Genetic characterization of Theobroma cacao L. in Nicaragua

Erwin Manuel Aragon ObandoMaster’s thesisUniversity of HelsinkiDepartment of Applied BiologyPlant BreedingAugust, 2009

HELSINGIN YLIOPISTO HELSINGFORS UNIVERSITET UNIVERSITY OF HELSINKI

Tiedekunta/Osasto Fakultet/Sektion Faculty

Faculty of Agriculture and Forestry

Laitos Institution DepartmentDepartment of Applied Biology

Tekijä Författare Author

Erwin Manuel Aragon Obando

Työn nimi Arbetets titel TitleGenetic characterization of Theobroma cacao L Nicaraguan

Oppiaine Läroämne SubjectPlant breeding

Työn laji Arbetets art Level

Master Sciences Thesis

Aika Datum Month and yearAugust 2009

Sivumäärä Sidoantal Number of pages

50Tiivistelmä Referat Abstract

Genetic composition of Theobroma cacao L., including 60 Nicaraguan farmersaccessions, was investigated using nine microsatellite (SSR) markers. Fourteenbreeders accessions from Experimental Center “El Recreo”, INTA, Nicaragua, twoCriollos accession from CATIE, Costa Rica, and two accessions from Ecuadorwere included as reference material. The average PIC value (0.78) indicated ahigh power of discrimination for the nine loci used. A total of 155 alleles weredetected at the nine loci. The number of alleles per marker ranged from 10 to 22with a means of 17.22 alleles per locus. A heterozygosity deficiency (HExp < HObs)was registered for all microsatellite loci. The average expected heterozygositywas=0.68 among Nicaraguan farmers accessions. The Analysis of molecularvariance (AMOVA) showed a low level of differentiation among populations. Thegenetic distances determined for the groups of farmers accessions RAAS andPacifico Sur are closely similar, while a great genetic distance was observedbetween RAAN and RAAS groups. The cluster analysis presented a stronggenetic relation between the Criollo 13 from CATIE and farmers accessionMAT0404. The principal component analysis showed that 7 farmers accessionfrom Nicaragua are genetically related with the accessions Criollo 13 and Yucatanfrom the international accessions. The present study suggested a good possibilityto select farmers accessions to be included in breeding programs, especiallythose accessions related to know Criollo accessions.

Avainsanat Nyckelord Keywords

Genetic differentiation, Genetic diversity, microsatellites, Farmers and BreedersaccessionSäilytyspaikka Förvaringsställe Where deposited

Muita tietoja Övriga uppgifter Further informationSupervised by : Helena Korpelainen –- helena.korpelainen@helsinki.fi

CONTENTS

1. Introduction...............................................................................................4 1.1 Origin and domestication..................................................................4 1.2 Morphology and varieties of Theobroma cacao L...........................6 1.3 Importance of production and use of Theobroma cacao ...............8

2. Objectives..................................................................................................93. Materials and methods...........................................................................10 3.1 Plant materials ..................................................................................10

3.2 DNA extraction ..................................................................................16 3.3 Microsatellite analysis ......................................................................16 3.4 Capillary electrophoresis and data collection................................17 3.5 Data Analysis.....................................................................................18 3.5.1 Genetic diversity ......................................................................18 3.5.2 Genetic differentiation .............................................................19 3.5.3 Genetic distances ....................................................................20 3.5.4 Cluster analysis........................................................................20 3.5.5 Principal component analysis.................................................21

4. Results.....................................................................................................21 4.1 Genetic diversity of Nicaraguan farmers accessions....................22 4.2 Genetic diversity of Nicaraguan farmers accessions at group level.........................................................................................22

4.3 Genetic distances.............................................................................24 4.4 Cluster analysis.................................................................................25 4.5 Principal component analysis..........................................................27

5. Discussion...............................................................................................295.1 Genetic diversity and population structure....................................29

5.2 Differentiation among groups and genetic proximities ................326. Conclusions ............................................................................................347. Acknowledgements ................................................................................358. List of references....................................................................................369. Appendices .............................................................................................44

4

1. Introduction

1.1 Origin and domestication

Sterculiaceae family has 70 genera and 1,500 species of tropical tree, which the

most famous and important species is Theobroma cacao L. (2n = 20) due to its

economic importance. Theobroma cacao L. is native to the tropical rainforest

and considered exclusive of the neotropical area, with a natural distribution in

rainforests, extended from the Amazon basin to southern Mexico (Dias 2001).

However, the origin and domestication have been controversial and widely

discussed due to wide geographic distribution of Theobroma cacao L.

The first propose about origin was done by Vavilov, who has indicated as

Mexico and Andes as centers of diversity, but it was rejected by F.J Pound in

1937/1938, who found an extensive variability in the wild cocoa trees of

Ecuador. According to Chessman (1944), based on Vavilov theory and the

variability of cacao reported by Pound argued that center of origin of

Theobroma cacao was located in 400 km radius of the Amazon River, in the

vicinity of the rivers Napo, Caqueta and Putumayo. Chessman suggested the

possible migration two groups of subspecies of cacao, one towards Venezuela

and other towards Central America, which the isthmus of Panama was a barrier

that helped to evolved independently the differentiation among both groups. The

Venezuelan group was called as Forastero and Central America group was

called Criollo.

More recently, through to biotechnology tools, Motamayor et al (2002)

compared the genetic diversity of cacao populations from Mesoamerica (Mexico

and Central America) and South America population. They concluded that

Criollo populations found in Lacadamia, Mexico, would consider as near to wild

population found in Peru, established as the center of origin. However, Ogata et

al. (2006) suggested include more samples from Oaxaca, southern of Veracruz,

(Mexico), Central America, and South America in molecular studies in order to

definite the real center origin due to previous (De la Cruz et al. 1995; Whitkus et

al. 1998) study have discovered unique cultivars in Yucatan, which suggested

that origin of Theobroma cacao L still a mystery.

Theobroma cacao L. is a relatively domesticated species. According to

Motamayor et al. (2002), McNeil (2006), and Bartley (2005), it has been

5

cultivated in Central America already since pre-Columbian times. Cheesman

(1944) suggested Theobroma cacao L in Central America and South America

have evolved independently. Dias (2001), consider that Criollo populations were

originated and cultivated in central America, from Mexico to the south of Costa

Rica, and Forastero existed in the wild state in South America. Among Criollo,

some populations are classified on geographic basis, such as those from

Central America (Mexican and Nicaraguan Criollos) and those from northern

South America (Colombian and Venezuelan Criollos)

There are many evidences that support Mesoamerica domestication for

Theobroma cacao L. Firstly, the cacao word is a Spanish corruption of Nahuatl

(native language) used for the plant and product, but Indigenous peoples called

to the cacao tree as “Cacahuatl” and “Kakawa”.

Theobroma cacao L was more important in Mesoamerican culture (Maya

and Aztec culture) than Southern American culture; due to Theobroma cacao L

was used in religious ceremony and weeding as special beverage (McNeil,

2006). Also, the preparations, use, and consume of cacao, in Mesoamerica,

was different than Southern America. In Mesoamerica the husk, pulp, and seed

of cacao was prepared and consumed of different method by native peoples,

nonetheless, southern America only consumed the pulp; also cacao was used

as currency in many places as Nicaragua.

Bartley (2005) suggested that Theobroma cacao L had less importance in

southern America due to existences of many species that were used as

stimulant (e.g., Erythroxylum coca), nonetheless in Mesoamerica was the

principal sources used as stimulant.

In Nicaragua, there are archeological evidences about importance and

cultivation of Theobroma cacao L. during pre-Columbian period, which has

been located to North of Chinandega, Leon, Granada, and Rivas as centers of

cacao production in pre-Columbian time. In addition, the North of Chinandega

was presumably the existences of sporadic tree in areas inhabited by native

peoples; nevertheless, in department of Rivas were cultivated and managed a

precious tree in fertile lands (Stainbrenner, 2006).

6

1.2 The Morphology and varieties of Theobroma cacao L.

The cacao tree seldom exceeds a height of 7.5 m in cultivations and may go up

to 12.5 m or more in wild growing. The main stem is divided in four to six lateral

branches called “Jorqueta” or “fan” with plagiotropic growth. An axillaries bud is

develops with an orthotropic shoot below the Jorqueta, which will again form a

Jorqueta a few feet higher up. Other Jorqueta will develop again, this process

should repeat during four times, producing a leafy canopy.

The mature leaves are dark green, about 37 cm long and 7.5 cm broad,

oblong oval or elliptic oval with prominent veins and veinletss, the short petiole

is provided with two articulations (Kochhar, 1986). The flush (young and

developing leaves) exhibit a range of colors from lightest green to red shades.

The flower is a complex organ and possesses some features that make it

unique and distinctive. The flowers are borne on the bark of the trunk and older

branches, and never on young shoot. Few of many thousand flowers will

develop in fruit. Flowering and fruiting continues through one year.

Theobroma cacao L. flowers are bisexual, regular and pentamerous. The

flower has the variation with regard to their shape and pigmentation. The sepals

are prominent, leathery and fused at the base. The corolla consists of five

petals, smaller than sepals, each having a broad curved, saccate basal and a

much narrower terminal portion expanding terminally into a cup of shaped a

pouch. Ten stamens are arranged in two whorls of five, the outer being

represented by infertile, narrow, ciliate, erect pointed structure forming a fence

around style, while the stamens of the inner whorl have curve filaments. The

stamens and staminoide are fused in the basal region forming a short tube. In

general; apparently there is a relation between color buds and fruit colors

(Kochhar, 1986).

Bartley (2005), the maturity fruit is a berry but commonly called a pod, which

is composed of a fairly thick, leathery, smooth or corrugated pericarp or husk.

The fruit varied in shape from spherical to very narrow elongate, and their colors

ranging from green (immaturity), yellow (mature), and red (immaturity) to purple

(maturity). Generally, a pod has 20 to 40 flat or round seeds, or cacao beans

embedded in a white, pink or brown, aromatic, mucilaginous, sweet or faintly

acid pulp. Each cacao tree produces only one or two pounds of beans every

year (Kochhar, 1986).

7

The period between fertilization of a flower and the initiation of maturity is

around 135 to 180 days. Self-incompatibility is a series problem that some

genotype presents. The discovery of self-incompatibility in cacao was

determinate as consequence of genetic mechanisms. The mechanism by self-

incompatibility takes place in the ovary of the flower during fertilization, which is

describes as a rejection by the egg nucleus of a male gamete carrying the same

incompatibility alleles as the female gamete. Bartley & Cope (1973) showed that

a series of alleles were involved of which one had a neutral effect, in which case

the rejection mechanism did not function in the egg cells when the gametes are

identical.

The first classification of variety of cacao was proposed by Chessman

(1944), and it was according to morpho geographical groups designated such

as Criollo, Forastero and Trinitario. According to the geographic origin of the

clones, the Forastero group is subdivided into the lower Forastero and upper

Forastero type. The lower Forastero type was first cultivated in the Amazon

basin and the first to be introduced to Africa, also. The upper Forastero type is

highly diverse and often used in plant breeding (Laurent et al, 1994). The

Forastero group has a green pod when immature, turning yellow at maturity.

They are smooth, melon-shaped with rounded ends and relatively thick walled.

Forastero group are hardier, robust, highly productive and resistance to

diseases. The seed colors are purple due to low Theobromine concentration.

The Criollo group, found from Mexico to Colombia and Venezuela, has

narrow genetic bases (Motamayor, et al. 2002). The Criollo group has a yellow

or a red pod when ripe, usually deeply ten-furrowed and warty with long pointed

end. Enclosed within the thin shell is numerous seed. Criollo group has been

characterized by low productivity, susceptibility to diseases, but pleasant aroma

and white cotyledons as consequence of high Theobromine concentration.

According to Bartley (2005), Forastero and Criollo are words derived from

Spanish. Criollo is translated as “Native” and the word was used to defined to

the first variety cultivated in a geographical unit outside to indigenous range of

species to distinguish it from later introduction. In Nicaragua has reported two

kind of cacao Criollo, Dias (2001) reported the Nicaraguan Criollo, which were

referred as the group of Criollo cacao from Nicaragua, and not to native cacao

of Nicaragua. Bartley (2006) cited to Hart (1893), who described two kind of

8

genotype from Nicaragua, which one of them was called “Alligator cacao” due to

husk characteristics, the another one was called “Nicaraguan Criollo”.

1.3 Importance of production and use of Theobroma cacao L.

According to Lass (2004), cacao cultivation has played an important role in the

transformations of lowland tropical forest landscapes in Latin America, Africa

and Asia over the past centuries and continues to do so today. Cacao is now

grown in some 50 tropical countries, which the most important production take

place in Cameroon (179,239 ton in 2007), Brazil (201,651 ton in 2007), Côte d’

Ivory (1,384,000 ton in 2007), Indonesia (740,006 ton in 2007), Ecuador and

Nigeria (85,891 and 500.000 in 2007). The average per hectare varied between

398.3 kg ha-1 and 800.9 kg ha-1, which Nigeria presented the highest yield ha-1

than others countries.

Currently, in Central America, cacao is produced in Guatemala, Costa Rica,

Honduras and Nicaragua. In the 1990s, Nicaragua had 6,500 hectares

cultivated. However, the Caribbean coast presents larger potential for cacao

cultivars, with its almost 350.000 hectares available to cacao cultivations (INTA,

2005). The yield average is ranged between 100.0 kg ha-1 to 276.1 kg ha-1,

which Nicaragua presented the highest value. However, Costa Rica has more

area harvested in 2007, with 4543 ha (FAOSTAT, 2009). The demand for

chocolate is growing and the question now is whether the world supply of a

product that comes from a strictly tropical, rainforest-inhabiting tree will continue

to meet the demand.

In Nicaragua, the cacao crop is one of the most important crops in the

national politics of agriculture, because the country has a big potential and the

international demands are huge, and it is possible that the national production

does not satisfy the national demand. Therefore the government is promoting

the increase of areas where cacao is grown. This should offer good incomes to

poor farmers and avoiding deforestation in critical areas.

The National Institute of Agriculture and Technology (Instituto Nicaraguense

de Tecnologia Agropecuaria –INTA- in Spanish) has been developing a cacao

breeding program through traditional methods, which is a slow and long

process. The Experimental Center “El Recreo”, situated 285 km from the capital

is part of the INTA. This center has been dedicated to the breeding of cacao

9

tree. There are 180 clones introduced in the 1970s and 1980s from Colombia,

Costa Rica and Mexico.

In addition, in 2003, the INTA began a national collection of cacao Criollo,

including material from the Caribbean and Pacific coast. The principal objective

has been to include them in the breeding program of cacao beans. Currently,

those samples are growing in the Experimental center “El Recreo”.

“El Recreo” has been doing conventional breeding between Trinitario

cultivars; however, the material does not have molecular support for their

genetic characteristics, as those materials focuses on phenotype

characteristics. This method has resulted in a lot of variability in the new

materials. However, with the use of modern techniques it is possible to improve

some traits, which should be associated such as diseases and poor and the low

quality of the yield. Using molecular markers it should be possible to select

material from the national collection of cacao for diseases resistance and quality

of seed or for breeding before the phenotypic expression. For example, by

identifying a molecular marker associated with pod rot, one could identify

materials for breeding without having to wait until the disease appears in the

fruits. Such measures should greatly reduce the cycle time for the selection of

cacao genotypes.

Currently, breeding programs in cacao are based on crosses between

parents belonging to different groups. However, the classic breeding requires a

long generation time. A more modern technique using genetic markers may be

particularly helpful when used to improve breeding strategies and increase our

knowledge of the genetically important agronomic and quality traits (Lanaud et

al, 1995).

2. Objectives

The present study has the aims to investigate the genetic diversity of the

farmers accessions of Theobroma cacao L. in order to reveal the genetic

relationship among 60 farmers accession and to discover genotypes for

breeding programs.

10

3. Materials and methods

3.1 Plant materials

A total of 60 accessions collected from Nicaraguan’s farms, 14 breeders

accession, and 2 samples from Ecuador, those samples are available in the

national collections of the Experimental Center “El Recreo”, located at 120 07'

North, 820 24' W in Autonomous Region of the Southern Atlantic (“Región

Autónoma del Atlántico Sur –RAAS -” in Spanish), Nicaragua. Also, two

samples considered as Criollo from CATIE germplasm were included in this

study.

Farmers accessions: The accessions were collected from different farmers

(see figure 1) by National Institute of Agriculture and Technology (Instituto

Nicaraguense de Tecnologia Agropecuaria –INTA- in Spanish). Those sampling

(table 1), it was conducted between 2003 to 2008 in farms around the country

(see figure1). During those collections were considered the parameters related

to cacao Criollo as a trunk with a single plagiotropic branch, leaf with pale green

flush, flowers with white staminodes, an elongate fruits (Pod) with long acute or

attenuate, rough and a ridged surface with a thin or soft husk, and large size

seeds with white cotyledons (Figure 2).

International accessions: In order to use samples with knowing genetic

structure, two samples of international germplasm from CATIE, Costa Rica

were used. Criollo 13 was collected in Panama and Yucatan in Mexico, both

samples considered as pure Criollo due to morphologic characteristic. The

samples of Ecuador were introduced in 2003 and were established in

Experimental Center El Recreo.

Breeders samples: In 1978, INTA introduced a total of 189 clones from

Costa Rica, South America, Africa, Jamaica, and Indonesia. Those clones were

evaluated during 25 years, under tropical rain condition. In 1998, INTA selected

clones with a high yield and tolerance to specific diseases such as frosty pod

and black pod. The clones selected were used as parents in the breeding

program. A total of 14 hybrids (Table 2) were produced and distributed widely

throughout the whole country.

11

Figure 1: Map of Nicaragua with sites of farmer’s collections: 1. RAAS (Región

Autónoma del Atlántico Sur), 2. RAAN (Región Autónoma del Atlántico Norte),

3. RSJ (Rio San Juan), 4. MAT (Matagalpa), 5. Pacifico sur (5.a Masaya, 5.b

Granada and 5.c Rivas), 6. Chi (Chinandega)

12

Figure 2: Characteristics of farmers accessions collected on Nicaraguan farm.

a) Tree habit on farm. b) Pale green flush. c) Long and thin leaf. d) White flower.

e) Fruit shape. f) Long and white seed.

13

Table 1: Description of Nicaraguan farmers accessions. (See Figure 1 for the

location in the map)

*RAAS (Región Autonoma del Atlántico Sur), 2. RAAN (Region Autonoma delAtlántico Norte), 3. RSJ (Rio San Juan), 4.MAT (Matagalpa), 5. Pacifico sur(Masaya, Granada and Rivas), 6 Chi (Chinandega).

Name Location GroupRAAS 0401 Region Autonoma Atlantico Sur RAASRAAS 0402 Region Autonoma Atlantico Sur RAASRAAS 0403 Region Autonoma Atlantico Sur RAASRAAS 0404 Region Autonoma Atlantico Sur RAASRAAS 0405 Region Autonoma Atlantico Sur RAASRAAS 0406 Region Autonoma Atlantico Sur RAASRAAS0407 Region Autonoma Atlantico Sur RAASRAAS0408 Region Autonoma Atlantico Sur RAASRAAS 0409 Region Autonoma Atlantico Sur RAASRAAS 0410 Region Autonoma Atlantico Sur RAASRAAS 0411 Region Autonoma Atlantico Sur RAASRAAS 0412 Region Autonoma Atlantico Sur RAASRAAS0413 Region Autonoma Atlantico Norte RAANRAAS 0414 Region Autonoma Atlantico Norte RAANRAAN 0401 Region Autonoma Atlantico Norte RAANRAAN 0403 Region Autonoma Atlantico Norte RAANRAAN 0404 Region Autonoma Atlantico Norte RAANRSJ 0401 Rio San Juan RSJRSJ 0402 Rio San Juan RSJRSJ 0403 Rio San Juan RSJRSJ 0404 Rio San Juan RSJRSJ 0405 Rio San Juan RSJRSJ 0406 Rio San Juan RSJRSJ 0504 Rio San Juan RSJRSJ 0501 Rio San Juan RSJRSJ 0503 Rio San Juan RSJRSJ 0508 Rio San Juan RSJMAT 0401 Matagalpa MatagalpaMAT 0402 Matagalpa MatagalpaMAT 0404 Matagalpa Matagalpa

14

Tabla 1: continuation...

* 5. Pacifico sur (Masaya, Granada and Rivas), 6 Chi (Chinandega).

Name Location GroupMAS 0401 Masaya Pacifico surMAS 0402 Masaya Pacifico sur

PACAYITA 0108 Masaya Pacifico surSJC 0108 Masaya Pacifico sur

CATARINA 0108 Masaya Pacifico surMENIER 0108 Granada Pacifico sur

EC 0108 Granada Pacifico surMOMBACHO 0108 Granada Pacifico surMOMBACHO 0208 Granada Pacifico surMOMBACHO 0308 Granada Pacifico sur

RIV 0401 Rivas Pacifico surRIV 0405 Rivas Pacifico sur

H-1 Granada Pacifico surH-2 Granada Pacifico surH-3 Granada Pacifico surH-4 Granada Pacifico surH-6 Granada Pacifico surH-5 Granada Pacifico sur

CHI 0306 Chinandega ChiCHI 0308 Chinandega ChiCHI 0304 Chinandega Chi

CHI 0301A Chinandega ChiCHI 0407 Chinandega ChiCHI 0409 Chinandega ChiCHI 0410 Chinandega ChiCHI 0411 Chinandega ChiCHI 0412 Chinandega ChiCHI 0414 Chinandega ChiCHI 0415 Chinandega ChiCHI 0405 Chinandega Chi

15

Table 2: Description of breeders accessions and international accessions of

Theobroma cacao L.

* Sample provided by CATIE – Centro Agronómico tropical de investigación y

enseñanza, Costa Rica-

Name Type location

Group

UF 650 xPOUND 12

Trinitario (Criollo xForastero)

ElRecreo

Breeders accession

UF 667 x Pound12

Trinitario (Criollo xForastero)

ElRecreo

Breeders accession

EET 400 x Pound12

Hybrid (Forastero) ElRecreo

Breeders accession

UF 296 x Pound12

Hybrid x Forastero ElRecreo

Breeders accession

EET 399 x SCA12

Hybrid x Forastero ElRecreo

Breeders accession

IMC 67 x UF 613 Forastero x Trinitario ElRecreo

Breeders accession

UF 613 x Pound12

Trinitario x Forastero ElRecreo

Breeders accession

UF 668 x UF 613 Criollo x Trinitario ElRecreo

Breeders accession

UF 667 x SCA 6 Trinitario (Criollo xForastero)

ElRecreo

Breeders accession

UF 29 x Pound 12 Trinitario (Criollo xForastero)

ElRecreo

Breeders accession

EET 95 x SCA 6 Hybrid x Forastero ElRecreo

Breeders accession

IMC 67 x UF 12 Trinitario (Criollo xForastero)

ElRecreo

Breeders accession

UF 654 x Pound12

Trinitario (Criollo xForastero)

ElRecreo

Breeders accession

UF 676 x Pound12

Hybrid x Forastero ElRecreo

Breeders accession

ER-011 Ecuador ElRecreo

internationalAccession

ER-012 Ecuador ElRecreo

internationalAccession

Criollo 13 Criollo Catie* internationalAccession

Yucatan Criollo Catie internationalAccession

16

3.2 DNA extraction

Dried and fresh young plant leaves were used for DNA extractions following the

standard protocol for DNA extraction described by Doyle and Doyle (1990). A 1

cm2 piece of leaf was placed into a 1.5 ml Eppendorf tube and 500 µl of the

CTAB buffer (2% CTAB, 1.4 mM Tris pH 8, 1 % PVP, 0.2 % 2- -

mercaptoethanol added before use) and small amount of sterilized sand were

added, after which grinding was conducted with a plastic Kontle Pellet Pestle.

After were incubated at 65 0C for 30 minutes. Then added 500 µl of CIA 24:1

(Chloroform: Isoamylalcohol) and mixed slowly, then was centrifuged at 14,800

g for 5 minutes. After removing supernatant into new 1.5 ml Eppendorf tube and

500 CIA 24:1 was added, and again centrifuged at 14,800 g for 5 minutes. Then

supernatant was removed into new 1.5 ml Eppendorf tube. To precipitate the

DNA, 2/3 of final volume of cold isopropanol was added and it was kept at -20ºC for 10 minutes. After centrifuging at 14,800 g for 5 minutes was decanted

liquid without disturbed and the pellet was washed added 100 µl of 70 %

ethanol and centrifuged for 5 minutes at 14,800 g for 2 minutes. Then the pellet

was dried. The pellet was re-suspended by adding 50 µl of low salt TE (100 mM

Tris-Cl and 1 mM EDTA pH 8). After was added 0.3 µl of RNAse (100mg/ml),

and then was incubated at 37 ºC for 1 hour. The DNA was electrophoresed on

0.8 % agarose gel, stained with ethidium bromide and visualized under UV

trans-illuminator for quality DNA assessment. DNA quality was estimated from

the clearness of the band, and the amount of DNA was estimate from bands

intensity in comparison with GeneRuler marker (50 bp DNA leader).

3.3 Microsatellite Analysis

DNA polymorphisms were detected by polymerase chain reaction (PCR), using

9 microsatellites markers (Table 3 describes microsatellites used in this study

developed for cacao by Lanaud, 1999). PCR reaction was performed in a

volume of 20 µl at testing state and 10 µl in the final analysis. The 10 µl reaction

mixture contained 0.5 µl DNA (2-3 ng of total genomic DNA per 1 µl of reaction

volume) as a template, 6 µl of MQ water, 1 µl 10x reaction buffer, 0.2 µl dNTP

mix, 0.3 µl (0.6 U) DynazymeTM II DNA Polymerase, 1 µl (5mM) forward primer

17

and 1 µl (5mM) reverse primer (the forward primers were fluorescently labeled

at 5’ end).

The DNA amplification were performed in a thermocycler (Bio-Rad,

C1000TM Thermal Cycler), with the following programmed; a denaturation step

of 4 minutes at 94 ºC followed by 34 cycles followed by denaturation for 40

second at 94 ºC, annealing for 40 second at 46 ºC or 51 ºC depending on

microsatellite, extension at 72 ºC for 1 minute, and a final extension at 72 ºC for

8 minutes.

3.4 Capillary electrophoresis and data collection

The PCR product was diluted 1/19, using 1µl of PCR product and 19 µl of Mille

Q water. From this solution was used 0.5 µl of each template and mixed with 20

µl of HiDi-formamide and 0.15 µl of size standard (GeneScan 500 ROX).

Before the run the samples were briefly denatured (5 min, 95 0C). Finally the

samples were loaded with Applied Biosystems 3730 DNA Analyzer into 96-well

plates. Fragment sizes were determined by Peak Scanner™ Software v1.0.

18

Table 3: Description of the microsatellite loci developed by Lanaud et al. (1999),with primer sequences used. The fluorescent labels used in this study areshown.

3.5 Data Analysis

3.5.1 Genetic diversity

For farmers selection, the following genetic diversity parameters were estimated

using POPGENE software v 3.2. (Yeh and Boyle, 1997)

1. Number of allele per locus. It was accounted for each amplified locus.

Effective number of allele. It was estimated with GENALEX v.6.2 software

program.

2. The mean of observed and expected heterozygosity (HObs and HExp). The

Heterozygosity was calculated at each locus using the formula proposed by

Nei, 1987.

For observed heterozygosity:

HObs= 1- Pij, (1)

SSR EMBLAccession

Linkagegroup

5’Forwardprimer

3’ Reverseprimer

AnnealingTemp 0C

Label

Size ofcloned

allele (bp)

Repeat

MtcCIR1 Y16883 8 GCAGGGCAGGCTCAGTGAAGCA

TGGGCAACCAGAAAACGAT

51 HEX 143 (CT)14

MtcCIR7 Y16981 7 ATGCGAATGACAACTGGT

GCTTTCAGTCCTTTGCTT

51 HEX 160 (GA)11

MtcCIR8 Y16982 9 CTAGTTTCCCATTTACCA

TCCTCAGCATTTTCTTTC

46 TET 301 (TC)5TT(CT)17TTT(C

T)4MtcCIR

10Y16984 5 CCGAATT

GACAGATGGCCTA

CCCAAGCAAGCCTCATACTC

46 FAM 208 (TG)13

MtcCIR11

Y16985 2 CATTGCGGATTACGGTTTTT

TGATTAAGCACACGAGCACTG

46 FAM 298 (TC)13

MtcCIR12

Y16986 4 TTTCTGACCCCAAACCTGTAA

TTCCAGTTAAAGCACATGAGGA

46 FAM 188 (CATA)4N18(T

G)6

MtcCIR15

Y16988 1 CAGCCGCCTCTTGTTAG

TATTTGGGATTCTTGATG

46 TET 254 (TC)19

MtcCIR18

Y16991 4 GCTAAGGGGATTGAGGAAGC

TGGGTTGCAGTCAATGTCTC

46 FAM 345 (GA)12

MtcCIR21

Y16995 3 GTCGTTGTTGATGTCGGT

GGTGAGTGTGTGTGTTTGTCT

46 TET 157 (TC)11N5(CA)

12

19

Where Pij= wiPij at each locus, which wi is a relative size of sub population and

wi=1 and Pij is a genotype frequency

For expected heterozygosity:

HExp =1- p2j (2)

Where p2j= wip2

ij, Pij is the frequency of the jth allele at ith locus summed at

across all alleles of the locus.

The polymorphism information content value is a value used to measure the

polymorphism for a marker locus (Botstein et al. 1980). It depends only on the

number of alleles and the frequency of each allele at the marker locus (Guo and

Elston, 1998).

The PIC estimator was calculated for each locus using the formula proposed by

Anderson et al., 1993:

PICi= 1- p2ij (3)

Where: pij is the frequency of the jth microsatellite allele.

The Shannon index is once the most commonly measurement used to compare

diversity among individuals. It has been widely used in studies as ecological

diversity and diversity of social relationship among adult primates and female

primates (Di Bitetti, 2000). The Shannon diversity index is tipically used to

measure the number of species in a community (the richness) and the relative

frequency of these species.

The Shannon index was calculated for each locus and groups using

software Arlequin ver. 3.1. (Excoffier et al. 2005)

3.5.2 The genetic differentiation

Genetic differentiation was quantified by the analysis of molecular variance

(AMOVA) and F-statistics estimator (FST), as described by Weir and Cockerha

(1984), Excoffier et al. (1992) and Weir (1996) using software Arlequin ver. 3.1.

(Excoffier et al. 2005)

20

3.5.3 Estimation of Genetic Distance

The genetic distance is estimation between two entities that can be described

by allelic variation (Nei´s, 1973).

The genetic identity (Di) and genetic distance (D) between groups were

calculated based on Nei´s (1987) unbiased genetic distance.

According to Nei´s (1978), the genetic distance is defined as:

D= -ln [GXY GXGY] (4)

Where: GX, GY and GXY are the means of pi2, qj

2 and piqi over all loci in the

genome, respectively.

For genetic identity, GX, GY and GXY, by sample gene identities, JX, JY, and JXY,

which are the means of xi2, yi

2, and xiyi over r loci studied. However, from D

was obtained by substitution the unbiased estimates of GX, GY for JX and JY:

= -ln[ XY X Y] (5)

Where: X and Y are the means of (2nXJX-1)/ (2nX-1) and (2nYJY-1)/ (2nY-1)

over r loci studied, respectively, and XY = JXY.

Nei (1978), suggested the used of unbiased when D bias has a large

magnitude, because bias is negligible. The unbiased estimator of Di and D were

obtained using POPGEN software.

3.5.4 Cluster analysis

From the original microsatellite data, a bootstrap values were computed over

1,000 replications with Seqboot program. After, the Mix program was used to

cluster the accessions according to the Wagner parsimony method (Eck &

Dayhoff, 1996; Kluge & Farris, 1969) for discrete character data. Then, the

Consense program was used to find the consensus tree applying the extended

majority rule. The Seqboot, Mix, and Consense program are from Phylip version

3.68 (Felsentein, 2004). The tree was drawn using the Treeview software

version 1.6.6 (Page, 1996).

21

3.5.5 The Principal component analysis

In order to know the relationship between different individuals was carried out

the Principal Component Analysis (PCA), using GENALEX v.6.2 software

program.

The PCA allows identifying differences among the individuals and identifying

possible group. PCA derives a 2 or 3-dimensional scatter plot of individuals,

making geometrical distances among individuals in the plot reflect the genetic

distances among them with minimal distortion (Mohammadi & Prasanna, 2003).

This analysis used a variance-covariance matrix, considering absolute changes

between individuals. The farmers accessions were compared again breeders

materials and internationals accessions in order to know the relationship

between them.

4. Results

4.1 Genetic diversity of Nicaraguan farmers accessions

A total of 155 alleles were identified in the 60 farmer’s accessions with a mean

of 17.2 alleles per locus (Table 4). The microsatellites MtcCIR8 detected high

polymorphism with 22 alleles per locus. Moreover, the lowest detection was

identified by MtcCIR1 with 10 alleles per locus. (See appendix 1 for allele

frequency).

The effective number of alleles per locus had a mean of 3.7. However, the

highest effective number of allele per locus was found by MtcCIR15 with 6

alleles per locus and most of rest microsatellites were ranged between 2.9 and

4.2 effective number alleles per locus.

Heterozygote deficiency (HExp < HObs) was registered for all microsatellite

used in this study. The lowest observed Heterozygote valued was presented by

MtcCIR7 with 0.28 and the highest value was presented MtcCIR21 with 0.53,

respectively. The highest value for the heterozygote expected was 0.82 for the

microsatellite MtcCIR15 and 0.61 was the lowest value for the microsatellite

MtcCIR10.

22

The PIC values presented were generally high for all loci (PIC > 0.5). PIC

values varied between 0.73 and 0.91, with a mean 0.78. The microsatellite

MtcCIR15 shown the highest value with 0.909 and MtcCIR8 presented the

lowest value with 0.73. The Shannon diversity index showed a mean of 1.97.

The microsatellite MtcCIR1 presented lowest value with 1.53 and MtcCIR15 the

highest value with 2.63, respectively.

Table 4: Genetic parameters for microsatellite markers L. based on Farmer’s

accession from Nicaragua using 9 microsatellites : number of alleles per locus

(N), effective number of alleles per locus (Ne), heterozygosity observed (Hobs)

and expected (HExp), PIC (Polymorphism information content), and Shannon

genotypic diversity index, based on Farmer’s accession from Nicaragua.

Microsatellite N* Ne* Hobs Hexp PIC I*MtcCIR1 10 2.9 0.52 0.62 0.75 1.53MtcCIR7 12 2.9 0.28 0.63 0.75 1.69MtcCIR8 22 3.3 0.45 0.61 0.73 2.03

MtcCIR10 18 4.2 0.49 0.64 0.85 2.22MtcCIR11 20 3.4 0.43 0.65 0.75 1.91MtcCIR12 15 2.9 0.54 0.65 0.70 1.54MtcCIR15 20 6.0 0.47 0.82 0.91 2.63MtcCIR18 18 4.2 0.41 0.70 0.81 2.14MtcCIR21 20 3.6 0.53 0.68 0.76 1.97

Mean 17.22 3.7 0.47±0.06 0.67±0.08 0.78±0.07 1.97±0.35*Ne = Effective number of alleles [Kimura & Crow (1964)]

***I = Shannon Index [Lewontin (1972)]

HObs and HExp were computed using Levene (1949)

4.2 Genetic diversity of Nicaraguan farmers accessions at group level

The genetic parameters used were a number of alleles per locus (N), Number of

different alleles per locus (Na), number of effective alleles per locus (Ne), and

heterozygosity observed (Hobs) and expected (HExp), and Shannon information

Index (I) (Table 5). Those parameters were evaluated for farmer accession,

international accession and breeder accessions.

The total means of number alleles per locus in whole groups was 5.7. In

addition, the groups RAAS and Pacifico sur obtained a high number of alleles

per locus with 8.4 and 7.8, respectively. Moreover, Matagalpa and RAAN

presented lowest value for number alleles per locus with 2.8 and 3.4.

23

On other hand, the heterozygote presented a deficit in all groups (HObs >

HExp). The total means of HObs for whole groups studied was 0.46; the highest

values were presented by Chinandega and Rio San Juan with 0.55 and 0.51,

respectively. Pacifico Sur and RAAS presented lowest values with 0.34 and

0.42. The highest value for HExp was 0.79 for RAAS and the lowest 0.48 for

Matagalpa.

Shannon information Index (I) presented variation between 0.82±0.15

(Matagalpa) and 1.81±0.14 (RAAS).

Table 5: Genetic diversity of Theobroma cacao L. L. based on Farmer’s

accession from Nicaragua, international accession and breeders accessions,

using 9 microsatellite: mean number of alleles per locus (Na), Number of

different alleles per locus, number of effective alleles per locus (Ne), and

heterozygosity observed (Hobs) and expected (HExp), and Shannon information

Index (I).Group HObs HExp IRAAS 0.42 0.79 1.81RAAN 0.44 0.65 1.14

Rio San Juan 0.51 0.69 1.47Pacifico sur 0.34 0.76 1.66Chinandega 0.55 0.64 1.32Matagalpa 0.48 0.48 0.82

Mean for Fameraccessions

0.46±0.17 0.67±0.08 1.37±0.12

Group

Internationalaccessions

0.26±0.06 0.75±0.1 1.26±0.17

Breeder accessions 0.66±0.08 0.78±0.32 1.66±0.12Mean 0.46±0.07 0.77±0.21 1.46±0.15

The Analysis of molecular variance (AMOVA) showed that 6.1 % of genetic

variation was due to variance among groups, whereas 93.9 % was divided

within groups which show statistic different in AMOVA for both components

among groups and within group (Table 6). The mean FST presented for all group

was 0.06.

24

Table 6: Component of Analysis of molecular variance of Theobroma cacao L.

L. based on Farmer’s accession from Nicaragua using 9 microsatellites

Source ofvariation

d.f Sum ofsquares

Variancecomponents

Percentage ofvariation

Among groups 5 36.76 0.22 Va 6.1Within groups 114 376.77 3.31 Vb 93.9

Total 119 413.53 3.52Mean FST 0.06

The pair comparison between groups (Table 7), shown that group RAAS has

not presented statistic difference between Matagalpa groups, but has statistic

significance with rest groups. RAAN has only statistic difference with

Chinandega and Matagalpa, Rio San Juan has only statistic difference with

Chinandega.

Table 7: Pairwise (FST) comparisons of Theobroma cacao L. for groups of

farmers accession from Nicaragua using 9 microsatellitesRAAS RAAN Rio San

JuanPacifico

SurChinandega Matagalpa

RAAS 0RAAN 0.10490* 0

Rio SanJuan

0.06058* 0.09236 0

Pacifico sur 0.03716* 0.09309 0.02645 0Chinandega 0.08957* 0.14122* 0.04623* 0.04606* 0Matagalpa 0.07369 0.20582* 0.07564 0.07711 0.08247 0

*significant at P< 0.05

4.3 Genetic distances

Nei’s distances and genetic identity matrices are shown in table 8. Those

results were based on analysis of six groups including all individuals. The

ranged presented for Nei’s distances was between 0.1374 for group

Chinandega and 0.9096 for Matagalpa. The genetic distance between RAAN

and Matagalpa was the highest, and Rio San Juan with Pacifico Sur was the

lowest.

Genetic identity values varied between 0.4027 and 0.8716. Pacifico Sur and

Rio San Juan obtained the highest value and Matagalpa with RAAN the lowest

value, respectively.

25

Table 8: The Genetic identity and genetic distance of Theobroma cacao L.

based on Farmer’s accession from Nicaragua using 9 microsatellitesRAAS RAAN Rio San

JuanPacifico Sur Chinandega Matagalpa

RAAS **** 0.4438 0.7438 0.7992 0.7002 0.7437RAAN 0.8124 **** 0.6066 0.5631 0.5330 0.4027

Rio SanJuan

0.2960 0.4999 **** 0.8716 0.8464 0.7624

Pacifico sur 0.2242 0.5744 0.1374 **** 0.8505 0.7558Chinandega 0.3564 0.6293 0.1667 0.1620 **** 0.7726Matagalpa 0.2961 0.9096 0.2713 0.2800 0.2580 ****

*Nei's genetic identity (above diagonal) and genetic distance (below diagonal).

4.4 Cluster analysis

The cluster analysis classified whole accessions into 9 groups and three distinct

individuals. The distinct individuals were RAAS0405, RAAS0401, and

RAAN0404. The first group was divided into two subgroups and one distinct

individual. The first subgroup was formed for two hybrids (UF676xP12 and

UF29xP12), the second subgroup were included three individuals (ER012,

Chi0304, Chi0411). A hybrid (IMC67xUF613) was clustering as distinct

individual into this group. The second group was formed by four individuals

(RAAS0409, Chi0407, Chi0308, and RAAN0401); all of them presented a

strong clustering relationship (96%)

The third group was formed for one hybrid (UF668xUF613) and one farmer

accession (RSJ0404). In the fourth group were included two hybrids

(UF654xP12 and EET95xSCA6) and two farmers accession (RAAS0407 and

RSJ0503); they were exhibited a strong clustering relationship. The fifth group

present bootstrap values below 80%. However, this group was divided into two

subgroups. The first subgroup presented a strong relationship and was formed

for 5 individuals Pacayita0108, Mombacho0108, UF650x P12, Chi0410 and

Chi0301a), the second subgroup presented a weak clustering relationship

(below 80%).

The sixth group presented a strong relationship (100%) and was formed

from three individuals (RAAS0408, RAAS0404, and Chi0415). The seventh

group presented a weak clustering relationship value (below 80%). However,

into this subgroup was presented a strong bootstrap value. The eighth group

was formed for 25 individuals with a strong clustering relationship (100 %). In

this group was included the CRIOLLO 13, which presented a strong clustering

relationship with Mat0404. (Figure 3)

26

Raas0405Raas0401Raan0404Imc67xUf613Uf676xP12Uf29xP12Er012Chi0304Chi0411Raas0409Chi0407Chi0308Raan0401Uf668xUf613Rsj0404Rsj0503Raas0407Uf654xP12Eet95xSca6Raas0403Chi0301aChi0410Uf650xP12Mombacho0108Pacayita0108Rsj0504Uf613xP12Eet00xP12Chi0412Chi0306Raas0408Raas0404Chi0415Rsj0406ChI0414Uf667xP12Raas0413YucatanH6Chi0409H1H2H4Chi0405Mat0402Uf296xP12Riv0405Sjc0108Imc67XUf613Mombacho0208Ec0108Catarina0108Mas0402Raas0410Mombacho0308Eet399xSca12Raas0414Riv0401Uf667xSca6Raan0403Rsj0401Raas0402Raas0406H3H5Mas0401Rsj0508Rsj0402Raas0411Mat0404Criollo13Raas0412Er011Menier0108Rsj0501Rsj0405Rsj0403Mat0401

100

100

100

100

100

100

100100

10010093

100

92

100

96

100

100

100

100

100

100

100100

100100

100

100

96

10093

95 100

100100

98

95

82

9999

10098

100

10094

100

96

100

100100

100

100100

96100

9999

100

1

2

3

4

5

6

7

8

Figure 3: Cluster analysis bootstrapped over 1,000 replicates, based on the

genetic distances between 60 farmer accessions from Nicaragua, 4

internationals accessions and 14 improve samples of Theobroma cacao.

Bootstrap values above 80 % were marked.

27

4.5 Principal component analysis

The principal component analysis distributed all individuals in four different axes

(Figure 4). The axis one was found 24 individuals. In this axis was included

only three improved individuals, which were dominated by the cross Forastero x

Trinitario. Also, three pairs individuals were found with equally genetic alleles:

MAT0402 with CHI0301A, RSJ0504 with RSJ0404, and the last pair were

RAAN0404 with RAAS0409.

A total of 17 individuals were found in axis 2. The Criollo 13 and Yucatan

were included in this axis. In addition, three samples were found related to

Criollo 13 such as SJC0108, Catarina0108 and MAS0402. Also, Yucatan was

related with RAAS0406, RAAS0410. RAAS0414, and Menier0108.

Furthermore, RAAN0403 was found related with ER-012 (Ecuador). In addition,

most materials found in this axis were homozygote.

In the Axis three were found 25 individuals. Moreover, the majority of

improved materials were found in this axis. In additions, two pairs of individuals

were found close related with RAAS0403 with UF296xP12, and RAAS0401 with

EET95xSCA6. The rests of individuals (12) were distributed in axis 4. Further,

H5 and H6 had the same genetic structure.

28

RAAS0401

RAAS0402

RAAS0403

RAAS0404

RAAS0405

RAAS0406

RAAS0407

RAAS0408

RAAS0409

RAAS0410

RAAS0411

RAAS0412

RAAS0413

RAAS0414

RAAN0401

RAAN0403

RAAN0404

RSJ0401

RSJ0402

RSJ0403

RSJ0404

RSJ0405 RSJ0406

RSJ0501

RSJ0503

RSJ0504

RSJ0508

MAS0401

MAS0402

RIV0401

RIV0405

H1

H2

H3H4

H5 H6

Pacayita0108

SJC0108

Menier0108

EC0108

Mombacho0108

Mombacho0208

Mombacho0308

Catarina0108

CHI0301A

CHI0304

CHI0306

CHI0308

CHI0407

CHI0409

CHI0410

CHI0411

CHI0412

CHI0414

CHI0415

CHI0405

Criollo13

Yucatan

ER-011

ER-012

UF650xP12

UF667xP12

EET400xP12

UF296xP12

EET399xSCA12

IMC67xUF613

UF613xP12

UF668XUF613

UF667xSCA6

UF29xP12

UF654xP12UF676xP12

EET95xSCA6

IMC67xP12

MAT0401MAT0402

MAT0404

Co

ord

. 2

Coord. 1

Principal Coordinates

Pop1

Pop2

Pop3

Pop4

Pop5

Pop6

Pop7

Pop8

Figure 4: Principal component Analysis (PCA) plot for 78 individuals using 9

microsatellites, based on the genetic distances between 60 farmer accessions

from Nicaragua (Pop1= RAAS, Pop2 = RAAN, Pop3 = RSJ, Pop4 = Pacifico

Sur, Pop5 = Chi, Pop7 = Mat), 4 internationals accessions (Pop6) and 14

breeders accessions (Pop7) of Theobroma cacao.

29

5. Discussion

In the present study were used microsatellites genotyping to examine the

genetic diversity, population structure, and the relationship between farmers

accession, breeders accession and internationals accessions.

5.1 Genetic diversity and population structure

Studies of genetic diversity have been carried out using isozymes, RAPD,

AFLP, RFLP, and SSR (microsatellite) markers in Theobroma cacao L. due to

the importance of this crop in chocolate industry. AFLP has been used to

distinguish cultivars and create a linkage map in cacao (Davey et al. 1998;

Risterucci et al. 2000). In previous studies, Motamayor et al. (2002) and

Risterucci et al. (2000) have shown that microsatellites are more efficient than

RFLP in genetic diversity study for Theobroma cacao L., because

microsatellites have allowed detected more alleles per locus as well as higher

level of polymorphism and are equally powerful tools for estimation of

heterozygosity.

Microsatellites have been widely used to study genetic diversity in

Theobroma cacao (Zhang et al. 2009; Cryer et al. 2006; Efombagn et al. 2006;

Sereno et al. 2006; Takrama et al. 2005; Fossati et al. 2005; Saunders et al.

2004; Motamayor et al. 2003; Motamayor et al. 2002; Marita et al. 2001;). The

main purpose of those analyses has been to identify differences between Criollo

groups and Forastero groups.

The polymorphic information content (PIC) was used to measure the ability

of a marker to detect polymorphism in cacao samples of Nicaraguan farmers

accession. In the present study, the PIC value showed a high power of

discrimination (PIC>0.78), of the loci used in Nicaraguan famers accessions,

which is an indicator of a high genetic diversity for nine loci studied. This

corroborated the use of these microsatellite loci in the estimation of genetic

diversity among each famer accession collected in Nicaragua. This result has

similarity with the result found by Zhang et al. 2006 and Efombagn et al. 2006

(0.58 and 0.69, respectively).

In this study, the overall allelic richness per locus presented was (17.2

overall allelic per locus and 3.7 effective allelic per locus). The level of

30

polymorphism detected in the present study would be affected by the mutation

rate of microsatellite and the small size population in the present studied.

According to Jin et al. (1996), Thuillet et al. (2002), and Wilkinson (2000),

mutation rate of microsatellite can be originated by replication slippage, which

can create high similarity in allele’s sizes and differences between few repeat

units.

The allelic diversity (relatively low Ne= 3.7), presented in this study was

similar to results presented by Smulder et al. (2009), that reported a low allelic

diversity (Ne= 3.54) for cacao populations from South America, and by Zhang et

al (2006) with an allelic diversity of 3.68 for semi natural population from

Huallaga, Peru, while Alves et al. 2007 presented an average 3.37 of alleles per

locus for a natural population of Theobroma grandiflorun. Previous studies, in

Theobroma cacao, using microsatellite found averages of 5.7 allelic per locus

for managed populations (Zhang et al. 2006). Studies realized separately in

Brazil and French Guiana presented averages of 4.45 and 4.48, respectively.

Those values were considered moderately high for richness allelic (Sereno et

al. 2006; Lachenaud & Zhang, 2008). In additions, low allelic diversity could be

explain by the fact that cacao is an endemic plant from Central America or

genetic drift, which would have reduced allelic diversity or allelic loss in that

accessions.

The heterozygote deficit (HExp<HObs) showed an inbreeding in all Nicaraguan

famers’ accessions analyzed. The results presented in study coincided with

results presented in previous studies by Zhang et al. (2009); Lachenaud &

Zhang, (2008); Cryer et al. (2006); Efombagn et al. (2006); Sereno et al. (2006);

Takrama et al. (2005); Fossati et al. (2005); Saunders et al. 2004; Motamayor et

al. 2003; Motamayor et al. 2002; Marita et al. (2001). The inbreeding could be

related to the biology of the reproductive system in cacao plant and the

selection that famers have been managed with cacao plantation through time.

Nonetheless, the inbreeding was unexpected, as cacao is an outcross species,

which it would be assumed an absence of inbreeding, which indicate that most

individuals into Nicaraguan farmers accessions are homozygosis and have self-

compatibility. In that sense, RAAS and Pacifico Sur presented more inbreeding,

compare to places where that have been considered as places where

indigenous tribes have managed and selected the cacao trees since the pre-

Columbian period. In that way, Dias (2002), have supported the idea that

31

Indigenous people started the cacao selection based on the white beans, by

doing so, they indirectly selected self-compatibility, promoting inbreeding.

Breeder accession was expected to present high level of heterozygosis

(HObs= 0.66) as they are product of strong human intervention, Chi and RSJ

groups, also presented relative value with breeder accession (HObs = 0.55 and

0.5, respectively), which was expected the presence of high heterozygosis in

those areas where cacao crops has been promoting with breeding accession by

national government and nongovernmental organization.

The gene diversity (HExp= 0.67) presented in this study was similar to

results presented by Sereno et al. (2006) for population form the Brazilian

Amazon (HExp= 0.5), also Motamayor et al. (2002) presented a similar gene

diversity for modern Criollo (HExp= 0.52). Motamayor et al. (2002) defined as

"Modern Criollo" those samples that have presented the morphological trait that

were described by Chessman (1944), but collected on farms. Farmers

accessions presented less gene diversity than breeders accession, and it was

expected, because Breeder accessions are the product of intensive genetic

recombination in hybridization realized. This result coincides with previous

comparison between farmers selection and breeders accession realized in

Cameroon by Efombang et al. (2006), also, Laurent et al (1993) found a high

level of polymorphism among Criollo group and low level in Forastero group.

The study found that RAAS and Pacifico sur of farmers accessions are more

close to International accessions (Criollo group) than the rest of groups studied

(Table 7), and RSJ and Chi are more related to Breeders materials. Several

studies have coincided that during pre-Columbian time, cacao Criollo was

distributed along the Pacific Coast in Nicaragua (Steinbrenner, 2006; Bartley,

2004; Ciferri & Ciferri, 1957; Bergmann, 1969), which result presented in this

study support previous hypothesis about Criollo distribution. As cacao

exchange and the human migration until jungle as consequence of the

conquest, indigenous carry out cacao samples, for this reason samples of

RAAS are similar to Pacifico Sur.

Moreover, RAAS and Pacifico Sur presented heterozygosis similar to

international accession (Criollo reference). Moreover, RSJ and Chi groups were

more close to breeders accession, due to the recent promotion of cacao crops

in Nicaragua, which indicate that farmers have obtained breeders materials and

32

this action have allowed the genetic introgression between Criollo group and

breeder accession.

5.2 Groups differentiation and genetic proximities

The analysis of molecular variance (AMOVA), shown that most variation was

found within groups (Table 6) while low variation among groups. This was

expected due to the endemic nature of Thebroma cacao in the region (Central

America and South America). According to Silvertown & Charlesworth (2001),

endemic species have a low variation among group as they have a unique

genetic structure.

Additionally, the pairwise comparison (Table 7) shown that RAAS and

Pacifico Sur have low genetic variability (0.037), this result coincided with

genetic distance between both groups, which was more near among the others

groups. It seems that exchange of materials due to human migration, have

reduced the genetic distances between both group (RAAS and Pacifico Sur).

The Cluster and PCA analyses allowed identify the relationship between

individuals. The cluster analysis showed a strong clustering relationship among

individuals (Figure 3). Four undistinguished farmers accessions were indentified

as well as some stronger genetic relation between farmers accessions and

international accessions (Criollo). This was expected, as researcher such as

Dias (2002), Bartley (2005) and Laurent et al. (1993) have considered the

existence of Criollo sample in Nicaragua. Nonetheless, Motamayor (2002)

considered that most cacao samples in Nicaragua are Trinitario type, as

consequence of outcrossing among Forastero and Criollo. The cluster analysis

found many farmers accession and breeders accession with a strong

relationship.

An important finding in the cluster analysis was the strong relationship

among ER011 from Ecuador and Nicaraguan farmers accession (Menier0108,

Criollo 13, RAAS0412, RSJ0405, RSJ0403, and Mat0401). According to Dias

(2002), the Nacional accession from Ecuador is more genetically related to

Criollo than forasteros, also Bartley (2006) reported that first gene flow of

Theobroma cacao from Nicaragua occurred in 1893, when Harts carried out a

total of 150 plants with Criollo characteristic toward Trinidad. This event could

33

be considered as trigger genetic origin of the relationship between Ecuador's

and Nicaraguan's accession.

In addition, PCA allowed identification of duplicated samples and relation

between Criollo 13 and Yucatan samples (Figure 4). The samples duplicated

were found in Matagalpa and Chinandega (Mat0402 and Chi0301a) and

Pacifico sur (H5 and H6). Also, most Trinitarios group was finding in axis 3,

which were included most breeders accessions that were classified as

Trinitario. In this axis was predominated farmers accession from RAAS.

The PCA also indicated that most samples, genetically related with

Criollo 13 were collected in pacific Sur (SJC0108, Catarina0108 and MAS0402).

Those samples had morphologic characteristic similar to the samples described

by Chessman (1944) and Hart 1893 (in Bartley, 2002) for cacao Criollo.

Additionally, it was found that Nicaraguan farmers accessions (RAAS0406,

RAAS0410. RAAS0414 and Menier0108) were genetically related to Yucatan,

that relationship would indicate that Nicaraguan indigenous was related to

Mexican indigenous, especially indigenous for the groups located in the Pacific

Coast, Nicaragua.

From the PCA included in axis 3 (Figure 4), it can be seen that most

breeders accession (Trinitario), as well as 25% of all farmers accessions were

genetically related to breeder accessions. this result could be caused by the

high promotion of cacao and renovations of old plantations for new breeders

plantations with specific characteristic as diseases resistance to Black pod

(Phytophthora spp) and Frosty pod (Moniliophthora roreri) and high yield.

34

6. Conclusions

The present study has revealed the existence of a genetic diversity of 60

Nicaraguan farmers accessions based on nine microsatellites. This study

provides a basic knowledge about genetic structure of cacao farmers in

Nicaragua and differences between cacao accessions from different area when

were collected those samples. The values of the genetic parameter obtained in

this study, mainly the values of heterozygosis indicate that Nicaraguan farmers

accessions are inbreed with high genetic diversity. Also, the allelic richness

suggests the presence of potential unique and rare alleles.

The analysis molecular of variance (AMOVA) was highly significant and

showed a low variance among groups but high variance within groups. Based

on this study (cluster and PCA analyses), it has been found that some cacao

farmers accession are genetically related with Criollos genotypes, but most

farmers accessions have Trinitario characteristic as consequence of promoting

improved materials. Also, was found a few farmers accessions and Ecuadorian

accession with the same genetic origin. Those results would suggest a good

possibility for selection and improvement of cacao. Those promising accession

should be used in a breeding program.

In the future, will be necessary collect and increase the collections of

farmers accessions and the molecular data generated will be correlated with

morphologic characterization.

35

7. Acknowledgements

To Finnish Government –specially Finnish Embassy in Nicaragua and Foreigner

Ministry of Finland-

To University of Helsinki –specially Department of Applied Biology-

To NIFAPRO Staff – Jari Valkonen, Helena Korpelainen, Paula Elomaa, Aldo

Rojas-

INTAs’ Authorities and all cacaos Workers -present and not presents- that have

contributed and rescued the knowledge about cacao.

To 71 years of foundation of Experimental Center “EL Recreo” and 30 of cacao

research

To CATIE –Costa Rica- for facilities the Criollo genotypes

36

8. List of references

Alves, R.M., Sebbenn, A.M., Artero, A.S., Clement, C. & Figueira, A. 2007. High

levels of genetic divergence and inbreeding in populations of cupsuassu

(Theobroma grandiflorum). Tree Genetics & Genomes 3: 289-298.

Anderson, J.A., Churchill, G.A., Autrique, J.E., Tanksley, S.D. & Sorrells, M.E.

1992. Optimizing parental selection for genetic linkage maps. Genome 36:

181-186.

Bartley B.G.D & Cope F.W (1973). Practical aspects of self incompatibility in

Theobroma cacao L. In: Moav R (ed). Agricultural Genetics Selected

Topics. Wiley and Sons: New- York, pp 109–134.

Bartley BGD, Cope FW (1973). Practical aspects of self-incompatibility in

Theobroma cacao L. In: Moav R (ed). Agricultural Genetics—Selected

Topics. Wiley and Sons: New-York, pp 109–134.

Bergmann, J. F. 1969. The distribution of cacao cultivation in pre-Columbian

America. Annals of the Association of American Geographers 5:185–96.

Botstein, D., White, R. L., Skalnick, M. H., & Davies, R. W. 1980. Construction

of a genetic linkage map in man using restriction fragment length

polymorphism, American Journal of Human Genetics 32: 314-331.

Cheesman, E.E. 1944. Notes on the nomenclature, classification and possible

relationships of cocoa groups. Tropical Agriculture, 21: 144–159.

Ciferri, R., & F. Ciferri. 1957. The evolution of cultivated cacao. Evolution:

International Journal of Organic Evolution 9:381–397

Cryer, N.C., Fenn, M.G.E., Turnbull. C.J. & Wilkinson, M.J. 2006. Allelic size

standards and reference genotypes to unify international cocoa (Theobroma

cacao L.) microsatellite data. Genetic Resources and Crop Evolution

53:1643-1652.

37

Davey, M.R., Perry, M.D., Power, J.B., Lowe, K.C., J Blich, H.F., Roach, P.S. &

Jones, C. 1998. DNA isolation and AFLPTM genetic fingerprinting of

Theobroma cacao (L). Plant Molecular Biology Reporter 16: 49-59.

De la Cruz, M., Whitkus, R., Gomez-Pompa, A., & Mota-Bravo, L. 1995. Origins

of cacao cultivation. Nature 375: 542-543.

Dias, L.A.S. 2001.Genetic Improvement of Cacao (Melhoramento Genético Do

Cacaueiro) (ed. Dias LAS), FUNAPE-UFG, Brazil. Translated into English

by Abreu-Richart CE (http://ecoport.org)

Di Betetti, M.S. 2000. The distribution of grooming among female primates:

testing hypotheses with Shannon-Wiener diversity index. Behaviour 137

(11): 1517-1540.

Doyle, J. F., & Doyle, J. L.1990. Isolation of plant DNA from fresh tissue. Focus

12: 13–15.

Efombagn, M.I.B., Sounigo, O., Nyasse, S., Manzanares-Dauleux, M., Cilas, C.,

Eskes, M.A.B. & Kolesnikova-Allen. 2006. Genetic diversity in cocoa

germplasm of southern Cameroon revealed by simple sequences repeat

(SSRS) markers. African Journal of Biotechnology 5 (16): 1441-1449.

Excoffier, L. G. Laval, & S. Schneider. 2005. Arlequin ver. 3.0: An integrated

software package for population genetics data analysis. Evolutionary

Bioinformatics Online 1:47-50.

Excoffier, L., Smouse, P, & Quattro, J. 1992. Analysis of Molecular Variance

Inferred from Metric Distances among DNA Haplotypes: Application to

Human Mitochondrial DNA Restriction Data. Genetics 131 (2): 479-491.

FAO. 2009. FAOstat. http://faostat.fao.org/site/567/default.aspx#ancor. Vienna,

Austria: Food and Agriculture Organization of the United Nation; Visited

30.07.2009.

38

Fossati, T., Zapelli, I., Bisoffi, S., Micheletti, A., Vietto, L., Sala, F., & Lastiglione,

S. 2005. Genetic relationships and clonal identity in a collection of

commercially relevant poplar cultivars assessed by AFLP and SSR. Tree

Genetics & Genomes 1: 11-19.

Garcia, A.A.F., Benchimol, L.L., Barbosa, A.M.M., Geraldi, I.O., Souza Jr, C.L &

De Souza P. 2004. Comparisson of RAPD, RFLP, AFLP, and SSR markers

for diversity studies in tropical maize inbred lines. Genetic Molecular Biology

27: 579-588.

Guo X, & Elston RC. 1999. Linkage Information Content of Polymorphic Genetic

Markers. Human Heredity 49:112-118.

INTA. 2006. El cacao: Riqueza potencial de la tierra nica a la espera de ser

explotada comercialmente en los mercados internacionales. INTA.

Managua, Nicaragua. 7 pp.

Jin, L., Macaubas, C., Hallmayer, J., Kimura, A. & Mignot, E. 1996. Mutation

rate varies among alleles at a microsatellite locus: phylogenetic evidence.

Proceedings of the National Academy of Sciences of the United of States of

America 93: 15285-15288.

Kimura, M., & J. F. Crow. 1964. The number of alleles that can be maintained in

a finite population. Genetics 49:725–738.

Kochhar, S.L. 1986. Tropical crops. A textbook of economic botany. 1st edition.

Macmillan publisher Ltd. 467 pp

Lachenaud, P. & Zhang, D. 2008. Genetic diversity and population structure in

wild stands of cacao trees (Theobroma cacao L.) in French Guiana. Annals

of forest science 65: 310.

39

Lanaud, C., Risterucci, A. M., Pieretti, I., Falque, M,. Bouet A, & Lagoda PJL.

1999. Isolation and characterization of microsatellites in Theobroma cacao

L. Molecular Ecology. 8: 2141–2152.

Lanaud, C., Risterucci, A.M., N’Goran, A.K.J., Clement, D., Flament, M.H.,

Laurent, V. & Falque, M. 1995. A genetic linkage map of Theobroma cacao

L. Theoretical and Applied Genetics 91: 987-993.

Lass, T. 2004. Balancing cocoa production and consumption. In: Flood J,

Murphy R (eds) Cocoa futures. A source book on some important issues

facing the cocoa industry. Cabi FEDERACAFE. USDA. Chinchina´.

Colombia. pp 8–15.

Laurent V, Risterucci AM, Lanaud C.1994. Genetic diversity in cacao revealed

by cDNA probes. Theoretical and Applied Genetics 88:193-198.

Lerceteau, E., Robert, T., Petiard, V. & Crouzillat, D. 1997. Evaluation of the

extent of genetic variability among Theobroma cacao accessions using

RAPD and RFLP markers. Theoretical and Applied Genetics 95: 10-19.

Levene, H. 1949. On a matching problem arising in genetics. The Annals of

Mathematical Statistics 20:91–94.

Lewontin, R.C. 1972. The apportionment of human diversity. In: Dobzhansky T,

Hecht MK, Steere WC, editors. Evolutionary Biology 6: 381–398.

Madell, S. 2008. Where is the true home of cocoa?.

http://www.chocolatereview.com.au/cocoa_history.ChocolateReview.

Visited 13.07.09.

Marita, J.M., Nienhuis, J., Pires, J.L. & Aitken, W.M. 2001. Analysis of genetic

diversity in Theobroma cacao with emphasis on Witches’ broom disease

resitance. Crop Science 41: 1305-1316.

40

McNeil, C. 2006. Chocolate in Mesoamerica. A cultural history of cacao, 1th

edition. University Press of Florida.542 pp.

Mohammadi, S. A. & Prasanna, B. M. 2003. Analysis of Genetic Diversity in

Crop Plants--Salient Statistical Tools and Considerations. Crop Science 43:

1235-1248.

Motamayor, J.C., Ristericci, A.M., Heath, M. & Lanaud, C. 2003. Cacao

domestication II: Progenitor Germplasm of the Trinitario cacao cultivar.

Heredity 91: 322-330.

Motamayor, J.C., Risterucci, A.M., Lopez, P.A., Ortiz, C.F., Moreno, A., &

Lanaud, C. 2002. Cacao domestication I: The origin of the cacao cultivated

by the mayas. Heredity 89: 380-386.

Mouzeyar, S., Roeckel-Drevet, P., Gentzbittel, J.P., Tourvieille De Labrouhe,

D.T. & Nicolas, P. 1995. RFLP and RAPD mapping of sunflower pl1 locus

for resistance to plasmopara halstedii race 1. Theoretical and Applied

Genetics 91: 733-737.

N’Goran, J.A.K., Laurent, V., Risterucci, A.M. & Lanaud, C. 1994. Comparative

genetic diversity studies of Theobroma cacao L. using RFLP and RAPD

markers. Heredity 73: 589-597.

Nagaoka, T. & Ogihara, Y. 1997. Applicability of inter-simple sequence repeat

polymorphism in Wheat for use as DNA markers in comparison to RFLP and

RAPD markers. Theoretical and Applied Genetics 94: 597-602.

Nei, M. 1973. Analysis of gene diversity in subdivided groups. Proceedings of

the National Academy of Sciences, USA 70: 3321–3323.

Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a

small number of individuals. Genetics 89: 583–590.

41

Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New

York.

Nei, M., & CHESSER, R.K. 1983. Estimation of fixation indices and gene

diversities. Annals of Human Genetics 47: 253–259.

Ogata, N. Gomez-Pompa., & Tabue, K.A. 2006. Chapter 3: The domestication

and distribution of Theobroma cacao L. in the Neotropics. In: Chocolate in

Mesoamerica: A cultural history of cacao. (Ed. by McNeil, C). University of

press of Florida.

Page, R.D.M. 1996. TREEVIEW: An application to display phylogenetic trees on

personal computers. Computer Applications in the Biosciences 12: 357-358.

Peakall, R., & Smouse, P.E., 2006. GENALEX 6: genetic analysis in Excel.

Population genetic software for teaching and research. Molecular Ecology

Notes 6: 288-295.

Risterucci, A.M., Eskes, B., Fargeas, D., Motamayor, J.C. & Lanaud, C. 2000.

Use of microsatellite markers for germplasm identity analysis in cocoa. In:

Proceedings of the international workshop on the new technologies and

cocoa breeding. INGENIC Newsletter: 25-33.

Risterucci, A.M., Grivet, L., N’Goran, J.A.K., Pieretti, I., Flament, M.H. &

Lanaud, C. 2000. A high-density linkage map of Theobroma cacao L.

Theoretical and Applied Genetics 101: 948-955.

Saunders, J.M., Mischke, S., Leamy, E.A. & Hemeida, A.A. 2004. Selection of

international molecular standards for DNA fingerprinting of Theobroma

cacao. . Theoretical and Applied Genetics 110: 41-47.

Sereno, M.L., Alburquerquer, P.S.B., Vencovsky, R. & Figueira, A. 2006.

Genetic diversity and natural population structure of cacao (Theobroma

cacao L.) from the Brazilian Amazon evaluated by microsatellite markers.

Conservation Genetics 7: 13-24.

42

Shannon, CE. & Weaver, W. 1949. The mathematical theory of communication.

University of Illinois Press, Urbana.

Souza, C.A.S. & Dias, L.A.S. 2001. Chapter 1: Environment improvement and

socio-economy. In: Genetic improvement of cacao. (ed. Dias LAS), FUNAPE-

UFG, Brazil. Translated into English by Abreu-Richart CE (http://ecoport.org).

Stainbrebber, L. 2006.Chapter 12: Cacao in greater Nicoya. Ethnohistory and

unique tradition. In: Chocolate in Mesoamerica: A cultural history of cacao.

(Ed. by McNeil, C). University of press of Florida.

Takrama, J.F., Cervantes-Martinez, C., Brown, J.S., Motamayor, J.C. & Schnelf.

2005. Determination of off-types in cocoa breeding programme using

microsatellite. Ingenic Newslatter 10: 2-8.

Thormann, C.E., Ferreira, M.E., Camargo, L.E.A., Tivang, J.G. & Osborn, T.C.

1994. Comparison of RFLP and RAPD markers to estimating genetic

relationships within and among cruciferous species. Theoretical and Applied

Genetics 88: 973-980.

Thuillet, A.C., Bru, D., David, J., Roumet, P., Santoni, S., Sourdille, P. &

Bataillon, T. 2002. Direct estimation of mutation rate for 10 microsatellite

loci in Durum wheat, Triticum turgidum (L) Thell.ssp durum desf. Molecular

Biology and Evolution 19 (1): 122-125.

WEIR, B. S. 1996. Genetic data analysis II. Sinauer, Sunderland,

Massachusetts, USA.

Weir, BS, & Cockerham, C.C. 1984. Estimating F-Statistics for the analysis of

population structure. Evolution, 38: 1358–1370.

Whitkus, R., De la Cruz, M., Mota-Bravo, A. & Gómez-Pompa, A. 1998. Genetic

diversity and relationships of cacao (Theobroma cacao L.) in southern

Mexico. . Theoretical and Applied Genetics 96: 621-627.

43

Yeh, F.C. & Boyle, T.J.B. 1997. Population genetic analysis of co-dominant and

dominant markers and quantitative traits. Belgian Journal of Botany 129:

157.

Zhang, D., Arevalo-Gardini, E., Mischke, S., Zuñiga-Cernades, L., Barreto-

Chavez, A. & Adriazola de Aguila, J. 2006. Genetic diversity and structure of

managed and semi-natural populations of cocoa (Theobroma cacao) in the

Huallaga and Ucayali Valleys of Peru. Annals of Botany 98: 647-655.

Zhang, D., Mischke, S., Johnson, E.S., Phillips-Mora, W., Meinhardt, L. 2009.

Molecular characterization of an international cacao collection using

microsatellite markers. Tree Genetics & Genomes 5: 1-10.

44

9. Appendices

Appendix 1: Allele frequencies of microsatellites loci in groups of Theobroma

cacao L. from Nicaragua

Locus Allele/n RAAS RAAN RSJ P.S Chi I.A B.A MatmTcCIR 1 N 14 3 10 18 12 4 14 3

127 0.107 0.333 0.250 0.333 0.250 0.500 0.179 0.000128 0.357 0.000 0.100 0.083 0.042 0.000 0.107 0.667131 0.036 0.000 0.000 0.000 0.000 0.000 0.000 0.000133 0.000 0.000 0.000 0.028 0.000 0.000 0.000 0.000134 0.000 0.000 0.000 0.000 0.000 0.000 0.071 0.000135 0.000 0.000 0.000 0.000 0.000 0.125 0.000 0.000139 0.036 0.000 0.000 0.028 0.000 0.000 0.000 0.000140 0.107 0.667 0.250 0.111 0.208 0.250 0.179 0.000141 0.357 0.000 0.400 0.389 0.500 0.125 0.464 0.167150 0.000 0.000 0.000 0.028 0.000 0.000 0.000 0.167

mTcCIR 7 N 14 3 10 18 12 4 14 3149 0.000 0.000 0.000 0.000 0.000 0.000 0.036 0.000150 0.000 0.000 0.000 0.000 0.000 0.250 0.000 0.000153 0.000 0.000 0.000 0.000 0.000 0.000 0.036 0.000155 0.071 0.333 0.100 0.167 0.042 0.125 0.036 0.000156 0.321 0.500 0.700 0.389 0.375 0.000 0.393 0.667157 0.071 0.000 0.000 0.222 0.250 0.250 0.000 0.333158 0.286 0.000 0.000 0.000 0.000 0.250 0.000 0.000159 0.000 0.167 0.050 0.167 0.000 0.000 0.250 0.000160 0.250 0.000 0.000 0.000 0.125 0.000 0.071 0.000161 0.000 0.000 0.150 0.028 0.208 0.000 0.107 0.000162 0.000 0.000 0.000 0.000 0.000 0.000 0.036 0.000163 0.000 0.000 0.000 0.028 0.000 0.125 0.036 0.000

mTcCIR8 N 14 3 10 17 12 4 14 3250 0.000 0.000 0.000 0.029 0.000 0.000 0.000 0.000251 0.107 0.000 0.000 0.000 0.000 0.000 0.000 0.000257 0.000 0.000 0.000 0.000 0.000 0.250 0.000 0.000270 0.000 0.167 0.000 0.000 0.000 0.000 0.000 0.000286 0.071 0.000 0.000 0.000 0.000 0.000 0.000 0.000288 0.071 0.000 0.000 0.176 0.000 0.000 0.000 0.000289 0.393 0.333 0.600 0.324 0.708 0.250 0.393 0.833291 0.107 0.000 0.050 0.029 0.000 0.000 0.214 0.000292 0.071 0.000 0.050 0.000 0.000 0.000 0.000 0.000293 0.036 0.000 0.000 0.088 0.000 0.000 0.214 0.000294 0.000 0.000 0.000 0.000 0.042 0.000 0.000 0.000295 0.000 0.000 0.050 0.000 0.000 0.000 0.000 0.000

45

Appendix 1: Continue…

Locus Allele/n RAAS RAAN RSJ P.S Chi I.A B.A MatmTcCIR8 N 14 3 10 17 12 4 14 3

297 0.000 0.000 0.100 0.000 0.000 0.000 0.143 0.000299 0.000 0.333 0.000 0.000 0.000 0.250 0.000 0.000300 0.000 0.000 0.000 0.088 0.000 0.250 0.000 0.000302 0.036 0.000 0.000 0.000 0.000 0.000 0.000 0.000303 0.000 0.000 0.000 0.059 0.000 0.000 0.000 0.000304 0.036 0.000 0.000 0.029 0.000 0.000 0.000 0.000305 0.000 0.167 0.150 0.118 0.208 0.000 0.036 0.167307 0.071 0.000 0.000 0.000 0.000 0.000 0.000 0.000308 0.000 0.000 0.000 0.000 0.042 0.000 0.000 0.000389 0.000 0.000 0.000 0.059 0.000 0.000 0.000 0.000

mTcCIR 10 N 14 3 10 18 12 3 14 3194 0.000 0.000 0.000 0.000 0.000 0.000 0.036 0.000212 0.000 0.333 0.000 0.000 0.000 0.000 0.000 0.000213 0.036 0.000 0.000 0.000 0.000 0.000 0.000 0.000214 0.071 0.167 0.000 0.000 0.250 0.000 0.107 0.000215 0.071 0.000 0.050 0.000 0.000 0.000 0.036 0.000216 0.000 0.000 0.050 0.083 0.000 0.000 0.036 0.000217 0.000 0.000 0.050 0.000 0.000 0.000 0.036 0.000218 0.393 0.000 0.200 0.306 0.250 0.000 0.071 1,000219 0.036 0.500 0.000 0.000 0.042 0.000 0.036 0.000220 0.179 0.000 0.050 0.278 0.167 0.000 0.214 0.000221 0.000 0.000 0.250 0.056 0.083 1,000 0.107 0.000222 0.000 0.000 0.050 0.000 0.000 0.000 0.036 0.000225 0.071 0.000 0.000 0.000 0.000 0.000 0.036 0.000226 0.000 0.000 0.100 0.000 0.000 0.000 0.000 0.000228 0.071 0.000 0.150 0.167 0.125 0.000 0.214 0.000229 0.071 0.000 0.000 0.056 0.083 0.000 0.036 0.000230 0.000 0.000 0.050 0.000 0.000 0.000 0.000 0.000303 0.000 0.000 0.000 0.056 0.000 0.000 0.000 0.000

mTcCIR11 N 14 3 10 18 12 4 14 3196 0.036 0.000 0.000 0.000 0.000 0.000 0.000 0.000197 0.036 0.000 0.100 0.000 0.000 0.000 0.429 0.000198 0.000 0.000 0.000 0.000 0.000 0.000 0.071 0.000200 0.000 0.000 0.000 0.000 0.000 0.250 0.000 0.000202 0.000 0.000 0.050 0.000 0.000 0.000 0.000 0.000203 0.000 0.333 0.000 0.000 0.000 0.000 0.036 0.000205 0.036 0.000 0.000 0.000 0.000 0.000 0.000 0.000209 0.107 0.333 0.050 0.028 0.000 0.000 0.000 0.000

46

Appendix 1: Continue...

Locus Allele/n RAAS RAAN RSJ P.S Chi I.A B.A MatmTcCIR11 N 14 3 10 18 12 4 14 3

210 0.250 0.167 0.250 0.361 0.083 0.250 0.071 0.167211 0.000 0.000 0.050 0.000 0.000 0.000 0.000 0.000212 0.071 0.000 0.000 0.000 0.000 0.000 0.036 0.000216 0.000 0.000 0.000 0.028 0.042 0.125 0.071 0.000217 0.000 0.000 0.100 0.083 0.000 0.000 0.000 0.000219 0.000 0.167 0.000 0.000 0.000 0.000 0.000 0.000220 0.000 0.000 0.000 0.000 0.083 0.000 0.000 0.000221 0.000 0.000 0.000 0.028 0.000 0.000 0.000 0.000223 0.179 0.000 0.000 0.028 0.000 0.000 0.000 0.167224 0.000 0.000 0.000 0.056 0.000 0.000 0.000 0.000225 0.214 0.000 0.400 0.389 0.792 0.375 0.286 0.667295 0.071 0.000 0.000 0.000 0.000 0.000 0.000 0.000

mTcCIR 12 N 14 3 10 18 12 4 14 3163 0.000 0.000 0.000 0.000 0.000 0.250 0.000 0.000189 0.179 0.000 0.200 0.306 0.375 0.000 0.036 0.333197 0.000 0.000 0.000 0.000 0.000 0.250 0.000 0.000202 0.036 0.000 0.050 0.111 0.208 0.000 0.143 0.000204 0.000 0.000 0.000 0.028 0.000 0.125 0.036 0.000205 0.000 0.167 0.050 0.000 0.000 0.000 0.000 0.000206 0.000 0.000 0.050 0.028 0.000 0.000 0.107 0.000207 0.000 0.333 0.000 0.000 0.000 0.000 0.000 0.000210 0.000 0.333 0.000 0.000 0.000 0.000 0.000 0.000213 0.250 0.000 0.000 0.056 0.125 0.125 0.000 0.000214 0.000 0.000 0.000 0.000 0.000 0.125 0.000 0.000215 0.536 0.167 0.650 0.472 0.292 0.000 0.643 0.333223 0.000 0.000 0.000 0.000 0.000 0.125 0.000 0.000224 0.000 0.000 0.000 0.000 0.000 0.000 0.036 0.000238 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.333

mTcCIR 15 N 14 3 10 17 12 4 14 3214 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.167234 0.214 0.000 0.000 0.000 0.042 0.000 0.000 0.000235 0.071 0.167 0.000 0.059 0.083 0.000 0.107 0.000236 0.071 0.000 0.000 0.000 0.000 0.125 0.000 0.333237 0.000 0.000 0.300 0.206 0.125 0.500 0.107 0.167239 0.036 0.000 0.000 0.029 0.000 0.000 0.036 0.000242 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.167245 0.036 0.000 0.000 0.029 0.042 0.000 0.071 0.000

47

Appendix 1: continue…

Locus Allele/n RAAS RAAN RSJ P.S Chi I.A B.A MatmTcCIR 15 N 14 3 10 17 12 4 14 3

246 0.000 0.000 0.100 0.000 0.000 0.000 0.000 0.000248 0.036 0.000 0.000 0.000 0.000 0.000 0.000 0.000250 0.000 0.000 0.000 0.059 0.125 0.250 0.000 0.000251 0.107 0.000 0.000 0.059 0.042 0.000 0.107 0.000252 0.143 0.000 0.100 0.000 0.083 0.000 0.036 0.000253 0.000 0.000 0.000 0.118 0.208 0.000 0.107 0.000254 0.143 0.333 0.000 0.176 0.083 0.125 0.000 0.000255 0.071 0.333 0.200 0.265 0.125 0.000 0.321 0.000256 0.036 0.000 0.150 0.000 0.042 0.000 0.036 0.167257 0.036 0.000 0.000 0.000 0.000 0.000 0.036 0.000258 0.000 0.000 0.100 0.000 0.000 0.000 0.000 0.000259 0.000 0.167 0.050 0.000 0.000 0.000 0.036 0.000

mTcCIR18 N 13 3 10 18 12 3 14 3192 0.038 0.000 0.000 0.000 0.000 0.000 0.000 0.000199 0.000 0.000 0.100 0.111 0.000 0.333 0.000 0.167200 0.231 0.000 0.150 0.167 0.000 0.333 0.107 0.167201 0.000 0.000 0.000 0.083 0.042 0.000 0.000 0.000202 0.038 0.167 0.100 0.028 0.000 0.167 0.179 0.000203 0.038 0.000 0.000 0.000 0.000 0.000 0.036 0.000204 0.038 0.000 0.050 0.000 0.042 0.167 0.286 0.000205 0.077 0.000 0.000 0.000 0.000 0.000 0.000 0.000207 0.000 0.000 0.000 0.056 0.000 0.000 0.000 0.000209 0.000 0.333 0.000 0.000 0.000 0.000 0.000 0.000210 0.077 0.000 0.000 0.000 0.000 0.000 0.000 0.000212 0.154 0.000 0.050 0.111 0.292 0.000 0.179 0.000213 0.077 0.000 0.000 0.167 0.000 0.000 0.000 0.167214 0.077 0.500 0.550 0.278 0.625 0.000 0.214 0.500227 0.038 0.000 0.000 0.000 0.000 0.000 0.000 0.000236 0.038 0.000 0.000 0.000 0.000 0.000 0.000 0.000243 0.038 0.000 0.000 0.000 0.000 0.000 0.000 0.000255 0.038 0.000 0.000 0.000 0.000 0.000 0.000 0.000

mTcCIR 21 N 14 3 10 17 12 4 14 3142 0.000 0.000 0.100 0.000 0.000 0.000 0.071 0.000143 0.000 0.000 0.000 0.000 0.042 0.000 0.000 0.000144 0.107 0.167 0.000 0.029 0.083 0.125 0.036 0.000145 0.071 0.000 0.000 0.000 0.042 0.000 0.250 0.000147 0.000 0.000 0.000 0.000 0.000 0.250 0.000 0.000150 0.000 0.000 0.000 0.029 0.000 0.000 0.000 0.000

48

Appendix 1: Continue...

Locus Allele/n RAAS RAAN RSJ P.S Chi I.A B.A MatmTcCIR21

N 14 3 10 17 12 4 14 3

151 0.000 0.000 0.000 0.029 0.083 0.000 0.000 0.000153 0.071 0.000 0.100 0.000 0.000 0.250 0.000 0.000154 0.143 0.000 0.100 0.118 0.000 0.000 0.000 0.000155 0.286 0.500 0.350 0.500 0.542 0.250 0.393 0.667157 0.000 0.000 0.150 0.000 0.000 0.000 0.000 0.000158 0.000 0.000 0.000 0.000 0.000 0.000 0.071 0.000159 0.179 0.167 0.000 0.000 0.000 0.000 0.071 0.000160 0.000 0.000 0.000 0.029 0.000 0.000 0.000 0.000164 0.143 0.167 0.150 0.206 0.125 0.000 0.000 0.333165 0.000 0.000 0.000 0.000 0.083 0.000 0.000 0.000169 0.000 0.000 0.000 0.029 0.000 0.000 0.107 0.000173 0.000 0.000 0.050 0.000 0.000 0.000 0.000 0.000180 0.000 0.000 0.000 0.029 0.000 0.000 0.000 0.000181 0.000 0.000 0.000 0.000 0.000 0.125 0.000 0.000