Science in China Series C: Life Sciences

© 2009 SCIENCE IN CHINA PRESS

Springer

Citation: HU Y, CONG Y G, LI S, et al. Identification of in vivo induced protein antigens of Salmonella enterica serovar Typhi during human infection. Sci China SerC-Life Sci, 2009, 52(10): 942-948, doi: 10.1007/s11427-009-0127-z

www.scichina.com life.scichina.com

www.springer.com/scpwww.springerlink.com

Identification of in vivo induced protein antigens of Salmonella enterica serovar Typhi during human infection

HU Yong1,2, CONG YanGuang1†, LI Shu1, RAO XianCai1, WANG Gang3 & HU FuQuan1† 1 Department of Microbiology, Third Military Medical University, Chongqing 400038, China; 2 Department of Biotechnology, Chongqing University of Technology, Chongqing 400050, China; 3 Department of Clinical Laboratory, The 3rd Hospital of People’s Liberation Army, Baoji 721004, China

During infectious disease episodes, pathogens express distinct subsets of virulence factors which allow them to adapt to different environments. Hence, genes that are expressed or upregulated in vivo are implicated in pathogenesis. We used in vivo induced antigen technology (IVIAT) to identify antigens which are expressed during infection with Salmonella enterica serovar Typhi. We identified 7 in vivo induced (IVI) antigens, which included BcfD (a fimbrial structural subunit), GrxC (a glutaredoxin 3), SapB (an ABC-type transport system), T3663 (an ABC-type uncharacterized transport system), T3816 (a putative rhodanese-related sulfurtransferase), T1497 (a probable TonB-dependent receptor) and T3689 (unknown function). Of the 7 identified antigens, 5 antigens had no cross-immunoreactivity in adsorbed control sera from healthy subjects. These 5 included BcfD, GrxC, SapB, T3663 and T3689. Antigens identified in this study are potential targets for drug and vaccine development and may be utilized as diagnostic agents.

Salmonella enterica serovar Typhi, in vivo induced antigen technology (IVIAT), virulence

Typhoid fever, a serious public health problem in de-veloping countries[1], is a bacterial illness caused by Salmonella enterica serovar Typhi. Typhoid symptoms are typically the sudden onset of sustained fever, severe headache, loss of appetite, and either constipation or mild diarrhea[2,3]. Better control of typhoid fever is ur-gently needed because, as noted by Crump et al.[4], an estimated 21 million cases of typhoid fever and 220000 annual deaths occur worldwide. The incidence of dis-ease caused by multidrug-resistant serovar Typhi organ-isms is increasing and this has made treatment increas-ingly more difficult[2], increasing the need for novel ap-proaches for the diagnosis, treatment and prevention of typhoid fever to be developed.

However, because humans are the only known natural hosts for serovar Typhi infection, pathogenicity studies of serovar Typhi are difficult to perform. Relatively little is known about the specific factors which may contrib-

ute to the ability of this organism to cause typhoid fever or which facilitate its adaptation to human hosts[5,6]. Most research on the pathogenesis of typhoid fever has been based on the infection of mice with S. enterica se-rovar Typhimurium, which causes a systemic infection that resembles typhoid fever in humans[7]. However, there are many differences between these two organisms; for example, serovar Typhimurium is a broad-host-range pathogen and only causes gastroenteritis in humans[2]. Infection with serovar Typhimurium induces apoptosis in mouse macrophages, while infection with serovar Typhi causes less apoptosis in human macrophages[8]. Consequently, there are limitations to the application of results obtained with serovar Typhimurium to the un- Received June 2, 2009; accepted July 21, 2009 doi: 10.1007/s11427-009-0127-z †Corresponding author (email: ygcong@tmmu.edu.cn; hufuquan@yahoo.com) Supported by the National Natural Science Foundation of China (Grant No. 30500435)

Article

HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 | no. 10 | 942-948 943

derstanding of human infection by serovar Typhi organ- isms. A second method is to study pathogenesis using human and murine cell lines, but these types of models are limited to single stages of infection and are unable to mimic all of the complex and changing environmental stimuli that occur at the sites of an infection in the intact host.

During disease progression, pathogens adapt to a se-ries of environments, and survival in any one niche would likely need the expression of a distinct subset of virulence factors. Hence, genes that be expressed spe-cifically or upregulated in vivo may be critical factors in the disease process[9]. If the proteins encoded by these genes are antigenic, they would stimulate the body to produce antibodies, so immunogenic techniques could be used to identify these antigens[10]. In the present study, we utilized in vivo induced antigen technology (IVIAT), an immunogenic technique, to identify serovar Typhi antigens expressed during infection. Doing so circum-vented the limitation of animal models such that the identified antigens may prove to be significant in the virulence of organism pathogen.

1 Materials and methods

1.1 Strains, plasmids and media

S. enterica serovar Typhi Ty2 strain was obtained from the National Center for Medical Culture Collections (Beijing, China). Escherichia coli DH5α and BL21 (DE3) were used as the host strains for recombinant plasmids. All bacterial strains were grown in Luria- Bertani (LB) medium. Kanamycin (Kan) was added at the concentration of 50 μg/mL when required.

1.2 Patient and control sera

Convalescent-phase sera were collected from patients who were culture-confirmed for serovar Typhi. Only the sera from patients on days 22 to 40 post-illness were used in this study. Sera samples from four healthy sub-jects were used as negative control. All sera were sup-plied by the 3rd Hospital of People’s Liberation Army (Baoji, China) and stored at −70℃ until usage. This study was approved by the local ethical committees.

1.3 Adsorption of sera

For more effective screening in future studies, three sera with high-level antibody titers were collected and used in the following experiments. Equal volumes of the three

sera (300 μL/each) were pooled and adsorbed exten- sively with in vitro-grown serovar Typhi Ty2 organisms and with the expression host strain E. coli BL21(DE3) containing the native pET-30 expression plasmid. The pooled sera were serially adsorbed against whole cells, cell extracts and denatured cell extracts immobilized onto nitrocellulose membranes (Millipore), as previ- ously described[11,12]. To check the efficacy of each ad- sorption step, a 10 μL aliquot of the serum was removed after each adsorption and an indirect enzyme linked immunosorbent assay (ELISA) was performed as previ- ously described[11]. The resultant adsorbed serum sample was found by ELISA to retain no discernible reactivity, utilizing the Ty2 strain lysates and was aliquoted and stored at –70℃ for further use.

1.4 Construction of a genomic expression library of serovar Typhi Ty2

We used pET-30a/b/c expression vectors, which allowed appropriate expression of the insert DNA in one of three open reading frames (ORFs) under the transcriptional control of the T7 phage promoter. The vector DNA was digested with restriction enzyme BamHI, gel purified with a gel extraction kit (Watson, Shanghai), and treated with shrimp alkaline phosphatase. Genomic DNA of serovar Typhi Ty2 was partially digested with Sau3AI and subjected to electrophoresis. A DNA fragment of 0.5—1.5 kb was cut and purified using the gel extraction kit. A rational ratio of vector DNA and insert fragments was ligated and electroporated into competent E. coli DH5α. Transformants were spread on LB plates con-taining kanamycin. After overnight incubation at 37℃, all colonies on the plates were collected and recombi-nant plasmid DNA was recovered and electroporated into E. coli BL21 (DE3).

1.5 Screening of IVI antigens of serovar Typhi Ty2

To find the antigens that were expressed in vivo, an ali-quot of the expression library, which was constructed as above in the expression host BL21 (DE3), was diluted and spread on LB plates containing kanamycin to pro-duce about 400 colonies per plate. These plates were incubated at 37℃ until the clones became pinpoint sized. A sterile nitrocellulose membrane was then placed onto each plate for 10 min to produce a replica, which was then placed onto an LB plate containing kanamycin and isopropyl-β-D-thiogalactoside (IPTG, 1 mmol/L), and incubated for 5 h at 37℃ to induce expression of

944 HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 | no. 10 | 942-948

genes in cloned inserts. The primary plates were also incubated for 5 h at 37℃ and stored at 4℃ as the mas-ter plates. Each membrane was removed and partially lysed by exposing them to chloroform vapor for 15 min, followed by blocking with 10% nonfat skim milk over-night at 4℃. After washing with PBS-T, each membrane was reacted with adsorbed convalescent sera (1︰200 dilution) for 1 h at room temperature with mild agitation, then washed 3 times with PBS-T. Clones reacting with antibody in adsorbed sera were detected by using per- oxidase-conjugated goat anti-human Ig (Southern- biotech) at a 1︰20000 dilution, and developed by using an ECL chemiluminescence kit (Pierce). Reactive clones were then identified by their positions on the master plate, and each positive clone was purified and stored at −70℃ as a glycerol stock.

To eliminate false positive clones in the primary screen, a secondary screening was done by comparing them directly to the reactivity of a control strain, E. coli BL21(DE3) containing the pET-30 vector without an insert, in a whole-colony immunoblot assay. Plasmids from persistent reactive clones were then purified and the serovar Typhi DNA inserted into the vector was se- quenced. A tertiary screening was carried out by cloning each of the entire predicted ORFs that were generated by PCR amplification into 5′ Nde I or Nco I (if the gene had Nde I sites) and 3′ Not I restriction enzyme sites in the pET-30a vector, and then screened by the same method as the secondary screening. The PCR primer sequences of the predicted ORFs are shown in Table 1.

1.6 Screening antigens identified by IVIAT against sera from subjects

To assess the degree of cross-immunoreactivity of anti- gens identified by IVIAT, we screened reactive clones

Table 1 Oligonucleotide primers used for polymerase chain reaction (PCR) amplification of the fifteen genes a)

Gene Primer sequence

Pf1: 5′ cgcgCATATGaaaatacctcttttatttgctc 3′ bcfD

Pr1: 5′ cggcGCGGCCGCttagtcaaagtccactcgc 3′

Pf2: 5′ cgcgCATATGcaagaaattatgcaatttgttg 3′ t3816

Pr2: 5′ cggcGCGGCCGCtcacttaccgcgcacca 3′

Pf3: 5′ cgcgCATATGgccaatattgaaatctacacca 3′ grxC

Pr3: 5′ cggcGCGGCCGCttaacgcaacagcggatcc 3′

Pf4: 5′ cgcgCATATGaaaattatttccgttagacagc 3′ t1497

Pr4: 5′ cggcGCGGCCGCttattcaaattgccatgccag 3′

Pf5: 5′ cgcgCCATGGccatgattatcttcaccctg 3′ sapB

Pr5: 5′ cggcGCGGCCGCttatcgtaaggcataccatt 3′

Pf6: 5′ cgcgCCATGG ttatggcaacccggcaca 3′ t3663

Pr6: 5′ cggcGCGGCCGC ctacggccctggctcaa 3′

Pf7: 5′ cgcgCATATGaaaaaacgctcccttttgct 3′ t3689

Pr7: 5′ cggcGCGGCCGCtcaaaagcgatactcacc 3′

Pf8: 5′ cgcgCATATGacccttcaacatacccgac 3′ t0309

Pr8: 5′ cggcGCGGCCGC ctatttagcggatagcgc 3′

Pf9: 5′ cgcgCATATG gtttcatcatccacaaccgt 3′ cysZ

Pr9: 5′ cggcGCGGCCGC ttatttccataacgcgtgttt 3′

Pf10: 5′ cgcgCATATG atgcaggatttgcgtctgat 3′ t0429

Pr10: 5′ cggcGCGGCCGCtcaggcgttagcgtccat 3′

Pf11: 5′ cgcgCCATGGacaaagcgcattaataaagaca 3′ t3664

Pr11: 5′ cggcGCGGCCGCttacagacgtgaccaggc 3′

Pf12: 5′ cgcgCCATGGctatgtctacaacaacgttaa 3′ t3467

Pr12: 5′cggcGCGGCCGCtcaggcttcctcccgttt 3′

Pf13: 5′ cgcgCATATGatgacaaatctaaaaaagcgcgaa3′ t0769

Pr13: 5′ cgcgGCGGCCGCttaatacgccgctttattaacaaac 3′

Pf14: 5′ cgcgCATATGatggcggttgaagttaaatacgta3′ t0995

Pr14: 5′ cgcgGCGGCCGCtcaggcggcttgctttttcgtt 3′

Pf15: 5′ cgcgCATATGatgagtttacgacaaaaaacgatc 3′ t0770

Pr15: 5′ cgcgGCGGCCGCtcatccgacacgtaataacttttt 3′

a) Restriction sites in each primer are underlined.

Table 2 S.enterica serovar Typhi strain Ty2 antigens identified by IVIAT

Gene designation in S. enterica serovar Typhi strain Ty2 genome sequence Name of encoded protein product Function

t0025 BcfD fimbrial structural subunit

t3816 rhodanese-related sulfurtransferase

t3817 GrxC glutaredoxin and related proteins

t1497 outer membrane receptor proteins, mostly Fe transport

t1598 SapB ABC-type transport systems, permease components

t3663 ABC-type uncharacterized transport system

t3689 hypothetical protein

HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 | no. 10 | 942-948 945

for immunoreactivity against pooled sera from four healthy subjects. Prior to screening, the pooled control sera were also adsorbed with in vitro-grown E. coli BL21(DE3) containing the pET-30a vector without an insert to reduce background reactivity against the host bacteria used in the whole-colony immunoblot assay.

2 Results

2.1 Construction and analysis of the expression li-brary

A serovar Typhi Ty2 DNA fragment at a length of 0.5—1.5 kb was obtained by partially digesting Ty2 ge- nomic DNA with Sau3AI (Figure 1). It was recovered and ligated with prepaired vector pET-30 a/b/c and elec- troporated into host stains, thereby obtaining a genomic expression library. To check for the presence of inserts, the plasmid DNA from 10 randomly selected clones of the library was purified and digested with Kpn I and Hind III and then subjected to electrophoresis. The re-sults showed all these randomly selected clones con-tained DNA inserts (Figure 2).

2.2 Screening of the expression library for positive clones

The adsorbed convalescent sera were used to screen the

Figure 1 Partially digested Ty2 genomic DNA with Sau 3AI. M: DNA marker.

Figure 2 Restriction enzyme analysis of expression library with Kpn I and Hind . Ⅲ Lane 1: Negative controle plasmid; Lanes 2-11: ten ran-domly selected recombinant plasmids; M: DNA marker.

expression libraries for positive clones. Approximately 30000 clones of the serovar Typhi Ty2 expression li- brary were screened in the first screen, and 23 immuno- reactive clones were identified (one positive clone is shown in Figure 3A as an example). In secondary screening, eight clones out of the 23 immunoreactive clones were found to be persistently reactive with ad- sorbed sera compared to the negative control, E. coli BL21 (DE3) containing the native pET-30 vector with- out an insert.

Figure 3 Screening positive clones. A, One of the reactive clones (indi-cated by the black arrow) identified in the first screen; B, seven reactive clones identified in the tertiary screen. Negative control: E. coli BL21 (DE3) containing the pET-30a without an insert.

2.3 Identification of IVI antigens

Insert Ty2 DNA sequences in the 8 persistently reactive clones were sequenced (TaKaRa), and 15 ORFs were revealed in the 8 clones by BLAST (http://www.ncbi. nlm.nih.gov/BLAST/). To confirm which ORF encoded the IVI antigen, all 15 ORFs full length sequences were respectively cloned into pET-30a vector and screened with adsorbed convalescent sera in a wholecolony immunoblot assay. Seven ORFs were confirmed to have positive immunoreactivity against the sera (Figure 3B). The proteins encoded by the seven indentified ORFs are shown in Table 2. These proteins included BcfD (a fim-brial structural subunit), GrxC (a glutare-doxin 3), SapB (an ABC-type transport systems), T3663 (an ABC-type uncharacterized transport system), T3816 (a putative rhodanese-related sulfurtransferase), T1497 (a probable TonB-dependent receptor, mostly involved in Fe trans-port) and T3689 (unknown function).

2.4 Immunoreactivities of antigens identified by IVIAT to sera from volunteers

The degree of the seven antigens identified by IVIAT against adsorbed sera from volunteers was shown in a whole-colony immunoblot assay in Figure 4. Five (BcfD, GrxC, Sap, T3689, T3663) had no detectable degree of

946 HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 | no. 10 | 942-948

Figure 4 Immunoreactivities of antigens identified by IVIAT against sera from volunteers in a whole-colony immunoblot assay. 1a: T3816; 3c: T1497; 1b: GrxC; 2a: BcfD; 2c: T3689; 3a: SapB; 3b: T3663; 1c and 2b: plasmids pET-30a.

immunoreactivity with adsorbed volunteers sera. This result suggests that these five antigens have no cross- immunoreactivity to sera from healthy individuals.

3 Discussion

Microbial pathogenicity is defined as the ability of the pathogen to enter into, propagate in, and persist at sites in the host that are inaccessible to commensal species[13]. Many virulence determinants that contribute to this ability share a unique phenotype in that they are induced within the host[14,15]. These IVI genes were shown to be poorly expressed in laboratory media but exhibited relatively elevated levels of expression in host tissues or in cultured cells[13]. It is not anticipated that all IVI genes will have essential roles in virulence. However, their in vivo induction suggests that they contribute to growth in restricted host tissues and thus enhance pathogenicity.

Several in vivo technologies have been developed in recent years to identify IVI genes, including in vivo ex- pression technology (IVET)[14,16], signature-tagged mutagenesis (STM)[17] and differential fluorescence in- duction (DFI)[18]. All of these technologies have certain limitations. Their common drawback is that they depend on the use of animal models of infection. Animal models are not available for many pathogens and even in a case where an animal model is available, it might not closely approximate the conditions in humans[10]. The key ad- vantage of IVIAT is its independence of animal models, which makes IVIAT the optimal method for study of S. erterica serovar Typhi, as humans are its only host[3]. Furthermore, the virulence factors which are identified by other technologies that utilize animal or cell culture models must be validated in the context of the actual

human infection process. The pooled serum from con- valescent phase patients allows a direct identification of antigens produced in the patients during different stages of infection[19].

Although Harris et al.[20] identified 35 immunogenic bacterial antigens by using IVIAT in S. enterica serovar Typhi CT18, we identified seven new antigens which were dissimilar from those previously identified. Of the 7 antigens, five had no cross-immunoreactivity against adsorbed control sera. These five were encoded by genes grxC, bcfD, sapB, t3663 and t3689.

The identified gene grxC encodes glutaredoxin 3, which is a constituent of an important redox system, the glutathione/glutaredoxin system[21]. Several studies have indicated that production of oxidative and nitrosative substances by phagocytes is a main effector in the innate defense against infection of murine primary macrophages

and macrophage-like cells in culture, as well as in living mice, by S. enterica serovar Typhimurium[22,23]. The re- dox-shuffling pathways that operate in salmonellae may provide protection against oxidative stress[23]. Consider- ing the important role of glutathione/glutare- doxin sys- tem in the in vivo survival of serovar Typhi, the induced expression of grxC is not unexpected.

The gene t0025 encodes a subunit of fimbriae BcfD. Fimbriae and other surface molecules mediate adherence

via specific receptors on host cell surfaces. Adhesion to host cells and mucosal surfaces is often considered to be

an essential step during the course of infection, as it al- lows bacteria to initiate colonization[3]. The gene bcfD belongs to a fimbrae operon Bcf, which consists of bcf ABCDEFG[24]. This operon exists in all Salmonella se- rovars. Huang et al.[25] found that bcfA of S. enterica serovar Typhimurium, which encodes subunits of fim- briae, is involved in bacterial adhesion and colonization during infection in pigs. Humphries et al.[26] found that injection of static LB broth cultures of S. enterica se- rovar Typhimurium into bovine ligated ileal loops re- sulted in the expression of BcfA. Our data are consistent with the results of these studies, as both bcfA and bcfD genes are in the same operon, the expression of bcfA and bcfD could be coincident.

Both sapB and t3663 encode ABC-transporters. ABC- transporters in bacteria are usually involved in control- ling influx and efflux of small molecules through meta- bolic pathways in response to environmental changes[27].

HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 | no. 10 | 942-948 947

Multidrug resistance[28,29] and pathogenicity[30] may also be attributed to ABC-transporters. It is widely accepted that over-expression of ABC-type multidrug transporters efficiently evades the pressure of drugs and enhances the invasive ability of pathogens[28,29,31].

IVIAT was demonstrated to be an effective method for screening in vivo induced antigens during infection with pathogens which have no animal model for study-

ing. Because IVI antigens are expressed in response to specific cues during infection and might help pathogens adapt to or counter hostile in vivo environments, those the antigens identified in this study are potential targets for drug and vaccine development. Also, those antigens which had no immunoreactivity against adsorbed control sera from healthy subjects may be utilized as diagnostic agents of typhoid fever.

1 Kumar S, Balakrishna K, Singh G P, et al. Rapid detection of Sal-

monella typhi in foods by combination of immunomagnetic separa-

tion and polymerase chain reaction. World J Micro, 2005, 21: 625—

628

2 Boyle E C, Bishop J L, Grassl G A, et al. Salmonella: from patho-

genesis to therapeutics. J Bacteriol, 2007, 189: 1489—1495

3 House D, Bishop A, Parry C, et al. Typhoid fever: pathogenesis and

disease. Curr Opin Infect Dis, 2001, 14: 573—578

4 Crump J A, Luby S P, Mintz E D. The global burden of typhoid fever.

Bull WHO, 2004, 82: 346—353

5 Faucher S P, Curtiss R, Daigle F. Selective capture of Salmonella

enterica serovar typhi genes expressed in macrophages that are absent

from the Salmonella enterica serovar Typhimurium genome. Infect

Immun, 2005, 73: 5217—5221

6 Chanana V, Majumdar S, Ray P, et al. Coordinated expression and

immunogenicity of an outer membrane protein from Salmonella en-

terica serovar Typhi under iron limitation, oxidative stress and an-

aerobic conditions. J Biomed Sci, 2006, 13: 303—312

7 Chander H, Majumdar S, Sapru S, et al. Reactivity of typhoid patients

sera with stress induced 55 kDa phenotype in Salmonella enterica

serovar Typhi. Mol Bioch, 2004, 267: 75—82

8 Schwan W R, Huang X Z, Hu L, et al. Differential bacterial survival,

replication, and apoptosis-inducing ability of Salmonella Serovars

within human and murine macrophages. Infect Immun, 2000, 68:

1005—1013

9 Rediers H, Rainey P B, Vanderleyden J, et al. Unraveling the secret

lives of bacteria: use of in vivo expression technology and differential

fluorescence induction promoter traps as tools for exploring

niche-specific gene expression. Microbiol Mol Biol Rev, 2005, 69:

217—261

10 Handfield M, Brady L J, Progulske-Fox A. IVIAT: a novel method to

identify microbial genes expressed specifically during human infec-

tions. Trends Microbiol, 2000, 8: 336—339

11 Hang L, John M, Asaduzzaman M. et al. Use of in vivo-induced an-

tigen technology (IVIAT) to identify genes uniquely expressed during

human infection with Vibrio cholerae. Proc Natl Acad Sci USA, 2003,

100: 8508—8513

12 Rollins S M, Peppercorn A, Hang L, et al. In vivo induced antigen

technology (IVIAT). Cell Microbiol, 2005, 7: 1—9

13 Heithoff D M, Conner C P, Hanna P C, et al. Bacterial infection as

assessed by in vivo gene expression. Proc Natl Acad Sci USA, 1997,

94: 934—939

14 Mahan M J, Slauch J M, Mekalanos J J. Selection of bacterial viru-

lence genes that are specifically induced in host tissues. Science, 1993,

259: 686—688

15 Mahan M J, Tobias J W, Slauch J M, et al. Antibiotic-based selection

for bacterial genes that are specifically induced during infection of a

host. Proc Natl Acad Sci USA, 1995, 92: 669—673

16 Angelichio M J, Camilli A. In vivo expression technology. Infect

Immun, 2002, 70: 6518—6523

17 Hensel M, Shea J E, Gleeson C, et al. Simultaneous identification of

bacterial virulence genes by negative selection. Science, 1995, 269:

400—403

18 Valdivia R H, Falkow S. Fluorescence-based isolation of bacterial

genes expressed within host cells. Science, 1997, 277: 2007—2011

19 Kim Y R, Lee S E, Kim C M, et al. Characterization and pathogenic

significance of Vibrio vulnificus antigens preferentially expressed in

septicemic patients. Infect Immun, 2003, 71: 5461—5471

20 Harris J B, Baresch-Bernal A, Rollins S M, et al. Identification of in

vivo-induced bacterial protein antigens during human infection with

Salmonella enterica Serovar Typhi. Infect Immun, 2006, 74: 5161—

5168

21 Aslund F, Beckwith J. The thioredoxin superfamily: redundancy,

specificity, and gray-area genomics. J Bacteriol, 1999, 181: 1375—

1379

22 Bjur E, Eriksson Y S, Aslund F, et al. Thioredoxin 1 promotes intra-

cellular replication and virulence of Salmonella enterica Serovar

Typhimurium. Infect Immun, 2006, 74: 5140—5151

23 Shiloh M U, Nathan C F. Reactive nitrogen intermediates and the

pathogenesis of Salmonella and mycobacteria. Curr Opin Microbiol,

2000, 3: 35—42

24 Townsend S M, Kramer N E, Edwards R, et al. Salmonella enterica

Serovar Typhi possesses a unique repertoire of fimbrial gene se-

quences. Infect Immun, 2001, 69: 2894—2901

25 Huang Y, Leming C L, Suyemoto M, et al. Genome-wide screen of

Salmonella genes expressed during infection in pigs, using in vivo

948 HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 | no. 10 | 942-948

expression technology. Appl Environ Microbiol, 2007, 73: 7522—

7530

26 Humphries A D, Raffatellu M, Winter S, et al. The use of flow cy-

tometry to detect expression of subunits encoded by 11 Salmonella

enterica serotype Typhimurium fimbrial operons. Mol Microbiol,

2003, 48: 1357—1376

27 Yazaki K. ABC transporters involved in the transport of plant sec-

ondary metabolites. FEBS Lett, 2006, 580: 1183—1191

28 Jones P M, George A M. Multidrug resistance in parasites: ABC

transporters, P-glycoproteins and molecular modelling. Int J Parasitol,

2005, 35: 555—566

29 Sipos G, Kuchler K. Fungal ATP-binding cassette (ABC) transporters

in drug resistance & detoxification. Curr Drug Targets, 2006, 7:

471—481

30 Brown J S, Gilliland S M, Holden D W. A Streptococcus pneumoniae

pathogenicity island encoding an ABC transporter involved in iron

uptake and virulence. Mol Microbiol, 2001, 40: 572—585

31 Wolfger H, Mamnun Y M, Kuchler K. Fungal ABC proteins: Plei-

otropic drug resistance, stress response and cellular detoxification.

Res Microbiol, 2001, 152: 375—389

1 Materials and methods1.1 Strains, plasmids and media1.2 Patient and control sera1.3 Adsorption of sera1.4 Construction of a genomic expression library of serovar Typhi Ty21.5 Screening of IVI antigens of serovar Typhi Ty21.6 Screening antigens identified by IVIAT against sera from subjects

2 Results2.1 Construction and analysis of the expression library2.2 Screening of the expression library for positive clones2.3 Identification of IVI antigens2.4 Immunoreactivities of antigens identified by IVIAT to sera from volunteers

3 Discussion