GENE MAPPING 3
-
Upload
arputha-selvaraj-a -
Category
Health & Medicine
-
view
1.305 -
download
1
description
Transcript of GENE MAPPING 3
![Page 1: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/1.jpg)
GENE MAPPING - 3
By A.Arputha Selvaraj
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
![Page 2: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/2.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contents
Genetic mapping: Virtual or relational mapping
Physical mapping: systematic analysis Chromosome walking: find a gene on
chromosome Determining DNA sequences: quick revision New techniques for mapping and sequencing
![Page 3: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/3.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Why map before sequencing?
Major problem in large-scale sequencing: Current technologies can only sequence 600–800 bases
at a time. We need to sequence 30 billion bp in order to perfectly sequence human genome
One solution: make a physical map of overlapping DNA fragments: Top-Down approach Chromosomal libraries: 46 chromosomes/23 pairs Genomic library for many fragments from each
chromosome Determine sequence of each fragment Then assemble to form contiguous sequence
![Page 4: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/4.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Map-less sequencing: Bottoms up Celera approach
Alternative solution: fragment entire genome Sequence each fragment Assemble overlapping sequences to form
contiguous sequence Focus here on principles and techniques of
mapping and sequencing of the genomes
![Page 5: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/5.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458Figure 3.15 Genomes 3 (© Garland Science 2007)
Mitosis
Chromatids
![Page 6: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/6.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458Figure 3.16 Genomes 3 (© Garland Science 2007)
Meiosis
![Page 7: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/7.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From:
![Page 8: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/8.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From:
![Page 9: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/9.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458Figure 3.17 Genomes 3 (© Garland Science 2007)
![Page 10: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/10.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Mapping I
Mapping is identifying relationships between genes on chromosomes Just as a road map
shows relationships between towns on highway: fine maps
Two types of mapping: genetic and physical
![Page 11: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/11.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Mapping II
Genetic mapping Based on differences in recombination
frequency between genetic loci: meiosis Physical mapping
Based on actual distances in base pairs between specific sequences found on the chromosome
Most powerful when genetic and physical mapping are combined
![Page 12: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/12.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping I
Based on recombination frequencies The further away two points are on a
chromosome, the more recombination there is between them
Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci
Distance between the markers
![Page 13: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/13.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping II
Genetic mapping requires that a cross be performed between two related organisms The organism should have phenotypic
differences (contrasting characters like red and white or tall and short etc) resulting from allele differences at two or more loci
The frequency of recombination is determined by counting the F2 progeny with each phenotype
![Page 14: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/14.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example I
Genes on two different chromosomes Independent
assortment during meiosis (Mendel)
No linkage Dihybrid ratio
F1
9 : 3 : 3 : 1
F2
P
![Page 15: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/15.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example II
Genes very close together on same chromosome Will usually end up
together after meiosis Tightly linked
F1
1 : 2 : 1
F2
P
![Page 16: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/16.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic mapping example III
Genes on same chromosome, but not very close together Recombination will
occur Frequency of
recombination proportional to distance between genes
Measured in centiMorgans =cM
RecombinantsNon-parental features
One map unit = one centimorgan (cM) = 1% recombination between loci
![Page 17: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/17.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458Figure 3.18 Genomes 3 (© Garland Science 2007)
cM or centimorgan
1% Recombination = 1 cM
![Page 18: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/18.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic markers
Genetic mapping between positions on chromosomes Positions can be genes
Responsible for phenotype Examples: eye color or disease trait: limited
Positions can be physical markers DNA sequence variation
![Page 19: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/19.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical markers
Physical markers are DNA sequences that vary between two related genomes
Referred to as a DNA polymorphism Usually not in a gene
Examples RFLP SSLP SNP
![Page 20: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/20.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
RFLP
Restriction-fragment length polymorphism Cut genomic DNA from two individuals with
restriction enzyme Run Southern blot Probe with different pieces of DNA Sequence difference creates different band pattern
GGATCCCCTAGG
GTATCCGATAGG
GGATCCCCTAGG
200 400
GGATCCCCTAGG
GCATCCGGTAGG
GGATCCCCTAGG
200 400*
*
200
400
600
1 2
**
2
1
![Page 21: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/21.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SSLP/Microsatellites
• Simple-sequence length polymorphism• Most genomes contain repeats of three or four
nucleotides• Length of repeat varies due to slippage in replication• Use PCR with primers external to the repeat region• On gel, see difference in length of amplified fragment
ATCCTACGACGACGACGATTGATGCT
12
18
1 2
2
1
ATCCTACGACGACGACGACGACGATTGATGCT
![Page 22: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/22.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SNP
Single-nucleotide polymorphism One-nucleotide difference in sequence of two
organisms Found by sequencing Example: Between any two humans, on average one
SNP every 1,000 base pairs
ATCGATTGCCATGACATCGATGGCCATGAC2
1
SNP
![Page 23: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/23.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic map of Medicago truncatula BMC Plant Biology 2002, 2:1doi:10.1186/1471-2229-2-1
![Page 24: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/24.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical mapping
Determination of physical distance between two points on chromosome Distance in base pairs
Example: between physical marker and a gene Need overlapping fragments of DNA
Requires vectors that accommodate large inserts Examples: cosmids, YACs, and BACs
![Page 25: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/25.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical Mapping SystemsPhysical Mapping Systems
(like a Filing system of clones)(like a Filing system of clones)
Yeast Artificial Chromosomes (YACs) 200-1000 kb
Bacteriophage P1 90 kb
Cosmids 40 kb
Bacteriophage 9-23 kb
Plasmids (2-6 kb)
![Page 26: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/26.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Large insert vectors
Lambda phage Insert size: 20–30 kb
Cosmids Insert size: 35–45 kb
BACs and PACs (bacterial and P1 artificial chromosomes (Viral) respectively) Insert size: 100–300 kb
YACs (yeast artificial chromosomes) Insert size: 200–1,000 kb
![Page 27: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/27.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pros and cons of large-insert vectors
Lambda phage and cosmids Inserts stable But insert size too
small for large-scale sequencing projects
YACs Largest insert size But difficult to work
with due to instability
![Page 28: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/28.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
BACs and PACs
BACs and PACs Most commonly used
vectors for large-scale sequencing
Good compromise between insert size and ease of use
Growth and isolation similar to that for plasmids
![Page 29: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/29.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs
Contigs are groups of overlapping pieces of chromosomal DNA Make contiguous clones
For sequencing one wants to create “minimum tiling path” Contig of smallest number of inserts that covers a region of
the chromosome
genomic DNA
contig
minimumtiling path
![Page 30: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/30.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs from overlapping restriction fragments
Cut inserts with restriction enzyme
Look for similar pattern of restriction fragments Known as
“fingerprinting” Line up overlapping
fragments Continue until a contig
is built
![Page 31: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/31.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Restriction mapping applied to large-insert clones
Generates a large number of fragments Requires high-resolution separation of
fragments Can be done with gel electrophoresis
![Page 32: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/32.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Analysis of restriction fragments
Computer programs perform automatic fragment-size matching
Possibilities for errors Fragments of similar size may in fact be
different sequences Repetitive elements give same sizes, but from
different chromosomal locations
![Page 33: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/33.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Gel image processing
![Page 34: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/34.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
FPC: fingerprint analysis window
![Page 35: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/35.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Building contigs by probing with end fragments
Isolate DNA from both ends of insert and mix
Label and probe genomic library
Identify hybridizing clones
Repeat with ends of overlapping clones
![Page 36: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/36.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Chromosome walking
Combines probing with insert ends and restriction mapping
First find hybridizing clones Then create a
restriction map Identify the clone with
the shortest overlap Make probe from its end Repeat process
probelibrary
probe library
![Page 37: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/37.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequencing
All large-scale sequencing projects use the Sanger method
Based on action of DNA polymerase Requires template DNA and primer Polymerase and nucleotides
Polymerase adds nucleotides according to template
Small amount of nucleotide analog included Stops synthesis
![Page 38: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/38.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequencing reaction
Chain-termination method Uses dideoxy
nucleotides When added in right
amount, the chain is terminated Every time that base
appears in template Need a reaction for each
base: A, T, C, and G
3’ ATCGGTGCATAGCTTGT 5’
5’ TAGCCACGTATCGAACA* 3’5’ TAGCCACGTATCGAA* 3’5’ TAGCCACGTATCGA* 3’5’ TAGCCACGTA* 3’5’ TAGCCA* 3’5’ TA* 3’
Sequence reaction products
Template
![Page 39: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/39.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence detection
To detect products of sequencing reaction
Include labeled nucleotides
Formerly, radioactive labels used
Now, fluorescent labels used
Use different fluorescent tag for each nucleotide
Can run all four bases in same lane
TAGCCACGTATCGAA*
TAGCCACGTATC*
TAGCCACG*
TAGCCACGT*
![Page 40: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/40.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence separation
Terminated chains need to be separated
Requires one-base-pair resolution See difference between
chain of X and X+1 base pairs
Gel electrophoresis Very thin gel High voltage Works with radioactive
or fluorescent labels
A T C G–
+
![Page 41: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/41.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Capillary electrophoresis
Newer automated sequencers use very thin capillary tubes
Run all four fluorescently tagged reactions in same capillary
Can have 96 capillaries running at the same time
96–well plate
robotic arm and syringe
96 glass capillaries
load bar
![Page 42: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/42.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence reading of radioactively labeled reactions
Radioactively labeled reactions Gel dried Placed on X-ray film
Sequence read from bottom up
Each lane is a different base
–
+ C A G T C A G T
![Page 43: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/43.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Sequence reading of fluorescently labeled reactions
Fluorescently labeled reactions scanned by laser as a particular point is passed
Color picked up by detector
Output sent directly to computer
![Page 44: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/44.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Optical Mapping
• Single-molecule technique Individual DNA molecules attached to glass
support Restriction enzymes on glass are activated When DNA is cut, microscope records length
of resulting fragments Has potential to rapidly generate restriction
maps
Optical mapping was developed at New York University in the late 1990s by David Schwartz, now a professor of chemistry and genetics at the University of Wisconsin-Madison.
The method uses fluorescence microscopy to image individual DNA molecules that have been divided into orderly fragments by restriction enzymes.
![Page 45: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/45.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing I
Based on production of pyrophosphate during sequencing reaction
Each time polymerase adds nucleotide (dNTP) to the growing strand, pyrophosphate (PPi) is released Amount released equal
to number of nucleotides added
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Ronaghi et al. (1998-07-17). "A sequencing method based on real-time pyrophosphate". Science 281: 363.
![Page 46: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/46.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing II
To quantitate amount of PPi released: ATP sulfurylase converts PPi to ATP ATP used by enzyme luciferase (firefly) to
produce light from the substrate luciferin The amount of light produced is directly
proportional to the amount of ATP, which is proportional to the amount of PPi released
![Page 47: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/47.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing III
Sequential addition of each dNTP gives sequence
Apyrase enzyme used to degrade dNTPs after reaction completed
Sequence read from amount of light emitted as each dNTP is added
Nucleotide sequence
Nucleotide added
“pyrogram,”
![Page 48: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/48.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pyrosequencing is a method of DNA sequencing based on the "sequencing by synthesis" principle. The technique was developed by Mostafa Ronaghi and Pål Nyrén at the Royal Institute of Technology in Stockholm in the 1990s.
"Sequencing by synthesis" involves taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymatically. The Pyrosequencing method is based on detecting the activity of DNA polymerase (a DNA synthesizing enzyme) with another chemiluminescent enzyme. Essentially, the method allows sequencing of a single strand of DNA by synthesizing the complementary strand along it, one base pair at a time, and detecting which base was actually added at each step. The template DNA is immobilized, and solutions of A, C, G, and T nucleotides are added and removed after the reaction, sequentially. Light is produced only when the nucleotide solution complements the first unpaired base of the template. The sequence of solutions which produce chemiluminescent signals allows the determination of the sequence of the template.
ssDNA template is hybridized to a sequencing primer and incubated with the enzymes DNA polymerase, , luciferase and apyrase, and with the substrates (APS) and luciferin.
The addition of one of the four deoxynucleotide triphosphates (dNTPs)(in the case of dATP we add dATPαS which is not a substrate for a luciferase) initiates the second step. DNA polymerase incorporates the correct, complementary dNTPs onto the template. This incorporation releases pyrophosphate (PPi) stoichiometrically.
ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5´ phosphosulfate. This ATP acts as fuel to the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light produced in the luciferase-catalyzed reaction is detected by a camera and analyzed in a program.
Unincorporated nucleotides and ATP are degraded by the apyrase, and the reaction can restart with another nucleotide.
Currently, a limitation of the method is that the lengths of individual reads of DNA sequence are in the neighborhood of 300-500 nucleotides, shorter than the 800-1000 obtainable with chain termination methods (e.g. Sanger sequencing). This can make the process of genome assembly more difficult, particularly for sequence containing a large amount of repetitive DNA. As of 2007, pyrosequencing is most commonly used for resequencing or sequencing of genomes for which the sequence of a close relative is already available.
![Page 49: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/49.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Who owns it?
Pyrosequencing AB in Uppsala. Sweden, was started to commercialize the machine and reagent for sequencing of short stretches of DNA. Pyrosequencing AB was renamed to Biotage in 2003. Pyrosequencing technology was further licensed to 454 Life Sciences. 454 developed an array-based Pyrosequencing which has emerged as a rapid platform for large-scale DNA sequencing. Most notable are the applications for genome sequencing and metagenomics. GS FLX, the latest pyrosequencing platform by 454 Life Sciences (owned by Roche), can generate 100 million nucleotide data in a 7 hour run with a single machine. It is anticipated that the throughput would increase by 5-10 fold with the next release. Each run would cost about 5,000-6,000 USD, pushing de novo sequencing of mammalian genomes into the million dollar range.
![Page 50: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/50.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Membrane sequencing
Single DNA molecules pass through pore in membrane
Each nucleotide has slightly different charge
Charge detected as nucleotides pass through membrane
Many problems need to be worked out before this method can be used for genomic sequencing
![Page 51: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/51.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
From http://www.foresight.org/Nanomedicine/Sequencing.html
Nov. 1996 "Characterization of individual polynucleotide molecules using a membrane channel" (John J. Kasianowicz, Eric Brandin, Daniel Branton, David W. Deamer)
Nov. 1998 "Use of a Single Nanometer-Scale Pore to Rapidly Examine Individual DNA or RNA Strands" (Mark Akeson, Daniel Branton, John J. Kasianowicz, Eric Brandin, David W. Deamer)
Dec. 1999 "Microsecond time-scale discrimination among polycytidylic acid, polyadenylic acid, and polyuridylic acid as homopolymers or as segments within single RNA molecules" (M. Akeson, D. Branton, J.J. Kasianowicz, E. Brandin, D.W. Deamer) Abstract Paper
Feb. 2000 "Rapid nanopore discrimination between single polynucleotide molecules" (Amit Meller, Lucas Nivon, Eric Brandin, Gene Golovchenko, Daniel Branton)
Apr. 2000 "Nanopores and nucleic acids: prospects for ultrarapid sequencing" (D.W. Deamer, M. Akeson)Abstract
Sep. 2000 "Nanopore Sequencing. Probing Polynucleotides with a Nanopore: High Speed, Single Molecule DNA Sequencing" (Daniel Branton, Jene Golovchenko)
![Page 52: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/52.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary I
Basics of mapping Genetic mapping
Based on recombination frequencies Physical mapping
Requires overlapping DNA fragments Can use restriction enzymes Probing with end fragments Combination: chromosome walking
![Page 53: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/53.jpg)
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Summary II
Basics of sequencing Chain-termination method Radioactive or fluorescent labels Separated by gel or capillary electrophoresis Read from X-ray film or by laser detector
New technologies Optical mapping Pyrosequencing Membrane sequencing
![Page 54: GENE MAPPING 3](https://reader036.fdocuments.in/reader036/viewer/2022062312/55494c4db4c905e94e8b459c/html5/thumbnails/54.jpg)
Thank You
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458