Bioresource Technology 101 (2010) 1021–1027

Contents lists available at ScienceDirect

Bioresource Technology

journal homepage: www.elsevier .com/locate /bior tech

Identification of fungi associated with municipal compost usingDNA-based techniques

Gregory Bonito a,*, Omoanghe S. Isikhuemhen b, Rytas Vilgalys a

a Biology Department, Duke University, Durham, NC 27708, United Statesb School of Agriculture and Environmental Sciences, North Carolina Agricultural and Technical State University, Greensboro, NC 27411, United States

a r t i c l e i n f o

Article history:Received 17 February 2009Received in revised form 28 August 2009Accepted 28 August 2009Available online 18 September 2009

Keywords:FungiYeastClone libraryDGGEDecomposition

0960-8524/$ - see front matter � 2009 Elsevier Ltd. Adoi:10.1016/j.biortech.2009.08.109

* Corresponding author. Address: Biology DepartmeUniversity, Durham, NC 27708, United States. Tel.: +660 7293.

E-mail address: Gregory.Bonito@duke.edu (G. Bon

a b s t r a c t

Fungi are important in terrestrial decay processes. However, fungi associated with organic decay duringcomposting are still not well known. In this study culture-independent methods were used to identifyfungi associated with composting organic municipal wastes to gain a better understanding of the diver-sity of fungi associated with this process. Fungal communities from 0, 210, and 410 day-old compostsamples were assessed with DNA fingerprinting using denaturing gradient gel electrophoresis (DGGE)and by the analysis of DNA sequences from rDNA clone libraries. From 207 rDNA sequences, 82 fungalOTU’s were detected. A disproportionate number of yeast sequences were detected in Day 0 clonelibraries, including the human pathogens Candida tropicalis and Candida krusei (Saccharomycetales).Basidiomycetes accounted for over half of the clones from the Day 210 sample. Clones of Cercophoraand Neurospora species accounted for most of the fungal clones of the Day 410 sample. No Zygomycetesor Aspergillus species were detected in this study. These findings call for a reassessment of long held viewsabout the organisms involved in the composting of organic municipal wastes.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

Composting organic wastes is an important pathway for carbonflow and cycling of nutrients, both in industrial and developingcountries. Our knowledge of the microbiology of this process islimited, particularly concerning the fungi. Culture-based studieshave yielded important, yet limited, information on fungal diver-sity in compost. The use of molecular tools is expected to increaseawareness of the specific fungi involved in the composting process,due to the increased sensitivity of molecular methods over culture-based approaches for detecting microbial diversity. Knowledge ofthe fungi involved in composting could be valuable to microbialengineering efforts aimed at managing and improving the effi-ciency of composting and biomass-conversion processes.

Modern large-scale composting is accomplished by grinding or-ganic matter into smaller particles, which are conveyed into longrows (windrows). The composting process is characterized by fourphases: (1) the initial mesophilic phase (10–42 �C) during whichthe temperature rapidly rises, (2) the thermophilic phase (45–70 �C) distinguished by prolonged high temperatures, (3) the mid-dle mesophilic phase (65–50 �C) during which temperatures de-crease, and (4) the finishing phase (50–23 �C) during which the

ll rights reserved.

nt, Campus Box 90338, Duke1 919 660 7363; fax: +1 919

ito).

organic matter and biological heat production stabilize (Miller,1996; Ryckeboer et al., 2003a,b). Although composting is consid-ered to be an aerobic microbial process (Isikhuemhen et al.,1996), the high biological oxygen demand may lead to anaerobicfermentation. Forced aeration may be used to prevent anaerobicconditions and to accelerate the composting cycle (Fasidi et al.,1996; Kulcu and Yaldiz, 2004).

Although fungi are known to dominate terrestrial decomposi-tion processes, their importance in composting is considered tobe minor in comparison to that of bacteria (Miller, 1996). This isbecause self-heating that occurs during composting may reachtemperatures too extreme for survival of eukaryotic organisms(>65 �C) and sometimes high enough to induce spontaneous com-bustion (Waksman et al., 1939; Cooney and Emerson, 1964; Peterset al., 2000; Ryckeboer et al., 2003a,b). Fungi have been culturedfrom all four phases of the compost cycle, but appear most preva-lent during the initial and middle mesophilic phases (De Bertoldiet al., 1983; Ryckeboer et al., 2003a,b). The most dominant fungicultured from the mesophilic phases are species in the genera Acre-monium, Alternaria, Aspergillus, Chaetomium, Cladosporium, Emeri-cella, Fusarium, Geotrichum, Mortierella, Mucor, Pencillium,Pseudallescheria, Scopulariopsis and Trichoderma. Absidia, Aspergil-lus, Chaetomium, Coprinus, Mucor, Paecilomyces, Penicillium, Rhizo-mucor, Scytalidium and Thermomyces are thermotolerant generathat have been isolated at higher temperatures (Waksman et al.,1939; Ghazifard et al., 2001; Vijay et al., 2002; Ryckeboer et al.,2003a,b; Anastasi et al., 2005). Pathogenic fungi recovered from

1022 G. Bonito et al. / Bioresource Technology 101 (2010) 1021–1027

composts include: Aspergillus sp., Phialophora richardsii, Geotrichumcandidum, Trichophyton, Epidermophyton, Candida albicans, C. krusei,C. tropicalis, C. guillermondii, Cryptococcus neoformans, and Tricho-sporon sp., however these fungi are typically associated with com-posts amended with sewage sludge additions (Gaby, 1975; Burgeand Miller, 1980; De Bertoldi et al., 1983; Dumontet et al., 2001).

Most information concerning the biology of composting isbased on direct observation and culture studies. Culture-basedstudies may be biased against more fastidious or unculturableorganisms. Culture-independent DNA-based methods offer analternative approach to studying microbial diversity, and are usu-ally more sensitive in detecting species than culturing. DNA se-quence and fingerprinting approaches have already been usedsuccessfully to profile and characterize fungal communities in soils(O’Brien et al., 2005; Perez-Piqueres et al., 2006; Anderson et al.,2008; Bates and Garcia-Pichel, 2009). This pilot study was con-ducted to determine the feasibility of using DNA sequencing andfingerprinting to identify fungi associated with compost producedby the local municipality.

2. Methods

2.1. Study site

Compost samples were taken from three windrows at the Cityof Durham Composting Facility, North Carolina, USA during June2004. This facility does not use forced aeration or irrigation, andconsequently, a complete composting cycle may last for over16 months. The source material of the sampled compost consistedof an unspecified mix of the following substrates that were col-lected from city residences and shredded: grass clippings, treebranches/stumps, and wood pallets, although small amounts ofplastic and metal inevitably ended up in the mix. No wastewateror biosolid sludge was added to the composting mix. Windrowswere moved and mixed about every 6 months with heavy equip-ment, and large uncomposted debris was separated out duringthese times. Sampling dates and times were coordinated withwindrow mixing dates to ensure field samples were wellhomogenized.

2.2. Sampling

Compost windrows were sampled during spring and included; amix of freshly shredded substrates (Day 0) that had accumulatedover a few months, material that had composted 7 months andthat was being mixed and separated for the first time (Day 210),and finished compost that was being mixed and separated for athird time (Day 410). For each time period sampled, approximately0.5 m3 of homogenized compost was collected from the conveyerbelt after mixing. Compost windrow temperatures were measuredin the field by inserting a thermometer 0.3 m into each newlyformed compost windrow and taking a measurement after15 min. Samples were immediately brought back to the laboratoryfor processing and were thoroughly mixed and shaken. Sub-sam-ples were then taken to calculate field moisture, pH, and carbonand nitrogen concentrations.

Sub-samples for carbon and nitrogen analysis were freeze-driedbefore being ground to a fine dust in a Wiley mill. Carbon andnitrogen concentrations were analyzed on a Carlo Erba ElementalAnalyzer (Milan, Italy). Equal volumes of compost sample anddeionized water were stirred into a slurry in a 250 ml beaker,and after 30 min pH measurements were taken with an Orion310 pH electrode. Percent moisture was calculated by the differ-ence in mass between samples at field moisture and after beingdried in an oven for three days at 65 �C.

Compost samples used for DNA analyses first were sieved(2 mm) and then were frozen in liquid nitrogen and ground to adust with a sterile mortar and pestle. Total DNA was extractedfrom a 0.5 g subsample of this material with the MoBio Laborato-ries Ultraclean Soil DNA extraction kit and according to manufac-turer’s instructions (MoBio, Solana Beach, CA). In order tominimize DNA extraction biases, two DNA extractions were per-formed for each of the three samples. Purified DNA samples wereeluted in 50 ll of sterile double distilled water and were storedat �20 �C until further analysis.

2.3. Molecular methods

Fungal DNA fingerprinting through Denaturing Gel GradientElectrophoresis (DGGE) as outlined by Janse et al. (2004) was usedto assess the complexity of eukaryotic community assemblages inthe compost samples. Total DNA extracted from compost sampleswas PCR amplified with the primers ITS1 (TCCGTAGGT-GAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC), the formerof which was modified with a 40-bp GC clamp (50-CGC CCG CCGCGC GCG GCG GGC GGG GCG GGG GCA CGG GGG G-30) to stopDNA migration during the gel electrophoresis (White et al., 1990;Muyzer et al., 1993). The ITS ribosomal DNA gene region was cho-sen because it shows high variation between most species of fungiin both length and sequence and is commonly used in molecularfungal ecology (Smith et al., 2007; Peay et al., 2008). The PCR pro-tocol included a final extension at 72 �C PCR for 30 min to reducePCR artifacts (Janse et al., 2004). The urea denaturant gradient ofthe gel increased from 0% to 60%.

Although the ITS region is valuable for identifying species andoperational taxonomic units (OTUs), the ribosomal large subunit(LSU) is more value for community phylogenetic approaches be-cause it can be aligned across the fungal kingdom. Therefore, forclone libraries, the 5.8S ribosomal gene and both the internal tran-scribed spacer region 2 (ITS2) and a portion of the LSU were ampli-fied from compost DNA extracts using universal primer set 5.8SRand LR5 (Vilgalys and Hester, 1990). Two PCR reactions were madefor each DNA extract to minimize PCR biases. The PCR protocol be-gan with an initial denaturation at 94 �C for 3 min, followed by 20cycles at 94 �C with a 2 min extension time, 50 �C for 30 s, and72 �C for 1 min, with a final extension at 72 �C for 7 min. Twentycycles were used rather than 35 in order to reduce PCR bias againstrare or long DNA templates. Each 25 ll PCR reaction consisted of0.2 mM each dNTPs, PCR buffer including 1.5 mM of MgCl, 25 lgBSA, 0.5 lM each 5.8SR and LR5 primers, 0.75 U Taq DNA polymer-ase, and 10 ll DNA extract.

PCR products were cloned into Escherichia coli plasmids withthe Topo-TA 5-min PCR cloning kit (Invitrogen, Carlsbad, CA) fol-lowing the manufacturer’s instructions. One clone library wasmade from each PCR reaction, resulting in a total of 12 clone li-braries. Maximum recommended incubation times were used foreach step, and 2 ll of PCR product was used in each reaction. In-serts from white colonies were amplified by adding whole cells di-rectly to PCR reactions using the primer set M13 F and M13 R(Invitrogen, Carlsbad, CA). A ‘‘colony PCR” protocol beginning withan initial denaturation of 94 �C for 10 min, followed by 20 cycles of94 �C for 1 min, 55 �C for 1 min, and 72 �C for 1 min, with a finalextension of 72 �C for 10 min was used to amplify cloned regions.Each 25 ll PCR reaction consisted of 0.2 mM of each dNTPs, PCRbuffer including 1.5 mM of MgCl, 10 lg BSA, 0.5 lM forward pri-mer M13 F, 0.5 lM reverse primer M13 R, 0.75 U Taq DNA poly-merase, and 15 ll water. PCR products containing the insert werepurified by affinity chromatography with QIAquick spin columns(Qiagen, Valencia, CA). Cycle sequencing was performed with BigDye chemistry version 3.1 (Applied Biosystems, Foster City, CA)

G. Bonito et al. / Bioresource Technology 101 (2010) 1021–1027 1023

with the primer 5.8 SR and LR5 and Sanger sequenced with anABI3700 (Applied Biosystems, Foster City, CA).

2.4. Taxonomic and phylogenetic affiliation of compost sequences

A phylogenetic approach was employed to determine taxo-nomic affiliation of generated sequences. Sequences were manu-ally edited with Sequencher 4.0 (Gene Codes, Ann Arbor, MI) andambiguous regions at the ends were trimmed. Operational Taxo-nomic Units (OTUs) were defined as groups of sequences with atleast 97% pairwise similarity within the ITS2 locus, a threshold thatdelimits most fungal species from each other (O’Brien et al., 2005;Peay et al., 2008). Both ITS2 and LSU sequences were queriedagainst the Genbank database using the BLASTN algorithm. Se-quences were identified to the lowest taxonomic rank based onthe top 15 BLASTN hits, E-values and percent similarity. The LSUregion of sequences clone libraries were grouped at 99% similarity(to remove replicate OTUs) with MacClade 4.0 (Maddison andMaddison, 2000) and were combined into an alignment with near-est LSU BLAST results and reference taxa from the Assembling theFungal Tree of Life project (http://aftol.org/). Ambiguously alignedregions were excluded from the alignment. Phylogenetic analyseswere conducted using PAUP 4.0 using Neighbor Joining algorithmand a Jukes-Cantor model of evolution (Swofford, 2002). Sequencesfrom this study have been deposited in Genbank under the acces-sion numbers DQ900939–DQ901007.

3. Results

3.1. Compost sample attributes

Physical and chemical measurements from compost samplesare presented in Table 1. The initial Day 0 sample was mesophilic(29.4 �C). Samples representing Day 210 (55.0 �C) and Day 410(51.7 �C) were above the 50 �C threshold widely used for designat-

Table 1Attributes of organic municipal compost samples used in this study.

Compost phase Age(days)

Temperature(�C)

Moisture con(%)

InitialMesophilic

0 29.4 22.61

MiddleMesophilic

210 55.0 28.40

Finishing 410 51.7 30.88

Fig. 1. Proportion of fungal and non-fungal groups recovered from DNA sequence analysand increasing taxonomic breadth between samples suggestive of ecosystem succession

ing fungi as thermotolerant. In terms of pH, the Day 0 sample wasslightly acidic (pH 5.8), and the Day 210 and Day 410 samples wereneutral (pH 7.0). Carbon to nitrogen ratios ranged from 208 (Day 0)to 21 (Day 410).

3.2. Fungal DNA fingerprinting

The differences in banding patterns seen by DGGE communityfingerprinting reveals dramatic shifts between the three time peri-ods sampled (Fig. 2). Species richness in compost samples wasmoderate, as shown by the many bands. There were prominentbands during each compost phase, and these differed betweencompost samples. PCR products from Day 210 and Day 410 sam-ples were dominated by fewer bands that appeared further downthe denaturant concentration gradient.

3.3. Sequence diversity from clone libraries

In this study, 207 sequences consisting of 82 fungal OTUs andrepresenting a broad diversity of fungi were generated from clonelibraries. There was no sequence overlap between the three sam-pled time periods. Although sequence recovery was disproportion-ate between phases, we recovered 81 sequences representing 27OTUs at Day 0, 46 sequences representing 32 OTUs sample atDay 210, and 80 sequences representing 23 OTUs at Day 410.The Day 0 sequences were dominated by Ascomycetes (85%), whilethe majority of Day 210 sequences belonged to Basidiomycetes(51%). The majority of sequences at Day 410 were of ascomycetousfungi (43%) and Stramenopiles (42%) (Fig. 1).

3.4. Phylogenetic analysis of clone library sequences from compostsamples

The phylogenetic placement of fungi sequenced from LSU clonelibraries from these compost samples is shown in Fig. 3. Of partic-

tent Carbon(%)

Nitrogen(%)

C:N pH

47.22 0.227 208 5.8

24.93 0.804 31.0 7.0

19.56 0.922 21.2 7.0

is during three time periods of the composting cycle. Note the drastic shifts in biota.

Fig. 2. Fungal community DNA fingerprint: Denaturing Gradient Gel Electropho-resis acrylamide gel based on ITS2 DNA amplification for three time periods(SC = Day 0, MC = Day 210, FC = Day 410) during the composting process. Notice thedifferent banding patterns for each phase and how replicate PCR products (1 and 2)give reproducible fingerprints.

1024 G. Bonito et al. / Bioresource Technology 101 (2010) 1021–1027

ular interest is the lack of sequences from Zygomycete (i.e. Morti-erella, Mucor, Rhizopus) and Eurotialean (i.e. Penicillium, Aspergillus,Emericella) fungi recovered from clone libraries.

Fungal sequences dominated Day 0 clones, while sequences ofProtists were recovered from Day 210 and to a greater extent inDay 410 clone libraries. Because this research focused on fungi,and the fact that BLAST results of LSU sequences of Protists andStramenopiles had low E-values and maximum identity scores, se-quences belonging to non-fungal organism were removed fromfurther analyses. The greatest proportion of sequences at Day 0 be-longed to yeasts, particularly the Saccharomycetales, howeverBasidiomycete yeasts in the Tremelloid clade were also recovered,as were filamentous fungi in the Sordariomycetes and Agaricales.At Day 210, Ascomycetes in the Sordariomycetes, a Dothideomyc-ete, and Basidiomycetes grouping within the Ustilaginomycetesand Agaricales clades were recovered. At Day 410, most of the fun-gal sequences generated belonged within two Ascomycete groups:the Sordariomycetes and Pezizomycetes.

Species designations for sequences generated based on top ITS2BLAST hits in this study are presented in Table 2. These results re-vealed that 48 of the 81 sequences recovered from Day 0 were of

Candida tropicalis, a facultative human pathogen (Wingard et al.,1979; Diezmann et al., 2004). Other pathogenic yeasts detectedin the Day 0 clone libraries were Candida krusei and Trichosporonasahii (Samaranayake and Samaranayake, 1994; Chowdharyet al., 2004). The plant biotrophs Nectria haematococca and Bot-ryosphaeria dothidea were also sequenced from the initial meso-philic phase sample.

4. Discussion

4.1. Methodological considerations

In this study, DNA-based methods were used to explore fungaldiversity during composting. DNA fingerprinting through DGGEand clone library DNA sequence analyses identified different fungaltaxa and a higher richness of fungi associated with compost thanhave studies based on culturing approaches (Waksman et al.,1939; Cooney and Emerson, 1964; Kane and Mullins, 1973; De Ber-toldi et al., 1983; Barlaz, 1996; Ivors et al., 2002). We found DNAfingerprinting using DGGE to be a cost effect method to provide vi-sual screening of the community richness (or complexity) withinsamples. One clear advantage to this approach is that many sam-ples can be run simultaneously and in a relatively short period oftime, although it may be difficult to compare samples across differ-ent gels. The resolution of DGGE can be enhanced by cutting andsequencing bands although this was not attempted in this study(Bastias et al., 2006).

The clone library/sequence approach provided a detailed per-spective of the particular species composition in the samples, al-beit at a greater cost. Screening clones using restriction fragmentlength polymorphisms (RFLP) would have reduced the number ofredundant sequences produced in this study, and could be consid-ered as an approach to better access species richness in sampleswhen limited by financial resources. In addition, the use of fun-gal-specific primers such as ITS1F would have eliminated the gen-eration of non-fungal sequences, which constituted a largeproportion data recovered from the middle mesophilic and finish-ing phases.

4.2. Microbial ecology considerations

In this study we did not find any sequence overlap between thethree sets of samples, which were selected from different win-drows in order to represent distinct compost phases. However, itis uncertain whether these detected differences are due to differ-ences in the initial microbial community or substrate materials,or whether they result from successional changes duringcomposting.

A high proportion of yeast sequences were recovered from DNAclone libraries in the initial stage of composting. Many of the yeastsequences produced in this study were from opportunistic humanpathogens and were only sequenced from the initial compost sam-ples. Other studies have also reported on the presence of yeastsduring the early stages of composting (Garrett, 1951; Hansgateet al., 2005). We have verified the presence of both Candida tropi-calis and Candida krusei in early composts and wood mulchesthrough culturing on Candida CHROMagar (CHROMagar, Paris)selective media. Current work is underway to calculate the patho-gen load, characterize the genetic diversity, and assess the degreeof pathogenicity of isolates from environmental sources (Bonito,unpublished). High pathogen loads in composts could be a publichealth concern, and may represent an unidentified genetic reser-voir for these organisms. Although plant and animal pathogenswere found in the initial mesophilic stage, few pathogenic specieswere recovered from samples representing the later stages of com-

Fig. 3. Phylogenetic placement of fungi sequenced from composting municipal yard waste: sequences are coded according to compost phase from which they were extractedand amplified: SC = Day 0; MC = Day 210; FC = Day 410. Replicate compost clone sequences were removed by collapsing at the 99% similarity level. Groups with replicates arenotated by an underscore after their name, followed by the number of sequences in this group. This Neighbor Joining phylogram is based on a Jukes-Cantor model of evolutionand DNA sequence alignment of 75 LSU rDNA sequences. The alignment included 698 characters. Of the 388 included characters, 212 were constant and 176 were variable.

G. Bonito et al. / Bioresource Technology 101 (2010) 1021–1027 1025

posting suggesting that the composting process is effective in theremoval of fungal pathogens, as reported previously (Kane andMullins, 1973; Burge and Miller, 1980; De Bertoldi et al., 1983).

Basidiomycetes are known to produce powerful degradation en-zymes (Waksman and Nissen, 1932; Fasidi et al., 1996; Isikhuemhenet al., 1996; Tuomela et al., 2000). Most Basidiomycetes associatedwith composting produce conspicuous mushrooms (such as Copri-nus) (Waksman and Nissen, 1932; Anastasi et al., 2005), however,this study suggests numerous other Basidiomycetes with less con-spicuous fruit bodies are also associated with composting organicmatter. A large number of non-fungal eukaryotes (e.g. Protists andMetazoa) accounted for nearly a third of the sequences recoveredfrom Day 210 clone libraries. Sequences from the Day 410 clone li-

braries were dominated by Ascomycetes, but half of the sequencesbelonged to Stramenopiles, Alveolates, Metazoans, and Chytridio-mycetes suggesting the development of a complex food web.

Important questions remain concerning fungal diversity incomposts: Do microbial communities in compost ecosystems fol-low similar trajectories in terms of species succession and turn-over, given the same substrate material? Does the diversity ofmicrobes in compost arise from the source material itself (autoch-thonous), or do organisms disperse into the system from the sur-rounding environment (allochthonous)? Is there any impact ofgeography or latitude on the composting process or on the organ-isms involved in the process? Additional data, including replicatedsampling are needed to address these questions.

Table 2Top BLAST results for ITS2 ribosomal DNA sequences of fungi cloned from samples of composting organic municipal waste compost of three different ages.

OTU Sample Top BLAST hit Percentage similarity Classification Frequency

1 Day 0 Candida tropicalis 99–100 Saccharomycetales 482 ‘‘ Candida rugosa 92–100 Saccharomycetales 133 ‘‘ Candida krusei 99–100 Saccharomycetales 54 ‘‘ Trichosporon asahii 100 Trichosporonales 45 ‘‘ Entrophospora contigua 99 Diversisporales 26 ‘‘ Hyphodontia tropica 100 Aphyllophorales 27 ‘‘ Nectria haematococca 100 Hypocreales 18 ‘‘ Dipodascus australiensis 100 Saccharomycetales 19 ‘‘ Endothia gyrosa 100 Diaporthales 1

10 ‘‘ Botryosphaeria dothidea 100 Pezizomycotina 111 ‘‘ Discosia sp. 99 Xylariales 112 ‘‘ Trichosporon loubieri 99 Trichosporonales 113 ‘‘ Camillea obularia 99 Xylariales 114 Day 210 Leucoagaricus meleagris 99 Agaricales 415 ‘‘ Malassezia restricta 100 Malasseziales 116 ‘‘ Phialophora fastigiata 98 Helotiales 117 ‘‘ Psilocybe coprophila 97 Agaricales 118 ‘‘ Polyporus arcularius 97 Aphyllophorales 119 ‘‘ Ophiostomatales sp. 91 Ophiostomatales 120 ‘‘ Exidiopsis sp. 88 Auriculariales 1

‘‘ No close match – – 3621 Day 410 Cercophora appalachianensis 96 Sordariales 1522 ‘‘ Neurospora sublineolata 99 Sordariales 223 ‘‘ No close match – – 63

1026 G. Bonito et al. / Bioresource Technology 101 (2010) 1021–1027

The rapid and drastic changes in environmental conditions andresource quality during composting provides steep selection gradi-ents, and makes the composting process a useful system for testingmicrobial and ecological theory and for exploring microbial diver-sity (Peters et al., 2000; Alfreider et al., 2002). The aid of DNA-based fingerprinting and sequence-based tools make this endeavorever more possible.

5. Conclusions

In this study, culture-independent methods were used to iden-tify a large number of fungi associated with compost samples.Pathogenic and non-pathogenic yeasts were particularly abundantin the starting compost sample, and their abundance decreasedwith composting. Although Zygomycetes are considered to becommonly associated with compost, these fungi are not repre-sented in clone libraries suggesting they are ephemeral. This workdemonstrates the value of molecular tools for providing high reso-lution ‘‘snap-shots” of microbial communities within compostsamples, which allows for the identification of fungal species thatare fastidious to culture.

Acknowledgements

This research was funded through a Mellon Foundation System-atics Training Grant and Sigma Xi award to Gregory Bonito, withadditional support from the NSF Duke Forest Mycological Observa-tory (NSF award # 0084207). Special thanks to Valerie Hofstetterfor laboratory assistance, Tim James and Frank Kauff for assistancewith phylogenetic analyses, Ellen Cooper for assistance with DGGEanalysis, and Heath O’Brien, Stephanie Diezmann, Jeri Parrent, DanHenk, and Jason Jackson for useful discussions and reviews of thismanuscript.

References

Alfreider, A., Peters, S., Tebbe, C.C., Rangger, A., Insam, H., 2002. Microbialcommunity dynamics during composting of organic matter as determined by16S ribosomal DNA analysis. Compost Science and Utilization 10 (4), 303–312.

Anastasi, A., Varese, G.C., Marchisio, V.F., 2005. Isolation and identification of fungalcommunities in compost and vermicompost. Mycologia 97 (1), 33–44.

Anderson, I.C., Parkin, P.I., Campbell, C.D., 2008. DNA- and RNA-derived assessmentsof fungal community composition in soil amended with sewage sludge rich incadmium, copper and zinc. Soil Biology and Biochemistry 40 (9), 2358–2365.

Barlaz, M., 1996. Microbiology of solid waste landfills. In: Palmisano, A.C., Barlaz,M.A. (Eds.), Microbiology of Solid Waste. CRC Press, Boca Raton, Florida, pp. 31–70.

Bastias, B.A., Huang, Z.Q., Blumfield, T., Xu, Z.H., Cairney, J.W.G., 2006. Influence ofrepeated prescribed burning on the soil fungal community in an easternAustralian wet sclerophyll forest. Soil Biology and Biochemistry 38 (12), 3492–3501.

Bates, S.T., Garcia-Pichel, F., 2009. A culture-independent study of free-living fungiin biological soil crusts of the Colorado Plateau: their diversity and relativecontribution to microbial biomass. Environmental Microbiology 11 (1), 56–67.

Burge, W.D., Miller, P.D., 1980. Health Aspects of Composting: Primary andSecondary Pathogens. Ann Arbor Sci. Pub. Inc., Ann Arbor, MI.

Chowdhary, A., Ahmad, S., Khan, Z.U., Doval, D.C., Randhawa, H.S., 2004.Trichosporon asahii as an emerging etiologic agent of disseminatedtrichosporonosis: a case report and an update. Indian Journal of MedicalMicrobiology (22), 16–22.

Cooney, D.G., Emerson, R., 1964. Thermophilic Fungi – An Account of Their Biology,Activities and Classification. W.H. Freeman & Co., San Francisco, CA.

De Bertoldi, M., Vallini, G., Pera, A., 1983. The biology of composting: a review.Waste Management Resources 1, 157–176.

Diezmann, S., Cox, C.J., Schonian, G., Vilgalys, R.J., Mitchell, T.G., 2004. Phylogenyand evolution of medical species of Candida and related taxa: a multigenicanalysis. Journal of Clinical Microbiology 42 (12), 5624–5635.

Dumontet, S., Scopa, A., Kerje, S., Krovacek, K., 2001. The importance of pathogenicorganisms in sewage and sewage sludge. Journal of the Air and WasteManagement Association 51 (6), 848–860.

Fasidi, I.O., Isikhuemhen, O.S., Zadrazil, F., 1996. Bioreactors for solid statefermentation of lignocellulosics. Journal of Scientific and Industrial Research55 (5–6), 450–456.

Gaby, W.L., 1975. Evaluation of health hazards associated with solid waste/sewagesludge mixtures. US EPA Report EPA-670/2-75-023, NTIS PB 241810.

Garrett, S.D., 1951. Ecological groups of soil fungi: a survey of substraterelationships. New Phytologist 50, 110–166.

Ghazifard, A., Kasra-Kermanshahi, R., Far, Z.E., 2001. Identification of thermophilicand mesophilic bacteria and fungi in Esfahan (Iran) municipal solid wastecompost. Waste Management and Research 19 (3), 257–261.

Hansgate, A.M., Schloss, P.D., Hay, A.G., Walker, L.P., 2005. Molecularcharacterization of fungal, community dynamics in the initial stages ofcomposting. FEMS Microbiology Ecology 51 (2), 209–214.

Isikhuemhen, O.S., Zadrazil, F., Fasidi, I.O., 1996. Cultivation of white rot fungi insolid state fermentation. Journal of Scientific and Industrial Research 55 (5–6),388–393.

Ivors, K., Beyer, D., Wuest, P., Kang, S., 2002. Survey of fungal diversity in mushroomcompost using sequences of PCR-amplified genes encoding 18S ribosomal RNA.In: Insan, H., Riddeck, N., Klammer, S. (Eds.), Microbiology of Composting.Spinger-Verlag, New York, pp. 17–24.

Janse, I., Bok, J., Zwart, G., 2004. A simple remedy against artifactual double bands indenaturing gradient gel electrophoresis. Journal of Microbiological Methods 57(2), 279–281.

G. Bonito et al. / Bioresource Technology 101 (2010) 1021–1027 1027

Kane, B.E., Mullins, J.T., 1973. Thermophilic fungi in a municipal waste compostsystem. Mycologia 65 (5), 1087–1100.

Kulcu, R., Yaldiz, O., 2004. Determination of aeration rate and kinetics of compostingsome agricultural wastes. Bioresource Technology 93 (1), 49–57.

Maddison, W.P., Maddison, D.R., 2000. Macclade 4.0. Sinauer Associates,Sunderland, Massachusetts.

Miller, F.C., 1996. Composting of municipal solid waste and its components. In:Palmisano, A.C., Barlaz, M.A. (Eds.), Microbiology of Solid Waste. CRC Press, BocaRaton, Florida, pp. 115–154.

Muyzer, G., De Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbialpopulations by denaturing gradient gel electrophoresis analysis of polymerasechain reaction-amplified genes coding for 16S rRNA. Applied andEnvironmental Microbiology 59 (3), 695–700.

O’Brien, H.E., Parrent, J.L., Jackson, J.A., Moncalvo, J.M., Vilgalys, R., 2005. Fungalcommunity analysis by large-scale sequencing of environmental samples.Applied and Environmental Microbiology 71 (9), 5544–5550.

Peay, K.G., Kennedy, P.G., Bruns, T.D., 2008. Fungal community ecology: a hybridbeast with a molecular master. Bioscience 58 (9), 799–810.

Perez-Piqueres, A., Edel-Hermann, W., Alabouvette, C., Steinberg, C., 2006. Responseof soil microbial communities to compost amendments. Soil Biology andBiochemistry 38 (3), 460–470.

Peters, S., Koschinsky, S., Schwieger, F., Tebbe, C.C., 2000. Succession of microbialcommunities during hot composting as detected by PCR-single-strand-conformation polymorphism-based genetic profiles of small-subunit rRNAgenes. Applied and Environmental Microbiology 66 (3), 930–936.

Ryckeboer, J., Mergaert, J., Coosemans, J., Deprins, K., Swings, J., 2003a.Microbiological aspects of biowaste during composting in a monitoredcompost bin. Journal of Applied Microbiology 94 (1), 127–137.

Ryckeboer, J., Mergaert, J., Vaes, K., Klammer, S., De Clercq, D., Coosemans, J., Insam,H., Swings, J., 2003b. A survey of bacteria and fungi occurring during

composting and self-heating processes. Annals of Microbiology 53 (4), 349–410.

Samaranayake, Y.H., Samaranayake, L.P., 1994. Candida krusei – biology,epidemiology, pathogenicity and clinical manifestations of an emergingpathogen. Journal of Medical Microbiology 41 (5), 295–310.

Smith, M.E., Douhan, G.W., Rizzo, D.M., 2007. Intra-specific and intra-sporocarp ITSvariation of ectomycorrhizal fungi as assessed by rDNA sequencing ofsporocarps and pooled ectomycorrhizal roots from a Quercus woodland.Mycorrhiza 18 (1), 15–22.

Swofford, D.L., 2002. PAUP*: phylogenetic analysis using parsimony (* and othermethods) 4.0. Sinauer Associates, Sunderland, Massachusetts.

Tuomela, M., Vikman, M., Hatakka, A., Itavaara, M., 2000. Biodegradation of lignin ina compost environment: a review. Bioresource Technology 72 (2), 169–183.

Vijay, B., Sharma, S.R., Lakhanpal, T.N., 2002. Role of thermophilic fungi in compostproduction for Agaricus bisporus. Journal of Mycology and Plant Pathology 32,204–210.

Vilgalys, R., Hester, M., 1990. Rapid genetic identification and mapping ofenzymatically amplified ribosomal DNA from several Cryptococcus species.Journal of Bacteriology 172 (8), 4238–4246.

Waksman, S.A., Nissen, W., 1932. On the nutrition of the cultivated mushroom,Agaricus campestris, and the chemical changes brought about by this organismin the manure compost. American Journal of Botany 19 (6), 514–537.

Waksman, S.A., Umbreit, W.W., Cordon, T.C., 1939. Thermophilic actinomycetes andfungi in soils and in composts. Soil Science 47 (1), 37–61.

White, T.M., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing offungal ribosomal RNA for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky,J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications.Academic Press, San Diego, CA, pp. 315–321.

Wingard, J.R., Merz, W.G., Saral, R., 1979. Candida tropicalis – major pathogen inimmunocompromised patients. Annals of Internal Medicine 91 (4), 539–543.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具