ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic...

49
Bart De Moor ESAT-SCD Katholieke Universiteit Leuven A: Kasteelpark Arenberg 10, B-3001 Leuven Belgium T: +32(0)475 2 8 7052 W: www.esat.kuleuven.be/~demoor E: [email protected] ICT and eHealth New scientific challenges

Transcript of ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic...

Page 1: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Bart De Moor

ESAT-SCDKatholieke Universiteit Leuven

A: Kasteelpark Arenberg 10, B-3001 LeuvenBelgium

T: +32(0)475 2 8 7052W: www.esat.kuleuven.be/~demoorE: [email protected]

ICT and eHealth

New scientific challenges

Page 2: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Outline

-Trends

-Context

-Opportunities and challenges

-What to do ?

2

Page 3: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Trends

I. Exponential evolution in ICT, medical and bio-technology

II. Tsunami of data

III. Inter-, cross-, and multi-disciplinarity

IV. Societal demands

V. Translational gap

3

Page 4: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Gordon Moore’s law

0

1 10 9

2 10 9

3 10 9

4 10 9

5 10 9

6 10 9

1975 1980 1985 1990 1995 2000 2005 2010

Year

BookkeepingAudio

Video

3D games

LUI

Op

erati

on

s/

seco

nd

‘Understand’ ?

4

Page 5: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Broad band capacity

5

Page 6: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Tsunami of data

-New technologies generate more data

-Increased spatial and temporal resolution

-More studies per patient, more datasets per study

Virtual colonoscopy from CT images

with automatically detected polyps

subtraction CT angiography

6

Page 7: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

transcriptome proteome metabolome interactomegenome

ACACATTAAATCTTATATGC

TAAAACTAGGTCTCGTTTTA

GGGATGTTTATAACCATCTT

TGAGATTATTGATGCATGGT

TATTGGTTAGAAAAAATATA

CGCTTGTTTTTCTTTCCTAG

GTTGATTGACTCATACATGT

GTTTCATTGAGGAAGGAAC

TTAACAAAACTGCACTTTTT

TCAACGTCACAGCTACTTTA

AAAGTGATCAAAGTATATCA

AGAAAGCTTAATATAAAGAC

ATTTGTTTCAAGGTTTCGTA

AGTGCACAATATCAAGAAG

ACAAAAATGACTAATTTTGT

TTTCAGGAAGCATATATATT

ACACGAACACAAATCTATTT

TTGTAATCAACACCGACCAT

GGTTCGATTACACACATTAA

ATCTTATATGCTAAAACTAG

GTCTCGTTTTAGGGATGTTT

ATAACCATCTTTGAGATTAT

TGATGCATGGTTATTGGTTA

GAAAAAATATACGCTTGTTT

TTCTTTCCTAGGTTGATTGA

PrometaGS-FLX Roche Applied Science 454

7

Page 8: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Making sense of the 1000 $ genome ?

• Human genome project

– Initial draft: June 2000

– Final draft: April 2003

– 13 year project

– $300 million value with 2002 technology

• Personal genome

– June 1, 2007

– Genome of James Watson, co-discoverer of DNA double helix, is sequenced

• $1.000.000

• Two months

• €1000-genome

– Expected 2012-2020

1,00E-07

1,00E-06

1,00E-05

1,00E-04

1,00E-03

1,00E-02

1,00E-01

1,00E+00

1,00E+01

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

1,00E+09

1,00E+10

1,00E+11

1990 1995 2000 2002 2005 2007 2010 2015

Cost per base pair

Genome cost

Year Cost per base pair Genome cost

1990 10 3E+10

1995 1 3.000.000.000

2000 0.2 600.000.000

2002 0.09 270.000.000

2005 0.03 90.000.000

2007 0.000333333 1.000.000

2010 3.33333E-06 10000

2015 0.0000001 300

8

Page 9: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Moore versus Carlson

9

Page 10: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

By 2010, 1/3 of all world data bases will consist of biomedical data 10

Text mining

Page 11: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Analysis bottlenecks

# Genetic data

Complexity

Price pbp

Interpretability

Analysis bottleneck

11

Page 12: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Outline

-Trends

-Context

-Opportunities and challenges

-What to do ?

12

Page 13: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Obama

http://www.whitehouse.gov/blog/09/04/27/The-Necessity-of-Science/

But in order to lead in the global economy and to ensure that our businesses can grow and innovate, and our familiescan thrive, we're also going to have to address the shortcomings of our health care system.

The Recovery Act will support the long overdue step of computerizing America's medical records, to reduce theduplication, waste and errors that cost billions of dollars and thousands of lives. But it's important to note, theserecords also hold the potential of offering patients the chance to be more active participants in the prevention andtreatment of their diseases. We must maintain patient control over these records and respect their privacy. At thesame time, we have the opportunity to offer billions and billions of anonymous data points to medical researcherswho may find in this information evidence that can help us better understand disease.

History also teaches us the greatest advances in medicine have come from scientific breakthroughs, whether thediscovery of antibiotics, or improved public health practices, vaccines for smallpox and polio and many other infectiousdiseases, antiretroviral drugs that can return AIDS patients to productive lives,pills that can control certain types of blood cancers, so many others.

Because of recent progress –- not just in biology, genetics and medicine, but also in physics, chemistry, computerscience, and engineering –- we have the potential to make enormous progress against diseases in the comingdecades. And that's why my administration is committed to increasing funding for the National Institutes of Health,including $6 billion to support cancer research -- part of a sustained, multi-year plan to double cancer research in ourcountry. (Applause.)

13

Page 14: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Rationales for eHealth -Improve quality performance of health decision/diagnosis systems

-Support individual medical doctor -Avoid/decrease number of medicial errors -Web portal for Evidence Based Medicine

-Organised access to literature-Examples: UK, Norway, Sweden, Finland

-Information sharing among doctors -avoid/monitor patient (s)hopping behavior-Global Medical File per patient -Interoperability

-Deal with ‘empowerment of the patient’: Patient-centric health care -Medical care in 4P: personalized, preventive, predictive, participatory -Increasing trend for ‘customized’’personalized’ medicine -Improve transparancy and consistency -Deal/cope with ‘professional’ (chronical) patients (heart, diabetes, cancer,…) -Improve patient mobility

-Cost effectiveness of the health care system -Ageing population:

-EU 2050: 65+ +70%; 80+ +180%-Vl. 2012: 60+ 25 % of Vl.

-Monitor overconsumption -Improve transparancy -Detect abnormalities in diagnosis/therapy/…

-Cope with tsunami of available information and data (clinical, population, ….) 14

Page 15: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Outline

-Trends

-Context

-Opportunities and challenges

-What to do ?

15

Page 16: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Examples and cases

• Diagnosis via DNA-chips

• Gene prioritization via multiple sources

• International Ovarian Tumor Analysis

Page 17: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Test Ref.

High Low

Low High

High High

Low Low

Microarrays – DNA-chips

Page 18: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

18

Algorithm

- Abu Ja'far Muhammad ibn Musa al-Khwarizmi was born in Uzbekistan around 800 A.D.

- His name persists in the word 'algorithm'.

- Main work: “De kunst van het overbrengen en het wegstrepen”“ Ilm aljabr wa'l muqabalah”, in which we recognize the root of the word “algebra”.

- al-Khwarizmi also enriched the Arabian number notation with the cipher zero.

- The calculus book by al-Khwarizmi lay hidden in the library of Bagdad before itwas translated in Latin and found its way to Europe, where it was introduced bymathematicians such as Fibonacci (Sicily, 1200), Tartaglia (Venice, 1500), Cardano (Rome, 1500), Vieta (France, 1550), Descartes (France, 1625), before it got its ultimate position in analytic geometry.

Page 19: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

19

Clustering and classification algorithms

black blond

orange

blue

long

short

Hair color

length

Color clothes

FeauturesClustersSimilarityDecision

Page 20: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Microarray data: genetic fingerprints

20

Page 21: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

21

High-throughputgenomics

Data analysis Candidategenes

?Information sources

Candidate prioritization

Validation

Aerts et al, Nature Biotechnology, 2006

Heterogenous data source:gene prioritization

Page 22: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

International Ovarian Tumor Analysis Group (IOTA)

Making it easier to diagnose ovarian cancer

Page 23: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

• Clinicians have to make many decisions concerning the therapy of their patients e.g.:– Diagnosis– Prognosis– Response to therapy

Clinician Diagnosis

Page 24: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

• Clinicians have to make many decisions concerning the therapy of their patients e.g.:– Diagnosis– Prognosis– Response to therapy

Clinician Diagnosis

Prognosis

Page 25: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

• Clinicians have to make many decisions concerning the therapy of their patients e.g.:– Diagnosis– Prognosis– Therapy response

Clinician Diagnosis

Prognosis

Response to

therapy

• Based on expertise

• But often the clinician has

Page 26: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

DATAClinician Diagnosis

Prognosis

Response to

therapy

• Clinicians have to make many decisions concerning the therapy of their patients e.g.:– Diagnosis– Prognosis– Therapy response

• Based on expertise

• But often the clinician has

– Patient Data

Page 27: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

• Clinicians have to make many decisions concerning the therapy of their patients e.g.:– Diagnosis– Prognosis– Therapy response

• Based on expertise

• But often the clinician has

– Patient Data

• Patient history

• Tumor characteristics

• Ultrasound characteristics

• Tumor markers

Patient history

Tumor

characteristics

Ultrasound

characteristics

Tumor markers

Clinician Diagnosis

Prognosis

Response to

therapy

Page 28: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Patient history

Tumor

characteristics

Ultrasound

characteristics

Tumor markers

Clinician Diagnosis

Prognosis

Response to

therapy

Motivation

• Not all these data types are relevant for every disease

• But for example for the diagnosis of ovarian masses many data types are suspected to be relevant

Page 29: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

• Solution:

Patient history

Tumor

characteristics

Ultrasound

characteristics

Tumor markers

Clinician Diagnosis

Prognosis

Response to

therapy

Page 30: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Motivation

• Solution:

– Clinical decision support modeling

– Building a mathematical model on the data

– Use this model to predict patient outcome• Diagnosis

• Prognosis

• Therapy response

Patient history

Tumor

characteristics

Ultrasound

characteristics

Tumor markers

Clinician

Model

Diagnosis

Prognosis

Response to

therapy

Page 31: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Standardization

• To make sure clinicians everywhere record the same data, they have to agree about their definitions of features

• Standardization of features

• Protocol for data collection

• European Panel of clinicians defined the IOTA features

Page 32: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Clinical Data

• Data gathered by IOTA group

– Standardized multi-centric collection of clinical data

– AIM: diagnose ovarian cancer

– > 60 variables collected, 32 selected relevant for prediction

• Data gathered in two phases:

– Phase 1: 1066 patients in 9 European centers

– Phase 2: 1938 patients in 12 new International centers

Page 33: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Privacy is ensured

Data collection

After input this data is anonymized and a unique code is given

to each patient

Page 34: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Data collection

Page 35: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Leuven

Malmö

Monza

London

Maurepas Paris

RomeNapels

Milan

IOTA phase 1 centers9 centers

Result: Data for 1066 patients

Page 36: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Model building

Accuracy > 90%

Page 37: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Validation of the model

Page 38: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

IOTA phase 2 centers12 new centers

Lund

Prague

Udinese

Lublin

Bologna

Genk

Sardinia

Ontario, Canada

Beijing, China

2x Milan

Napoli

Result: Data from 1938 new patients for validation

Page 39: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

IOTA phase 2numbers

0

200

400

600

800

1000

1200

Italy Belgium Poland United

Kingdom

Czech

Republic

Sweden China Canada

Number of patients

Number of masses

Number of patients

Italy

Belgium

Poland

United Kingdom

Czech Republic

Sweden

China

Canada

Page 40: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Performance comparison

Performance of an expert Performance of IOTA models

Performance of old models

Performance of non-experts

IOTA models improve patient diagnosis in centers where no experts are available

This is the case for the majority of hospitals internationally

Page 41: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Information security aspects

-Multilateral security for community-centric healthcare IT platforms

-System and software security of critical community (e-health) infrastructures

-Enabling technologies for collaborative work in the e-health sector

-Policy negotiation, enforcement and compliance

-Privacy preserving data-mining and statistical databases

-Body Area Networks (implanted devices, wearable devices,…) and Personal Area Networks

- E-government : identity management, delegation, controlled data exchange

41

You share, we care !

Page 42: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

42

Nano-Sensoren en Actuatoren

CMOS Imager

IR Sensor (IMEC)

Blood gas sensor (IMEC)

NeuronSensor (KNS)

Prostate cancer diagnosis (IMEC)

Smart Pill (Ohio State Univ)

Page 43: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

43

Human++ programma IMEC

EEG

Hearing

ECG

Blood

pressureglucose

Implants

Vision

DNA

protein

positioning

Cellular

POTS

WLAN

ww

wN

etw

ork

Transducer

Nodes

Personal

Assistant

Page 44: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Leuven - BELGIUM

Multidisciplinary team

Dr. Coli The bacterial drug

delivery system

44

Synthetic Biology

Page 45: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Overview

7 subsystems

Global system

Modeling

Memory

Input

Filter

Reset

InverTimer

Cell Death

Output

45

Page 46: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Outline

-Trends

-Context

-Opportunities and challenges

-What to do ?

46

Page 47: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Positioning IBBT

IBBT = Interdisciplinary Institute for

Broadband Technology

1 out of 4 strategic research centers (SOC)

in Flanders

Virtual: expertise of university research

groups

Link between research and industry

Page 48: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Structure IBBT

5 research departments

Digital Society

Future Media

Future Health

eSecurity

Future Internet

Page 49: ICT and eHealth New scientific challengesbdmdotbe/bdm2013/documents/Le… · c h a ra c te ris tic s U ltra s o u n d c h a ra c te ris tic s T u m o r m a rk e rs C lin ic ia n D

Health Decision Support

knowledge &

technology flows