas, S. A. Riddler, R. Haubrich, B. D. Walker, P. R. Harrigan, D. 517
Heckerman, and S. Mallal. 2009. HLA-associated immune escape pathways in HIV-1 518
subtype B Gag, Pol and Nef proteins. PLoS One 4:e6687. 519
11. Carl, S., T. C. Greenough, M. Krumbiegel, M. Greenberg, J. Skowronski, J. L. 520
Sullivan, and F. Kirchhoff. 2001. Modulation of different human immunodeficiency 521
virus type 1 Nef functions during progression to AIDS. J Virol 75:3657-65. 522
12. Cohen, G. B., R. T. Gandhi, D. M. Davis, O. Mandelboim, B. K. Chen, J. L. 523
Strominger, and D. Baltimore. 1999. The selective downregulation of class I major 524
histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells. 525
Immunity 10:661-71. 526
13. Collins, K. L., B. K. Chen, S. A. Kalams, B. D. Walker, and D. Baltimore. 1998. 527
HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T 528
lymphocytes. Nature 391:397-401. 529
14. Couillin, I., B. Culmann-Penciolelli, E. Gomard, J. Choppin, J. P. Levy, J. G. 530
Guillet, and S. Saragosti. 1994. Impaired cytotoxic T lymphocyte recognition due to 531
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 27: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/27.jpg)
Lewis et al 27 Mapping Nef MHC-I downregulation with Immune Selection
genetic variations in the main immunogenic region of the human immunodeficiency virus 532
1 NEF protein. J Exp Med 180:1129-34. 533
15. Craig, H. M., M. W. Pandori, and J. C. Guatelli. 1998. Interaction of HIV-1 Nef with 534
the cellular dileucine-based sorting pathway is required for CD4 down-regulation and 535
optimal viral infectivity. Proc Natl Acad Sci U S A 95:11229-34. 536
16. Crooks, G. E., G. Hon, J. M. Chandonia, and S. E. Brenner. 2004. WebLogo: a 537
sequence logo generator. Genome Res 14:1188-90. 538
17. Daniel, M. D., F. Kirchhoff, S. C. Czajak, P. K. Sehgal, and R. C. Desrosiers. 1992. 539
Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 540
258:1938-41. 541
18. Deacon, N. J., A. Tsykin, A. Solomon, K. Smith, M. Ludford-Menting, D. J. Hooker, 542
D. A. McPhee, A. L. Greenway, A. Ellett, C. Chatfield, V. A. Lawson, S. Crowe, A. 543
Maerz, S. Sonza, J. Learmont, J. S. Sullivan, A. Cunningham, D. Dwyer, D. Dowton, 544
and J. Mills. 1995. Genomic structure of an attenuated quasi species of HIV-1 from a 545
blood transfusion donor and recipients. Science 270:988-91. 546
19. Dyer, W. B., A. F. Geczy, S. J. Kent, L. B. McIntyre, S. A. Blasdall, J. C. Learmont, 547
and J. S. Sullivan. 1997. Lymphoproliferative immune function in the Sydney Blood 548
Bank Cohort, infected with natural nef/long terminal repeat mutants, and in other long-549
term survivors of transfusion-acquired HIV-1 infection. Aids 11:1565-74. 550
20. Erdtmann, L., K. Janvier, G. Raposo, H. M. Craig, P. Benaroch, C. Berlioz-Torrent, 551
J. C. Guatelli, R. Benarous, and S. Benichou. 2000. Two independent regions of HIV-1 552
Nef are required for connection with the endocytic pathway through binding to the mu 1 553
chain of AP1 complex. Traffic 1:871-83. 554
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 28: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/28.jpg)
Lewis et al 28 Mapping Nef MHC-I downregulation with Immune Selection
21. Fackler, O. T., and A. S. Baur. 2002. Live and let die: Nef functions beyond HIV 555
replication. Immunity 16:493-7. 556
22. Felsenstein, J. 1989. PHYLIP-Phylogeny Inference Package (Version 3.2). Cladistics 557
5:164-166. 558
23. Franken, P., S. Arold, A. Padilla, M. Bodeus, F. Hoh, M. P. Strub, M. Boyer, M. 559
Jullien, R. Benarous, and C. Dumas. 1997. HIV-1 Nef protein: purification, 560
crystallizations, and preliminary X-ray diffraction studies. Protein Sci 6:2681-3. 561
24. Garcia, J. V., and A. D. Miller. 1991. Serine phosphorylation-independent 562
downregulation of cell-surface CD4 by nef. Nature 350:508-11. 563
25. Geffin, R., D. Wolf, R. Muller, M. D. Hill, E. Stellwag, M. Freitag, G. Sass, G. B. 564
Scott, and A. S. Baur. 2000. Functional and structural defects in HIV type 1 nef genes 565
derived from pediatric long-term survivors. AIDS Res Hum Retroviruses 16:1855-68. 566
26. Geyer, M., O. T. Fackler, and B. M. Peterlin. 2001. Structure--function relationships in 567
HIV-1 Nef. EMBO Rep 2:580-5. 568
27. Geyer, M., C. E. Munte, J. Schorr, R. Kellner, and H. R. Kalbitzer. 1999. Structure 569
of the anchor-domain of myristoylated and non-myristoylated HIV-1 Nef protein. J Mol 570
Biol 289:123-38. 571
28. Geyer, M., H. Yu, R. Mandic, T. Linnemann, Y. H. Zheng, O. T. Fackler, and B. M. 572
Peterlin. 2002. Subunit H of the V-ATPase binds to the medium chain of adaptor protein 573
complex 2 and connects Nef to the endocytic machinery. J Biol Chem 277:28521-9. 574
29. Gibbs, J. S., D. A. Regier, and R. C. Desrosiers. 1994. Construction and in vitro 575
properties of HIV-1 mutants with deletions in "nonessential" genes. AIDS Res Hum 576
Retroviruses 10:343-50. 577
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 29: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/29.jpg)
Lewis et al 29 Mapping Nef MHC-I downregulation with Immune Selection
30. Hodge, D. R., K. J. Dunn, G. K. Pei, M. K. Chakrabarty, G. Heidecker, J. A. 578
Lautenberger, and K. P. Samuel. 1998. Binding of c-Raf1 kinase to a conserved acidic 579
sequence within the carboxyl-terminal region of the HIV-1 Nef protein. J Biol Chem 580
273:15727-33. 581
31. Huang, Y., L. Zhang, and D. D. Ho. 1995. Characterization of nef sequences in long-582
term survivors of human immunodeficiency virus type 1 infection. J Virol 69:93-100. 583
32. Kestler, H. W., 3rd, D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. 584
Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high 585
virus loads and for development of AIDS. Cell 65:651-62. 586
33. Kirchhoff, F., P. J. Easterbrook, N. Douglas, M. Troop, T. C. Greenough, J. Weber, 587
S. Carl, J. L. Sullivan, and R. S. Daniels. 1999. Sequence variations in human 588
immunodeficiency virus type 1 Nef are associated with different stages of disease. J Virol 589
73:5497-508. 590
34. Kirchhoff, F., T. C. Greenough, D. B. Brettler, J. L. Sullivan, and R. C. Desrosiers. 591
1995. Brief report: absence of intact nef sequences in a long-term survivor with 592
nonprogressive HIV-1 infection. N Engl J Med 332:228-32. 593
35. Koenig, S., A. J. Conley, Y. A. Brewah, G. M. Jones, S. Leath, L. J. Boots, V. Davey, 594
G. Pantaleo, J. F. Demarest, C. Carter, and et al. 1995. Transfer of HIV-1-specific 595
cytotoxic T lymphocytes to an AIDS patient leads to selection for mutant HIV variants 596
and subsequent disease progression. Nat Med 1:330-6. 597
36. Krebs FC, Hogan TH, Quiterio S, Gartner S, and W. B. 2001. Lentiviral LTR-598
directed Expression, Sequence Variation, and Disease Pathogenesis. Theoretical Biology 599
and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM. 600
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 30: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/30.jpg)
Lewis et al 30 Mapping Nef MHC-I downregulation with Immune Selection
37. Lama, J., A. Mangasarian, and D. Trono. 1999. Cell-surface expression of CD4 601
reduces HIV-1 infectivity by blocking Env incorporation in a Nef- and Vpu-inhibitable 602
manner. Curr Biol 9:622-31. 603
38. Lee, C. H., K. Saksela, U. A. Mirza, B. T. Chait, and J. Kuriyan. 1996. Crystal 604
structure of the conserved core of HIV-1 Nef complexed with a Src family SH3 domain. 605
Cell 85:931-42. 606
39. Lemey, P., A. Rambaut, and O. G. Pybus. 2006. HIV evolutionary dynamics within 607
and among hosts. AIDS Rev 8:125-40. 608
40. Lewis, M. J., A. Balamurugan, A. Ohno, S. Kilpatrick, H. L. Ng, and O. O. Yang. 609
2008. Functional adaptation of Nef to the immune milieu of HIV-1 infection in vivo. J 610
Immunol 180:4075-81. 611
41. Liu, L. X., N. Heveker, O. T. Fackler, S. Arold, S. Le Gall, K. Janvier, B. M. 612
Peterlin, C. Dumas, O. Schwartz, S. Benichou, and R. Benarous. 2000. Mutation of a 613
conserved residue (D123) required for oligomerization of human immunodeficiency virus 614
type 1 Nef protein abolishes interaction with human thioesterase and results in 615
impairment of Nef biological functions. J Virol 74:5310-9. 616
42. Lu, X., H. Yu, S. H. Liu, F. M. Brodsky, and B. M. Peterlin. 1998. Interactions 617
between HIV1 Nef and vacuolar ATPase facilitate the internalization of CD4. Immunity 618
8:647-56. 619
43. Mangasarian, A., V. Piguet, J. K. Wang, Y. L. Chen, and D. Trono. 1999. Nef-620
induced CD4 and major histocompatibility complex class I (MHC-I) down-regulation are 621
governed by distinct determinants: N-terminal alpha helix and proline repeat of Nef 622
selectively regulate MHC-I trafficking. J Virol 73:1964-73. 623
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 31: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/31.jpg)
Lewis et al 31 Mapping Nef MHC-I downregulation with Immune Selection
44. Mariani, R., F. Kirchhoff, T. C. Greenough, J. L. Sullivan, R. C. Desrosiers, and J. 624
Skowronski. 1996. High frequency of defective nef alleles in a long-term survivor with 625
nonprogressive human immunodeficiency virus type 1 infection. J Virol 70:7752-64. 626
45. Niederman, T. M., B. J. Thielan, and L. Ratner. 1989. Human immunodeficiency 627
virus type 1 negative factor is a transcriptional silencer. Proc Natl Acad Sci U S A 628
86:1128-32. 629
46. Noviello, C. M., S. L. Pond, M. J. Lewis, D. D. Richman, S. K. Pillai, O. O. Yang, S. 630
J. Little, D. M. Smith, and J. C. Guatelli. 2007. Maintenance of Nef-mediated 631
modulation of major histocompatibility complex class I and CD4 after sexual 632
transmission of human immunodeficiency virus type 1. J Virol 81:4776-86. 633
47. Piguet, V., and D. Trono. 1999. A structure-function analysis of the nef protein of 634
primate lentiviruses, p. 448-459. In C. L. Kuiken, B. Foley, B. Hahn, P. A. Marx, F. 635
McCutchan, J. W. Mellors, J. Mullins, S. Wolinsky, and B. Korber (ed.), Human 636
Retroviruses and AIDS. Los Alamos National Laboratory, Los Alamos, NM. 637
48. Piguet, V., and D. Trono. 1999. The Nef protein of primate lentiviruses. Rev Med Virol 638
9:111-20. 639
49. Piguet, V., L. Wan, C. Borel, A. Mangasarian, N. Demaurex, G. Thomas, and D. 640
Trono. 2000. HIV-1 Nef protein binds to the cellular protein PACS-1 to downregulate 641
class I major histocompatibility complexes. Nat Cell Biol 2:163-7. 642
50. Pond, S. L., S. D. Frost, and S. V. Muse. 2005. HyPhy: hypothesis testing using 643
phylogenies. Bioinformatics 21:676-9. 644
51. Poon, A. F., L. C. Swenson, W. W. Dong, W. Deng, S. L. Kosakovsky Pond, Z. L. 645
Brumme, J. I. Mullins, D. D. Richman, P. R. Harrigan, and S. D. Frost. 2010. 646
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 32: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/32.jpg)
Lewis et al 32 Mapping Nef MHC-I downregulation with Immune Selection
Phylogenetic analysis of population-based and deep sequencing data to identify 647
coevolving sites in the nef gene of HIV-1. Mol Biol Evol 27:819-32. 648
52. Posada, D., and K. A. Crandall. 1998. MODELTEST: testing the model of DNA 649
substitution. Bioinformatics 14:817-8. 650
53. Richter, S. N., I. Frasson, and G. Palu. 2009. Strategies for inhibiting function of HIV-651
1 accessory proteins: a necessary route to AIDS therapy? Curr Med Chem 16:267-86. 652
54. Riggs, N. L., H. M. Craig, M. W. Pandori, and J. C. Guatelli. 1999. The dileucine-653
based sorting motif in HIV-1 Nef is not required for down- regulation of class I MHC. 654
Virology 258:203-7. 655
55. Saksela, K. 2004. Therapeutic targeting of interactions between Nef and host cell 656
proteins. Curr Drug Targets Immune Endocr Metabol Disord 4:315-9. 657
56. Saksela, K., G. Cheng, and D. Baltimore. 1995. Proline-rich (PxxP) motifs in HIV-1 658
Nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced 659
growth of Nef+ viruses but not for down-regulation of CD4. Embo J 14:484-91. 660
57. Salter, R. D., D. N. Howell, and P. Cresswell. 1985. Genes regulating HLA class I 661
antigen expression in T-B lymphoblast hybrids. Immunogenetics 21:235-46. 662
58. Sawai, E. T., A. Baur, H. Struble, B. M. Peterlin, J. A. Levy, and C. Cheng-Mayer. 663
1994. Human immunodeficiency virus type 1 Nef associates with a cellular serine kinase 664
in T lymphocytes. Proc Natl Acad Sci U S A 91:1539-43. 665
59. Schaefer, M. R., E. R. Wonderlich, J. F. Roeth, J. A. Leonard, and K. L. Collins. 666
2008. HIV-1 Nef targets MHC-I and CD4 for degradation via a final common beta-COP-667
dependent pathway in T cells. PLoS Pathog 4:e1000131. 668
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 33: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/33.jpg)
Lewis et al 33 Mapping Nef MHC-I downregulation with Immune Selection
60. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, and J. M. Heard. 1996. 669
Endocytosis of major histocompatibility complex class I molecules is induced by the 670
HIV-1 Nef protein. Nat Med 2:338-42. 671
61. Smith, B. L., B. W. Krushelnycky, D. Mochly-Rosen, and P. Berg. 1996. The HIV nef 672
protein associates with protein kinase C theta. J Biol Chem 271:16753-7. 673
62. Swigut, T., L. Alexander, J. Morgan, J. Lifson, K. G. Mansfield, S. Lang, R. P. 674
Johnson, J. Skowronski, and R. Desrosiers. 2004. Impact of Nef-mediated 675
downregulation of major histocompatibility complex class I on immune response to 676
simian immunodeficiency virus. J Virol 78:13335-44. 677
63. Tomiyama, H., H. Akari, A. Adachi, and M. Takiguchi. 2002. Different effects of 678
Nef-mediated HLA class I down-regulation on human immunodeficiency virus type 1-679
specific CD8(+) T-cell cytolytic activity and cytokine production. J Virol 76:7535-43. 680
64. Ueno, T., C. Motozono, S. Dohki, P. Mwimanzi, S. Rauch, O. T. Fackler, S. Oka, 681
and M. Takiguchi. 2008. CTL-mediated selective pressure influences dynamic evolution 682
and pathogenic functions of HIV-1 Nef. J Immunol 180:1107-16. 683
65. Walker, P. R., M. Ketunuti, I. A. Choge, T. Meyers, G. Gray, E. C. Holmes, and L. 684
Morris. 2007. Polymorphisms in Nef associated with different clinical outcomes in HIV 685
type 1 subtype C-infected children. AIDS Res Hum Retroviruses 23:204-15. 686
66. Wick, W. D., P. B. Gilbert, and O. O. Yang. 2009. Predicting the impact of blocking 687
human immunodeficiency virus type 1 Nef in vivo. J Virol 83:2349-56. 688
67. Williams, M., J. F. Roeth, M. R. Kasper, T. M. Filzen, and K. L. Collins. 2005. 689
Human immunodeficiency virus type 1 Nef domains required for disruption of major 690
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 34: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/34.jpg)
Lewis et al 34 Mapping Nef MHC-I downregulation with Immune Selection
histocompatibility complex class I trafficking are also necessary for coprecipitation of 691
Nef with HLA-A2. J Virol 79:632-6. 692
68. Yang, O. O., P. T. Nguyen, S. A. Kalams, T. Dorfman, H. G. Gottlinger, S. Stewart, 693
I. S. Chen, S. Threlkeld, and B. D. Walker. 2002. Nef-mediated resistance of human 694
immunodeficiency virus type 1 to antiviral cytotoxic T lymphocytes. J Virol 76:1626-31. 695
69. Yang, O. O., P. T. Sarkis, A. Ali, J. D. Harlow, C. Brander, S. A. Kalams, and B. D. 696
Walker. 2003. Determinant of HIV-1 mutational escape from cytotoxic T lymphocytes. J 697
Exp Med 197:1365-75. 698
699
700
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 35: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/35.jpg)
Lewis et al 35 Mapping Nef MHC-I downregulation with Immune Selection
Table I. Nef Residues Under Selection by Gag-Specific CTLs. 701
702
Nef Residue (HXB2 numbering)
dN/dS Known Functional Role
E18 -4.37 “X” in RXR motif, ↓MHC-I, β-COP binding, (59, 67)
N52 -3.24 None reported
E62 -3.87 ↓MHC-I, PACS-1 binding (49, 67)
V74 -5.00 “φ” in PxφP motif, ↓MHC-I, cell signaling, (43, 56)
A83 3.68 ↓MHC-I, cell signaling (43)
A84 -3.00 None reported
D123 -4.45 ↓MHC-I, Dimerization, thioesterase binding (41, 67)
Y135 -4.38 None reported
G140 -3.00 None reported
L164 -4.97 Cellular Trafficking, ↓CD4 (15)
S169 -3.24 None reported
H171 -3.24 None reported
D175 -3.24 Cellular trafficking and signaling (28, 30, 42)
V180 -4.00 None reported
703
704
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 36: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/36.jpg)
Lewis et al 36 Mapping Nef MHC-I downregulation with Immune Selection
Table II. Primary Plasma Nef Mutant Genotypes1 at Selected and Known MHC-I-associated 705
Sites. 706
Subject No. Genotype at Selected Sites Genotype at Known MHC-I-
Associated Sites2 00021 All Consensus All Consensus
00022 E18D, E62K, G140E R19K, E63V/A, P72A
00026 A84D, G140R, H171G All Consensus
00030 E62K, V74A, H171P, D175N R17G, E63D, E65G, P78L
00034 E62G, D123G/N R19K/G, M20I
00035 E18K, E62K, Y135F, L164Y, H171N R19G
00037 N52S, D123N, G140R, D175E E63-65K
00039 E62G, Y135F E63G
00041 S169N/I, V180E All Consensus
1 indicates a change in at least one clone in the quasispecies mix, not necessarily fixed substitutions or consensus 707 sequences. 708 2 sites examined: R17, R19, M20, E62-65, P72, P75, P78 709
710
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 37: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/37.jpg)
Lewis et al 37 Mapping Nef MHC-I downregulation with Immune Selection
FIGURES AND FIGURE LEGENDS 711
712
Figure 1. Phylogeny of nef quasispecies in the absence and presence of immune selection by 713
Gag-specific CTLs. Plasma nef sequences from nine subjects (“input” sequences, n=94, blue 714
circles), nef sequences passaged in the absence of CTL selection (“control” sequences, n=71, 715
green squares), and nef sequences passaged in under Gag-specific CTL selection (“selected” 716
sequences, n=67, red triangles) were aligned with NL4-3 nef to create a neighbor-joining 717
phylogenetic tree. Independent clusters for each subject were supported by > 99% bootstrap 718
support, with the exception of Subjects 00035 and 00039, whose sequences were previously 719
found to be related (40). Significant clustering of CTL-selected sequences (bootstrap values 720
>70%) are marked with an “*”. 721
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 38: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/38.jpg)
Lewis et al 38 Mapping Nef MHC-I downregulation with Immune Selection
722
723
Figure 2. CTL selection exerts
evolutionary pressure on the nef
quasispecies.
The nef quasispecies sequences were
examined for changes resulting from
selection by the Gag-specific CTLs,
comparing the input, control, and
selected sequences. A.) The
percentages of sequences with non-
sense mutations (frameshift and/or
early stop mutations) are plotted for
each group across all subjects. B.) For
nef sequences from each subject,
pairwise diversity (calculated for each
group using 500 bootstrap replicates to
give the standard error of the mean) is
plotted for each group. C.) For each
subject, the change in nef diversity due
to CTL selection (comparing the
control to selected groups) is plotted,
and the median across all subjects is
indicated. * indicates a p-value<0.05
for the difference between control and
selected sequences.
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 39: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/39.jpg)
Lewis et al 39 Mapping Nef MHC-I downregulation with Immune Selection
724
725
726
727
Figure 3. Passaging of HIV-1 in the
presence of Gag-specific CTLs results in
purifying selection of nef. The input,
control and selected sequences were
evaluated for evidence of selective
pressure as reflected by dN/dS ratios. A.)
Maximium likelihood estimates of the
global dN/dS ratios with 95% confidence
intervals are plotted for each of the three
groups of sequences. * indicates non-
overlapping CIs. B.) Site-by-site analysis
for CTL selection was performed with
multiple methods, shown here are results
from the SLAC method. The plot shows
the estimated dN/dS ratios for codons
(numbered according to the HXB2
numbering system) that demonstrated
significant selection (p <0.05) by both
SLAC and FEL methods.
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 40: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/40.jpg)
Lewis et al 40 Mapping Nef MHC-I downregulation with Immune Selection
728
729
Figure 4. Structural locations and conservation of amino acids associated with MHC-I 730
downregulation. A.) The 13 codons determined to be under purifying selection are indicated on 731
the predicted three-dimensional structure of the Nef protein (composite crystal structure kindly 732
provided by Art F.Y. Poon). The probablility of each amino acid, based on an alignment of all 733
complete, non-recombinant Nef sequences including genotypes A-K submitted to the LANL 734
HIV-1 Sequence database through 2010 (N>2100 sequences), was calculated for B.) the sites 735
under purifying selection shown in Table I, and C.) sites previously identified as important for 736
Nef MHC-I downregulation. 737
738
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 41: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/41.jpg)
Lewis et al 41 Mapping Nef MHC-I downregulation with Immune Selection
739
Figure 5. Downregulation of MHC-I by Nef Mutants Identified by CTL Immune Selection. 740
Eight mutants at the 7 selected sites with no previously reported role in Nef function were 741
individually introduced into NL4-3 recombinant reporter viruses. Specific amino acid changes 742
were selected based on their presence in primary plasma isolates before selection, except H171A. 743
Their ability to downregulate HLA-A*0201 was measured by flow cytometry and compared to 744
NL4-3 Nef, Delta Nef, and M20A Nef, a mutant specifically deficient in MHC-I downregulation. 745
A.) Summary of the average HLA-A*0201 downregulation of each mutant relative to NL4-3 Nef 746
based on at least 3 separate infections, * indicates a significant difference from NL4-3 with a p-747
value <0.05, ** p<0.001. B.) shows the histogram plots of the levels of HLA-A*0201 on cells 748
infected with either mutant (filled histograms, mutant labeled in the upper right) or NL4-3 Nef 749
(open histograms). 750
751
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
![Page 42: immune selection in vitro reveals human immunodeficiency virus-1 ...](https://reader034.fdocuments.in/reader034/viewer/2022042611/58a2f9fc1a28abcb1c8baa37/html5/thumbnails/42.jpg)
Lewis et al 42 Mapping Nef MHC-I downregulation with Immune Selection
752
753
754
755
756
Figure 6. CTL-selected Nef sequences have
preserved MHC-I downregulatory function.
Levels of A*0201 on the surface of cells
infected with reporter viruses carrying input
versus CTL-selected Nef quasispecies were
measured by flow cytometry. A.)
Histogram plots of A*0201 on cells infected
with wild-type NL4-3 Nef and M20A Nef,
deficient in MHC-I downregulation, (top
panels) and for Subjects 00021 and 00022
before and after immune selection (middle
and bottom panels, respectively). Open
histograms are cells without Nef; the filled
histograms are cells infected with the Nef
allele labeled in the upper right corner. B.)
Summary plots are given for Nef
quasispecies from Subjects 00021, 00022,
00030, 00034, and 00037 for input and
selected viruses, as well as a wild-type NL4-
3 virus control that underwent CTL
selection. The error bars indicate the
standard deviation for three independent
experiments with each input virus group.
Note that only one sample of each selected
virus was available for testing.
on April 14, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from