Function of damage inducible DNA polymerase IV from ...738/fulltext.pdf · past and present....

1

FUNCTION OF DAMAGE INDUCIBLE DNA POLYMERASE IV FROM Escherichia coli

A dissertation presented

by

Jason M. Walsh

to The Department of Chemistry and Chemical Biology

In partial fulfillment of the requirements for the degree of Doctor of Philosophy

in the field of

Chemistry

Northeastern University Boston, Massachusetts

December, 2012

2

Function of Damage Inducible DNA Polymerase IV from Escherichia coli

by

Jason M. Walsh

ABSTRACT OF DISSERTATION

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Chemistry and Chemical Biology

in the Graduate School of Science of Northeastern University, December 2012

3

Abstract Y family polymerases are a family of DNA polymerases that carry out replication of

damaged DNA in a process known as translesion synthesis (TLS) when normal

polymerases cannot bypass the damaged base. TLS occurs in two distinct steps: the

insertion of a nucleotide opposite the lesion, which can be correct or mutagenic, and the

extension step, where 3-6 nucleotides (TLS patch) are added downstream from the lesion

so that the normal replicative polymerase can then continue DNA replication. This

extension step may be more essential to cell survival than the insertion step. This

dissertation presents a comprehensive study to understand the basis of specificity of Y

family DNA polymerases, analyzing both the amino acid residues of the DNA

polymerases as well as using modified DNA constructs.

Using computational prediction methods THEMATICS and POOL developed at

Northeastern, we have identified amino acid residues in DinB that are distant from the

active site that are predicted to contribute to activity. Mutation of these amino acids have

varying effects, from complete loss of activity to a reduction in the efficiency of

incorporating dCTP opposite DinB’s cognate lesion N2-furfuryl-dG. The inactive DinB

variants were found to bind to damaged DNA as well as wild-type DinB does, indicating

that the loss of activity is due to a defect in catalytic activity rather than substrate binding.

Most striking is that those variants that were active were specifically defective for the

essential extension step of TLS.

The DinB subfamily, which includes polymerase IV (DinB) from E. coli, Dpo4 from S.

solfataricus and mammalian DNA polymerase kappa, are specialized to copy bases that

are modified on the minor groove side of DNA such as the N2 position on guanosine.

4

They are less efficient at replicating beyond DNA adducts that lie on the major groove

side of DNA. DinB is unable to copy DNA containing the bulky cytosine analog tC (1,3-

diaza-2-oxo-phenothiazine), even though the A-family DNA polymerase Klenow

fragment is proficient at copying DNA that contains tC. However, DinB will utilize the

triphosphate version of tC to incorporate it onto the growing primer strand and extend

from it by inserting the next base. Other major groove DNA adducts such as N6-furfuryl-

dA and etheno-dA are not readily bypassed by the DinB subfamily of polymerases. All

three polymerases remain faithful in addition of dTTP from N6-furfuryl-dA. DinB

extension is completely blocked by etheno-dA. Polymerase kappa and Dpo4 show weak

extension on templates containing etheno-dA at the 60 minute time point, however, there

is no observable dTTP addition opposite etheno-dA. We have identified a variant of

DinB, R35A, that performs TLS on templates containing N6-furfuryl-dA but not etheno-

dA. This is an intriguing development in the study of Y family polymerases and their

inherent function and specificity.

5

Acknowledgements

I would like to thank my advisor Dr. Penny J. Beuning. I am really appreciative of the opportunity that you gave me to succeed, and for all of your help through the years, fighting for me, and your continuing assistance throughout the process of writing my papers and all of the help you gave me in my eventual transition from graduate school to the real world. I could not have accomplished any of this without you. I would like to thank my dissertation committee members: Dr. Mary Jo Ondrechen, Dr. David Budil, and Dr. Lee Makowski. Thank you all for taking time to read this dissertation, and offering me constructive questions, comments, and help to make this the best it could possibly be. I would like to thank my collaborators: Ondrechen Research Group at Northeastern University; Wilhelmmsson Group at Chalmers University, Sweden; Rozners Group at SUNY Binghamton. I would like to thank the Department of Chemistry and Chemical Biology at Northeastern University. I would like to thank all of the Beuning DNA Damage and Repair Laboratory members, past and present. Especially my post-doc Dr. Jana Sefcikova, and my partners in crime; Dr. Jaylene Ollivierre, Michelle Silva, Lisa Hawver, Phillip Nevin, Dr. Srinivas Somarowthu, Ramya Parasuram, Brenna Shurtleff, Nicholas DeLateur, Rajal Sharma, Paul Ippolitti. I would also like to thank the undergrads that have worked on these projects: Khadijah Balfour-Jeffrey, Kasia Wilk, Tara Dhingra, and Josh Araya. Finally, I would like to thank my family. First and foremost my beautiful, patient, helpful and understanding wife Jacqueline…I never would have survived this thing if it wasn’t for your ability to kick me in the ass, or listen to me complain, pick me up from the city when I missed the good train, drive me in early, edit my writing, and do the household chores on the weekends when I was toiling away in the lab. You are my rock. Also Myles, I can’t wait to meet you, and hopefully one day you will be able to read this thing, and get a sense of how your old man spent his late twenties. Trigger, my best friend in the whole world, you opened my eyes, made me laugh and hung out with me whenever I felt down. My dad Raymond, mom Carolyn, brothers Jared and Jacob, Nana, aunts, uncles, cousins, my Braintree and WNEC homeboys, plus the Biology and Chemistry departments at Western New England College; you all helped mold a young me into what became a real life scientist. I would also like to recognize my new family: Nicole, Noreen, Billy, Rosemary, Dan, and Pam. Thank you all so very much, for all of your help.

6

Table of Contents

Page Abstract of Dissertation ...................................................................................................... 2

Acknowledgements ............................................................................................................. 5

Table of Contents ................................................................................................................ 6

List of Figures ..................................................................................................................... 8

List of Tables .................................................................................................................... 10

List of Abbreviations ........................................................................................................ 11

Chapter 1: Background ..................................................................................................... 17

1.1 Introduction ............................................................................................................. 17 1.2 Transcriptional and Post-Translational Regulation ................................................ 22 1.3 DNA Polymerase IV: DinB .................................................................................... 24 1.4 Specificity of DinB ................................................................................................. 26 1.5 DinB Variants ......................................................................................................... 30 1.6 Cellular Interactions of DinB .................................................................................. 32 1.7 Non-natural Nucleotides as Probes for Polymerases .............................................. 34 1.8 Uses of Non-natural Nucleotides ............................................................................ 35 1.9 Synthetic Abasic Sites............................................................................................. 36 1.10 Minimal Requirements for Polymerization and Base Size Tolerance .................. 37 1.11 Fluorescent Nucleotide Analogs ........................................................................... 38 1.12 Major Groove Adducts ......................................................................................... 41 1.13 Summary ............................................................................................................... 43 1.14 References ............................................................................................................. 44

Chapter 2: Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB

(DNA polymerase IV) ....................................................................................................... 59

2.1: Introduction ............................................................................................................ 59 2.2 Materials and Methods ............................................................................................ 67

2.2.1 Computational Methods ................................................................................... 67 2.2.2 Experimental Methods .................................................................................... 68

2.3 Results ..................................................................................................................... 69 2.3.1 H6L .................................................................................................................. 72 2.3.2 D10E, D10N .................................................................................................... 73 2.3.3 Y106A, Y106F ................................................................................................. 74 2.3.4 K146A .............................................................................................................. 75 2.3.5 K150A, K157A, K157I .................................................................................... 76

2.4 Discussion ............................................................................................................... 76 2.5 References ............................................................................................................... 82

7

Chapter 3: Discrimination against the Cytosine Analog tC by Escherichia coli DNA

Polymerase IV DinB ......................................................................................................... 93

3.1 Introduction ............................................................................................................. 93 3.2 Materials and Methods ............................................................................................ 97

3.2.1 Proteins and Nucleic Acids ............................................................................. 97 3.2.2 Primer Extension Assays ................................................................................ 97 3.2.3 DNA Binding Assays ....................................................................................... 99 3.2.4 Model of DinB bound to DNA containing tC ................................................ 100

3.3 Results ................................................................................................................... 100 3.3.1 DinB discriminates against tC as the template base ...................................... 100 3.3.2 DinB faithfully incorporates dGTP opposite tC ............................................ 103 3.3.3 DinB requires primers at least three nucleotides beyond tC for efficient extension ................................................................................................................. 105 3.3.4 DinB adds dtCTP to a primer terminus.......................................................... 107

3.4 Discussion ............................................................................................................. 108 Chapter 4: Discrimination against major groove adducts by Y family polymerases of the

DinB subfamily ............................................................................................................... 121

4.1 Introduction ........................................................................................................... 121 4.2 Materials and Methods .......................................................................................... 124 4.3 Results ................................................................................................................... 126

4.3.1 Cytosine analogs dP and pyrrolo-dC modestly inhibit DinB......................... 126 4.3.2 N6-furfuryl-deoxyadenosine inhibits TLS ...................................................... 128 4.3.3 1,N6-ethenodeoxyadenosine (εdA) strongly inhibits TLS ............................. 132 4.3.4 DinB R35A mutation allows bypass of N6-furfuryl-dA but not εdA ............. 133

4.4 Discussion ............................................................................................................. 135 4.5 References ............................................................................................................. 139

Chapter 5: Future Considerations ................................................................................... 143

5.2 References ............................................................................................................. 147

8

List of Figures

Figure 1.1 Comparison of the overall folds of (a) a replicative DNA polymerase, and

(b) a Y-family DNA polymerase ............................................................................ 18

Figure 1.2 The canonical Watson-Crick base pairs. .................................................... 19

Figure 1.3 The domains and relative sizes of some Y family polymerases ................ 21

Figure 1.4 DNA damaging agents lead to the formation of lesions in DNA that

disrupt replication and induce the SOS response ................................................ 23

Figure 1.5 Adducts of deoxyguanine bypassed by E. coli pol IV ................................ 28

Figure 1.6 Mechanisms for the generation of -1 frameshift mutations by E. coli pol

IV .............................................................................................................................. 29

Figure1.7 Model of DinB with some important residues highlighted ........................ 31

Figure 1.8 2-Aminopurine (2AP) and its base pairs (a) 2AP base paired with

thymine and (b) 2AP base paired with cytosine ................................................... 39

Figure 1.9 Fluorescent cytosine analogs tC and tC° form canonical base pairs with

dG ............................................................................................................................. 42

Figure 2.1 Structural comparison of (a) natural deoxyguanosine and (b) N2-furfuryl-

deoxyguanosine (N2-f-dG) ...................................................................................... 60

Figure 2.2 Homology model of E. coli polymerase IV DinB ....................................... 71

Figure 2.3 Schematic of single nucleotide incorporation of each of the four

deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP) ............................ 72

Figure 2.4 Schematic of primer extension assays with primer/template DNA

containing N2-f-dG correctly base paired with C ................................................. 73

Figure 2.5 (a) ConSurf model of DinB ......................................................................... 78

Figure 3.1 Hydrogen bonding between (a) canonical guanine and cytosine and (b)

guanine and the cytosine analog tC ....................................................................... 96

Figure 3.2 Primer extension assay on DNA containing tC with (a) standing start

primer and (b) running start primer .................................................................. 101

Figure 3.3 DinB cannot extend past tC in the DNA template. DinB primer extension

on template containing C (a) and template containing tC (b) with primer 22 103

Figure 3.4 (a) DinB faithfully incorporates only dGTP opposite tC in the DNA

template .................................................................................................................. 104

9

Figure 3.5 DinB extension on both tC-containing DNA template and C-containing

DNA template with primers of varying lengths ................................................. 106

Figure 3.6 DinB incorporates the tC analog and replicates at least one additional

nucleotide ............................................................................................................... 107

Figure 3.7 Model of DinB bound to DNA ................................................................... 111

Figure 4.1 (a) The canonical Watson-Crick base pairing of G:C and cytosine analogs

pyrrolo-dC and dP (b) The canonical Watson-Crick base pairing of A:T and

adenosine analogs N6-furfuryl-dA and etheno-dA. ............................................ 123

Figure 4.2 Primer extension as well as fidelity of incorporation of Y family

polymerases E. coli DinB, human DNA polymerase κ and S. solfataricus Dpo4

on templates containing pyrrolo-dC .................................................................... 127

Figure 4.3 (a) Primer extension of Y family polymerases E. coli DinB, human

polymerase κ and S. solfataricus Dpo4 on templates containing N6-furfuryl-dA.

(b) Fidelity of incorporation of Y family polymerases E. coli DinB, human

polymerase κ and S. solfataricus Dpo4 on templates containing N6-furfuryl-dA.

(c) Primer extension of Y family polymerases E. coli DinB, human polymerase

κ and S. solfataricus Dpo4 on templates containing etheno-dA (d) Fidelity of

incorporation of Y family polymerases E. coli DinB, human polymerase κ and

S. solfataricus Dpo4 on templates containing etheno-dA. ................................. 128

Figure 4.4: Primer extension of Y family polymerases (a) E. coli DinB, (b) human

polymerase κ, or (c) S. solfataricus Dpo4 on templates containing N6-furfuryl-

dA and etheno-dA ................................................................................................. 131

Figure 4.5 Primer extension and fidelity of incorporation of wild-type DinB (25 nM)

and DinB R35A (12.5 nM) with templates containing (a) N6-furfuryl-dA or (b)

etheno-dA. (c) Position of residue R35 in DinB .................................................. 134

Figure 5.1 Diagram of the two phases of translesion synthesis (TLS): insertion

opposite the lesion, and extension beyond it ....................................................... 145

10

List of Tables

Table 2.1 Top 8% of POOL predicted residues………………………………….66 Table 2.2 Kinetic Parameters for dCTP incorporation opposite N2-f-dG by DinB and Binding Affinity of DinB to DNA…………………………………………………74 Table 3.1 Sequences of DNA primers and templates………………………….....99 Table 3.2 Dissociation constants for DinB binding to DNA constructs……….102 Table 3.3 Steady state kinetic parameters for dGTP incorporation opposite tC vs C……………………………………………………………………………………..105 Table 3.4 Steady state kinetic parameters for incorporation of dtCTP versus dCTP opposite template G……………………………………………………………108 Table 4.1 Steady state kinetic parameters for dTTP incorporation opposite N2-f-dA and A by DinB, DinB R35A, polymerase kappa and Dpo4…………………….129 Table 4.2 Steady state kinetic parameter comparison of DinB addition of dCTP from N2-f-dG and N6-f-dA……………………………………………………………129

11

List of Abbreviations

% percent

* position of 32P

ʹ prime

~ approximately

α alpha

β beta

γ gamma

η eta

ι iota

κ kappa

ζ zeta

γ-HOPdG γ-hydroxypropano-deoxyguanosine

εdA etheno-dA

2-AAF N-2-Acetylaminofluorene

2-AF 2-aminofluorene

4NQO 4-nitroquinoline-1-oxide

8-oxo-G 8-oxo-guanine 32P Phosphrous-32

A adenosine

A Alanine

aaRSs Aminoacyl-tRNA synthetases

Ala Alanine

Asn Asparagine

AP abasic

Arg Arginine

Asp Aspartic Acid

ATP adenosine triphosphate

BL21 E. coli cells

12

BPDE Benzo[a]pyrene diolepoxide

BSA bovine serum albumin

C carbon

C cytosine

CEdG N2-(1-carboxylethyl)-2ʹ-deoxyguanosine

CPG controlled pore glass

Cys Cysteine

D Aspartic acid

dA deoxyadenine

dAPMP deoxyaminopurine monophosphate

dATP deoxyadenosine triphosphate

dC deoxycytosine

dCTP deoxycytosine triphosphate

dG deoxyguanosine

dGTP deoxyguanosine triphosphate

DMT dimethoxytrityl

DNA deoxyribonucleic acid

dNTP deoxynucleotide triphosphate

dT deoxythymine

dtCTP deoxy-1,3-diaza-2-oxophenothiazine triphosphate

dTTP deoxythymine triphosphate

E Glutamic Acid

E. coli Escherichia coli

EDTA ethylenediaminetetraacetic acid

Extn+ extension plus

F Fluorine

F Phenylalanine

FPLC fast protein liquid chromatography

FRET fluorescence/Fӧrster resonance energy transfer

G Glycine

G guanine

13

Gln Glutamine

Glu Glutamic Acid

Gly Glycine

g g-force

GE General Electric

H Histidine

H hydrogen

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

HIV human immunodeficiency virus

I isoleucine

I2 molecular iodine

ID identification number

Ile isoleucine

IPTG Isopropyl β-D-1-thiogalactopyranoside

K Lysine

kcat catalytic constant; turnover number

KD dissociation constant

kDa kilodalton

KF Klenow fragment

Km Michaelis-Menten constant

KSI ketosteroid isomerase

Leu Leucine

L liter

LB Luria broth

Lt DNA concentration

Lys Lysine

M molar

Me metal

mer unit length of nucleic acid

Met methionine

mg milligram

14

Mg magnesium

µM micromolar

min minute

mL milliliter

mM millimolar

MW molecular weight

N Asparagine

N nitrogen

N2-f-dG N2-furfuryl-deoxyguanosine

N6-f-dA N6-furfuryl-deoxyadenosine

NaCl sodium chloride

NFZ nitrofurazone

NH nitrile hydratase

NH4 ammonium

nM nanomolar

nm nanometers

nt nucleotide

O6-BzG O6-benzylguanine

O6-MeG O6-methylguanine

OAc acetate

O oxygen

P phosphorous

P primer

P Proline

PAGE polyacrylamide gel electrophoresis

PDB Protein data bank

PGI phosphoglucose isomerase

Phe Phenylalanine

PMSF phenyl methyl sulfonyl fluoride

pol polymerase

pols polymerases

15

POOL Partial Order Optimum Likelihood

Pro Proline

Q Glutamine

R Arginine

Rh rhodium

RNA ribonucleotide

Rt total protein concentration

S Serine

SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis

Ser Serine

SO4 sulfate

SOS save our souls

SSB single stranded DNA binding protein

T Threonine

T thymine

T template; length of fully extended primer

tC 1,3-diaza-2-oxophenothiazine

TCA trichloroacetic acid

THEMATICS Theoretical Microscopic Anomalous Titration Curve Shapes

Thr Threonine

TLS translesion synthesis

tRNA transfer ribonucleic acid

Tyr Tyrosine

UV ultraviolet

V Valine

Val Valine

Vmax maximum velocity

W Tryptophan

wt wild-type

XPV Xerdoerma pigmentosum variant

Y Tyrosine

16

This chapter is reproduced with permission from the following "Escherichia coli Y Family DNA Polymerases" Jason M. Walsh, Lisa A. Hawver, and Penny J. Beuning Frontiers in Bioscience 16 3164-3182 (2011) dx.doi.org/10.2741/3904 Educational Use Frontiers in Bioscience grants permission to all authors, readers and third parties of educational nature to reproduce and use published material and online resources as part of another publication or entity. This permission is granted free of charge provided that: There is no charge, submission fee, royalty, honorarium, or any other monetary rewards for the use of the figure by the author, user, website, publisher, organizer or any other entity using the material. The material is properly credited by including citing the source within the text or legend and including the full citation of the article in the reference section of educational material. When available, the DOI link should also be provided. If reproduced in CD format, the reference should be included in the same page that the material is included. If reproduced on a website, the reference should be linked to the article published in the Frontiers in Bioscience. Users who do not know the URL of the link can request it by providing the citation in an email to [email protected]. If used online, the use should be for a timeline not longer than 1 month. The educational use includes, for example, the use of a figure, table or text in a presentation, another article, a book chapter, newsletter, thesis, dissertations, classroom material, academic course, academic conference material, training material or posting of an abstract on a website. If your use complies with the above guideline, you do not need to obtain permission from Frontiers in Bioscience for the use of material. and "Synthetic nucleotides as probes of DNA polymerase specificity" Jason M. Walsh and Penny J. Beuning, Journal of Nucleic Acids 2012 530963 (2012) http://dx.doi.org/10.1155/2012/530963 Journal of Nucleic Acids is an open access journal. Open access authors retain the copyrights of their papers, and all open access articles are distributed under the terms of the Creative Commons Attribution license, which permits unrestricted use, distribution and reproduction in any medium, provided that the original work is properly cited.

17

Chapter 1: Background

1.1 Introduction

Since the structure of DNA was determined (Franklin 1953; Watson 1953),

biochemists have sought more detailed ways to study DNA and the proteins that interact

with it (Kornberg 1957; Kleppe 1971), notably the DNA polymerases that carry out the

job of copying the molecule of life. DNA polymerases generally adopt a right-hand fold,

in which the thumb and fingers bind DNA and nucleotide (Figure 1.1) (Patel 2001;

Federley 2010). DNA polymerases add nucleotides to the growing DNA strand via

nucleophilic attack of the free 3′ hydroxyl group of the DNA primer on the alpha

phosphate of the incoming deoxynucleotide with release of pyrophosphate.

18

Figure 1.1 Comparison of the overall folds of (a) a replicative DNA polymerase, Bacillus stearothermophilus DNA pol I (Johnson 2003) and (b) a Y-family DNA polymerase, Sulfolobus solfataricus Dpo4 (Ling 2001). The respective thumb domains are shown in green, palm domains are in red, and fingers domains are in blue. The little finger domain unique to the Y family DNA polymerases is in purple (Ling 2001). The “vestigial” exonuclease domain of Bs pol I has been omitted for clarity (Kiefer 1997) (c) Polymerase catalyzed DNA replication (phosphoryl transfer) reaction. Polymerization of DNA occurs at a free 3´ hydroxyl group of the deoxyribose. Polymerases use a divalent magnesium ion (Me2+) to coordinate the negative charges of both the phosphate groups and the aspartic acid or glutamic acid in the active site of the polymerase (Berdis 2009).

DNA polymerase active site residues, which are usually glutamate or aspartate and are

located in the palm domain, coordinate divalent magnesium ions that serve to activate the

3′OH nucleophile (Figure 1.1) (Adler 1958; Bessman 1958; Kornberg 1958; Lehman

1958; Burgers 1979). The catalytic cycle is generally accompanied by conformational

changes in the fingers domain. In replicating DNA, DNA polymerases have to be able to

19

form all four base pair combinations specifically and efficiently in order to maintain the

integrity of the genome (Figure 1.2); however, when replication errors occur, the

mismatched bases can be removed by the exonucleolytic proofreading function of DNA

polymerases (Berdis 2009). Replicative DNA polymerases possess an exonuclease

domain that may be part of the same or a separate polypeptide that utilizes a metal-

dependent mechanism to excise mismatched bases (Berdis 2009; Reha-Krantz 2010). The

proofreading process involves translocation of the primer terminus from the polymerase

active site to the exonuclease active site; after the phosphodiester bond is hydrolyzed to

remove the mismatched base, the primer strand re-anneals to the template so that

polymerization can continue (Lee 2010; Reha-Krantz 2010). Replication errors that

escape proofreading can be repaired by the mismatch repair system (Friedberg 2006).

Figure 1.2 The canonical Watson-Crick base pairs. Standard numbering is indicated. Unless otherwise noted, R indicates the position of the deoxyribose in all figures.

Based on sequence conservation, DNA polymerases are divided into A, B, C, D,

X, and Y families. The A and B family DNA polymerases can be involved in replication

or repair, whereas members of the C family are involved in DNA replication (Rothwell

2005). X family DNA polymerases are involved in repair and Y family DNA

polymerases are specialized for copying damaged DNA (Rothwell 2005) in a process

known as translesion synthesis (TLS). In general, replicative DNA polymerases cannot

20

copy damaged DNA; rather, a specialized TLS polymerase must be recruited to extend

primers a sufficient distance past distortions in DNA templates to allow replicative DNA

polymerases to recover synthesis (Fuchs 2004; Fujii 2004; Pages 2005; Jarosz 2009).

DNA replication past damage or unusual DNA structures requires the ability to both

insert a nucleotide opposite a modification in the template as well as to extend the newly-

generated primer beyond that position.

Translesion synthesis (TLS) was first postulated almost forty years ago (Radman

1975). It was observed that DNA damage induced the E. coli SOS response, which is

accompanied by mutagenesis of the DNA (Radman 1975). Originally DNA damage-

induced mutagenesis was thought to result from the modification of replicative DNA

polymerases, which allowed them to bypass DNA damage, albeit sometimes

mutagenically (Woodgate 1989). However it was later discovered that the UmuC/UmuD′

complex (UmuD′2C, pol V) and DinB (pol IV) are Y family DNA polymerases that have

the specialized ability to carry out potentially mutagenic TLS (Yang 2005).

Y family DNA polymerases (Ohmori 2001) are found throughout all domains of

life; they have five conserved sequence motifs but the overall size of the proteins can

vary considerably (Figure 1.3) (Ohmori 1995; Ohmori 2001; Boudsocq 2002; Friedberg

2006; Yang 2007; Pata 2010).

21

DinB

Dpo4

hPolκ

UmuC

352

351

870

422

N‐clasp Polymerase Domain

Polymerase Domain

Polymerase Domain

Polymerase Domain

Little Finger

Little Finger

Little Finger C‐Terminus

C‐TerminusLittle Finger

Figure 1.3 The domains and relative sizes of some Y family polymerases (Lone 2007). The DinB ortholog human DNA polymerase kappa is represented as hPolk. Dpo4 represents DNA polymerase IV from Sulfolobus solfataricus.

In addition to bacterial pol IV and pol V, the eukaryotic members of the family include

Rev1, pol eta, pol kappa, and pol iota (Ohmori 2001). Y family polymerases possess a

domain known as the ‘little finger’ domain found only in the Y family (Ling 2001). The

Y family polymerases are characterized by small finger and thumb domains relative to

replicative DNA polymerases, which result in an open, solvent-accessible active site in

the palm domain of Y family members (Yang 2005; Chandani 2010). The active site of

replicative polymerases contains an ‘O-helix’, the role of which is to act as a steric check

on fidelity and allow only a correct base pair to be formed (Kaushik 1996; Ogawa 2001;

Beard 2003). Y family polymerases lack the O-helix, contributing to their more open and

flexible active sites and allowing them to accommodate lesions on the DNA template

(Ling 2001; Jarosz 2007). The available crystal structures of Y family DNA polymerases

(Pata 2010) tend to support the model of an open active site, as seen in the structure of

Sulfolobus solfataricus Dpo4 in complex with DNA containing a thymine-thymine (T-T)

cyclobutane pyrimidine dimer (Ling 2003). This structure demonstrates that both

thymines are accommodated in the active site simultaneously (Ling 2003). Structures of

other Y family DNA polymerases with or without DNA also generally show that these

proteins have small finger domains and open, solvent-accessible active sites, suggesting a

22

structural basis both for their ability to accommodate DNA lesions and for their low

fidelity when copying undamaged DNA (Ling 2001; Silvian 2001; Zhou 2001; Yang

2005; Chandani 2010; Pata 2010).

1.2 Transcriptional and Post-Translational Regulation

In E. coli, the expression of Y family polymerases along with other genes is

induced via the SOS response to damaged DNA. This cellular response was named the

SOS response by Miroslav Radman because there is a “danger signal which induces SOS

repair” (Radman 1974). Evelyn Witkin suggested that there is a pathway in E. coli that is

controlled by a repressor whose function is inactivated when DNA damage occurs and

that again becomes activated as a repressor once the repair of DNA damage is complete

(Witkin 1967). This repressor was discovered to be the LexA protein, the repressor of the

SOS genes. The SOS response is initiated when a lesion in the DNA template prevents

replicative polymerases from continuing with efficient replication, causing a region of

single-stranded DNA (ssDNA) to develop (Figure 1.4).

23

umuD umuC

SOS Box

UmuD′2 UmuC

Pol V

Pol IV

umuD umuC

SOS Box

UmuD2 UmuC

dinB

dinB

Chemical or Physical DNA Damaging Agents

RecA/ssDNA

SOS Box

SOS Box

RecA/ssDNA

LexALexA

Figure 1.4 DNA damaging agents lead to the formation of lesions in DNA that disrupt replication and induce the SOS response. Single-stranded DNA (ssDNA) develops and becomes coated with RecA creating a RecA/ssDNA nucleoprotein filament, which signals the initiation of the SOS response. At least 57 genes are regulated by the LexA repressor, which represses the SOS genes by binding to consensus sequences (“SOS boxes”) in the promoter regions. LexA cleaves itself upon its interaction with the RecA/ssDNA nucleoprotein filament (Friedberg 2006; Simmons 2008). The cleavage of LexA ablates its repressor function and allows for the expression of the umuDC and dinB genes, among others. UmuD2 also undergoes a cleavage reaction facilitated by the RecA/ssDNA nucleoprotein filament to form UmuD′2, the active form in SOS mutagenesis (Burckhardt 1988; Nohmi 1988; Shinagawa 1988). The dashed line in the UmuD2 cartoon signifies that the arm is behind the globular domain, as the monomers are related to each other by a C2 axis of symmetry. Both UmuD′2C (pol V) and DinB (pol IV) perform translesion synthesis (TLS) to bypass DNA adducts. It should be noted that it is not yet known exactly how UmuC and UmuD′2 interact and the cartoon merely indicates that they form a complex.

RecA is activated upon binding to ssDNA, forming a RecA/ssDNA nucleoprotein

filament (Friedberg 2006). LexA then binds the RecA/ssDNA nucleoprotein filament,

inducing LexA to cleave itself at its Ala84-Gly85 bond, approximately in the middle of the

protein (Horii 1981). Once LexA is cleaved it no longer represses the SOS genes,

24

allowing at least 57 genes, including umuC, umuD, and dinB, to be expressed during the

SOS response (Friedberg 2006; Simmons 2008).

The umuD gene products contribute an additional level of regulation of Y family

DNA polymerases in E. coli (Friedberg 2006). Upon expression, UmuD2 binds to the

RecA/ssDNA nucleoprotein filament, stimulating the ability of UmuD to cleave itself at

its Cys24-Gly25 bond and removing its N-terminal 24-amino acids to form UmuD′2 by a

mechanism similar to that of LexA (Burckhardt 1988; Nohmi 1988; Shinagawa 1988).

The full-length UmuD2 protein persists for approximately 20-40 min after expression is

induced, after which time the cleaved form UmuD′2 becomes the predominant form

(Figure 1.4) (Opperman 1999). Full-length UmuD2 and cleaved UmuD′2 play distinct

roles in the cellular response to DNA damage; UmuD2 contributes to accurate DNA

replication and repair while UmuD′2 facilitates mutagenesis (Marsh 1985; Opperman

1999; Reuven 1999; Tang 1999; Sutton 2001; Godoy 2007; Ollivierre 2010). Therefore,

this lag in the appearance of UmuD′2 delays the use of a potentially mutagenic pathway,

in part via direct interactions between the umuD gene products and Y family DNA

polymerases.

1.3 DNA Polymerase IV: DinB

DinB is one of two Y family polymerases found in E. coli (Reuven 1999; Tang

1999; Sutton 2001). The dinB (damage-inducible) gene was identified as being induced

upon treatment with DNA damaging agents (Kenyon 1980; Ohmori 1995). Subsequently,

the dinB gene product was demonstrated to be a DNA-dependent DNA polymerase

(Wagner 1999). DinB was also shown to possess the ability to accommodate misaligned

25

or bulged primer-template structures into its active site and to lack intrinsic 3′-5′

exonuclease proofreading activity (Wagner 1999).

DinB is expressed at a level of approximately 250 molecules per cell under non-

SOS induced conditions (Kim 2001). However, this number increases 10-fold after SOS

induction; therefore DinB is the most abundant DNA polymerase in E. coli during times

of cellular stress (Kim 2001). This level of upregulation of DinB leads to inhibition of Pol

III, decreasing the ability of Pol III to access DNA and ultimately leading to cell death

(Furukohri 2008; Uchida 2008).

A phenomenon known as adaptive mutagenesis involves dinB-dependent

increased mutability in starving, non-dividing cells (McKenzie 2001; Tompkins 2003). It

has been suggested that adaptive mutagenesis provides mutations that confer a selective

advantage in times of cellular stress (Foster 2007). DinB induction occurs late in

stationary phase and the higher levels may be maintained for at least several days with

maximum expression and mutagenesis occurring in cells that have active RNA

polymerase sigma factor (RpoS) (Layton 2003; Lombardo 2004). Adaptive mutagenesis

is a cellular starvation stress response system, which is partially distinct from the SOS

response. Notably, of the SOS genes, only DinB at elevated levels is required for stress-

induced mutagenesis (Galhardo 2009), although the exact molecular mechanism of

adaptive mutagenesis may not be entirely clear (McKenzie 2003; Slechta 2003; Hersh

2004). The GroE heat shock response chaperone system has also been shown to influence

DinB protein levels as well as adaptive mutagenesis, although no direct interaction

between GroE and DinB has been detected (Layton 2005).

26

Classically, expression of the dinB gene is repressed by LexA and induced as part

of the SOS response (Kenyon 1980; Simmons 2008). However, the dinB gene can also be

expressed under other conditions of cellular stress. For example, dinB expression is

induced by β-lactam antibiotic-mediated inhibition of the synthesis of bacterial cell walls

independent of LexA (Perez-Capilla 2005). This suggests that transcription of the dinB

gene can be considered a general stress response mechanism. Increased mutagenesis by

DinB, and possibly pol V, may be a contributing factor to antigenic variation or antibiotic

resistance (McKenzie 2001; Cirz 2007; Smith 2007; Petrosino 2009).

1.4 Specificity of DinB

DinB displays a preference for certain damaged DNA substrates. For example,

DinB possesses a 15-fold preference to insert C opposite N2-furfuryl-dG and a 25-fold

preference to extend from N2-furfuryl-dG in comparison to undamaged dG in a DNA

template (Figure 1.5) (Jarosz 2006; Jarosz 2009). While the endogenous source of N2-

furfuryl-dG has not yet been determined, by analogy to the formation of kinetin (N6-

furfuryl-dA), it may be a product of ribose oxidation (Barciszewski 1999). Strains in

which dinB has been deleted show a striking sensitivity to nitrofurazone and 4-

nitroquinoline-1-oxide (4NQO), both of which are thought to form N2-dG adducts, as

well as possibly other adducts (Friedberg 2006; Jarosz 2006). DinB also efficiently and

accurately bypasses N2-(1-carboxyethyl)-2′-deoxyguanine (N2-CEdG), which was

detected in 1 in 107 bases in melanoma cells and is formed as an adduct of methylglyoxal,

a common byproduct of glycolysis (Figure 1.5) (Yuan 2008). The presence of DinB

significantly increases bypass of the N2-dG adduct of benzo[a]pyrene (B[a]P), a potent

carcinogen consisting of a large, bulky polycyclic hydrocarbon (Figure 1.5) (Lenne-

27

Samuel 2000; Shen 2002; Fuchs 2004; Seo 2006). However, efficient bypass of some

isomers of B[a]P also requires pol V, suggesting that even subtle changes in the

conformation of adducts can alter how they are processed by DinB (Seo 2006). Acrolein

is a potent toxin and has tumor initiating properties, but it is also an endogenous

byproduct of fatty acid metabolism (Minko 2008). DinB inserts dCTP across from γ-

hydroxypropano-deoxyguanosine (γ-HOPdG), the N2-dG adduct of acrolein, as well as

peptide cross-links to γ-HOPdG (Figure 1.5) (Minko 2008). In addition to bypass of

DNA-peptide cross-links, DinB is also proficient in bypassing N2-N2-dG interstrand

cross-links (Kumari 2008). DinB may have a functional duality as a bypass polymerase

for certain metabolism-induced DNA lesions such as γ-HOPdG, N2-CEdG, and N2-

furfuryl-dG, and as a general bypass polymerase capable of negotiating larger N2-dG

adducts such as benzo[a]pyrene.

28

Figure 1.5 Adducts of deoxyguanine bypassed by E. coli pol IV: N2-dG-γ-hydroxypropano-dG (Minko 2008), N2-(1-carboxylethyl)-2′-dG (N2-CEdG) (Yuan 2008), N2-furfuryl-dG (Jarosz 2006), N2-+[trans, anti]-benzo[a]pyryl-dG (Shen 2002; Fuchs 2004; Seo 2006). Unmodified dG is shown for comparison. The table shows the identity of the nucleotide inserted by pol IV opposite each lesion.

DinB exhibits varying efficiency of bypass of a number of lesions resulting from

reactive oxygen species, including 8-oxoG, 2-oxoA, thymine glycol, 5-formyluracil, and

5-hydroxymethyluracil (Hori 2010), and is able to incorporate into DNA the oxidized

nucleotides 2-oxo-dATP and 8-oxo-dGTP (Yamada 2006). DinB has been shown to

bypass abasic (AP) sites in vitro generating either -1 or -2 frameshift mutations

(Kobayashi 2002; Maor-Shoshani 2002). The presence of accessory proteins, specifically

the beta processivity clamp and the gamma clamp loader, greatly increase the efficiency

of bypass (Maor-Shoshani 2002) and decrease frameshift mutagenesis (Kobayashi 2002).

29

On undamaged DNA, DinB has a relatively high error frequency of 2.1 x 10-4 for

frameshift mutations and 5.1 x 10-5 for base substitution mutations (Kobayashi 2002).

The majority of the frameshift mutations are single base deletions (~81%), whereas a

substantial number of frameshift mutations are two base deletions (~15%) (Kobayashi

2002). The mechanisms by which the -1 frameshift mutations occur in TLS by DinB is

most likely a combination of Streisinger slippage (Streisinger 1966) and dNTP-stabilized

misalignment in which a nucleotide downstream from the primer terminus is flipped out

of the DNA helix and is skipped by DinB generating a -1 frameshift mutation (Figure

1.6) (Kobayashi 2002; Tippin 2004; Foti 2010).

I. SOS- II. SOS+

X

UmuD′2

dNTP

X X

UmuD2

(b)

dNTP

X

X

dN

(a)

Y

Y

Z

Z

X

NY

Z

X

UmuD2X

Figure 1.6 Mechanisms for the generation of -1 frameshift mutations by E. coli pol IV. Pol IV is represented by the crystal structure of Dpo4 (yellow) (Ling 2001), while UmuD2 and UmuD′2 are shown in blue. (a). dNTP-stabilized misalignment mechanism (Kobayashi 2002; Tippin 2004) (b). Template slippage mechanism I. Prior to SOS induction, full-length UmuD2 regulates pol IV to enhance error-free synthesis (top). II. Upon SOS induction, cleaved UmuD′2 does not bind pol IV and so pol IV is free to generate -1 frameshift mutations via the template slippage mechanism (bottom) (Streisinger 1966; Foti 2010).

30

The dNTP-mediated mechanism may be at odds however with the recently published

mechanism of template slippage on homopolymeric runs by DinB (Foti 2010). This type

of slippage, which generates -1 frameshift mutations, is inhibited by UmuD2 (Figure 1.6)

(Foti 2010). Base skipping occurs as the template strand opposite the 5′ terminus folds

into the extrahelical space and the next nucleotide on the template strand becomes the

base opposite the primer terminus (Kunkel 1988; Bebenek 1990). This mechanism was

also observed in similar studies on the DinB ortholog Sulfolobus acidocaldaricus Dbh

(DeLucia 2007).

1.5 DinB Variants

Currently, there is no high-resolution structure of DinB but homology models

(Jarosz 2006; Seo 2009) have been constructed based on the crystal structures of other

homologous proteins: Sulfolobus solfataricus Dpo4 (Ling 2001) and Sulfolobus

acidocaldaricus Dbh (Silvian 2001). Therefore, interpretation of experiments in which

DinB variants have been constructed relies on the use of homology models. Cells

containing overexpressed wild-type DinB had have a mutation frequency of 6.8 x 10-3

(Wagner 1999), which is approximately 3600-fold greater than cells without

overexpressed DinB (Wagner 1999). DinB mutations D8A, D8H, R49A, R49F, D103A,

D103N (dinB003), and E104A led to between 850- and 3700-fold lower mutation

frequencies (Figure 1.7) (Wagner 1999). D103 and E104 reside in the S[LI]DE box

whose negatively charged residues in the active site coordinate the divalent magnesium

ions needed for adding the incoming nucleotide to the DNA primer (Wagner 1999; Ling

2001). Along with D103 and E104, D8 is strictly conserved (Wagner 1999). R49 is

predicted to lie in a loop region that is near the incoming nucleotide.

31

Figure1.7 Model of DinB with some important residues highlighted (Jarosz 2006). F13 (brown) is involved in accomodation of the lesion in the active site (Jarosz 2006). D8 (green), D103 and E104 (orange), R49 (purple) each when mutated confer a lower mutation frequency than wild-type DinB (Wagner 1999). D103 and E104 are involved in coordinating the divalent magnesium ion necessary for catalysis (Wagner 1999). Y79 (black) is important in regulating the steric gate residue (Jarosz 2009). Residues 346QLVLGL351 (pink) comprise one of the interaction sites with the beta clamp (Becherel 2002), while 303VWP305 (red) comprise the site of interaction with the dimer interface of the beta clamp (Bunting 2003).

The steric gate is a single residue in DNA polymerases that prevents the incorporation of

ribonucleotides into DNA by sterically occluding nucleotides with a 2′ hydroxyl group

(Astatke 1998). The steric gate residue of Y family DNA polymerases is most frequently

tyrosine or phenylalanine (Jarosz 2006; DeLucia 2007; Shurtleff 2009). Mutation of the

steric gate residue F13 in DinB has a marked effect on the ability of DinB to discriminate

against ribonucleotides, increasing the frequency of misincorporation from <10-5 to 10-3

(Jarosz 2006). It was hypothesized that the pocket in which F13 resides is involved in the

accommodation of a lesion in the active site (Figure 1.7) (Jarosz 2006). The substitution

F13V inhibits the ability of DinB to bypass N2-furfuryl-dG, and also slightly enhances the

ability of DinB to replicate undamaged DNA (Jarosz 2006).

Incoming nucleotide

101SLDE104

13F

8D

49R

79Y

346QLVLGL351

303VWP305

172F

32

Near the steric gate residue and conserved among all orthologous DinBs, Y79 is

hypothesized to regulate the function of the steric gate residue (Jarosz 2009). Mutations

at this position have a modest effect on primer extension on undamaged DNA but prevent

DinB from extending more than a few nucleotides beyond a lesion and result in extreme

cellular sensitivity to nitrofurazone (Jarosz 2009). Mutation of several other residues that

are distal to the active site have been shown to specifically affect the extension step of

TLS (Chapter 2) (Walsh 2012). As demonstrated in these studies, single mutations can

have a large effect on both the DNA replication and TLS activities of DinB.

1.6 Cellular Interactions of DinB DinB is regulated through protein-protein interactions with UmuD2, RecA, and

NusA, as well as with the beta clamp (Wagner 2000; Godoy 2007). Addition of RecA

and UmuD2 to a primer extension assay in which there are correctly paired bases at the

primer terminus increases the polymerization proficiency of DinB [Godoy 2007]. It

appears that the deleterious -1 frameshift mutator activity of DinB is a result of the

elevated number of molecules of DinB present in a cell relative to the amount of UmuD2

present [Godoy 2007]. Indeed, co-upregulation of both UmuD2 and DinB suppresses the -

1 frameshift mutation activity, while -1 frameshift mutations are elevated in the absence

of umuD (Figure 1.4) [Godoy 2007]. Modeling studies suggest that RecA and UmuD2

may suppress the -1 frameshift activity innate to DinB by decreasing the openness of the

DinB active site [Godoy 2007]. This regulation may explain the dual nature of the

polymerase activity of DinB, which accurately bypasses bulky N2-dG adducts but is also

responsible for highly mutagenic -1 frameshift mutations [Brotcorne-Lannoye 1986;

Kobayashi 2002; Jarosz 2006]. Deletion of umuD did not affect DinB-dependent

33

resistance to nitrofurazone, suggesting that the -1 frameshift mutator activity and TLS

functions are to some extent distinct [Godoy 2007]. DinB residue F172 is highly

conserved in DinB sequences from organisms that also harbor umuD and has been shown

to mediate the interaction between DinB and UmuD (Figure 1.7) [Godoy 2007]. DinB

also interacts physically with the beta processivity clamp. In the presence of the beta

clamp, DinB is recruited to the primer terminus to form a stable complex with DNA,

which substantially stimulates its processivity [Napolitano 2000]. The specific residues

involved in this protein-protein interaction have been identified as 346QLVLGL351

[Becherel 2002; Lenne-Samuel 2002], which is at the C-terminus of DinB (Figure 1.7).

The co-crystal structure of the little finger domain of DinB with the beta clamp reveals a

second interaction site between the two proteins at DinB residues 303VWP305 and near the

dimer interface of beta [Bunting 2003]. When the structure of full-length Dpo4 was

superimposed on the structure of the DinB little finger, the DNA polymerase did not

seem to be in the proper position to access the primer terminus [Bunting 2003]. This

suggests that this conformation, while likely not catalytically relevant, may be one way in

which the beta processivity clamp facilitates recruitment of DinB to replication forks

[Bunting 2003;Wagner 2009]. DinB can remove pol III from the beta clamp when pol III

is stalled at a primer terminus in vitro thus inhibiting the continuation of DNA synthesis

by the pol III holoenzyme [Furukohri 2008].

Recently, a role for the NusA protein in stress-induced mutagenesis has been

found that involves an interaction with DinB. NusA plays an important role in the

elongation, termination, and anti-termination phases of transcription [Greenblat 1981;

Farnham 1982; Liu 1996]. It was shown that DinB and NusA physically interact with one

34

another, so it was proposed that NusA recruits DinB to gaps that stall RNA polymerase

during transcription [Cohen 2009]. Though the exact location of the interaction has yet to

be identified, the C-terminal domain of NusA and surface residues near the nusA11Ts

mutation are likely sites [Nakamura 1986; Cohen 2009]. Genetic interactions have been

observed between nusA and both dinB and umuDC, which may indicate a genetic link

between TLS and transcription [Cohen 2009]. Moreover, NusA plays a role in

transcription-coupled nucleotide excision repair as well as in recruiting DinB for

transcription-coupled TLS of lesions that result in gaps in the DNA template that disrupt

RNA polymerase [Cohen, Lewis 2010]. Additionally, NusA has been found to be

required for DinB-dependent stress-induced, or adaptive, mutagenesis [Cohen, Walker

2010].

1.7 Non-natural Nucleotides as Probes for Polymerases

The genetic code is continuously expanding with new nucleobases designed to

suit specific research needs. These synthetic nucleotides are used to study DNA

polymerase dynamics and specificity and may even inhibit DNA polymerase activity.

The availability of an increasing chemical diversity of nucleotides allows questions of

utilization by different DNA polymerases to be addressed. Beyond the utility of non-

natural nucleotides as probes of DNA polymerase specificity, such entities can also

provide insight into the functions of DNA polymerases when encountering DNA that is

damaged by natural agents. Thus, synthetic nucleotides provide insight into how

polymerases deal with non-natural nucleotides as well as into the mutagenic potential of

non-natural nucleotides.

35

1.8 Uses of Non-natural Nucleotides Solid phase nucleic acid synthesis of DNA molecules facilitates the site-specific

incorporation of a wide range of chemically modified bases and sugar-phosphate

backbones, allowing the roles of specific atoms in DNA function and recognition to be

probed. Synthetic non-natural nucleobases are useful for a variety of studies of DNA

polymerase function, such as studies of DNA polymerase specificity, mutagenesis, and

dynamics, as well as fluorescence resonance energy transfer (FRET) analysis of DNA

polymerase interactions with DNA. The study of mutagenesis facilitated by DNA

polymerases has attracted increasing interest because replication defects can lead to

certain human diseases like the cancer-prone syndrome Xeroderma Pigmentosum-Variant

(XPV) (Cordonnier 1999; Bresson 2002) and other diseases (Pages 2002; Loeb 2008;

Takata 2011), as well as potentially contribute to antibiotic resistance (Napolitano 2000;

Miller 2004). Moreover, specialized damage-bypass DNA polymerases are implicated in

conferring cellular tolerance to cancer chemotherapy agents that act via DNA damage,

thereby decreasing their effectiveness (Bassett 2004; Albertella 2005a; Albertella 2005b;

Chen 2006; Ho 2011).

The four canonical bases vary in their chemical and geometric properties, but the

C1′-C1′ distance of the standard Watson-Crick base pairs and the backbone C-O-P-O-C

bonds remain constant regardless of the particular base pair (Kool 2002). Expansion of

the nucleobase alphabet must take some of these structural considerations into account;

usually non-natural bases need to have similar geometries as the natural bases, usually

but not necessarily retain some level of hydrogen bonding capabilities, and usually have π

36

electron systems in order to retain the stability provided by base stacking.

Hydrophobicity and base stacking interactions are also important for DNA structure

(Kool 2002).

1.9 Synthetic Abasic Sites

Because Y family DNA polymerases are known to copy non-canonical DNA

structures, their proficiency at copying synthetic abasic sites has been examined in some

detail. The model Y family DNA polymerase Sulfolobus solfataricus Dpo4 copies

synthetic abasic sites mainly by incorporating dA but also by generating small deletions

(Fiala 2007). E. coli DinB (DNA pol IV) efficiently copies DNA containing a synthetic

abasic site, but primarily by generating (-2) deletions (Maor-Shoshani 2003). Even

though both E. coli Y family DNA polymerases can copy DNA containing abasic sites,

Pol V is used to bypass abasic sites in vivo, probably because base substitutions are

generally less harmful than frameshift mutations (Maor-Shoshani 2003). Human DNA

pol eta copies abasic sites by incorporating predominantly dA but also dG (Masutani

2000; Kokoska 2003), whereas human pol kappa incorporates predominantly dA but also

generates one nucleotide deletions (Zhang 2000; Sherrer 2011). Y-family member Rev1

from yeast incorporates dC opposite abasic sites, which have been suggested to be the

cognate lesion of Rev1 (Otsuka 2002; Kim 2011; Pryor 2011). Due to the complicated

responses of even the relatively forgiving Y family DNA polymerases to the synthetic

model abasic site, it has been demonstrated that multiple DNA polymerases may be used

to bypass DNA damage efficiently while minimizing mutations (Johnson 2000; Shachar

2009).

37

1.10 Minimal Requirements for Polymerization and Base Size Tolerance

Y family DNA polymerases are able to copy DNA containing non-canonical

structures ranging from abasic sites to bulky DNA adducts (Washington 2003; Yang

2003; Jarosz 2007; Yang 2007; Waters 2009; Walsh 2011). Therefore, it was of interest

to determine the minimal features of DNA required for replication. Short (three or 12)

chains of methylene (CH2) residues in the middle of canonical DNA templates were used

to probe tolerance for minimal DNA backbones. E. coli pols I, II, and III were unable to

replicate either DNA structure. On the other hand, both pols IV and V could replicate the

three- or 12-methylene linker-containing DNA in vitro, although in an analogous

situation to abasic sites, only pol V is observed to replicate these unusual structures in

vivo (Maor-Shoshani 2003). Human DNA polymerases showed more subtle differences,

in that pols eta, kappa, and iota could replicate a three-methylene linker by inserting

nucleotides opposite the non-instructional segment, but only pols eta and kappa could

fully bypass the modified gap (Adar 2006). Pols eta and iota could insert nucleotides

opposite the 12-methylene linker, whereas pol kappa had little to no activity, and none of

these three polymerases could completely bypass the 12-methylene linker (Adar 2006).

Clearly, at least some Y family DNA polymerases are capable of replicating non-DNA

segments.

In order to probe the size tolerance for bases in the active site, a series of dG

analogs with increasingly large substituents at the N2 position in the minor groove were

constructed and used as the template base with a range of DNA polymerases. The N2

modifications included methyl, ethyl, isobutyl, benzyl, CH2-napthyl, CH2-anthracenyl,

and, in some cases, CH2-benzo[a]pyrenyl derivatives (Choi 2004; Choi 2005; Choi

38

2006a; Choi 2006c; Choi 2006d; Choi 2008). Bacteriophage T7 DNA polymerase

(exonuclease-) and HIV-1 reverse transcriptase are both able to bypass the N2-methyl

derivative efficiently, although significantly less efficiently than unmodified DNA, but

are not able to bypass any of the larger adducts (Choi 2004). Moreover, even the methyl

substituent caused a high frequency of misincorporation (Choi 2004). On the other hand,

each of the human Y family DNA polymerases is more tolerant of the size-expanded

bases (Choi 2005; Choi 2006a; Choi 2006c; Choi 2006d; Choi 2008). Rev1 is the most

tolerant of N2-dG-substitutions, followed by pol iota and pol kappa, whereas pol eta is the

least tolerant, showing a decrease in activity of approximately two orders of magnitude

between the CH2-napthyl and CH2-anthracenyl substituents (Choi 2008). A similar

analysis of O6-substituted bases showed that only Rev1 and pol iota could tolerate size-

expanded substituents up to the benzyl substitution, but pol eta and pol kappa showed

decreased activity even with an O6-methyl substitution (Choi 2006b; Choi 2008). The use

of a series of well-defined synthetic base modifications provides insights into the steric

constraints of DNA polymerase active sites and allows detailed comparisons to be made

between replicative and damage-bypass polymerases.

1.11 Fluorescent Nucleotide Analogs

The most common fluorescent base analog in use today is 2-aminopurine (2AP),

which can form hydrogen bonds and base pair with either of the pyrimidines thymine or

cytosine (Figure 1.8) (Wilhelmsson 2010). A recent crystal structure of DNA containing

a 2AP:dC base pair in the active site of the Y567A variant of RB69 DNA polymerase

suggests that the 2AP:dC pair may contain a bifurcated hydrogen bond between N2-H of

2AP and N3 and O2 of dC (Reha-Krantz 2010).

39

Figure 1.8 2-Aminopurine (2AP) and its base pairs (a) 2AP base paired with thymine and (b) 2AP base paired with cytosine (Wilhelmsson 2010).

In this example, the Y567A active site mutation in the nascent base-pair binding pocket is

both less discriminating in the formation of mismatched base pairs and is better able to

extend mismatched primer termini (Reha-Krantz 2010). The modified base 2AP is

commercially available and has been used to study a number of DNA binding protein

interactions including KF (Bloom 1993), EcoRI, DNA methyltransferase (Allan 1996),

endonuclease (Lycksell 1987), and uracil DNA glycosolate (Stivers 1999). The

fluorescence of this analog is sequence-context dependent, with the most pronounced

effect occurring when the base is surrounded by other purines; much like other

fluorescent nucleobases its fluorescence is quenched when it is within DNA (Ward

1969). KF has been shown to utilize 2AP and the fluorescence has been used to give

insights into the dynamics of this protein as it synthesizes DNA (Bloom 1993;

Hochstrasser 1994; Joyce 2008). For example in one FRET experiment with a labeled

KF, the mechanism of the fingers closing conformational change was studied (Joyce

2008) and was found to be influenced by the added nucleotide. Specifically, mismatched

nucleotides are detected before the polymerase “closes” on the DNA suggesting that the

mismatched nucleotide itself may destabilize the “open” polymerase conformation (Joyce

40

2008). The role in the conformational change of the divalent cation (usually Mg2+ or Ca2+

but in this case an “exchange inert” Rh(III)) was also probed using 2AP (Lee 2009) and it

was found that dNTP binding in the absence of the correct ion can induce the

conformational shift (Lee 2009).

Fluorescence spectroscopy with 2AP can be used to study DNA polymerization

on a millisecond time scale, and probe single events like nucleotide addition, base pairing

interactions and subsequent excision via nuclease activity (Bloom 1993; Hochstrasser

1994). Insertion kinetics have been measured for the monophosphate version of 2AP

(dAPMP vs dAMP) and dAPMP is found to be misincorporated at similar rates to the

incorporation of the natural triphosphate dATP opposite dT by KF (Bloom 1993). This

makes 2AP useful in studying polymerase activity as it is misincorporated about as

frequently as dA is incorporated. However, this incorporation is influenced by the

sequence surrounding the primer terminus, with double the rate of misincorporation of

2AP triphosphate if the nearest neighbor to the nascent base pair is dG, dC, or dA, as

compared to dT (Bloom 1993).

Y family polymerases also have been studied using 2AP. Dbh adds dTTP

correctly opposite 2AP in the template strand and binds various DNA substrates

containing 2AP with KD values similar to those of natural DNA substrates (DeLucia

2007). Use of 2AP to monitor conformation changes during the base-skipping

phenomenon, which can generate frameshift mutations as seen with Y family

polymerases, provides evidence that the misincorporation pathway is distinct from the

correct dNTP incorporation process (DeLucia 2007). Fluorescence from 2AP has been

41

also used to probe the proofreading mechanism by which bases are excised via nuclease

activity of phage T4 polymerase (Subuddhi 2008).

The analog 2AP has been used together with the base analog pyrrolo-dC as a

FRET pair as the excitation and emission wavelengths of these two nucleotide probes are

compatible (Marti 2006), though this pair has not yet been utilized to study DNA

polymerases. Pyrrolo-dC alone has been used to study DNA/RNA hybrids (Dash 2004),

single-stranded DNA hairpins (Zhang 2009), and base pair flipping (Yang 2008). Two

potential drawbacks of using 2AP are the sequence dependence of its fluorescence and

that it can perturb the DNA structure or be mutagenic if it forms a wobble pair with dT

(Wilhelmsson 2010). A 2AP:dT base pair destabilizes duplex DNA by ~8 °C relative to a

dA:dT base pair (Petruska 1985).

1.12 Major Groove Adducts

The synthetic cytosine analog tC was developed first by Mateucci (Lin 1995), but

then used as a probe of DNA polymerases by Wilhelmsson and co-workers (Wilhelmsson

2001; Sandin 2007; Stengel 2007). Although it has fluorescent properties, the extrahelical

system that lies on the major groove side of DNA was the major driving factor in the

research described in Chapter 3. The fluorescence quantum yield of this nucleotide

analog, unlike 2AP, is not sensitive to the surrounding environment (Stengel 2007;

Sandin 2009). This base also is incorporated into DNA, shows canonical base pairing

with guanosine (Figure 1.9), and does not perturb the B-form structure of DNA. In fact, a

dG:tC base pair stabilized DNA by 3 °C relative to a dG:dC base pair (Wilhelmsson

2010).

42

tC X=S

X

N

R

N

NR

NN

N

H

NO H

H N

H O

GtC° X=O

Figure 1.9 Fluorescent cytosine analogs tC and tC° form canonical base pairs with dG, do not perturb B-form DNA structure, and can pair with a FRET donor to probe DNA polymerase dynamics (Sandin 2007; Stengel 2007; Sandin 2008; Sandin 2009; Stengel 2009). In the case of tCo, X=O.

Different DNA polymerases have different efficiencies in utilizing tC in template DNA

and in incorporating tC into the growing DNA primer strand. For example, KF utilizes

template tC in preference to a template C, as KF apparently has a flexible enough active

site to accommodate the extra cyclic ring system. Klenow also preferentially incorporates

the tC nucleotide triphosphate in the growing DNA strand. E. coli Y-family DNA

polymerase DinB (pol IV) (Ohmori 2001), also utilizes the tC nucleotide triphosphate

more efficiently than dCTP, similar to Klenow (Walsh 2011). Primer extension by DinB

is inhibited unless the primer terminus is at least 3-4 nucleotides beyond the tC analog,

which suggests that the “TLS patch” of nucleotides required beyond non-cognate bases

for DNA polymerases to resume efficient synthesis is shorter for a Y family DNA

polymerase than for replicative polymerases. Moreover, the striking asymmetry of the

DinB active site has also been observed in the case of B family DNA polymerases human

polymerase alpha and herpes simplex virus I DNA polymerase when probed with non-

natural nucleotide analogs (Lund 2011).

43

1.13 Summary

E. coli Y family DNA polymerases play important roles in conferring resistance

to DNA damaging agents. The two Y family polymerases present in E. coli are proficient

for bypassing distinct sets of DNA lesions, which suggests that they play roles

complementary to each other in cells faced with DNA damage. The Y family

polymerases also regulate DNA replication in response to DNA damage and other

replication stress. Because of their role in mutagenesis, the Y family polymerases may be

involved in antigenic variation or antibiotic resistance. Thus, understanding both the

regulation and the inherent basis of specificity of Y family DNA polymerases is critical.

Also, non-natural nucleotides continue to provide an important tool for the study of DNA

and its interacting protein partners. In particular, DNA polymerases that are responsible

for the systematic replication of DNA, whether accurate or mutagenic, are required to

specifically recognize and efficiently base pair with a large number of non-canonical

DNA structures. An increasingly expanding genetic alphabet of non-natural nucleobases

provides the ability to obtain an unparalleled level of detail about how DNA polymerases

discriminate among many different DNA structures.

44

1.14 References Adar, S. and Z. Livneh (2006). "Translesion DNA synthesis across non-DNA segments

in cultured human cells." DNA Repair (Amst) 5(4): 479-490. Adler, J., I. R. Lehman, M. J. Bessman, E. S. Simms and A. Kornberg (1958).

"Enzymatic synthesis of deoxyribonucleic acid. Iv. Linkage of single deoxynucleotides to the deoxynucleoside ends of deoxyribonucleic acid." Proceedings of the National Academy of Sciences of the United States of America 44(7): 641-647.

Albertella, M. R., C. M. Green, A. R. Lehmann and M. J. O'Connor (2005a). "A role for polymerase eta in the cellular tolerance to cisplatin-induced damage." Cancer Research 65(21): 9799-9806.

Albertella, M. R., A. Lau and M. J. O'Connor (2005b). "The overexpression of specialized DNA polymerases in cancer." DNA Repair (Amst) 4(5): 583-593.

Allan, B. W. and N. O. Reich (1996). "Targeted base stacking disruption by the EcoRI DNA methyltransferase." Biochemistry 35(47): 14757-14762.

Astatke, M., K. Ng, N. D. Grindley and C. M. Joyce (1998). "A single side chain prevents Escherichia coli DNA polymerase I (Klenow fragment) from incorporating ribonucleotides." Proceedings of the National Acadamy of Sciences of the United States of America 95(7): 3402-3407.

Barciszewski, J., M. Z. Barciszewska, G. Siboska, S. I. Rattan and B. F. Clark (1999). "Some unusual nucleic acid bases are products of hydroxyl radical oxidation of DNA and RNA." Molecular Biology Reports 26(4): 231-238.

Bassett, E., N. M. King, M. F. Bryant, S. Hector, L. Pendyala, S. G. Chaney and M. Cordeiro-Stone (2004). "The role of DNA polymerase eta in translesion synthesis past platinum-DNA adducts in human fibroblasts." Cancer Research 64(18): 6469-6475.

Beard, W. A. and S. H. Wilson (2003). "Structural insights into the origins of DNA polymerase fidelity." Structure 11(5): 489-496.

Bebenek, K. and T. A. Kunkel (1990). "Frameshift errors initiated by nucleotide misincorporation." Proceedings of the National Acadamy of Sciences of the United States of America 87(13): 4946-4950.

Becherel, O. J., R. P. Fuchs and J. Wagner (2002). "Pivotal role of the beta-clamp in translesion DNA synthesis and mutagenesis in E. coli cells." DNA Repair (Amst) 1(9): 703-708.

Berdis, A. J. (2009). "Mechanisms of DNA polymerases." Chemical Reviews 109(7): 2862-2879.

Bessman, M. J., I. R. Lehman, J. Adler, S. B. Zimmerman, E. S. Simms and A. Kornberg (1958). "Enzymatic synthesis of deoxyribonucleic acid. Iii. The Incorporation of pyrimidine and purine analogues into deoxyribonucleic acid." Proceedings of the National Academy of Sciences of the United States of America 44(7): 633-640.

Bloom, L. B., M. R. Otto, J. M. Beechem and M. F. Goodman (1993). "Influence of 5'-nearest neighbors on the insertion kinetics of the fluorescent nucleotide analog 2-aminopurine by Klenow fragment." Biochemistry 32(41): 11247-11258.

45

Boudsocq, F., H. Ling, W. Yang and R. Woodgate (2002). "Structure-based interpretation of missense mutations in Y-family DNA polymerases and their implications for polymerase function and lesion bypass." DNA Repair (Amst) 1(5): 343-358.

Bresson, A. and R. P. Fuchs (2002). "Lesion bypass in yeast cells: Pol eta participates in a multi-DNA polymerase process." EMBO Journal 21(14): 3881-3887.

Bunting, K. A., S. M. Roe and L. H. Pearl (2003). "Structural basis for recruitment of translesion DNA polymerase Pol IV/DinB to the beta-clamp." EMBO Journal 22(21): 5883-5892.

Burckhardt, S. E., R. Woodgate, R. H. Scheuermann and H. Echols (1988). "UmuD mutagenesis protein of Escherichia coli: overproduction, purification, and cleavage by RecA." Proceedings of the National Acadamy of Sciences of the United States of America 85(6): 1811-1815.

Burgers, P. M. and F. Eckstein (1979). "A study of the mechanism of DNA polymerase I from Escherichia coli with diastereomeric phosphorothioate analogs of deoxyadenosine triphosphate." Journal of Biological Chemistry 254(15): 6889-6893.

Chandani, S., C. Jacobs and E. L. Loechler (2010). "Architecture of y-family DNA polymerases relevant to translesion DNA synthesis as revealed in structural and molecular modeling studies." Journal of Nucleic Acids 2010.

Chen, Y. W., J. E. Cleaver, F. Hanaoka, C. F. Chang and K. M. Chou (2006). "A novel role of DNA polymerase eta in modulating cellular sensitivity to chemotherapeutic agents." Molecular Cancer Research 4(4): 257-265.

Choi, J. Y., K. C. Angel and F. P. Guengerich (2006a). "Translesion synthesis across bulky N2-alkyl guanine DNA adducts by human DNA polymerase kappa." Journal of Biological Chemistry 281(30): 21062-21072.

Choi, J. Y., G. Chowdhury, H. Zang, K. C. Angel, C. C. Vu, L. A. Peterson and F. P. Guengerich (2006b). "Translesion synthesis across O6-alkylguanine DNA adducts by recombinant human DNA polymerases." Journal of Biological Chemistry 281(50): 38244-38256.

Choi, J. Y. and F. P. Guengerich (2004). "Analysis of the effect of bulk at N2-alkylguanine DNA adducts on catalytic efficiency and fidelity of the processive DNA polymerases bacteriophage T7 exonuclease- and HIV-1 reverse transcriptase." Journal of Biological Chemistry 279(18): 19217-19229.

Choi, J. Y. and F. P. Guengerich (2005). "Adduct size limits efficient and error-free bypass across bulky N2-guanine DNA lesions by human DNA polymerase eta." Journal of Molecular Biology 352(1): 72-90.

Choi, J. Y. and F. P. Guengerich (2006c). "Kinetic evidence for inefficient and error-prone bypass across bulky N2-guanine DNA adducts by human DNA polymerase iota." Journal of Biological Chemistry 281(18): 12315-12324.

Choi, J. Y. and F. P. Guengerich (2008). "Kinetic analysis of translesion synthesis opposite bulky N2- and O6-alkylguanine DNA adducts by human DNA polymerase REV1." Journal of Biological Chemistry 283(35): 23645-23655.

Choi, J. Y., H. Zang, K. C. Angel, I. D. Kozekov, A. K. Goodenough, C. J. Rizzo and F. P. Guengerich (2006d). "Translesion synthesis across 1,N2-ethenoguanine by human DNA polymerases." Chemical Research in Toxicology 19(6): 879-886.

46

Cirz, R. T. and F. E. Romesberg (2007). "Controlling mutation: intervening in evolution as a therapeutic strategy." Critical Review of Biochemistry & Molecular Biology 42(5): 341-354.

Cordonnier, A. M. and R. P. Fuchs (1999). "Replication of damaged DNA: molecular defect in xeroderma pigmentosum variant cells." Mutation Research 435(2): 111-119.

Dash, C., J. W. Rausch and S. F. Le Grice (2004). "Using pyrrolo-deoxycytosine to probe RNA/DNA hybrids containing the human immunodeficiency virus type-1 3' polypurine tract." Nucleic Acids Research 32(4): 1539-1547.

DeLucia, A. M., N. D. Grindley and C. M. Joyce (2007). "Conformational changes during normal and error-prone incorporation of nucleotides by a Y-family DNA polymerase detected by 2-aminopurine fluorescence." Biochemistry 46(38): 10790-10803.

Federley, R. G. and L. J. Romano (2010). "DNA polymerase: structural homology, conformational dynamics, and the effects of carcinogenic DNA adducts." Journal of Nucleic Acids 2010.

Fiala, K. A., C. D. Hypes and Z. Suo (2007). "Mechanism of abasic lesion bypass catalyzed by a Y-family DNA polymerase." Journal of Biological Chemistry 282(11): 8188-8198.

Foster, P. L. (2007). "Stress-induced mutagenesis in bacteria." Critical Review of Biochemical and Molecular Biology 42(5): 373-397.

Foti, J. J., A. M. Delucia, C. M. Joyce and G. C. Walker (2010). "UmuD2 inhibits a non-covalent step during DinB-mediated template slippage on homopolymeric nucleotide runs." Journal of Biological Chemistry 285(30): 23086-23095.

Franklin, R. E. and R. G. Gosling (1953). "Evidence for 2-chain helix in crystalline structure of sodium deoxyribonucleate." Nature 172(4369): 156-157.

Friedberg, E., G. Walker, W. W. Siede, RD, R. Schultz and T. Ellenberger (2006). DNA repair and mutagenesis, ASM.

Fuchs, R. P., S. Fujii and J. Wagner (2004). "Properties and functions of Escherichia coli: Pol IV and Pol V." Advances in Protein Chemistry 69: 229-264.

Fujii, S. and R. P. Fuchs (2004). "Defining the position of the switches between replicative and bypass DNA polymerases." EMBO Journal 23(21): 4342-4352.

Furukohri, A., M. F. Goodman and H. Maki (2008). "A dynamic polymerase exchange with Escherichia coli DNA polymerase IV replacing DNA polymerase III on the sliding clamp." Journal of Biological Chemistry 283(17): 11260-11269.

Galhardo, R. S., R. Do, M. Yamada, E. C. Friedberg, P. J. Hastings, T. Nohmi and S. M. Rosenberg (2009). "DinB upregulation is the sole role of the SOS response in stress-induced mutagenesis in Escherichia coli." Genetics 182(1): 55-68.

Godoy, V. G., D. F. Jarosz, S. M. Simon, A. Abyzov, V. Ilyin and G. C. Walker (2007). "UmuD and RecA directly modulate the mutagenic potential of the Y family DNA polymerase DinB." Molecular Cell 28(6): 1058-1070.

Hersh, M. N., R. G. Ponder, P. J. Hastings and S. M. Rosenberg (2004). "Adaptive mutation and amplification in Escherichia coli: two pathways of genome adaptation under stress." Research in Microbiology 155(5): 352-359.

47

Ho, T. V., A. Guainazzi, S. B. Derkunt, M. Enoiu and O. D. Scharer (2011). "Structure-dependent bypass of DNA interstrand crosslinks by translesion synthesis polymerases." Nucleic Acids Research 39(17): 7455-7464.

Hochstrasser, R. A., T. E. Carver, L. C. Sowers and D. P. Millar (1994). "Melting of a DNA helix terminus within the active site of a DNA polymerase." Biochemistry 33(39): 11971-11979.

Hori, M., S. Yonekura, T. Nohmi, P. Gruz, H. Sugiyama, S. Yonei and Q. M. Zhang-Akiyama (2010). "Error-Prone Translesion DNA Synthesis by Escherichia coli DNA Polymerase IV (DinB) on Templates Containing 1,2-dihydro-2-oxoadenine." Journal of Nucleic Acids 2010: 807579.

Horii, T., T. Ogawa, T. Nakatani, T. Hase, H. Matsubara and H. Ogawa (1981). "Regulation of SOS functions: purification of E. coli LexA protein and determination of its specific site cleaved by the RecA protein." Cell 27(3 Pt 2): 515-522.

Jarosz, D. F., S. E. Cohen, J. C. Delaney, J. M. Essigmann and G. C. Walker (2009). "A DinB variant reveals diverse physiological consequences of incomplete TLS extension by a Y-family DNA polymerase." Proceedings of the National Acadamy of Sciences of the United States of America 106(50): 21137-21142.

Jarosz, D. F., V. G. Godoy, J. C. Delaney, J. M. Essigmann and G. C. Walker (2006). "A single amino acid governs enhanced activity of DinB DNA polymerases on damaged templates." Nature 439(7073): 225-228.

Jarosz, D. F., V. G. Godoy and G. C. Walker (2007). "Proficient and accurate bypass of persistent DNA lesions by DinB DNA polymerases." Cell Cycle 6(7): 817-822.

Johnson, R. E., M. T. Washington, L. Haracska, S. Prakash and L. Prakash (2000). "Eukaryotic polymerases iota and zeta act sequentially to bypass DNA lesions." Nature 406(6799): 1015-1019.

Johnson, S. J., J. S. Taylor and L. S. Beese (2003). "Processive DNA synthesis observed in a polymerase crystal suggests a mechanism for the prevention of frameshift mutations." Proceedings of the National Acadamy of Sciences of the United States of America 100(7): 3895-3900.

Joyce, C. M., O. Potapova, A. M. Delucia, X. Huang, V. P. Basu and N. D. Grindley (2008). "Fingers-closing and other rapid conformational changes in DNA polymerase I (Klenow fragment) and their role in nucleotide selectivity." Biochemistry 47(23): 6103-6116.

Kaushik, N., V. N. Pandey and M. J. Modak (1996). "Significance of the O-helix residues of Escherichia coli DNA polymerase I in DNA synthesis: dynamics of the dNTP binding pocket." Biochemistry 35(22): 7256-7266.

Kenyon, C. and G. Walker (1980). "DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli." Proceedings of the National Acadamy of Sciences of the United States of America 77(5): 2819-2823.

Kiefer, J. R., C. Mao, C. J. Hansen, S. L. Basehore, H. H. Hogrefe, J. C. Braman and L. S. Beese (1997). "Crystal structure of a thermostable Bacillus DNA polymerase I large fragment at 2.1 A resolution." Structure 5(1): 95-108.

Kim, N., S. V. Mudrak and S. Jinks-Robertson (2011). "The dCMP transferase activity of yeast Rev1 is biologically relevant during the bypass of endogenously generated AP sites." DNA Repair (Amst) 10(12): 1262-1271.

48

Kim, S. R., K. Matsui, M. Yamada, P. Gruz and T. Nohmi (2001). "Roles of chromosomal and episomal dinB genes encoding DNA pol IV in targeted and untargeted mutagenesis in Escherichia coli." Molecular Genetics & Genomics 266(2): 207-215.

Kleppe, K., E. Ohtsuka, R. Kleppe, I. Molineux and H. G. Khorana (1971). "Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases." Journal of Molecular Biology 56(2): 341-361.

Kobayashi, S., M. R. Valentine, P. Pham, M. O'Donnell and M. F. Goodman (2002). "Fidelity of Escherichia coli DNA polymerase IV. Preferential generation of small deletion mutations by dNTP-stabilized misalignment." Journal of Biological Chemistry 277(37): 34198-34207.

Kokoska, R. J., S. D. McCulloch and T. A. Kunkel (2003). "The efficiency and specificity of apurinic/apyrimidinic site bypass by human DNA polymerase eta and Sulfolobus solfataricus Dpo4." Journal of Biological Chemistry 278(50): 50537-50545.

Kool, E. T. (2002). "Replacing the nucleobases in DNA with designer molecules." Accounts of Chemical Research 35(11): 936-943.

Kornberg, A. (1957). "Enzymatic synthesis of deoxyribonucleic acid." Harvey Lectures 53: 83-112.

Kornberg, S. R., I. R. Lehman, M. J. Bessman, E. S. Simms and A. Kornberg (1958). "Enzymatic cleavage of deoxyguanosine triphosphate to deoxyguanosine and tripolyphosphate." Journal of Biological Chemistry 233(1): 159-162.

Kumari, A., I. G. Minko, M. B. Harbut, S. E. Finkel, M. F. Goodman and R. S. Lloyd (2008). "Replication bypass of interstrand cross-link intermediates by Escherichia coli DNA polymerase IV." Journal of Biological Chemistry 283(41): 27433-27437.

Kunkel, T. A. and A. Soni (1988). "Mutagenesis by transient misalignment." Journal of Biological Chemistry 263(29): 14784-14789.

Layton, J. C. and P. L. Foster (2003). "Error-prone DNA polymerase IV is controlled by the stress-response sigma factor, RpoS, in Escherichia coli." Molecular Microbiolgy 50(2): 549-561.

Layton, J. C. and P. L. Foster (2005). "Error-prone DNA polymerase IV is regulated by the heat shock chaperone GroE in Escherichia coli." Journal of Bacteriology 187(2): 449-457.

Lee, H. R., M. Wang and W. Konigsberg (2009). "The reopening rate of the fingers domain is a determinant of base selectivity for RB69 DNA polymerase." Biochemistry 48(10): 2087-2098.

Lee, I. and A. J. Berdis (2010). "Non-natural nucleotides as probes for the mechanism and fidelity of DNA polymerases." Biochimica et Biophysica Acta 1804(5): 1064-1080.

Lehman, I. R., M. J. Bessman, E. S. Simms and A. Kornberg (1958). "Enzymatic synthesis of deoxyribonucleic acid. I. Preparation of substrates and partial purification of an enzyme from Escherichia coli." Journal of Biological Chemistry 233(1): 163-170.

Lenne-Samuel, N., R. Janel-Bintz, A. Kolbanovskiy, N. E. Geacintov and R. P. Fuchs (2000). "The processing of a Benzo(a)pyrene adduct into a frameshift or a base

49

substitution mutation requires a different set of genes in Escherichia coli." Molecular Microbiology 38(2): 299-307.

Lin, K. Y., R. J. Jones and M. Matteucci (1995). "Tricyclic 2'-Deoxycytidine Analogs - Syntheses and Incorporation into Oligodeoxynucleotides Which Have Enhanced Binding to Complementary Rna." Journal of the American Chemical Society 117(13): 3873-3874.

Ling, H., F. Boudsocq, B. S. Plosky, R. Woodgate and W. Yang (2003). "Replication of a cis-syn thymine dimer at atomic resolution." Nature 424(6952): 1083-1087.

Ling, H., F. Boudsocq, R. Woodgate and W. Yang (2001). "Crystal structure of a Y-family DNA polymerase in action: a mechanism for error-prone and lesion-bypass replication." Cell 107(1): 91-102.

Loeb, L. A. and R. J. Monnat, Jr. (2008). "DNA polymerases and human disease." Nature Reviews Genetics 9(8): 594-604.

Lombardo, M. J., I. Aponyi and S. M. Rosenberg (2004). "General stress response regulator RpoS in adaptive mutation and amplification in Escherichia coli." Genetics 166(2): 669-680.

Lone, S., S. A. Townson, S. N. Uljon, R. E. Johnson, A. Brahma, D. T. Nair, S. Prakash, L. Prakash and A. K. Aggarwal (2007). "Human DNA polymerase kappa encircles DNA: implications for mismatch extension and lesion bypass." Molecular Cell 25(4): 601-614.

Lund, T. J., N. A. Cavanaugh, N. Joubert, M. Urban, J. N. Patro, M. Hocek and R. D. Kuchta (2011). "B Family DNA Polymerases Asymmetrically Recognize Pyrimidines and Purines." Biochemistry 50(33): 7243-7250.

Lycksell, P. O., A. Graslund, F. Claesens, L. W. McLaughlin, U. Larsson and R. Rigler (1987). "Base pair opening dynamics of a 2-aminopurine substituted Eco RI restriction sequence and its unsubstituted counterpart in oligonucleotides." Nucleic Acids Research 15(21): 9011-9025.

Maor-Shoshani, A., K. Hayashi, H. Ohmori and Z. Livneh (2003). "Analysis of translesion replication across an abasic site by DNA polymerase IV of Escherichia coli." DNA Repair 2: 1227-1238.

Maor-Shoshani, A. and Z. Livneh (2002). "Analysis of the stimulation of DNA polymerase V of Escherichia coli by processivity proteins." Biochemistry 41(48): 14438-14446.

Marsh, L. and G. C. Walker (1985). "Cold sensitivity induced by overproduction of UmuDC in Escherichia coli." Journal of Bacteriology 162(1): 155-161.

Marti, A. A., S. Jockusch, Z. Li, J. Ju and N. J. Turro (2006). "Molecular beacons with intrinsically fluorescent nucleotides." Nucleic Acids Research 34(6): e50.

Masutani, C., R. Kusumoto, S. Iwai and F. Hanaoka (2000). "Mechanisms of accurate translesion synthesis by human DNA polymerase eta." EMBO Journal 19(12): 3100-3109.

McKenzie, G. J., P. L. Lee, M. J. Lombardo, P. J. Hastings and S. M. Rosenberg (2001). "SOS mutator DNA polymerase IV functions in adaptive mutation and not adaptive amplification." Molecular Cell 7(3): 571-579.

McKenzie, G. J., D. B. Magner, P. L. Lee and S. M. Rosenberg (2003). "The dinB operon and spontaneous mutation in Escherichia coli." Journal of Bacteriology 185(13): 3972-3977.

50

McKenzie, G. J. and S. M. Rosenberg (2001). "Adaptive mutations, mutator DNA polymerases and genetic change strategies of pathogens." Current Opinions in Microbiolgy 4(5): 586-594.

Miller, C., L. E. Thomsen, C. Gaggero, R. Mosseri, H. Ingmer and S. N. Cohen (2004). "SOS response induction by beta-lactams and bacterial defense against antibiotic lethality." Science 305(5690): 1629-1631.

Minko, I. G., K. Yamanaka, I. D. Kozekov, A. Kozekova, C. Indiani, M. E. O'Donnell, Q. Jiang, M. F. Goodman, C. J. Rizzo and R. S. Lloyd (2008). "Replication bypass of the acrolein-mediated deoxyguanine DNA-peptide cross-links by DNA polymerases of the DinB family." Chemical Research Toxicology 21(10): 1983-1990.

Napolitano, R., R. Janel-Bintz, J. Wagner and R. P. Fuchs (2000). "All three SOS-inducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced mutagenesis." EMBO Journal 19(22): 6259-6265.

Nohmi, T., J. R. Battista, L. A. Dodson and G. C. Walker (1988). "RecA-mediated cleavage activates UmuD for mutagenesis: mechanistic relationship between transcriptional derepression and posttranslational activation." Proceedings of the National Acadamy of Sciences of the United States of America 85(6): 1816-1820.

Ogawa, M., A. Tosaka, Y. Ito, S. Yoshida and M. Suzuki (2001). "Enhanced ribonucleotide incorporation by an O-helix mutant of Thermus aquaticus DNA polymerase I." Mutation Research 485(3): 197-207.

Ohmori, H., E. C. Friedberg, R. P. Fuchs, M. F. Goodman, F. Hanaoka, D. Hinkle, T. A. Kunkel, C. W. Lawrence, Z. Livneh, T. Nohmi, L. Prakash, S. Prakash, T. Todo, G. C. Walker, Z. Wang and R. Woodgate (2001). "The Y-family of DNA polymerases." Molecular Cell 8(1): 7-8.

Ohmori, H., E. Hatada, Y. Qiao, M. Tsuji and R. Fukuda (1995). "dinP, a new gene in Escherichia coli, whose product shows similarities to UmuC and its homologues." Mutation Research 347(1): 1-7.

Ollivierre, J. N., J. Fang and P. J. Beuning (2010). "The Roles of UmuD in Regulating Mutagenesis." J Nucleic Acids 2010.

Opperman, T., S. Murli, B. T. Smith and G. C. Walker (1999). "A model for a umuDC-dependent prokaryotic DNA damage checkpoint." Proceedings of the National Acadamy of Sciences of the United States of America 96(16): 9218-9223.

Otsuka, C., D. Loakes and K. Negishi (2002). "The role of deoxycytidyl transferase activity of yeast Rev1 protein in the bypass of abasic sites." Nucleic Acids Research(2): 87-88.

Pages, V. and R. P. Fuchs (2002). "How DNA lesions are turned into mutations within cells?" Oncogene 21(58): 8957-8966.

Pages, V., R. Janel-Bintz and R. P. Fuchs (2005). "Pol III proofreading activity prevents lesion bypass as evidenced by its molecular signature within E.coli cells." Journal of Molecular Biology 352(3): 501-509.

Pata, J. D. (2010). "Structural diversity of the Y-family DNA polymerases." Biochimica et Biophysica Acta 1804(5): 1124-1135.

Patel, P. H., M. Suzuki, E. Adman, A. Shinkai and L. A. Loeb (2001). "Prokaryotic DNA polymerase I: evolution, structure, and "base flipping" mechanism for nucleotide selection." Journal of Molecular Biology 308(5): 823-837.

51

Perez-Capilla, T., M. R. Baquero, J. M. Gomez-Gomez, A. Ionel, S. Martin and J. Blazquez (2005). "SOS-independent induction of dinB transcription by beta-lactam-mediated inhibition of cell wall synthesis in Escherichia coli." Journal of Bacteriology 187(4): 1515-1518.

Petrosino, J. F., R. S. Galhardo, L. D. Morales and S. M. Rosenberg (2009). "Stress-induced beta-lactam antibiotic resistance mutation and sequences of stationary-phase mutations in the Escherichia coli chromosome." Journal of Bacteriology 191(19): 5881-5889.

Petruska, J. and M. F. Goodman (1985). "Influence of neighboring bases on DNA polymerase insertion and proofreading fidelity." Journal of Biolgical Chemistry 260(12): 7533-7539.

Pryor, J. M. and M. T. Washington (2011). "Pre-steady state kinetic studies show that an abasic site is a cognate lesion for the yeast Rev1 protein." DNA Repair (Amst) 10(11): 1138-1144.

Radman, M. (1974). Phenomenology of an inducible mutagenic DNA repair pathway in Escherichia coli: SOS repair hypothesis. Molecular and environmental aspects of mutagenesis. L. Prakash, F. Sherman, M. W. Miller et al. Springfield, Ill.,, Thomas: xv, 289 p.

Radman, M. (1975). "SOS repair hypothesis: phenomenology of an inducible DNA repair which is accompanied by mutagenesis." Basic Life Sciences 5A: 355-367.

Reha-Krantz, L. J. (2010). "DNA polymerase proofreading: Multiple roles maintain genome stability." Biochimica et Biophysica Acta 1804(5): 1049-1063.

Reuven, N. B., G. Arad, A. Maor-Shoshani and Z. Livneh (1999). "The mutagenesis protein UmuC is a DNA polymerase activated by UmuD', RecA, and SSB and is specialized for translesion replication." Journal of Biological Chemistry 274(45): 31763-31766.

Rothwell, P. J. and G. Waksman (2005). "Structure and mechanism of DNA polymerases." Advances in Protein Chemistry 71: 401-440.

Sandin, P., K. Borjesson, H. Li, J. Martensson, T. Brown, L. M. Wilhelmsson and B. Albinsson (2008). "Characterization and use of an unprecedentedly bright and structurally non-perturbing fluorescent DNA base analogue." Nucleic Acids Research 36(1): 157-167.

Sandin, P., P. Lincoln, T. Brown and L. M. Wilhelmsson (2007). "Synthesis and oligonucleotide incorporation of fluorescent cytosine analogue tC: a promising nucleic acid probe." Nature Protocols 2(3): 615-623.

Sandin, P., G. Stengel, T. Ljungdahl, K. Borjesson, B. Macao and L. M. Wilhelmsson (2009). "Highly efficient incorporation of the fluorescent nucleotide analogs tC and tCO by Klenow fragment." Nucleic Acids Research 37(12): 3924-3933.

Seo, K. Y., A. Nagalingam, S. Miri, J. Yin, S. Chandani, A. Kolbanovskiy, A. Shastry and E. L. Loechler (2006). "Mirror image stereoisomers of the major benzo[a]pyrene N2-dG adduct are bypassed by different lesion-bypass DNA polymerases in E. coli." DNA Repair (Amst) 5(4): 515-522.

Seo, K. Y., J. Yin, P. Donthamsetti, S. Chandani, C. H. Lee and E. L. Loechler (2009). "Amino acid architecture that influences dNTP insertion efficiency in Y-family DNA polymerase V of E. coli." Journal of Molecular Biology 392(2): 270-282.

52

Shachar, S., O. Ziv, S. Avkin, S. Adar, J. Wittschieben, T. Reissner, S. Chaney, E. C. Friedberg, Z. Wang, T. Carell, N. Geacintov and Z. Livneh (2009). "Two-polymerase mechanisms dictate error-free and error-prone translesion DNA synthesis in mammals." EMBO Journal 28(4): 383-393.

Shen, X., J. M. Sayer, H. Kroth, I. Ponten, M. O'Donnell, R. Woodgate, D. M. Jerina and M. F. Goodman (2002). "Efficiency and accuracy of SOS-induced DNA polymerases replicating benzo[a]pyrene-7,8-diol 9,10-epoxide A and G adducts." Journal of Biological Chemistry 277(7): 5265-5274.

Sherrer, S. M., K. A. Fiala, J. D. Fowler, S. A. Newmister, J. M. Pryor and Z. Suo (2011). "Quantitative analysis of the efficiency and mutagenic spectra of abasic lesion bypass catalyzed by human Y-family DNA polymerases." Nucleic Acids Research 39(2): 609-622.

Shinagawa, H., H. Iwasaki, T. Kato and A. Nakata (1988). "RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis." Proceedings of the National Acadamy of Sciences of the United States of America 85(6): 1806-1810.

Shurtleff, B. W., J. N. Ollivierre, M. Tehrani, G. C. Walker and P. J. Beuning (2009). "Steric gate variants of UmuC confer UV hypersensitivity on Escherichia coli." Journal of Bacteriology 191(15): 4815-4823.

Silvian, L. F., E. A. Toth, P. Pham, M. F. Goodman and T. Ellenberger (2001). "Crystal structure of a DinB family error-prone DNA polymerase from Sulfolobus solfataricus." Nature Structural Biology 8(11): 984-989.

Simmons, L., J. Foti, S. Cohen and G. Walker (2008). Chapter 5.4.3 The SOS Regulatory Network. EcoSal--Escherichia coli and Salmonella: cellular and molecular biology. A. Bock, R. C. III, J. B. Kaper et al. Washington, D.C., ASM Press.

Slechta, E. S., K. L. Bunny, E. Kugelberg, E. Kofoid, D. I. Andersson and J. R. Roth (2003). "Adaptive mutation: general mutagenesis is not a programmed response to stress but results from rare coamplification of dinB with lac." Proceedings of the National Acadamy of Sciences of the United States of America 100(22): 12847-12852.

Smith, P. A. and F. E. Romesberg (2007). "Combating bacteria and drug resistance by inhibiting mechanisms of persistence and adaptation." Nature Chemical Biology 3(9): 549-556.

Stengel, G., J. P. Gill, P. Sandin, L. M. Wilhelmsson, B. Albinsson, B. Norden and D. Millar (2007). "Conformational dynamics of DNA polymerase probed with a novel fluorescent DNA base analogue." Biochemistry 46(43): 12289-12297.

Stengel, G., B. W. Purse, L. M. Wilhelmsson, M. Urban and R. D. Kuchta (2009). "Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment." Biochemistry 48(31): 7547-7555.

Stivers, J. T., K. W. Pankiewicz and K. A. Watanabe (1999). "Kinetic mechanism of damage site recognition and uracil flipping by Escherichia coli uracil DNA glycosylase." Biochemistry 38(3): 952-963.

Streisinger, G., Y. Okada, J. Emrich, J. Newton, A. Tsugita, E. Terzaghi and M. Inouye (1966). "Frameshift mutations and the genetic code." Cold Spring Harbors Symposium on Quantitative Biology 31: 77-84.

53

Subuddhi, U., M. Hogg and L. J. Reha-Krantz (2008). "Use of 2-aminopurine fluorescence to study the role of the beta hairpin in the proofreading pathway catalyzed by the phage T4 and RB69 DNA polymerases." Biochemistry 47(23): 6130-6137.

Sutton, M. D. and G. C. Walker (2001). "umuDC-mediated cold sensitivity is a manifestation of functions of the UmuD2C complex involved in a DNA damage checkpoint control." Journal of Bacteriology 183(4): 1215-1224.

Takata, M. (2011). "Guest editorial: fanconi anemia and the DNA damage response." International Journal of Hematology 93(4): 415-416.

Tang, M., X. Shen, E. G. Frank, M. O'Donnell, R. Woodgate and M. F. Goodman (1999). "UmuD'2C is an error-prone DNA polymerase, Escherichia coli pol V." Proceedings of the National Acadamy of Sciences of the United States of America 96(16): 8919-8924.

Tippin, B., S. Kobayashi, J. G. Bertram and M. F. Goodman (2004). "To slip or skip, visualizing frameshift mutation dynamics for error-prone DNA polymerases." Journal of Biological Chemistry 279(44): 45360-45368.

Tompkins, J. D., J. L. Nelson, J. C. Hazel, S. L. Leugers, J. D. Stumpf and P. L. Foster (2003). "Error-prone polymerase, DNA polymerase IV, is responsible for transient hypermutation during adaptive mutation in Escherichia coli." Journal of Bacteriology 185(11): 3469-3472.

Uchida, K., A. Furukohri, Y. Shinozaki, T. Mori, D. Ogawara, S. Kanaya, T. Nohmi, H. Maki and M. Akiyama (2008). "Overproduction of Escherichia coli DNA polymerase DinB (Pol IV) inhibits replication fork progression and is lethal." Molecular Microbiology 70(3): 608-622.

Wagner, J., S. Fujii, P. Gruz, T. Nohmi and R. P. Fuchs (2000). "The beta clamp targets DNA polymerase IV to DNA and strongly increases its processivity." EMBO Reports 1(6): 484-488.

Wagner, J., P. Gruz, S. R. Kim, M. Yamada, K. Matsui, R. P. Fuchs and T. Nohmi (1999). "The dinB gene encodes a novel E. coli DNA polymerase, DNA pol IV, involved in mutagenesis." Molecular Cell 4(2): 281-286.

Walsh, J. M., I. Bouamaied, T. Brown, L. M. Wilhelmsson and P. J. Beuning (2011). "Discrimination against the cytosine analog tC by Escherichia coli DNA polymerase IV DinB." Journal of Molecular Biology 409(2): 89-100.

Walsh, J. M., L. A. Hawver and P. J. Beuning (2011). "Escherichia coli Y family DNA polymerases." Frontiers in Bioscience 16: 3164-3182.

Walsh, J. M., R. Parasuram, P. R. Rajput, E. Rozners, M. J. Ondrechen and P. J. Beuning (2012). "Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB (DNA polymerase IV)." Environmental and Molecular Mutagenesis: In press 10.1002/em.21730.

Ward, D. C., E. Reich and L. Stryer (1969). "Fluorescence studies of nucleotides and polynucleotides. I. Formycin, 2-aminopurine riboside, 2,6-diaminopurine riboside, and their derivatives." Journal of Biological Chemistry 244(5): 1228-1237.

Washington, M. T., S. A. Helquist, E. T. Kool, L. Prakash and S. Prakash (2003). "Requirement of Watson-Crick hydrogen bonding for DNA synthesis by yeast DNA polymerase eta." Molecular Cell Biolology 23(14): 5107-5112.

54

Waters, L. S., B. K. Minesinger, M. E. Wiltrout, S. D'Souza, R. V. Woodruff and G. C. Walker (2009). "Eukaryotic translesion polymerases and their roles and regulation in DNA damage tolerance." Microbiolgy & Molecular Biology Review 73(1): 134-154.

Watson, J. D. and F. H. Crick (1953). "Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid." Nature 171(4356): 737-738.

Wilhelmsson, L. M. (2010). "Fluorescent nucleic acid base analogues." Quarterly Reviews of Biophysics 43(2): 159-183.

Wilhelmsson, L. M., A. Holmen, P. Lincoln, P. E. Nielsen and B. Norden (2001). "A highly fluorescent DNA base analogue that forms Watson-Crick base pairs with guanine." Journal of American Chemical Society 123(10): 2434-2435.

Witkin, E. M. (1967). "The radiation sensitivity of Escherichia coli B: a hypothesis relating filament formation and prophage induction." Proceedings of the National Acadamy of Sciences of the United States of America 57(5): 1275-1279.

Woodgate, R., M. Rajagopalan, C. Lu and H. Echols (1989). "UmuC mutagenesis protein of Escherichia coli: purification and interaction with UmuD and UmuD'." Proceedings of the National Acadamy of Sciences of the United States of America 86(19): 7301-7305.

Yamada, M., T. Nunoshiba, M. Shimizu, P. Gruz, H. Kamiya, H. Harashima and T. Nohmi (2006). "Involvement of Y-family DNA polymerases in mutagenesis caused by oxidized nucleotides in Escherichia coli." Journal of Bacteriology 188(13): 4992-4995.

Yang, K. and R. J. Stanley (2008). "The extent of DNA deformation in DNA photolyase-substrate complexes: a solution state fluorescence study." Photochemisrty and Photobiology 84(3): 741-749.

Yang, W. (2003). "Damage repair DNA polymerases Y." Current Opinion in Structural Biology 13(1): 23-30.

Yang, W. (2005). "Portraits of a Y-family DNA polymerase." FEBS Letters 579(4): 868-872.

Yang, W. and R. Woodgate (2007). "What a difference a decade makes: insights into translesion DNA synthesis." Proceedings of the National Acadamy of Sciences of the United States of America 104(40): 15591-15598.

Yuan, B., H. Cao, Y. Jiang, H. Hong and Y. Wang (2008). "Efficient and accurate bypass of N2-(1-carboxyethyl)-2'-deoxyguanosine by DinB DNA polymerase in vitro and in vivo." Proceedings of the National Acadamy of Sciences of the United States of America 105(25): 8679-8684.

Zhang, X. and R. M. Wadkins (2009). "DNA hairpins containing the cytidine analog pyrrolo-dC: structural, thermodynamic, and spectroscopic studies." Biophysical Journal 96(5): 1884-1891.

Zhang, Y., F. Yuan, X. Wu, M. Wang, O. Rechkoblit, J. S. Taylor, N. E. Geacintov and Z. Wang (2000). "Error-free and error-prone lesion bypass by human DNA polymerase kappa in vitro." Nucleic Acids Research 28(21): 4138-4146.

Zhou, B. L., J. D. Pata and T. A. Steitz (2001). "Crystal structure of a DinB lesion bypass DNA polymerase catalytic fragment reveals a classic polymerase catalytic domain." Molecular Cell 8(2): 427-437.

55

This chapter is reproduced with permission from the following "Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB (DNA Polymerase IV) " Jason M. Walsh, Ramya Parasuram, Pradyumna R. Rajput, Eriks Rozners, Mary Jo Ondrechen and Penny J. Beuning Environmental and Molecular Mutagenesis in press. http://dx.doi.org/10.1002/em.21730 Penny J. Beuning and Mary Jo Ondrechen conceived the study. Ramya Parasuram modeled the DNA, refined the homology model, carried out calculations for the residue predictions, and prepared figures. Pradyumma R. Rajput constructed the homology model. Eriks Rozners synthesized DNA constructs. Jason M. Walsh collected and analyzed the experimental data and prepared the manuscript draft, tables and figures.

56

This is a License Agreement between Jason M Walsh ("You") and John Wiley and Sons ("John Wiley and Sons") provided by Copyright Clearance Center ("CCC"). The license consists of your order details, the terms and conditions provided by John Wiley and Sons, and the payment terms and conditions. All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form. License Number 3020251387153 License date Nov 01, 2012 Licensed content publisher John Wiley and Sons Licensed content publication Environmental and Molecular Mutagenesis Book title Licensed content author Jason M. Walsh,Ramya Parasuram,Pradyumna R. Rajput,Eriks Rozners,Mary Jo Ondrechen,Penny J. Beuning Licensed content date Oct 4, 2012 Start page n/a End page n/a Type of use Dissertation/Thesis Requestor type Author of this Wiley article Format Print and electronic Portion Full article Will you be translating? No Order reference number Total 0.00 USD Terms and Conditions TERMS AND CONDITIONS This copyrighted material is owned by or exclusively licensed to John Wiley & Sons, Inc. or one of its group companies (each a "Wiley Company") or a society for whom a Wiley Company has exclusive publishing rights in relation to a particular journal (collectively WILEY"). By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the billing and payment terms and conditions established by the Copyright Clearance Center Inc., ("CCC’s Billing and Payment terms and conditions"), at the time that you opened your Rightslink account (these are available at any time at http://myaccount.copyright.com) Terms and Conditions 1. The materials you have requested permission to reproduce (the "Materials") are protected by copyright. 2. You are hereby granted a personal, non-exclusive, non-sublicensable, non-transferable, worldwide, limited license to reproduce the Materials for the purpose specified in the licensing process. This license is for a one-time use only with a maximum distribution equal to the number that you identified in the licensing process. Any form of republication granted by this licence must be completed within two years of the date of the grant of this licence (although copies prepared before may be distributed thereafter). The Materials shall not be used in any other manner or for any other purpose. Permission is granted subject to an appropriate acknowledgement given to the author, title of the material/book/journal and the publisher. You shall also duplicate the copyright notice that appears in the Wiley publication in your use of the Material. Permission is also granted on the understanding that nowhere in the text is a previously published source acknowledged for all or part of this Material. Any third party material is expressly excluded from this permission. 3. With respect to the Materials, all rights are reserved. Except as expressly granted by the terms of the license, no part of the Materials may be copied, modified, adapted (except for minor reformatting required by the new Publication), translated, reproduced, transferred or distributed, in any form or by any means, and no derivative works may be made based on the Materials without the prior permission of the respective copyright owner. You may not alter, remove or suppress in any manner any copyright, trademark or other notices displayed by the Materials. You may not license, rent, sell, loan, lease, pledge, offer as security, transfer or assign the Materials, or any of the rights granted to you hereunder to any other person. 4. The Materials and all of the intellectual property rights therein shall at all times remain the exclusive property of John Wiley & Sons Inc or one of its related companies (WILEY) or their respective licensors, and your interest therein is only that of having possession of and the right to reproduce the Materials pursuant to Section 2 herein during the continuance of this Agreement. You agree that you own no right, title or interest in or to the Materials or any of the intellectual property rights therein. You shall have no rights hereunder other than the license as provided for above in Section 2. No right, license or interest to any trademark, trade name, service mark or other branding ("Marks") of WILEY or its licensors is granted hereunder, and you agree that you shall not assert any

57

such right, license or interest with respect thereto. 5. NEITHER WILEY NOR ITS LICENSORS MAKES ANY WARRANTY OR REPRESENTATION OF ANY KIND TO YOU OR ANY THIRD PARTY, EXPRESS, IMPLIED OR STATUTORY, WITH RESPECT TO THE MATERIALS OR THE ACCURACY OF ANY INFORMATION CONTAINED IN THE MATERIALS, INCLUDING, WITHOUT LIMITATION, ANY IMPLIED WARRANTY OF MERCHANTABILITY, ACCURACY, SATISFACTORY QUALITY, FITNESS FOR A PARTICULAR PURPOSE, USABILITY, INTEGRATION OR NON-INFRINGEMENT AND ALL SUCH WARRANTIES ARE HEREBY EXCLUDED BY WILEY AND ITS LICENSORS AND WAIVED BY YOU. 6. WILEY shall have the right to terminate this Agreement immediately upon breach of this Agreement by you. 7. You shall indemnify, defend and hold harmless WILEY, its Licensors and their respective directors, officers, agents and employees, from and against any actual or threatened claims, demands, causes of action or proceedings arising from any breach of this Agreement by you. 8. IN NO EVENT SHALL WILEY OR ITS LICENSORS BE LIABLE TO YOU OR ANY OTHER PARTY OR ANY OTHER PERSON OR ENTITY FOR ANY SPECIAL, CONSEQUENTIAL, INCIDENTAL, INDIRECT, EXEMPLARY OR PUNITIVE DAMAGES, HOWEVER CAUSED, ARISING OUT OF OR IN CONNECTION WITH THE DOWNLOADING, PROVISIONING, VIEWING OR USE OF THE MATERIALS REGARDLESS OF THE FORM OF ACTION, WHETHER FOR BREACH OF CONTRACT, BREACH OF WARRANTY, TORT, NEGLIGENCE, INFRINGEMENT OR OTHERWISE (INCLUDING, WITHOUT LIMITATION, DAMAGES BASED ON LOSS OF PROFITS, DATA, FILES, USE, BUSINESS OPPORTUNITY OR CLAIMS OF THIRD PARTIES), AND WHETHER OR NOT THE PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. THIS LIMITATION SHALL APPLY NOTWITHSTANDING ANY FAILURE OF ESSENTIAL PURPOSE OF ANY LIMITED REMEDY PROVIDED HEREIN. 9. Should any provision of this Agreement be held by a court of competent jurisdiction to be illegal, invalid, or unenforceable, that provision shall be deemed amended to achieve as nearly as possible the same economic effect as the original provision, and the legality, validity and enforceability of the remaining provisions of this Agreement shall not be affected or impaired thereby. 10. The failure of either party to enforce any term or condition of this Agreement shall not constitute a waiver of either party's right to enforce each and every term and condition of this Agreement. No breach under this agreement shall be deemed waived or excused by either party unless such waiver or consent is in writing signed by the party granting such waiver or consent. The waiver by or consent of a party to a breach of any provision of this Agreement shall not operate or be construed as a waiver of or consent to any other or subsequent breach by such other party. 11. This Agreement may not be assigned (including by operation of law or otherwise) by you without WILEY's prior written consent. 12. Any fee required for this permission shall be non-refundable after thirty (30) days from receipt. 13. These terms and conditions together with CCC’s Billing and Payment terms and conditions (which are incorporated herein) form the entire agreement between you and WILEY concerning this licensing transaction and (in the absence of fraud) supersedes all prior agreements and representations of the parties, oral or written. This Agreement may not be amended except in writing signed by both parties. This Agreement shall be binding upon and inure to the benefit of the parties' successors, legal representatives, and authorized assigns. 14. In the event of any conflict between your obligations established by these terms and conditions and those established by CCC’s Billing and Payment terms and conditions, these terms and conditions shall prevail. 15. WILEY expressly reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC’s Billing and Payment terms and conditions. 16. This Agreement will be void if the Type of Use, Format, Circulation, or Requestor Type was misrepresented during the licensing process. 17. This Agreement shall be governed by and construed in accordance with the laws of the State of New York, USA, without regards to such state’s conflict of law rules. Any legal action, suit or proceeding arising out of or relating to these Terms and Conditions or the breach thereof shall be instituted in a court of competent jurisdiction in New York County in the State of New York in the United States of America and each party hereby consents and submits to the personal jurisdiction of such court, waives any objection to venue in such court and consents to service of process by registered or certified mail, return receipt requested, at the last known address of such party. Wiley Open Access Terms and Conditions All research articles published in Wiley Open Access journals are fully open access: immediately freely available to read, download and share. Articles are published under the terms of the Creative Commons Attribution Non Commercial License. which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. The license is subject to the Wiley Open Access terms and conditions: Wiley Open Access articles are protected by copyright and are posted to repositories and websites in accordance with the terms of the Creative Commons Attribution Non Commercial License. At the time of deposit, Wiley Open Access articles include all changes

58

made during peer review, copyediting, and publishing. Repositories and websites that host the article are responsible for incorporating any publisher-supplied amendments or retractions issued subsequently. Wiley Open Access articles are also available without charge on Wiley's publishing platform,Wiley Online Library or any successor sites. Use by non-commercial users For non-commercial and non-promotional purposes individual users may access, download, copy, display and redistribute to colleagues Wiley Open Access articles, as well as adapt, translate, text- and data-mine the content subject to the following conditions: � The authors' moral rights are not compromised. These rights include the right of "paternity" (also known as "attribution" - the right for the author to be identified as such) and "integrity" (the right for the author not to have the work altered in such a way that the author's reputation or integrity may be impugned). � Where content in the article is identified as belonging to a third party, it is the obligation of the user to ensure that any reuse complies with the copyright policies of the owner of that content. � If article content is copied, downloaded or otherwise reused for non-commercial research and education purposes, a link to the appropriate bibliographic citation (authors, journal, article title, volume, issue, page numbers, DOI and the link to the definitive published version on Wiley Online Library) should be maintained. Copyright notices and disclaimers must not be deleted. � Any translations, for which a prior translation agreement with Wiley has not been agreed, must prominently display the statement: "This is an unofficial translation of an article that appeared in a Wiley publication. The publisher has not endorsed this translation." Use by commercial "for-profit" organisations Use of Wiley Open Access articles for commercial, promotional, or marketing purposes requires further explicit permission from Wiley and will be subject to a fee. Commercial purposes include: � Copying or downloading of articles, or linking to such articles for further redistribution, sale or licensing; � Copying, downloading or posting by a site or service that incorporates advertising with such content; � The inclusion or incorporation of article content in other works or services (other than normal quotations with an appropriate citation) that is then available for sale or licensing, for a fee (for example, a compilation produced for marketing purposes, inclusion in a sales pack) � Use of article content (other than normal quotations with appropriate citation) by for-profit organisations for promotional purposes � Linking to article content in e-mails redistributed for promotional, marketing or educational purposes; � Use for the purposes of monetary reward by means of sale, resale, licence, loan, transfer or other form of commercial exploitation such as marketing products � Print reprints of Wiley Open Access articles can be purchased from: [email protected] Other Terms and Conditions: BY CLICKING ON THE "I AGREE..." BOX, YOU ACKNOWLEDGE THAT YOU HAVE READ AND FULLY UNDERSTAND EACH OF THE SECTIONS OF AND PROVISIONS SET FORTH IN THIS AGREEMENT AND THAT YOU ARE IN AGREEMENT WITH AND ARE WILLING TO ACCEPT ALL OF YOUR OBLIGATIONS AS SET FORTH IN THIS AGREEMENT. v1.7 If you would like to pay for this license now, please remit this license along with your payment made payable to "COPYRIGHT CLEARANCE CENTER" otherwise you will be invoiced within 48 hours of the license date. Payment should be in the form of a check or money order referencing your account number and this invoice number RLNK500888515. Once you receive your invoice for this order, you may pay your invoice by credit card. Please follow instructions provided at that time. Make Payment To: Copyright Clearance Center Dept 001 P.O. Box 843006 Boston, MA 02284-3006 For suggestions or comments regarding this order, contact RightsLink Customer Support:[email protected] or +1-877-622-5543 (toll free in the US) or +1-978-646-2777. Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license for your reference. No payment is required.

59

Chapter 2: Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB (DNA polymerase IV)

2.1: Introduction

DNA polymerases are generally highly efficient and accurate enzymes that use

polymeric DNA as templates to synthesize new DNA. The DNA polymerase active site

consists of negatively charged aspartate and glutamate residues that bridge the metal ions

(2 Mg2+) and position them into the correct orientation to activate and facilitate

nucleophilic attack of the primer 3′-hydroxyl group onto the α-phosphate group of the

incoming deoxynucleotide triphosphate (Berdis 2009). The metal ions also help stabilize

the negative charge that accumulates on both this ternary complex transition state and on

the pyrophosphate product of DNA synthesis (Berdis 2009). DNA is constantly subjected

to insults from both environmental and endogenous sources (Friedberg 2006). The

resulting damaged DNA generally cannot be copied efficiently or accurately by

replicative DNA polymerases (Friedberg 2006). Thus, in addition to multiple DNA repair

processes, organisms in all domains of life harbor specialized DNA polymerases that can

copy damaged DNA in a process known as translesion synthesis (TLS) (Goodman 2002;

Friedberg 2005; Prakash 2005; Friedberg 2006; Walsh 2011). Y family DNA

polymerases are capable of carrying out TLS, which is an important mechanism of DNA

damage tolerance, and also exhibit a relatively high error frequency when copying

undamaged DNA. Because of their roles in DNA damage tolerance and in mutagenesis,

Y family DNA polymerases are implicated in cancer (Cordonnier 1999; Bresson 2002;

Pages 2002; Loeb 2008; Lange 2011), in resistance to DNA-damaging cancer

chemotherapy agents (Bassett 2004; Albertella 2005; Chen 2006; Ho 2011), and are

60

proposed to play a role in antibiotic resistance (Napolitano 2000; Miller 2004; Cirz 2005;

Cirz 2006; Cirz 2007). Notably, defects in Y family DNA pol eta can cause the cancer-

prone disease Xeroderma Pigmentosum-Variant (XPV) (Kraemer 1985; Johnson 1999;

Itoh 2000; Tanioka 2007; Inui 2008; Biertumpfel 2010).

DinB (DNA polymerase IV) is one of two Y family DNA polymerases in

Escherichia coli (E. coli) (Friedberg 2002). DinB incorporates nucleotides across from

deoxyguanine adducts at the N2 position, namely carboxyethyl (Yuan 2008),

benzo[a]pyrene (Shen 2002), and the furfuryl adduct (Jarosz 2006), with the latter being

bypassed preferentially to that of natural dG in the template (Figure 2.1).

N

O

NH

H

N NO

HN

dR

N

O

N

NH

NH

HdR

N

dG N2-furfuryl-dG

(a) (b)

Figure 2.1 Structural comparison of (a) natural deoxyguanosine and (b) N2-furfuryl-deoxyguanosine (N2-f-dG). DinB demonstrates a ~16 fold preference to incorporate dCTP opposite N2-f-dG (Jarosz 2006) and thus N2-f-dG is considered the cognate lesion of DinB.

The N2-furfuryl-dG lesion is thought to arise from nitrofurazone (Jarosz 2006), which

was used as an antibiotic in livestock until it was found to leave residue in edible tissues

and was suspected of causing tumors in laboratory animals (Smith 1998). However, by

analogy to the plant hormone kinetin (N6-furfuryl-dA), the furfuryl moiety could also

arise due to oxidation of ribose (Amasino 2005; Barciszewski 2007). Kinetin has also

been found in DNA extracted from human cells (Barciszewski 2007) and in human urine

61

(Barciszewski 2000). Incorporation of dCTP opposite N2-furfuryl-dG is efficient and

accurate for both DinB and its mammalian ortholog Pol κ (Jarosz 2006).

In addition to understanding the range of DNA damage that can be bypassed by

DinB, it is of interest to determine how specific amino acids contribute to the specialized

ability to bypass DNA damage. There are several important residues that have previously

been identified in DinB (Walsh 2011), including the ‘steric gate’ residue (F13), mutation

of which eliminates the enhanced ability of DinB to bypass its cognate lesion N2-furfuryl-

dG (Jarosz 2006). The steric gate residues found in many DNA polymerases (Astatke

1998; Bonnin 1999; Ogawa 2001; Yang 2002; DeLucia 2003; Shurtleff 2009; Sherrer

2011) including DinB (Jarosz 2006), prevents ribonucleotide incorporation (Patel 2000;

Brown 2011). Residue Y79, which is near the steric gate residue and highly conserved in

the DinB family, is thought to modulate the function of the steric gate residue (Jarosz

2009). Changing this residue has a profound effect on the ability of DinB to carry out the

extension step of TLS, in which the primer is extended sufficiently beyond the lesion so

that replicative DNA polymerases can resume replication (Jarosz 2009). This extension

step of TLS may be as significant in overall bypass as the addition of a nucleotide

opposite the lesion (Fujii 2004). The importance of positions other than the aromatic

residues F13 and Y79 has been probed; specifically, mutations at position D8 (D8A,

D8H), R49 (R49A, R49F), D103 (D103A, D103N), and E104 (E104A) confer a much

lower mutation frequency (ranging from ~850 to ~3600 fold) than wild-type DinB

(Wagner 1999). This is expected as D8, D103, and E104 are the highly conserved

residues that coordinate the critical divalent cations (Wagner 1999; Ling 2001). In

62

addition, R49 lies in a loop region that is predicted to be in close proximity to the

incoming nucleotide (Walsh 2011).

In order to systematically identify other residues that could contribute to

polymerase activity, we applied computational methods to predict the functionally

important residues in DinB. Theoretical Microscopic Anomalous Titration Curve Shapes

(THEMATICS) uses perturbations in theoretical titration curves of ionizable residues to

predict catalytic residues (Ondrechen 2001; Ko 2005; Wei 2007). Partial Order Optimum

Likelihood (POOL) (Tong 2009; Somarowthu 2011b) is a monotonicity-constrained

maximum likelihood machine learning methodology that incorporates the electrostatic

features of THEMATICS as well as other input data, such as surface geometric properties

and phylogenetic information, to rank all of the amino acid residues of DinB according to

their probability of functional importance. Since there is no known experimentally

determined crystal structure available for DinB, these methods were performed with a

DinB model, which is based on homology to Dpo4 (Fiala 2007). POOL with

THEMATICS and INTREPID (Sankararaman 2009) input features has been verified as a

successful predictor of catalytic and binding residues (Tong 2009; Somarowthu 2011b)

using the CSA-100 (Bartlett 2002; Porter 2004; Sankararaman 2009), a benchmark

dataset of 100 non-homologous enzymes with experimental annotations of functionally

important residues. Intriguingly, in addition to residues that immediately surround the

substrate, other residues that are more distant from the substrate are often predicted to be

important for activity. Such distal residues, although they do not come into direct contact

with the substrate, may influence specificity or efficiency, possibly by their contact with

those amino acid residues that do contact the substrate. These predictions of participation

63

in catalysis by distal residues has been verified experimentally for nitrile hydratase (NH)

(Brodkin 2011), phosphoglucose isomerase (PGI) and ketosteroid isomerase (KSI)

(Somarowthu 2011a), We typically define residues in contact with the substrate as first

shell, those in contact with the first shell as second shell and those in contact with the

second shell as third shell. Certain second-shell residues have been shown to have a

profound impact on PGI function, while distal residues contribute little to the activity of

KSI (Somarowthu 2011a), as predicted. Therefore, changing residues that are distally

located from the active site can impact different enzymes differently. While the residues

predicted by THEMATICS/POOL tend to be highly conserved residues, the use of these

electrostatics-based methods for the prediction of active residues has distinctive

advantages over simple selection of conserved residues. The chief advantage is selectivity

(Wei 2007). Residues may be conserved for a variety of reasons and thus not all

conserved residues are directly involved in catalysis. The specificity scores achieved by

THEMATICS (Wei 2007) and POOL (Tong 2009; Somarowthu 2011b) are substantially

higher that those obtained from simple sequence conservation-based methods. Indeed, as

was demonstrated in earlier studies of NH (Brodkin 2011) and of KSI and PGI

(Somarowthu 2011a), most of the residues predicted by THEMATICS prove to be

important for catalysis, whereas negative control residues, i.e. conserved nearby residues

that are not predicted by THEMATICS, are shown not to play a significant role in

catalytic efficiency.

To our knowledge, systematic characterization of the contributions of remote

residues to Y-family DNA polymerase activity has not yet been carried out, although

remote residues in DNA pol η are associated with the cancer prone disorder Xeroderma

64

Pigmentosum-Variant (XPV) (Broughton 2002; Tanioka 2007; Biertumpfel 2010).

Moreover, a systematic and thorough analysis of the roles of residues remote from the

active site in DNA polymerase β has identified residues that are important for nucleotide

selection and template alignment (Yamtich 2010). As one example, a triad of residues

Arg333 Glu316 Arg182 in the fingers domain of pol β may disrupt packing of side chains

in the hinge region and therefore alter the conformational change required for efficient

DNA replication (Murphy 2011). Distal mutations in two separate domains in Thermus

aquaticus DNA polymerase I can impact its ability to replicate DNA; S543N in the

thumb region can hinder template-dependent pausing during replication (Ignatov 1999)

and a number of mutations along the O helix (F667L, A661E, I665T) change the

mutation spectrum (Suzuki 2000). Because of the large size of the DNA substrate and

extensive contacts between DNA polymerases and DNA, it can be difficult to assign rigid

definitions of shells. For the purposes of this work, we defined the first shell residues as

the residues that are in contact with the incoming nucleotide substrate and the second

shell residues as those that are in contact with the first shell residues.

THEMATICS (Ondrechen 2001; Ko 2005; Wei 2007) and POOL (Tong 2009;

Somarowthu 2011b) were used to rank all amino acids of DinB in order of their

probability of functional importance. Typically, the top 8-10% of the rank-ordered

residues are used for functional residue prediction. Of the top 8% we chose to focus on

the top ten residues. Among the top ten POOL-predicted residues are seven that are in

direct contact with the substrate and three second- or third-shell residues (Table 2.1). The

identified residues are H6, D103, E104, D8, K150, K157, Y106, R49, D10, K146 in

POOL rank order (Table 2.1). As mutations at D8, R49, D103, and E104 have been

65

previously characterized (Wagner 1999), we constructed DinB variants that harbor the

single mutations H6L, K150A, K157A, K157I, Y106A, Y106F, D10E, D10N, and

K146A, and assessed the impact on catalytic efficiency of DinB with its cognate lesion

N2-furfuryl-dG. We find a range of contributions of these remote residues to activity,

from modest effects to nearly complete loss of activity. Moreover, we find that these

DinB variants have greatly diminished ability to carry out the extension step of

translesion synthesis.

66

Table 2.1 Top 8% of POOL predicted residues Residues in bold, italic type are involved in metal coordination. Shaded residues are the top ten of the POOL-predicted residues.

Rank No. Residue Shell Distance from

dNTP (Å)

Closest first

shell residue Domain

Consurf

Score

1 6 HIS second 7.6 E104 Palm -1.054

2 103 ASP first 2.4 Palm -1.053

3 104 GLU first 3.7 Palm -1.052

4 8 ASP first 3.2 Palm -1.053

5 150 LYS first 4.7 Palm -1.051

6 157 LYS first 2.5 Palm -1.051

7 106 TYR second 12.0 K150 Palm -0.407

8 49 ARG first 1.7 Finger -1.053

9 10 ASP first 4.7 Palm -1.053

10 146 LYS third 13.6 K150 Palm -1.006

11 9 MET first 3.3 Palm

12 98 GLU second 12.9 E104 Palm

13 158 PRO second 5.8 K157 Palm

14 79 TYR second 5.3 F13 Palm

15 54 ARG first 2.4 Finger

16 139 SER second 6.8 D8 Palm

17 66 CYS third 14.8 R54 Finger

18 57 MET second 5.8 R54 Finger

19 46 TYR second 7.1 R49 Finger

20 153 SER second 7.3 K157 Palm

21 330 ARG remote 14.3 Little finger

22 11 CYS first 2.6 Palm

23 101 SER first 4.3 Palm

67

2.2 Materials and Methods

2.2.1 Computational Methods

The DinB structure has not yet been determined, so a homology model was built

with DNA and incoming nucleotide bound using the structure of the Dpo4 polymerase

from Sulfolobus solfataricus with PDB ID 2imw (Fiala 2007) as the template using the

homology feature in the YASARA/WHATif suite of programs (Krieger 2002). The

model was refined with energy minimization using YAMBER3. The overall Quality Z-

score of the final model was calculated to be -1.033 by YASARA. There are no outlier

residues and 96.8% of residues are in the favored region of the Ramachandran plot

(Lovell 2003). Because the DNA in the 2imw structure is a blunt-end DNA molecule, the

DNA and the incoming nucleotide were modeled from 1jx4 (Ling 2001). The YASARA

molecular modeling software was used to add missing atoms to the ligands bound in the

final DinB model. The coordinates for the model are available on the Environmental &

Molecular Mutagenesis journal website: doi: 10.1016/j.jmb.2011.03.069.

Ligands are removed prior to the analysis using THEMATICS. The electrostatic

properties from THEMATICS (Ondrechen 2001), and the phylogenetic tree-based scores

from INTREPID (Sankararaman 2009). (http://phylogenomics.berkeley.edu/intrepid/)

were used as input features to POOL. POOL then generated an output file of all residues

in the model, rank-ordered according to their probability of functional importance.

Shell definitions were established as follows: The distance between the incoming

nucleotide and the predicted residues was calculated using YASARA. Any residue that is

within a distance of 5 Å of the incoming nucleotide was considered to belong to the first

shell, i.e. in direct contact with the incoming nucleotide. Any other residue that is within

5 Å of any of the first shell residues is considered to be in the second shell, and so on.

68

2.2.2 Experimental Methods

DinB was purified as described previously by Beuning, et al. (Beuning 2006) and

stored in single-use aliquots at −80 °C. The DNA template containing a single N2-

furfuryl-dG adduct was prepared as described (DeCorte 1996; Jarosz 2006). DNA

sequences used in primer extension assays are as follows: standing start primer, 31-mer 5ʹ

GCATATGATAGTACAGCTGCAGCCGGACGCC 3ʹ; MatchC primer, 32-mer,5ʹ

GCATATGATAGTACAGCTGCAGCCGGACGCCC 3ʹ; and template containing N2-

furfuryl-dG (N), 61-mer, 5ʹ GGTTACTCAGATCAGGCCTGCGAAGACCTNGGCGT

CCGGCTGCTGTACTATCATATGC 3ʹ. DNA primer (standing start or MatchC) and the

template containing N2-furfuryl-dG were combined to a final ratio of 1:1 (100 nM) and

annealed in annealing buffer [20 mM Hepes (pH 7.5) and 5 mM Mg(OAc)2] by heating

for 2 min at 95 °C, incubating at 50 °C for 60 min, and then cooling to 37 °C. The

reactions were carried out with 100 nM 32P-end-labeled primer/template in a reaction

buffer containing final concentrations of 30 mM Hepes (pH 7.5), 20 mM NaCl, 7.5 mM

MgSO4, 2 mM β-mercaptoethanol, 1% bovine serum albumin, and 4% glycerol (Beuning

2006). Experiments were carried out with dNTP concentrations ranging from 1 μM-5000

μM, unless otherwise noted, and DinB concentration varied based on the extent of

activity of each variant. An aliquot for the zero point was removed prior to addition of

dNTP, and reactions were initiated by the addition of dNTP (Beuning 2006). The final

reaction volumes were 30 μL. Time points were typically taken from 0.5 min to 30 min

and reactions were quenched with 85% formamide, 50 mM ethylenediaminetetraacetic

acid, 0.025% xylene cyanol, and 0.025% bromophenol blue (Beuning 2006). To

determine kinetic parameters, conditions were chosen such that less than 25% of the

substrate was converted to product. Quenched reaction products were analyzed on

69

denaturing (8 M urea) 16% polyacrylamide gels, which were subsequently imaged on a

Molecular Dynamics storage phosphor imaging screen with a Storm 860 imager.

ImageQuant software (GE Healthcare) was used to analyze data. Kinetic parameters

Vmax and Km were determined by assessing the percentage of primer extended at various

time points in the experiment and were derived using GraphPad Prism® nonlinear

regression analysis software (Segel 1993). DNA binding experiments were conducted by

titrating 25 µM annealed DNA into a 60 µL solution of 1 µM DinB as previously

described (Walsh 2011).

2.3 Results

Table 2.1 shows the top 8% of the POOL predicted residues from the homology

model of DinB. Of these, 12 residues belong to the first shell, 11 to the second shell,

three to the third shell, and two are in more distant shells. Among the POOL predicted

residues, there are 20 in the Palm domain, six in the finger domain and two in the little

finger domain.

When used as a standalone method without POOL and other input features,

THEMATICS predicts two clusters of residues using a statistical cutoff of 0.99 (Wei

2007). The first cluster has eight residues H6, D8, E104, Y106, K150, K157, D103 and

R49 of which H6 and Y106 are second-shell residues. These residues represent the eight

top-ranked residues also predicted by POOL. THEMATICS also predicts a second cluster

of two residues, R35 and D252, that is somewhat distant from the active site. These

residues are not ranked high in the POOL predictions, but may play a role in interaction

of the finger and little finger domains with DNA upon DNA binding and catalysis. In this

70

paper, we have investigated experimentally the top ten residues predicted by POOL, of

which three are residues outside the first shell.

Some of the highly POOL-ranked residues are the catalytic residues D8, D103,

and E104, and R49, which have previously been shown to be important for activity, and

other resides that are near the incoming nucleotide (Wagner 1999). Therefore, POOL

correctly predicts the importance of active site residues. These methods also identified a

number of distal resides, those not directly involved in binding the substrate, that are

likely to contribute to activity. In this work, we focused on the ten most highly ranked

POOL-predicted residues (Table 2.1). The predicted residues studied here form a

crescent-shaped cluster around, and including, the metal-coordinating residues D8, D103,

and E104 (Figure 2.2).

71

Figure 2.2 Homology model of E. coli polymerase IV DinB. Highlighted residues include the identified distal residues (shown in magenta stick models) and their position in relation to known important residues (shown in space filling models), including the main active site residues D8 (orange), D103 and E104 (green) (Wagner 1999); the steric gate and its modulator, F13 (Jarosz 2006) and Y79 (Jarosz 2009), respectively (black); and the important residue R49 (light blue) (Wagner 1999). Images were rendered using the UCSF Chimera package (Pettersen 2004).

All of these residues are ionizable and may have either a steric or an electronic impact on

the ability of DinB to catalyze dCTP addition across from N2-furfuryl-dG, its cognate

lesion. For every variant constructed, primer extension activity with a mixture of

nucleotides as well as fidelity of incorporation were determined. Each variant that was

active incorporated only dCTP opposite template N2-furfuryl-dG (Figure 2.3). For those

variants that were inactive, we also determined their ability to bind DNA. We find that

72

mutations at these amino acid positions have a variety of impacts on DinB function, as

described in detail below.

Figure 2.3 Schematic of single nucleotide incorporation of each of the four deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP) with a P indicating primer only, which are reactions in which no deoxynucleotide triphosphates were added. No misincorporation of dATP, dGTP, or dTTP opposite N2-f-dG was observed, while dCTP addition opposite N2-f-dG was observed for the variants that were active. The concentration of polymerase is noted above each set of reactions.

2.3.1 H6L

Histidine-6 is the highest POOL-ranked residue. Histidine-6 is a second shell

residue and lies in the middle of the crescent near Y106 and K157 and is in close

proximity to E104. Leucine was chosen as a reasonably close steric mimic of histidine.

Compared to wild-type DinB, the H6L variant showed a small but statistically significant

decrease (8.8-fold) in catalytic efficiency of dCTP incorporation opposite N2-furfuryl-dG,

with a 5-fold decrease in kcat and a 1.7-fold increase in KM. The H6L variant also showed

73

weak extension of the MatchC primer/N2-furfuryl-dG-containing template DNA, but did

not extend to the end of the template, in contrast to wild-type DinB (Figure 2.4).

Figure 2.4 Schematic of primer extension assays with primer/template DNA containing N2-f-dG correctly base paired with C. Wild type DinB extended to the end of the template; only H6L and Y106F showed appreciable extension, but they did not complete extension to the end of the template. The other variants could not extend to the end of the template. DinB was present at 25 nM.

2.3.2 D10E, D10N

Aspartic Acid-10 is a first-shell residue that is 9th in the POOL rankings and is

located near the catalytic metal ions, their coordinating residues D8, D103 and E104, and

the important aromatic residues F13 (Jarosz 2009) that are known to have a role in DinB

specificity. Specifically, D10 is near the steric gate residue F13, which is important for

TLS (Jarosz 2006), and Y79, which modulates the activity of F13 and plays a role in TLS

extension (Jarosz 2009). We constructed the mutation D10E to preserve the negative

charge and D10N to preserve the length of the original amino acid. We did not observe

any measurable activity with the D10E variant, although it could still bind DNA (Table

2.2), but the D10N variant was weakly active at insertion of dCTP opposite N2-furfuryl-

74

dG. D10N showed a ~25 fold decrease in activity of insertion and was not able to fully

extend to the end of the template, even when N2-furfuryl-dG was correctly paired with

the MatchC primer (Figure 2.4). The position of this residue is likely the main reason that

such large effects were observed.

Table 2.2 Kinetic Parameters for dCTP incorporation opposite N2-f-dG by DinB and Binding Affinity of DinB to DNA

DinB

Construct

Km

(µM)

kcat

(min-1)

Vmax

(µM min-1)

kcat/Km

(min-1 µM-1)

Fold

Decrease

KD, DNA

(µM)

Fold

Increase

Wild Type 49 +/- 22 24 0.24 +/- 0.070 0.49 1 0.33 +/- 0.07 1

His6Leu 81 +/- 21 4.5 0.045 +/- 0.030 0.056 8.8

Lys150Ala 27 +/- 5.9 0.92 0.023 +/- 0.0040 0.034 15

Lys157Ala ND ND 0.49 +/- 0.10 1.5

Lys157Ile 130 +/- 34 1.1 0.027 +/- 0.010 0.0083 59

Tyr106Ala 78 +/- 35 1.3 0.026 +/- 0.0030 0.017 29

Tyr106Phe 150 +/- 44 12 0.12 +/- 0.062 0.085 5.8

Asp10Glu ND ND 0.51 +/- 0.13 1.5

Asp10Asn 46 +/- 4.7 0.90 0.022 +/- .0050 0.020 25

Lys146Ala 30 +/- 7.2 2.1 0.053 +/- 0.009 0.07 7.1

ND, not detected

2.3.3 Y106A, Y106F

Tyrosine-106 is a second-shell residue that is near H6, K146, and K150, as well

as the first-shell catalytic residue E104. Tyrosine has the ability to be involved in

hydrogen bonding as well as pi stacking, so we first modified this position to alanine in

order to eliminate both of those properties. The effects of this Y106A modification on

overall catalytic efficiency were large, resulting in a decrease in kcat/Km of 29 fold.

75

Interestingly, this overall decrease in catalytic efficiency resulted from only a 1.6-fold

increase in Km, but an 18-fold decrease in kcat.

Modifying this position to phenylalanine (Y106F), which retains the aromatic pi

system, gives catalytic efficiency closer to that of wild-type DinB, with a small but

statistically significant 5.8-fold decrease. This mutation resulted in a ~3-fold increase in

the value of Km and a 2-fold decrease in kcat. This suggests that the pi system at this

position contributes to catalytic efficiency of DinB and that the hydroxyl group is also

important for activity.

2.3.4 K146A

Among the residues tested, lysine-146 is the furthest from either the DNA

substrate or the known catalytic residues that ranked in the top ten POOL-predicted

residues. Because it is behind second-shell residue Y106 with respect to the substrate, it

is defined as a third-shell residue. Even though it is considered a third-shell residue and

therefore only two other residues are between it and the substrate, K146 lies in a solvent

exposed area on alpha helix F. DinB K146A gave a 1.6-fold reduction in KM and an 11.4-

fold decrease in kcat. However, we could not detect extension of the primer to the end of

the template when DinB K146A was presented with a mixture of all four dNTPs, which

may suggest an inability to extend from the new primer terminus. To test this possibility,

K146A was also assayed for activity with a DNA substrate in which the N2-furfuryl

adduct was correctly paired with a C on the primer (MatchC). DinB K146A was not able

to extend the primer when the terminus involved a base pair containing the template N2-

dG (Figure 2.4). Such extension could only be detected at very high concentrations (1.5

μM) of DinB K146A.

76

2.3.5 K150A, K157A, K157I

Based on our homology model, Lysine-150, and Lysine-157 are both very near

the active site residues D8, D103, and E104, as well as the DNA and incoming nucleotide

substrates. According to POOL, these two residues are ranked 5th and 6th, respectively.

Changing either of these residues to alanine had significant effects on activity. DinB

K150A was active, but with a 15-fold decrease in catalytic efficiency relative to that of

wild-type DinB. Based on the homology model we hypothesize that this residue with its

positively charged side chain may stabilize the backbone phosphate of the nucleotide at

the end of the primer.

Lysine157 is closer than K150 to the catalytic residues and may be involved in

binding to the phosphate of the incoming nucleotide. The variant K157A was not

catalytically active; however, DinB K157A was found to bind DNA with similar affinity

to that of wild-type DinB (Table 2.2), suggesting that the overall conformation of DinB is

not greatly perturbed by this mutation. Introducing an isoleucine at this position restored

weak activity for incorporation of dCTP opposite N2-furfuryl-dG, suggesting that the

chain length is a factor in the importance of this residue. Among the variants that

exhibited detectable activity, K157I gave the largest change observed, with a ~59 fold

reduction in catalytic efficiency. None of these K157 mutations were able to exhibit any

further extension on DNA substrates from a MatchC primer (Figure 2.4).

2.4 Discussion

We used the THEMATICS and POOL programs, which predict functionally

important residues, to uncover and probe residues that contribute to activity in DinB. In

this work, we focused on the residues ranked in the top ten of the predicted residues.

77

These functional site predictors have been used to correctly predict important residues

outside of the first shell in several different enzymes (Brodkin 2011; Somarowthu

2011a). In each of the previous cases, the substrates were small molecules. In this work,

we tested two aspects of the prediction: (1) the performance with an enzyme such as

DinB that makes extensive contacts with its large DNA substrate and (2) the performance

of the prediction based on a homology model. The top ten POOL-predicted residues are

all in or near the catalytic site and include known metal-coordinating residues (D8, D103,

and E104) as well as R49, which is known to be critical for function (Wagner 1999). The

predicted residues include other residues near the substrate, which are likely to interact

directly with the incoming nucleotide, as well as second- and third-shell residues that are

found to contribute to activity. Notably in this case, the largest effects observed upon

mutation of the predicted residues were the catalytically inactive first-shell variants

K157A and D10E; whereas the largest effect of a variant that could accomplish catalysis

was the first-shell variant K157I, followed by a second-shell variant Y106A.

The K146 residue is a third-shell residue that is located near the well-conserved

“FLAKIA” motif in Y family DNA polymerases that includes the highly-conserved

residue K150 (Figure 2.5).

78

A

B

Figure 2.5 (A) ConSurf model (Glaser 2003) showing which amino acid residues are conserved in the DinB family. The degrees of conservation are color coded as blue being the least conserved to deep magenta being the most conserved. (B) The top ten POOL-predicted residues in DinB that are highly conserved, except for Y106, are highlighted. The substrates have been removed for clarity. Images were rendered using the UCSF Chimera package (Pettersen 2004).

DinB K146 appears to be involved in interactions with E98 and N235, the latter of which

is part of the peptide linker that tethers the little finger domain to the polymerase domain

in Y family DNA polymerases. Therefore, K146 could play a role in positioning the little

finger domain. K146, as well as other variants assayed here, also appear to play an

important role in the extension step of TLS, which can be as important in bypass as

insertion opposite the lesion (Jarosz 2009), because primer extension to the full length of

79

the template demonstrated by the K146 variant was very poor. The specific effect of a

third-shell residue on extension is unexpected.

Distal residues can have a variety of effects on the structure (Chalissery 2007;

Chaptal 2007), substrate binding affinity (Heitman 2006; Carpten 2007; Chalissery 2007;

Mirza 2007), stability (Hong 2007) and function (El Omari 2006; Dupre 2007; Klyuyeva

2008) of a wide variety of different enzymes (Lee 2011). The semantics of defining the

‘shell’ to which a specific amino acid residue belongs can be challenging, in particular in

enzymes with large substrates, such as DNA polymerases. In DNA polymerases, the

enzyme can make contacts with a larger proportion of the DNA substrate than an enzyme

with a small molecule substrate. Aminoacyl-tRNA synthetases (aaRSs) are examples of

enzymes that have very large nucleic acid substrates and whose activity is affected by

mutations of distant residues (Lue 2007). The aaRSs must bind to and activate their

cognate amino acids and tRNAs, and then transfer the activated aminoacyl adenylate to

the tRNA (Arnez 1997; Lee 2011). There is a need for communication between distinct

domains in aaRSs for efficient and accurate aminoacylation (Alexander 2001).

Interestingly, the mutation L570F in E. coli Leucyl-tRNA synthetase has a significant

impact on the function of this enzyme, resulting in a ~30-fold decrease in activity from

that of the wild type (Lue 2007). Crystal structure studies of Thermus thermophilus

LeuRS show that the equivalent residue does not influence the interaction between the

protein and the amino acid substrate (Cusack 2000). Rather, it is hypothesized that this

residue comes into close proximity to highly conserved M576 which is located in a

functionally important loop area in the protein that is responsible for the modulation of

80

the active site conformation that is essential for substrate recognition (Weimer 2009).

Thus, the remote residue L570 contributes substantially to activity via its ability to

mediate a conformational change. A more closely related protein to DinB is mammalian

DNA pol η, a Y family DNA polymerase encoded by the XPV gene (Johnson 1999;

Masutani 1999). Defective DNA pol η can cause the autosomal recessive disease XPV,

which is characterized by UV-light-induced deterioration of a variety of tissues, as well

as malignant skin carcinomas and melanomas (Kraemer 1985). Some of the pol η

variants that are associated with XPV involve mutations that are distal to the polymerase

active site triad including D13, D115 and E116 (Biertumpfel 2010), and are located

relative to the catalytic triad in similar positions to the highly ranked DinB residues

examined here. In particular, DNA pol η K220 is aligned with DinB K146.

Through the use of predictive computations we have demonstrated that residues

that are removed from the active site in a DNA damage bypass polymerase have an

impact on the catalytic efficiency of that enzyme. The ability of the TLS polymerase

DinB to add dCTP opposite its cognate N2-furfuryl-dG lesion is altered when point

mutations are introduced distal to the active site residues. In particular, we observed

reductions in catalytic efficiency from 6-60 fold as well as instances of complete loss of

activity. Using only computational methods to guide us, we identified residues that are

important for TLS activity. These residues are postulated to impact the active site

residues through steric, pi systems, or electrostatic interactions that are either lost or

reduced in the mutations made. Identifying these distal residues and characterizing their

contributions to activity may lead to a better understanding of the enzymes as well as to

81

controlled manipulation of enzyme activity and specificity (Somarowthu 2011a;

Somarowthu 2011b).

82

2.5 References Albertella, M. R., C. M. Green, A. R. Lehmann and M. J. O'Connor (2005). "A role for

polymerase eta in the cellular tolerance to cisplatin-induced damage." Cancer Research 65(21): 9799-9806.

Alexander, R. W. and P. Schimmel (2001). "Domain-domain communication in aminoacyl-tRNA synthetases." Progress in Nucleic Acids Research & Molecular Biology 69: 317-349.

Amasino, R. (2005). "1955: kinetin arrives: the 50th anniversary of a new plant hormone." Plant Physiology 138(3): 1177-1184.

Arnez, J. G. and D. Moras (1997). "Structural and functional considerations of the aminoacylation reaction." Trends in Biochemical Sciences 22(6): 211-216.

Astatke, M., K. Ng, N. D. Grindley and C. M. Joyce (1998). "A single side chain prevents Escherichia coli DNA polymerase I (Klenow fragment) from incorporating ribonucleotides." Proceedings of the National Acadamy of Sciences of the United States of America 95(7): 3402-3407.

Barciszewski, J., F. Massino and B. F. Clark (2007). "Kinetin--a multiactive molecule." International Journal of Biological Macromolecules 40(3): 182-192.

Barciszewski, J., M. Mielcarek, M. Stobiecki, G. Siboska and B. F. Clark (2000). "Identification of 6-furfuryladenine (kinetin) in human urine." Biochemical & Biophysical Research Communications 279(1): 69-73.

Bartlett, G. J., C. T. Porter, N. Borkakoti and J. M. Thornton (2002). "Analysis of catalytic residues in enzyme active sites." Journal of Molecular Biology 324(1): 105-121.

Bassett, E., N. M. King, M. F. Bryant, S. Hector, L. Pendyala, S. G. Chaney and M. Cordeiro-Stone (2004). "The role of DNA polymerase eta in translesion synthesis past platinum-DNA adducts in human fibroblasts." Cancer Research 64(18): 6469-6475.

Berdis, A. J. (2009). "Mechanisms of DNA polymerases." Chemical Reviews 109(7): 2862-2879.

Beuning, P. J., S. M. Simon, V. G. Godoy, D. F. Jarosz and G. C. Walker (2006). "Characterization of Escherichia coli translesion synthesis polymerases and their accessory factors." Methods Enzymol 408: 318-340.

Biertumpfel, C., Y. Zhao, Y. Kondo, S. Ramon-Maiques, M. Gregory, J. Y. Lee, C. Masutani, A. R. Lehmann, F. Hanaoka and W. Yang (2010). "Structure and mechanism of human DNA polymerase eta." Nature 465(7301): 1044-1048.

Bonnin, A., J. M. Lazaro, L. Blanco and M. Salas (1999). "A single tyrosine prevents insertion of ribonucleotides in the eukaryotic-type phi29 DNA polymerase." Journal of Molecular Biology 290(1): 241-251.

Bresson, A. and R. P. Fuchs (2002). "Lesion bypass in yeast cells: Pol eta participates in a multi-DNA polymerase process." EMBO Journal 21(14): 3881-3887.

Brodkin, H. R., W. R. Novak, A. C. Milne, J. A. D'Aquino, N. M. Karabacak, I. G. Goldberg, J. N. Agar, M. S. Payne, G. A. Petsko, M. J. Ondrechen and D. Ringe (2011). "Evidence of the participation of remote residues in the catalytic activity

83

of co-type nitrile hydratase from Pseudomonas putida." Biochemistry 50(22): 4923-4935.

Broughton, B. C., A. Cordonnier, W. J. Kleijer, N. G. Jaspers, H. Fawcett, A. Raams, V. H. Garritsen, A. Stary, M. F. Avril, F. Boudsocq, C. Masutani, F. Hanaoka, R. P. Fuchs, A. Sarasin and A. R. Lehmann (2002). "Molecular analysis of mutations in DNA polymerase eta in xeroderma pigmentosum-variant patients." Proceedings of the National Acadamy of Sciences of the United States of America 99(2): 815-820.

Brown, J. A. and Z. Suo (2011). "Unlocking the sugar "steric gate" of DNA polymerases." Biochemistry 50(7): 1135-1142.

Carpten, J. D., A. L. Faber, C. Horn, G. P. Donoho, S. L. Briggs, C. M. Robbins, G. Hostetter, S. Boguslawski, T. Y. Moses, S. Savage, M. Uhlik, A. Lin, J. Du, Y. W. Qian, D. J. Zeckner, G. Tucker-Kellogg, J. Touchman, K. Patel, S. Mousses, M. Bittner, R. Schevitz, M. H. Lai, K. L. Blanchard and J. E. Thomas (2007). "A transforming mutation in the pleckstrin homology domain of AKT1 in cancer." Nature 448(7152): 439-444.

Chalissery, J., S. Banerjee, I. Bandey and R. Sen (2007). "Transcription termination defective mutants of Rho: role of different functions of Rho in releasing RNA from the elongation complex." Journal of Molecular Biology 371(4): 855-872.

Chaptal, V., F. Vincent, V. Gueguen-Chaignon, V. Monedero, S. Poncet, J. Deutscher, S. Nessler and S. Morera (2007). "Structural analysis of the bacterial HPr kinase/phosphorylase V267F mutant gives insights into the allosteric regulation mechanism of this bifunctional enzyme." Journal of Biological Chemistry 282(48): 34952-34957.

Chen, Y. W., J. E. Cleaver, F. Hanaoka, C. F. Chang and K. M. Chou (2006). "A novel role of DNA polymerase eta in modulating cellular sensitivity to chemotherapeutic agents." Molecular Cancer Research 4(4): 257-265.

Cirz, R. T., J. K. Chin, D. R. Andes, V. de Crecy-Lagard, W. A. Craig and F. E. Romesberg (2005). "Inhibition of mutation and combating the evolution of antibiotic resistance." PLoS Biol 3(6): e176.

Cirz, R. T., B. M. O'Neill, J. A. Hammond, S. R. Head and F. E. Romesberg (2006). "Defining the Pseudomonas aeruginosa SOS response and its role in the global response to the antibiotic ciprofloxacin." J Bacteriol 188(20): 7101-7110.

Cirz, R. T. and F. E. Romesberg (2007). "Controlling mutation: intervening in evolution as a therapeutic strategy." Critical Review of Biochemistry & Molecular Biology 42(5): 341-354.

Cordonnier, A. M. and R. P. Fuchs (1999). "Replication of damaged DNA: molecular defect in xeroderma pigmentosum variant cells." Mutation Research 435(2): 111-119.

Cusack, S., A. Yaremchuk and M. Tukalo (2000). "The 2A crystal structure of leucyl-tRNA synthetase and its complex with a leucyl-adenylate analogue." EMBO Journal 19(10): 2351-2361.

DeCorte, B. L., D. Tsarouhtsis, S. Kuchimanchi, M. D. Cooper, P. Horton, C. M. Harris and T. M. Harris (1996). "Improved strategies for postoligomerization synthesis of oligodeoxynucleotides bearing structurally defined adducts at the N2 position of deoxyguanosine." Chemical Research Toxicology 9(3): 630-637.

84

DeLucia, A. M., N. D. Grindley and C. M. Joyce (2003). "An error-prone family Y DNA polymerase (DinB homolog from Sulfolobus solfataricus) uses a 'steric gate' residue for discrimination against ribonucleotides." Nucleic Acids Research 31(14): 4129-4137.

Dupre, M. L., J. M. Broyles and S. J. Mihic (2007). "Effects of a mutation in the TM2-TM3 linker region of the glycine receptor alpha1 subunit on gating and allosteric modulation." Brain Research 1152: 1-9.

El Omari, K., S. Liekens, L. E. Bird, J. Balzarini and D. K. Stammers (2006). "Mutations distal to the substrate site can affect varicella zoster virus thymidine kinase activity: implications for drug design." Molecular Pharmacology 69(6): 1891-1896.

Fiala, K. A., C. D. Hypes and Z. Suo (2007). "Mechanism of abasic lesion bypass catalyzed by a Y-family DNA polymerase." Journal of Biological Chemistry 282(11): 8188-8198.


Friedberg, E. C. (2005). "Suffering in silence: the tolerance of DNA damage." Nature Review of Molecular and Cell Biology 6(12): 943-953.

Friedberg, E. C., R. Wagner and M. Radman (2002). "Specialized DNA polymerases, cellular survival, and the genesis of mutations." Science 296(5573): 1627-1630.


Glaser, F., T. Pupko, I. Paz, R. E. Bell, D. Bechor-Shental, E. Martz and N. Ben-Tal (2003). "ConSurf: identification of functional regions in proteins by surface-mapping of phylogenetic information." Bioinformatics 19(1): 163-164.

Goodman, M. F. (2002). "Error-prone repair DNA polymerases in prokaryotes and eukaryotes." Annual Review in Biochemistry 71: 17-50.

Heitman, L. H., T. Mulder-Krieger, R. F. Spanjersberg, J. K. von Frijtag Drabbe Kunzel, A. Dalpiaz and I. J. AP (2006). "Allosteric modulation, thermodynamics and binding to wild-type and mutant (T277A) adenosine A1 receptors of LUF5831, a novel nonadenosine-like agonist." British Journal of Pharmacology 147(5): 533-541.

Ho, T. V., A. Guainazzi, S. B. Derkunt, M. Enoiu and O. D. Scharer (2011). "Structure-dependent bypass of DNA interstrand crosslinks by translesion synthesis polymerases." Nucleic Acids Research 39(17): 7455-7464.

Hong, B. S., G. Senisterra, W. M. Rabeh, M. Vedadi, R. Leonardi, Y. M. Zhang, C. O. Rock, S. Jackowski and H. W. Park (2007). "Crystal structures of human pantothenate kinases. Insights into allosteric regulation and mutations linked to a neurodegeneration disorder." Journal of Biological Chemistry 282(38): 27984-27993.

Ignatov, K. B., A. A. Bashirova, A. I. Miroshnikov and V. M. Kramarov (1999). "Mutation S543N in the thumb subdomain of the Taq DNA polymerase large fragment suppresses pausing associated with the template structure." FEBS Letters 448(1): 145-148.

Inui, H., K. S. Oh, C. Nadem, T. Ueda, S. G. Khan, A. Metin, E. Gozukara, S. Emmert, H. Slor, D. B. Busch, C. C. Baker, J. J. DiGiovanna, D. Tamura, C. S. Seitz, A.

85

Gratchev, W. H. Wu, K. Y. Chung, H. J. Chung, E. Azizi, R. Woodgate, T. D. Schneider and K. H. Kraemer (2008). "Xeroderma pigmentosum-variant patients from America, Europe, and Asia." Journal of Investigative Dermatology 128(8): 2055-2068.

Itoh, T., S. Linn, R. Kamide, H. Tokushige, N. Katori, Y. Hosaka and M. Yamaizumi (2000). "Xeroderma pigmentosum variant heterozygotes show reduced levels of recovery of replicative DNA synthesis in the presence of caffeine after ultraviolet irradiation." Journal of Investigative Dermatolology 115(6): 981-985.



Johnson, R. E., C. M. Kondratick, S. Prakash and L. Prakash (1999). "hRAD30 mutations in the variant form of xeroderma pigmentosum." Science 285(5425): 263-265.

Klyuyeva, A., A. Tuganova and K. M. Popov (2008). "Allosteric coupling in pyruvate dehydrogenase kinase 2." Biochemistry 47(32): 8358-8366.

Ko, J., L. F. Murga, P. Andre, H. Yang, M. J. Ondrechen, R. J. Williams, A. Agunwamba and D. E. Budil (2005). "Statistical criteria for the identification of protein active sites using Theoretical Microscopic Titration Curves." Proteins 59(2): 183-195.

Kraemer, K. H. and H. Slor (1985). "Xeroderma pigmentosum." Clinical Dermatology 3(1): 33-69.

Krieger, E., G. Koraimann and G. Vriend (2002). "Increasing the precision of comparative models with YASARA NOVA--a self-parameterizing force field." Proteins 47(3): 393-402.

Lange, S. S., K. Takata and R. D. Wood (2011). "DNA polymerases and cancer." Nature Reviews Cancer 11(2): 96-110.

Lee, J. and N. M. Goodey (2011). "Catalytic contributions from remote regions of enzyme structure." Chemical Reviews 111(12): 7595-7624.


Loeb, L. A. and R. J. Monnat, Jr. (2008). "DNA polymerases and human disease." Nature Reviews Genetics 9(8): 594-604.

Lovell, S. C., I. W. Davis, W. B. Arendall, 3rd, P. I. de Bakker, J. M. Word, M. G. Prisant, J. S. Richardson and D. C. Richardson (2003). "Structure validation by Calpha geometry: phi,psi and Cbeta deviation." Proteins 50(3): 437-450.

Lue, S. W. and S. O. Kelley (2007). "A single residue in leucyl-tRNA synthetase affecting amino acid specificity and tRNA aminoacylation." Biochemistry 46(15): 4466-4472.

Masutani, C., R. Kusumoto, A. Yamada, N. Dohmae, M. Yokoi, M. Yuasa, M. Araki, S. Iwai, K. Takio and F. Hanaoka (1999). "The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase eta." Nature 399(6737): 700-704.

86

Miller, C., L. E. Thomsen, C. Gaggero, R. Mosseri, H. Ingmer and S. N. Cohen (2004). "SOS response induction by beta-lactams and bacterial defense against antibiotic lethality." Science 305(5690): 1629-1631.

Mirza, M., P. Robinson, E. Kremneva, O. Copeland, O. Nikolaeva, H. Watkins, D. Levitsky, C. Redwood, M. El-Mezgueldi and S. Marston (2007). "The effect of mutations in alpha-tropomyosin (E40K and E54K) that cause familial dilated cardiomyopathy on the regulatory mechanism of cardiac muscle thin filaments." Journal of Biological Chemistry 282(18): 13487-13497.

Murphy, D. L., J. Jaeger and J. B. Sweasy (2011). "A triad interaction in the fingers subdomain of DNA polymerase beta controls polymerase activity." Journal of the American Chemical Society 133(16): 6279-6287.

Napolitano, R., R. Janel-Bintz, J. Wagner and R. P. Fuchs (2000). "All three SOS-inducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced mutagenesis." EMBO Journal 19(22): 6259-6265.

Ogawa, M., A. Tosaka, Y. Ito, S. Yoshida and M. Suzuki (2001). "Enhanced ribonucleotide incorporation by an O-helix mutant of Thermus aquaticus DNA polymerase I." Mutat Res 485(3): 197-207.

Ondrechen, M. J., J. G. Clifton and D. Ringe (2001). "THEMATICS: a simple computational predictor of enzyme function from structure." Proceedings of the National Acadamy of Sciences of the United States of America 98(22): 12473-12478.

Pages, V. and R. P. Fuchs (2002). "How DNA lesions are turned into mutations within cells?" Oncogene 21(58): 8957-8966.

Patel, P. H. and L. A. Loeb (2000). "Multiple amino acid substitutions allow DNA polymerases to synthesize RNA." Journal of Biological Chemistry 275(51): 40266-40272.

Pettersen, E. F., T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C. Meng and T. E. Ferrin (2004). "UCSF Chimera--a visualization system for exploratory research and analysis." Journal of Computational Chemistry 25(13): 1605-1612.

Porter, C. T., G. J. Bartlett and J. M. Thornton (2004). "The Catalytic Site Atlas: a resource of catalytic sites and residues identified in enzymes using structural data." Nucleic Acids Research 32(Database issue): D129-133.

Prakash, S., R. E. Johnson and L. Prakash (2005). "Eukaryotic translesion synthesis DNA polymerases: specificity of structure and function." Annual Review of Biochemistry 74: 317-353.

Sankararaman, S., B. Kolaczkowski and K. Sjölander (2009). "INTREPID: a web server for prediction of functionally important residues by evolutionary analysis." Nucleic Acids Research 37(suppl 2): W390-W395.

Segel, I. H. (1993). Enzyme Kinetics: Behavior and analysis of rapid equilibrium and steady-state enzyme systems. New York, NY, Wiley-Interscience.


Sherrer, S. M., K. A. Fiala, J. D. Fowler, S. A. Newmister, J. M. Pryor and Z. Suo (2011). "Quantitative analysis of the efficiency and mutagenic spectra of abasic lesion

87

bypass catalyzed by human Y-family DNA polymerases." Nucleic Acids Research 39(2): 609-622.

Shurtleff, B. W., J. N. Ollivierre, M. Tehrani, G. C. Walker and P. J. Beuning (2009). "Steric gate variants of UmuC confer UV hypersensitivity on Escherichia coli." J Bacteriol 191(15): 4815-4823.

Smith, D. J., G. D. Paulson and G. L. Larsen (1998). "Distribution of radiocarbon after intramammary, intrauterine, or ocular treatment of lactating cows with carbon-14 nitrofurazone." Journal of Dairy Science 81(4): 979-988.

Somarowthu, S., H. R. Brodkin, J. A. D'Aquino, D. Ringe, M. J. Ondrechen and P. J. Beuning (2011a). "A tale of two isomerases: compact versus extended active sites in ketosteroid isomerase and phosphoglucose isomerase." Biochemistry 50(43): 9283-9295.

Somarowthu, S., H. Yang, D. G. Hildebrand and M. J. Ondrechen (2011b). "High-performance prediction of functional residues in proteins with machine learning and computed input features." Biopolymers 95(6): 390-400.

Suzuki, M., S. Yoshida, E. T. Adman, A. Blank and L. A. Loeb (2000). "Thermus aquaticus DNA polymerase I mutants with altered fidelity. Interacting mutations in the O-helix." Journal of Biological Chemistry 275(42): 32728-32735.

Tanioka, M., T. Masaki, R. Ono, T. Nagano, E. Otoshi-Honda, Y. Matsumura, M. Takigawa, H. Inui, Y. Miyachi, S. Moriwaki and C. Nishigori (2007). "Molecular analysis of DNA polymerase eta gene in Japanese patients diagnosed as xeroderma pigmentosum variant type." Journal of Investigative Dermatology 127(7): 1745-1751.

Tong, W., Y. Wei, L. F. Murga, M. J. Ondrechen and R. J. Williams (2009). "Partial order optimum likelihood (POOL): maximum likelihood prediction of protein active site residues using 3D Structure and sequence properties." PLoS Computational Biology 5(1): e1000266.



Walsh, J. M., L. A. Hawver and P. J. Beuning (2011). "Escherichia coli Y family DNA polymerases." Frontiers in Bioscience 16: 3164-3182.

Wei, Y., J. Ko, L. Murga and M. J. Ondrechen (2007). "Selective prediction of interaction sites in protein structures with THEMATICS." BMC Bioinformatics 8(1): 119.

Weimer, K. M., B. L. Shane, M. Brunetto, S. Bhattacharyya and S. Hati (2009). "Evolutionary basis for the coupled-domain motions in Thermus thermophilus leucyl-tRNA synthetase." Journal of Biological Chemistry 284(15): 10088-10099.

Yamtich, J. and J. B. Sweasy (2010). "DNA polymerase family X: function, structure, and cellular roles." Biochimica et Biophysica Acta 1804(5): 1136-1150.

Yang, G., M. Franklin, J. Li, T. C. Lin and W. Konigsberg (2002). "A conserved Tyr residue is required for sugar selectivity in a Pol alpha DNA polymerase." Biochemistry 41(32): 10256-10261.

88


89

This chapter is reproduced with permission from the following "Discrimination against the Cytosine Analog tC by Escherichia coli DNA Polymerase IV DinB" Jason M. Walsh, Imenne Bouamaied, Tom Brown, L. Marcus Wilhelmsson, and Penny J. Beuning Journal of Molecular Biology 409 89-100 (2011) dx.doi.org/10.1016/j.jmb.2011.03.069 Penny J. Beuning and Jason M. Walsh designed the study. Imenne Bouamaid, Tom Brown, and L. Marcus Wilhelmsson synthesized the tC nucleotide triphosphate and DNA constructs. L. Marcus Wilhelmsson modeled the tC DNA into the DinB homology model. Jason M. Walsh collected and analyzed the experimental data and prepared the manuscript, tables and figures.

90

ELSEVIER LICENSE TERMS AND CONDITIONS Nov 06, 2012

This is a License Agreement between Jason M Walsh ("You") and Elsevier ("Elsevier") provided by Copyright Clearance Center ("CCC"). The license consists of your order details, the terms and conditions provided by Elsevier, and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see information listed at the bottom of this form.

Supplier Elsevier Limited The Boulevard,Langford Lane Kidlington,Oxford,OX5 1GB,UK

Registered Company Number 1982084

Customer name Jason M Walsh

Customer address 23 Beech St

Framingham, MA 01702

License number 3023210295538

License date Nov 06, 2012

Licensed content publisher Elsevier

Licensed content publication Journal of Molecular Biology

Licensed content title Discrimination against the Cytosine Analog tC byEscherichia coliDNA Polymerase IV DinB

Licensed content author Jason M. Walsh,Imenne Bouamaied,Tom Brown,L. Marcus Wilhelmsson,Penny J. Beuning

Licensed content date 3 June 2011

Licensed content volume number

409

Licensed content issue number 2

Number of pages 12

Start Page 89

End Page 100

Type of Use reuse in a thesis/dissertation

Portion full article

Format both print and electronic

Are you the author of this Elsevier article?

Yes

Will you be translating? No

Order reference number None

Title of your thesis/dissertation Function of Damage Inducible DNA Polymerase IV from Escherichia coli

Expected completion date Dec 2012

Estimated size (number of pages)

150

Elsevier VAT number GB 494 6272 12

Permissions price 0.00 USD

VAT/Local Sales Tax 0.0 USD / 0.0 GBP

91

Total 0.00 USD

Terms and Conditions

INTRODUCTION 1. The publisher for this copyrighted material is Elsevier. By clicking "accept" in connection with completing this licensing transaction, you agree that the following terms and conditions apply to this transaction (along with the Billing and Payment terms and conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you opened your Rightslink account and that are available at any time athttp://myaccount.copyright.com). GENERAL TERMS 2. Elsevier hereby grants you permission to reproduce the aforementioned material subject to the terms and conditions indicated. 3. Acknowledgement: If any part of the material to be used (for example, figures) has appeared in our publication with credit or acknowledgement to another source, permission must also be sought from that source. If such permission is not obtained then that material may not be included in your publication/copies. Suitable acknowledgement to the source must be made, either as a footnote or in a reference list at the end of your publication, as follows: “Reprinted from Publication title, Vol /edition number, Author(s), Title of article / title of chapter, Pages No., Copyright (Year), with permission from Elsevier [OR APPLICABLE SOCIETY COPYRIGHT OWNER].” Also Lancet special credit - “Reprinted from The Lancet, Vol. number, Author(s), Title of article, Pages No., Copyright (Year), with permission from Elsevier.” 4. Reproduction of this material is confined to the purpose and/or media for which permission is hereby given. 5. Altering/Modifying Material: Not Permitted. However figures and illustrations may be altered/adapted minimally to serve your work. Any other abbreviations, additions, deletions and/or any other alterations shall be made only with prior written authorization of Elsevier Ltd. (Please contact Elsevier at [email protected]) 6. If the permission fee for the requested use of our material is waived in this instance, please be advised that your future requests for Elsevier materials may attract a fee. 7. Reservation of Rights: Publisher reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions. 8. License Contingent Upon Payment: While you may exercise the rights licensed immediately upon issuance of the license at the end of the licensing process for the transaction, provided that you have disclosed complete and accurate details of your proposed use, no license is finally effective unless and until full payment is received from you (either by publisher or by CCC) as provided in CCC's Billing and Payment terms and conditions. If full payment is not received on a timely basis, then any license preliminarily granted shall be deemed automatically revoked and shall be void as if never granted. Further, in the event that you breach any of these terms and conditions or any of CCC's Billing and Payment terms and conditions, the license is automatically revoked and shall be void as if never granted. Use of materials as described in a revoked license, as well as any use of the materials beyond the scope of an unrevoked license, may constitute copyright infringement and publisher reserves the right to take any and all action to protect its copyright in the materials. 9. Warranties: Publisher makes no representations or warranties with respect to the licensed material. 10. Indemnity: You hereby indemnify and agree to hold harmless publisher and CCC, and their respective officers, directors, employees and agents, from and against any and all claims arising out of your use of the licensed material other than as specifically authorized pursuant to this license. 11. No Transfer of License: This license is personal to you and may not be sublicensed, assigned, or transferred by you to any other person without publisher's written permission. 12. No Amendment Except in Writing: This license may not be amended except in a writing signed by both parties (or, in the case of publisher, by CCC on publisher's behalf). 13. Objection to Contrary Terms: Publisher hereby objects to any terms contained in any purchase order, acknowledgment, check endorsement or other writing prepared by you, which terms are inconsistent with these terms and conditions or CCC's Billing and Payment terms and conditions. These terms and conditions, together with CCC's Billing and Payment terms and conditions (which are incorporated herein), comprise the entire agreement between you and publisher (and CCC) concerning this licensing transaction. In the event of any conflict between your obligations established by these terms and conditions and those established by CCC's Billing and Payment terms and conditions, these terms and conditions shall control. 14. Revocation: Elsevier or Copyright Clearance Center may deny the permissions described in this License at their sole discretion, for any reason or no reason, with a full refund payable to you. Notice of such denial will be made using the contact information provided by you. Failure to receive such notice will not alter or invalidate the denial. In no event will Elsevier or Copyright Clearance Center be responsible or liable for any costs, expenses or damage incurred by you as a result of a denial of your permission request, other than a refund of the amount(s) paid by you to Elsevier and/or Copyright Clearance Center for denied permissions. LIMITED LICENSE The following terms and conditions apply only to specific license types: 15. Translation: This permission is granted for non-exclusive world English rights only unless your license was granted for translation rights. If you licensed translation rights you may only translate this content into the languages you requested. A professional translator must perform all translations and reproduce the content word for word preserving the integrity of the article. If this license is to re-use 1 or 2 figures then permission is granted for non-exclusive world rights in all languages. 16. Website: The following terms and conditions apply to electronic reserve and author websites: Electronic reserve: If licensed material is to be posted to website, the web site is to be password-protected and made available only to bona fide students registered on a relevant course if: This license was made in connection with a course, This permission is granted for 1 year only. You may obtain a license for future website posting, All content posted to the web site must maintain the copyright information line on the bottom of each image, A hyper-text must be included to the Homepage of the journal from which you are licensing athttp://www.sciencedirect.com/science/journal/xxxxx or the Elsevier homepage for books athttp://www.elsevier.com , and

92

Central Storage: This license does not include permission for a scanned version of the material to be stored in a central repository such as that provided by Heron/XanEdu. 17. Author website for journals with the following additional clauses: All content posted to the web site must maintain the copyright information line on the bottom of each image, and the permission granted is limited to the personal version of your paper. You are not allowed to download and post the published electronic version of your article (whether PDF or HTML, proof or final version), nor may you scan the printed edition to create an electronic version. A hyper-text must be included to the Homepage of the journal from which you are licensing athttp://www.sciencedirect.com/science/journal/xxxxx . As part of our normal production process, you will receive an e-mail notice when your article appears on Elsevier’s online service ScienceDirect (www.sciencedirect.com). That e-mail will include the article’s Digital Object Identifier (DOI). This number provides the electronic link to the published article and should be included in the posting of your personal version. We ask that you wait until you receive this e-mail and have the DOI to do any posting. Central Storage: This license does not include permission for a scanned version of the material to be stored in a central repository such as that provided by Heron/XanEdu. 18. Author website for books with the following additional clauses: Authors are permitted to place a brief summary of their work online only. A hyper-text must be included to the Elsevier homepage at http://www.elsevier.com . All content posted to the web site must maintain the copyright information line on the bottom of each image. You are not allowed to download and post the published electronic version of your chapter, nor may you scan the printed edition to create an electronic version. Central Storage: This license does not include permission for a scanned version of the material to be stored in a central repository such as that provided by Heron/XanEdu. 19. Website (regular and for author): A hyper-text must be included to the Homepage of the journal from which you are licensing at http://www.sciencedirect.com/science/journal/xxxxx. or for books to the Elsevier homepage at http://www.elsevier.com 20. Thesis/Dissertation: If your license is for use in a thesis/dissertation your thesis may be submitted to your institution in either print or electronic form. Should your thesis be published commercially, please reapply for permission. These requirements include permission for the Library and Archives of Canada to supply single copies, on demand, of the complete thesis and include permission for UMI to supply single copies, on demand, of the complete thesis. Should your thesis be published commercially, please reapply for permission. 21. Other Conditions: v1.6

If you would like to pay for this license now, please remit this license along with your payment made payable to "COPYRIGHT CLEARANCE CENTER" otherwise you will be invoiced within 48 hours of the license date. Payment should be in the form of a check or money order referencing your account number and this invoice number RLNK500892011. Once you receive your invoice for this order, you may pay your invoice by credit card. Please follow instructions provided at that time. Make Payment To: Copyright Clearance Center Dept 001 P.O. Box 843006 Boston, MA 02284-3006 For suggestions or comments regarding this order, contact RightsLink Customer Support:[email protected] or +1-877-622-5543 (toll free in the US) or +1-978-646-2777.

Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license for your reference. No payment is required.

93

Chapter 3: Discrimination against the Cytosine Analog tC by Escherichia coli DNA Polymerase IV DinB

3.1 Introduction

Replication of DNA and the faithful transmission of genetic information are of

utmost importance to the survival of all organisms. DNA replication is a multistep

process that utilizes several mechanisms for discrimination against the incorporation of

incorrect bases, which increases the fidelity of the replication process (Kornberg 1992).

Under normal circumstances this process is highly accurate, as DNA polymerization by

replicative polymerases occurs with very high fidelity, making errors once in

approximately 107 nucleotides incorporated in E. coli (Kornberg 1992). When the

contributions of proofreading and mismatch repair mechanisms are included, the overall

accuracy increases to approximately 1 error in 1010 nucleotides (Kornberg 1992).

In addition to highly accurate replicative DNA polymerases, cells possess

multiple DNA polymerases to fulfill other functions. One such polymerase family is the

Y family, the members of which are specialized to copy damaged DNA, but they copy

undamaged DNA with lower fidelity than replicative DNA polymerases (Sutton 2001;

Friedberg 2006; Jarosz 2007; McCulloch 2008). Y family polymerases are conserved

throughout all domains of life (Ohmori 2001; Yang 2005; Friedberg 2006). Although

generally structurally similar to their replicative counterparts, there are several important

differences between Y family and replicative polymerases. The overall folds of both

replicative and Y family DNA polymerases resemble a right hand, including the thumb,

palm, and finger domains (Ling 2001; Yang 2003; Yang 2005). Y family polymerases are

characterized by small finger and thumb domains which result in an open and solvent-

94

exposed active site in the palm domain (Yang 2005). Specific to the Y family is a domain

known as the ‘little finger’ which is thought to have an important function in both

substrate selection and DNA binding (Ling 2001; Boudsocq 2004; Yang 2005). One

major difference between replicative and Y family DNA polymerases in the active site is

that the O-helix, which is present in replicative polymerases, is absent in the Y family

members (Ling 2001). The O-helix is important for ensuring the fidelity of nucleotide

incorporation into the primer DNA strand (Steitz 1987; Beese 1993; Steitz 1999). Y

family polymerases are generally not as accurate as their replicative counterparts (Tang

2000; Yang 2003; Prakash 2005; Friedberg 2006; Jarosz 2007; Yang 2007; Washington

2010), but their function in induced mutagenesis may play an important role in evolution

(Friedberg 2006).

The Y family polymerases are able to accommodate DNA lesions in their active

sites and replicate damaged DNA in a process known as translesion synthesis (TLS)

(Friedberg 2006), which may be accurate or error-prone. Escherichia coli DinB is a Y

family DNA polymerase (Wagner 1999) that is known to bypass certain DNA adducts

such as the dG adducts of benzo[a]pyrene (N2-B[a]P-dG) (Napolitano 2000; Seo 2006)

and methylglyoxal, which forms N2-(1-carboxyethyl)-2′-deoxyguanine (N2-CEdG) (Yuan

2008). DinB possesses a 15-fold preference to bypass N2-furfuryl-dG compared to

undamaged DNA (Jarosz 2006). Additionally, DinB accurately bypasses certain dG-dG

and dG-peptide cross-links by inserting dC opposite the adduct-G in the template DNA

and copies dG-dT intrastrand crosslinks accurately but stalls after incorporation of dA

opposite the 3′-T in the crosslink (Bellon 2006; Kumari 2008; Minko 2008). On the other

hand, DinB cannot bypass thymine-thymine cyclobutane pyridimidine dimers or

95

thymine-thymine (6-4) photoproducts, the principal DNA lesions resulting from exposure

to UV light (Tang 2000). The C8-dG adducts of 2-acetylaminofluorene and 2-

aminofluorene also block the primer extension activity of DinB (Ogawa 2001). The error

frequency of DinB in copying undamaged DNA is between 10-3 and 10-5, depending on

the identity of the base pair (Kobayashi 2002), but in general DinB has the ability to copy

DNA containing a range of N2-dG adducts accurately by incorporating dC opposite the

adduct-dG. These observations have led to the hypothesis that DinB is specific for minor

groove adducts of dG.

We probed the specificity of DinB by determining its efficiency in utilizing the

modified base 1,3-diaza-2-oxophenothiazine (tC), which is size-expanded in the major

groove, as a template base or incoming nucleotide. The modified base tC is a fluorescent

analog of C that forms a canonical Watson-Crick base pair with G, has increased base

stacking interactions compared to C, and has been used to probe mechanisms of

replication (Figure 3.1) (Marquez 1996; Wilhelmsson 2001; Engman 2004; Sandin 2005;

Stengel 2007; Reha-Krantz 2009; Sandin 2009; Sinkeldam 2010; Wilhelmsson 2010).

The tC nucleotide was originally developed as an analog of C with stronger binding to

complementary G bases within RNA (Lin 1995), and was further derivatized with a

guanidinium group, to form the so-called G-clamp that provides strong binding affinity

toward G (Lin 1998; Wilds 2002; Wilds 2003).

96

N

N

N

H

dR

N

N

dR

N

H

O H

NH N

H O

N

N

N

H

dR

N

N

dR

NO H

NH N

H O

S

(a) (b)

G C G tC

Figure 3.1 Hydrogen bonding between (a) canonical guanine and cytosine and (b) guanine and the cytosine analog tC (Stengel 2007).

We find that DinB, like Klenow fragment of DNA pol I, can add the tC

triphosphate across from template dG (Stengel 2007; Sandin 2009). We demonstrate that

DinB inserts dGTP faithfully across from tC, but cannot extend from the newly-generated

primer terminus. Moreover, we demonstrate that even with a nine-nucleotide running

start DinB cannot complete TLS to the end of the template containing tC. This lack of

activity is despite our finding that DinB binds DNA primer:template constructs that

contain tC more strongly than it binds unmodified DNA primer:templates. In contrast,

both Klenow fragment and human DNA polymerase α can insert dGTP opposite template

tC and extend past the noncanonical base pair to the end of the template (Stengel 2007;

Sandin 2009; Stengel 2009). This is an intriguing difference, as replicative polymerases

are generally considered to be accurate and specific for canonical base pairs (Beese

1993), whereas Y family polymerases have more open and solvent-accessible active sites

in order to accommodate bulky lesions in DNA (Yang 2003; Yang 2005; Friedberg

2006).

97


3.2.1 Proteins and Nucleic Acids

DinB was prepared as described in Beuning et al. (Beuning 2006). The

concentrations obtained in DinB purifications are generally in the micromolar range and,

therefore, concentrating the protein is not necessary if it is to be used in primer extension

assays. DinB was stored in single-use aliquots at -80 °C. DNA containing tC was

prepared using solid phase synthesis and the tC phosphoramidite was synthesized as

described elsewhere (Sandin 2007). The nucleotide triphosphate was prepared as

described in Sandin et al. (Sandin 2009). Unmodified DNA (Eurofins MWG Operon)

was purified by denaturing polyacrylamide gel electrophoresis. DNA sequences are

shown in Table 3.1. End-labeling with 32P was carried out as described (Maniatis 1982;

Beuning 2006).

3.2.2 Primer Extension Assays

Primer extension assays were performed on a 61-mer DNA template, where the

only variable is the position labeled X, which corresponds to G, C or tC (Table 3.1).

Standing start primer (31-mer), in which the first nucleotide incorporated is opposite the

analog, was generally used for determining the fidelity and kinetics of incorporation of a

single nucleotide. The DNA primer and template were combined to a final ratio of 1:1

(500 nM) and were annealed in annealing buffer (20 mM HEPES, pH 7.5, 5 mM

Mg(OAc)2) by heating for 2 min at 95 °C, incubating at 50 °C for 50 min, and then

cooling to 37 °C. The reactions were carried out with 100 nM 32P-labeled

primer/template in a reaction buffer containing final concentrations of 30 mM HEPES,

pH 7.5, 20 mM NaCl, 7.5 mM MgSO4, 2 mM β-mercaptoethanol, 1% BSA and 4%

glycerol. Experiments were carried out with 500 μM dNTPs unless otherwise noted and

98

10 nM DinB, except for the addition of dGTP from tC-containing template which was

done at 25 nM DinB due to the low activity of DinB in processing this analog. An aliquot

for the zero point was removed prior to addition of dNTP and reactions were initiated by

the addition of dNTP (Beuning 2006). Final reaction volumes were 30 μL. Time points

were typically taken from 0.5 min to 30 or 60 min and were quenched with 85%

formamide, 50 mM EDTA, 0.025% xylene cyanol, 0.025% bromophenol blue (Beuning

2006). In experiments to determine kinetic parameters, conditions were chosen such that

less than 25% of the substrate was converted to product. Products from the quenched

reactions were analyzed on denaturing (8 M urea) 12-16% polyacrylamide gels, which

were subsequently imaged on a Molecular Dynamics storage phosphor imaging screen

with a Storm 860 imager. Data were analyzed using ImageQuant software (GE

Healthcare) (Beuning 2006). This allows for the analysis of kinetic data and

determination of Vmax and KM by assessing the percentage of primer extended at various

time points in the experiment. Kinetic parameters were derived from GraphPad Prism®

non-linear regression analysis software (Segel 1993).

99

Table 3.1 Sequences of DNA primers and templates DNA Length Sequence

Primer 22 22 mer 5′GCATATGATAGTACAGCTGCAG3′

Standing Start 31 mer 5′GCATATGATAGTACAGCTGCAGCCGGACGCC3′

MatchG 32 mer 5′GCATATGATAGTACAGCTGCAGCCGGACGCCG3′

Extn+1 Primer 33 mer 5′GCATATGATAGTACAGCTGCAGCCGGACGCCGA3′

Extn+2 Primer 34 mer 5′GCATATGATAGTACAGCTGCAGCCGGACGCCGAG3′

Extn+3 Primer 35 mer 5′GCATATGATAGTACAGCTGCAGCCGGACGCCGAGG3′

Extn+4 Primer 36 mer 5′GCATATGATAGTACAGCTGCAGCCGGACGCCGAGGT3′

Template DNA

(X = G,C, or tC)

61 mer 5′GGTTACTCAGATCAGGCCTGCGAAGACCTXGGCGTCC

GGCTGCAGCTGTACTATCATATGC3′

3.2.3 DNA Binding Assays

Equilibrium dissociation binding constants for DNA binding to DinB were

determined by using tryptophan fluorescence quenching. A 1-μM DinB solution was

titrated with annealed 15 μM DNA primer:template mixture and the fluorescence

intensity was measured after each addition with a Varian Cary Eclipse Fluorescence

Spectrophotometer using λex of 278 nm. Fluorescence emission was monitored from 290

nm to 500 nm (Favicchio 2009). The emission intensity maxima between 300-400 nm

were obtained, corrected for the dilution factor, and the quenching (Q) was calculated by

dividing the corrected intensity by the original fluorescence intensity of the 1-μM DinB

solution alone (Favicchio 2009). Q was plotted against the final concentration of DNA

and Kd was determined by fitting to the following equation:

B = (Lt + Kd + Rt) – [((-Lt – Kd – Rt)2 – 4LtRt)

1/2]/2

100

where B = fraction bound, Lt = DNA concentration, Kd = dissociation constant, and Rt =

total protein concentration (Motulsky 1995; Swillens 1995).

3.2.4 Model of DinB bound to DNA containing tC

A homology model of DinB bound to DNA containing N2-furfuryl-dG as the

template base was used (Jarosz 2006). Using HyperChem (Hypercube, Inc.), an energy

optimized tC base (Wilhelmsson 2003) was superimposed onto the thymine (residue T6,

3′ to the template base) that was replaced, i.e. the inner pyrimidine ring of the tC was

superpositioned with the pyrimidine ring system of T. The T was deleted and tC was

connected to the deoxyribose moiety. The adenine opposite tC (residue P13) was then

replaced with a G. Finally, the furfuryl moiety on the guanine in the template (residue

T5) was removed.

3.3 Results

3.3.1 DinB discriminates against tC as the template base

In light of the studies in which DNA containing tC is efficiently replicated by the

Klenow fragment and by human polymerase α (Stengel 2007; Stengel 2009), we wanted

to determine the extent to which DinB could replicate a DNA template containing the tC

analog. We expected that DinB, which is specialized to copy non-canonical DNA, would

be proficient at copying tC as well. A comparison was made between the abilities of

DinB and Klenow to replicate DNA containing tC. Klenow fragment can incorporate a

nucleotide opposite tC, extend from the new primer terminus (Stengel 2007), and

synthesize DNA to the end of the template, whereas DinB could not synthesize DNA past

the site of tC (Figure 3.2).

101

(a) (b)

timeKF

P

T (61 nt)

5′ * C

DinB

PP+1P+2

KFDinB

tC TG

5′ * CG

C(a)

(b)

Figure 3.2 Primer extension assay on DNA containing tC with (a) standing start primer and (b) running start primer, shown at the top of the Figure (* indicates 32P label), by 10 nM Klenow fragment (KF) or 10 nM DinB. Klenow fragment extended the primer to the end of the template, while DinB did not. DinB demonstrates limited ability to add a nucleotide opposite tC. Samples were analyzed by 12% polyacrylamide gel electrophoresis. Time points were 0, 1, 10, 45 min for each. “P” indicates the position of the primer and “T” indicates the position of the fully extended primer (the length of the template strand). Complete DNA sequences are given in Table 3.1.

However, DinB was able to add a nucleotide across from template tC, extending the

standing start primer by one nucleotide, albeit weakly (Figures 3.2 and 3.3). At the

longest time points, we observe modest extension past template tC by DinB (Figures 3.2

and 3.3). To probe the extent to which a change in binding affinity for the tC-containing

DNA template could be responsible for the lack of catalytic activity of DinB on such a

template, we determined the equilibrium dissociation binding constant, Kd, of DinB for

DNA constructs containing either tC or C as the template base annealed to the standing

start primer. We found that DinB has slightly greater affinity for the primer:template

DNA containing tC than the primer:template containing unmodified C (Table 3.2),

therefore the defect in catalytic activity of DinB with the substrate containing tC is not

due to a lack of binding to DNA.

102

Table 3.2 Dissociation constants for DinB binding to DNA constructs DNA Primer / Template Kd (μM) Fold Decrease

Standing Start / Template-C 0.38 ± 0.034 --

Standing Start / Template-tC 0.11 ± 0.051 3.5

MatchG / Template-C 0.21 ± 0.093 --

MatchG / Template-tC 0.053 ± 0.016 3.9

Extn+1 / Template-C 0.34 ± 0.099 --

Extn+1 / Template-tC 0.076 ± 0.022 4.5

We next assayed the ability of DinB to bypass tC with a large running start of

nine nucleotides before encountering tC in the template. A primer extension assay was

performed with a 22-mer primer to assess the ability of DinB to bypass the analog

(Figure 3.3). DinB extends the primer to the end of the unmodified DNA template but is

severely impeded when the template strand contains the tC analog (Figure 3.3). Similar to

that observed with the standing start primer (Figure 3.2), DinB incorporates nucleotides

up to and across from the tC analog, but cannot appreciably extend beyond tC (Figure

3.3).

103

31nt

Primer 22/tC-DNAPrimer 22/C-DNA

61nt

22nt

(a) (b)

C G

G C

C T

GC

GG

CX

TC

CA

GA

AG

C(N

15)A

TT

GG

time

X5′ *

Figure 3.3 DinB cannot extend past tC in the DNA template. DinB primer extension on template containing C (a) and template containing tC (b) with primer 22. The 31-nucleotide marker indicates the position adjacent to the tC analog; one nucleotide beyond that is addition opposite the analog. The 61-nt marker represents fully extended primer. Samples were analyzed by 14% polyacrylamide gel electrophoresis. Time points for each were 0, 0.5, 1, 2, 5, 10, 15, 20, 30, 45, 60 min.

3.3.2 DinB faithfully incorporates dGTP opposite tC

Our observation that DinB inserts a nucleotide opposite tC led us to wonder about

the accuracy of this insertion. Single nucleotide incorporation assays were performed to

assess the fidelity of insertion across from tC in the template (Figure 3.4a). DinB was not

able to insert dATP, dCTP or dTTP across from the tC analog but faithfully adds dGTP

across from tC (Figure 3.4a).

104

Pri

mer

dA

TP

dC

TP

dG

TP

dT

TP

P

P+1

Pri

mer

dA

TP

dC

TP

dG

TP

dT

TP

P

P+1

time

(c) Template C (d) Template tC

(a)

tC TG5′ * C

X TG5′ * C G(b)

P

Figure 3.4 (a) DinB faithfully incorporates only dGTP opposite tC in the DNA template. The DNA construct used is diagrammed at the top (* indicates 32P label). Reactions were carried out with 500 μM dNTP and 10 nM DinB with standing start primer. Samples were analyzed by 16% polyacrylamide gel electrophoresis. Time points were 0 (primer control reaction) and 60 min. “P” indicates the position of the primer. (b) DNA construct used in (c) and (d) is shown (* indicates 32P label); X = C or tC. (c and d) DinB extends from MatchG primer annealed to template DNA containing C (c) but not to template DNA containing tC (d). Assays were carried out with 1 mM dATP with time points of 0, 0.5, 1, 5, 10, 30 min. “P” indicates the position of the primer.

We determined the efficiency of incorporation of dGTP opposite tC compared to

incorporation of dGTP opposite unmodified C (Table 3.3) and found that DinB

incorporates dGTP opposite template tC with a modest increase in KM but a more

significant decrease in kcat (~11-fold). Overall, incorporation of dGTP is 12-fold less

efficient opposite template tC than opposite template C (Table 3.3). Given that we do not

detect misincorporation, we cannot determine an error frequency for DinB with the tC

modification. From the limit of detection of the assay, we estimate the error frequency to

be less than ~6 x 10-4.

105

Table 3.3 Steady state kinetic parameters for dGTP incorporation opposite tC vs C

KM (μM) kcat (min-1) Vmax (μM·min-1) kcat/KM (min-1 µM-1) Fold

Decrease

dGTP*C 150 ± 24 17 0.17 ± 0.026 0.11 --

dGTP*tC 160 ± 31 1.5 0.038 ± 0.031 9.4 x 10-3 12

We next determined whether DinB can extend from this newly-generated primer

terminus opposite the tC modification. We used a synthetic primer constructed such that

it contains a G (“MatchG,” Table 3.1) opposite tC in the template. Although DinB is

highly proficient for extension from G opposite unmodified C, there is no extension

apparent from the MatchG primer annealed to a tC-containing template (Figure 3.4b-d).

Given that no extension of the primer opposite tC can be observed, we estimate the

decrease in nucleotide insertion activity to be at least 1500-fold. We also determined the

binding affinity of DinB for DNA constructs consisting of MatchG annealed to either a

C-containing template or tC-containing template. DinB has a slightly higher affinity for

the tC-containing DNA in this context (Table 3.2), indicating that the lack of activity is

not due to a defect in binding.

3.3.3 DinB requires primers at least three nucleotides beyond tC for efficient extension

Since DinB could insert a nucleotide opposite the template tC analog but could

not extend the newly-synthesized primer terminus, we determined the length of primer

beyond the tC analog that is required to allow DinB to efficiently extend the primer. We

compared the ability of DinB to extend beyond the tC analog with its ability to extend

beyond unmodified C at the same position in the template (Figure 3.5).

106

Extn+1/C-DNA Extn+1/tC-DNA Extn+2/C-DNA Extn+2/tC-DNA Extn+3/C-DNA Extn+3/tC-DNA Extn+4/C-DNA Extn+4/tC-DNA

time

P

T

X TG

5′ * C GC C A

AG

+1

+2

+3

+4

5′ * C G A G

5′ * C G A G G T

5′ * C G A G G

Figure 3.5 DinB extension on both tC-containing DNA template and C-containing DNA template with primers of varying lengths beyond the site of the tC analog (+1, +2, +3, +4, respectively), as shown. Samples were analyzed by 12% polyacrylamide gel electrophoresis. Time points for each: 0, 1, 5, 10, 30, 60 min. “P” indicates the position of the primer and “T” indicates the position of the fully extended primer (the length of the template strand).

When the primer terminus is one (Extn+1) or two (Extn+2) nucleotides beyond tC,

primer extension by DinB is weak (Figure 3.5). DinB exhibits more robust activity with a

primer terminus that is three (Extn+3) nucleotides beyond tC but still exhibits slightly

weaker primer extension activity on the tC-containing DNA than on an unmodified DNA

template (Figure 3.5). With a primer terminus four (Extn+4) nucleotides beyond the site

of the tC analog, there is little difference in efficiency of synthesis on templates

containing either tC or C (Figure 3.5). These observations suggest that in order to observe

efficient extension of the primer its terminus must be 3-4 nucleotides beyond a modified

base that is a poor substrate for DinB. We also determined the relative affinity of DinB

for primer/template DNA with a primer (Extn+1) that terminates one nucleotide beyond

the site of the tC modification, or unmodified C, in the template. DinB has modestly

higher affinity for the tC-containing construct (Table 3.2), therefore the lack of DinB

107

activity on a template containing tC cannot be explained by a difference in binding to

DNA.

3.3.4 DinB adds dtCTP to a primer terminus

Since it was previously demonstrated that the Klenow fragment preferentially

incorporates the size-expanded tC analog into the growing DNA strand opposite G by

approximately a factor of 10 (Sandin 2009), we next examined whether DinB could add

the deoxytriphosphate version of the tC analog across from G in the template. Kinetic

parameters for insertion of dtCTP or dCTP across from template G were determined

(Figure 3.6a, Table 3.4). DinB exhibited a modest decrease in KM for dtCTP relative to

dCTP and approximately a two-fold higher kcat for dtCTP than for dCTP. Overall, DinB

is ~3.5-fold more efficient in incorporation of dtCTP than dCTP opposite template G.

Thus, DinB shows a slight preference to add the dtCTP analog to templates containing G

relative to the addition of the natural nucleotide dCTP.

time

(a) dtCTP (b) dtCTP+dATP (c) dATP

PP+1

P

G TG5′ * C

Figure 3.6 DinB incorporates the tC analog and replicates at least one additional nucleotide. DNA construct used is shown at the top. (a) Addition of dtCTP by DinB across from template G. (b) Addition of both dtCTP and dATP. (c) DinB does not add dATP alone. Reactions were carried out with standing start primer. Samples were analyzed by 16% polyacrylamide gel electrophoresis. Time points were 0, 1, 5, 10, 30, 45 min. “P” indicates the position of the primer.

108

Table 3.4 Steady state kinetic parameters for incorporation of dtCTP versus dCTP opposite template G

KM (μM) kcat (min-1) Vmax (μM·min-1) kcat/KM (min-1 µM-1) Fold

Decrease

dCTP*G 190 ± 15 4.4 0.044 ± 0.0017 2.3 x 10-2 --

dtCTP*G 130 ± 74 11 0.11 ± 0.036 8.1 x 10-2 0.28

We next determined if DinB could extend a primer beyond the newly-added

dtCTP. A mixture of dtCTP and dATP was added to a final concentration of 250 μM

each, as the next nucleotide after G in the DNA template is T (Table 3.1). DinB was able

to incorporate both tC and A (Figure 3.6b). No further nucleotide additions were

observed, as the next template base is C and dGTP was omitted from these reactions.

These observations suggest that DinB is accurate after incorporation of tC. This

experiment was also conducted with only dATP available to DinB as a nucleotide

substrate and in this case extension was not observed, indicating that the extension

observed with the mixture of dtCTP and dATP is due to accurate incorporation of dtCTP

and dATP (Figure 3.6c). In contrast, DinB only very weakly extends primers from one or

two nucleotides beyond the position of tC in the template (Figure 3.5), suggesting a

higher degree of stringency for modifications of the template than for modified incoming

nucleotides.

3.4 Discussion

We have demonstrated that E. coli DinB, a Y-family DNA polymerase, will not

tolerate the size-expanded base analog tC when it is present in the template strand. DinB

synthesizes DNA up to and across from tC, accurately incorporating G, but cannot

109

efficiently bypass tC. It has also been observed that tC can tautomerize to a form that

base pairs with A (Stengel 2009; Stengel 2010), but similar to human DNA primase and

RNA polymerase (Stengel 2010; Urban 2010), we did not observe misincorporation by

DinB. The tC analog is known to be bypassed by the A family polymerase Klenow

fragment, as well as by human DNA polymerase α primase (Stengel 2007; Stengel 2009).

Specifically, Klenow accurately inserts dGTP opposite template tC (Stengel 2007) and

can then extend the primer to the end of the template (Stengel 2009). Remarkably,

Klenow is also fairly proficient at bypassing 8-oxo-G and C8-aminofluorene-dG

(Shibutani 1993; Miller 1997). The overall fidelity of base pair formation on normal,

undamaged DNA by Klenow has been determined to be 10-4, which is within the range of

10-3-10-5 determined for DinB (Kuchta 1988; Kobayashi 2002).

On the other hand, DinB is slightly more efficient at inserting the

deoxytriphosphate version of the tC analog relative to unmodified C into the primer

strand (Table 3.4). DinB also extends from tC after it is incorporated (Figure 3.6), as was

observed for Klenow (Stengel 2007; Tahmassebi 2009). Human DNA primase

incorporates tCTP 2.5-fold better than CTP opposite template G and Klenow shows a

~10-fold preference for tCTP over CTP (Sandin 2009; Urban 2010). The increase in

efficiency of incorporation of tCTP is generally ascribed to its increased hydrophobicity

and increased stacking interactions compared to unmodified C (Sandin 2009; Urban

2010). These observations suggest that DinB exhibits stronger discrimination against

modifications of the template and may have more relaxed specificity for the incoming

nucleotide. Indeed, a similar trend has been observed with DinB and 8-oxo-G as DinB

appears to be less efficient in replicating DNA templates containing 8-oxo-G than it is in

110

incorporating the nucleotide 8-oxo-GTP (Yamada 2006; Hori 2010). Other polymerases

can also exhibit marked asymmetry between utilization of modified bases in the template

compared to the incoming nucleotide or in fidelity of base pair formation (Einolf 1998;

Urban 2009). This observation may reflect asymmetry in the polymerase active site

(Einolf 1998) suggesting that the local environment of the template base compared to that

of the incoming nucleotide is apparently quite different, which could lead to differences

in efficiency of bond formation or translocation.

It is unclear why DinB specifically discriminates against tC as the template base

or at the T-1 or T-2 positions in the template strand (Figure 3.5). Because tC is size-

expanded in the major groove, our observations suggest that DinB displays

discrimination against major groove adducts in the template strand. Whereas minor

groove scanning is a well-known fidelity mechanism used by high-fidelity replicative

DNA polymerases, it is not clear that major groove scanning could be generally used

(Lutz 1996). Additionally, bases that are derivatized in the major groove are substrates

for an array of A and B family DNA polymerases (Thum 2001; Kool 2002; Jager 2005).

In structures of Y family polymerases bound to DNA, both the minor and major grooves

are highly exposed to solvent at and near the template base (Broyde 2008; Pata 2010).

The published homology model of DinB is consistent with this observation, as the

incipient base pair and the adjacent two base pairs are predicted by the model to be nearly

completely exposed to solvent in the major groove (Figure 3.7) (Jarosz 2006). We

modeled a tC:G base pair just upstream from the nascent base pair in DNA bound to

DinB, in which there is clearly no steric clash between the protein and the tC modified

base (Figure 3.7). The Y family polymerase-specific little finger domain binds DNA in

111

the major groove, but few of these contacts are at the incipient base pair and so are

unlikely to impart specificity at that position (Ling 2001; Yang 2003). The lack of

sequence conservation of the little finger domain between different Y family polymerases

may influence DNA binding and therefore could impart specificity, perhaps at DNA

positions other than the template base (Ling 2001).

(a) (b)Template

base

Incoming nucleotide

(c) (d)

tC

Figure 3.7 Model of DinB bound to DNA (Jarosz 2006) with the protein (yellow) shown as bonds (a) and surface (b). (c) and (d) Model of DinB bound to DNA containing a tC:G base pair with tC shown as bonds (c) and surface (d). The view is towards the major groove of DNA at the incipient base pair. The incipient base pair (top) and the next two base pairs are shown colored by identity of the atom and the rest of the DNA is pink. Figure was prepared with VMD (Humphrey 1996).

Crystal structures have been determined of Y family DNA polymerase Dpo4 with

several different major groove adducts. In the structures of Dpo4 bound to DNA

containing N6-benzo[a]-pyrene-dA, one structure shows the benzo[a]pyrene moiety

stacked in the DNA resulting in a catalytically-incompetent conformation, while a second

structure places benzo[a]pyrene in the major groove in a solvent-exposed conformation

that disrupts the Watson-Crick base pairing at the template base (Ling 2004). Strikingly,

112

the overall conformation of Dpo4 in both structures is remarkably similar, showing only a

small shift in the little finger domain (Ling 2004). Structures have also been solved of

Dpo4 with DNA containing either O6-methylguanine (O6-MeG) or O6-benzylguanine

(O6-BzG) paired with C in which the base pair shifts to form a ‘wobble’ pair (Eoff 2007a;

Eoff 2007b). With either lesion, Dpo4 misincorporates T or A with fairly high frequency

and base pairs between thymine and either lesion were observed in the structures (Eoff

2007a; Eoff 2007b). Dpo4 could extend efficiently from the C:O6-MeG base pair, but less

so from the T:O6-MeG base pair; the trend was similar but with more inhibition in the

case of extension from C:O6-BzG and T:O6-BzG base pairs, suggesting the degree of

inhibition may correlate with the size of the adduct (Eoff 2007a; Eoff 2007b). In the

experiments reported here, DinB was accurate in the addition of G opposite template tC

and it seems that tC forms Watson-Crick base pairs with G. In addition, we could detect

no extension from the G:tC base pair in which tC is the template base. In terms of

substrate specificity, it is not entirely clear how appropriate Dpo4 is as a model for DinB

(Chandani 2010), as Dpo4 efficiently bypasses adducts that are not substrates for DinB,

for example, thymine-thymine cyclobutane pyridime dimers (Tang 2000; Boudsocq

2001).

The process of TLS requires both insertion of a nucleotide opposite a non-

canonical base and extension of the newly-formed primer terminus. In some cases,

insertion opposite a non-canonical, non-cognate base is relatively facile, while the

extension step may be less efficient, as observed here. Indeed, replicative polymerases

can sense distortions in the DNA caused by lesions 4-6 nucleotides from the incipient

base pair (Carver 1994; Miller 1997; Johnson 2003; Fujii 2004). It has been shown that

113

the TLS polymerase pol V must synthesize 5-6 nucleotides beyond a lesion before the

replicative polymerase DNA pol III can resume synthesis; a shorter “TLS patch” leads to

proofreading by the pol III exonuclease (Fujii 2004). We find here that the activity of

DinB is disrupted by the fluorescent analog tC up to 2-3 nucleotides after the 3′ end of

the primer (Figure 3.5). Other investigators have also observed that DinB exhibits

pausing within three nucleotides after certain DNA adducts (Kumari 2008; Minko 2008;

Jarosz 2009). A DinB variant with a specific defect in copying DNA containing its

cognate lesion N2-furfuryl-dG also stalled three nucleotides after bypassing the lesion

(Jarosz 2009). Our findings are in agreement with other work that suggests that DinB

requires a slightly shorter buffer of three nucleotides beyond a non-cognate nucleotide

than replicative polymerases in order to complete extension. Taken together, these

observations suggest that Y family polymerases exhibit less stringency in the extension

phase of TLS when confronted with non-cognate bases than replicative DNA

polymerases, indicating that Y family polymerases may be able to recover synthesis

within a shorter distance downstream from non-cognate DNA damage. However, the

exact mechanism of polymerase switching between replicative and TLS polymerases is

not fully understood.

In conclusion, Y family polymerases are known for their specialized ability to

accommodate and bypass lesion-containing DNA. They also exhibit lowered fidelity on

undamaged DNA and are therefore potentially mutagenic. We show that, unlike Klenow

and DNA primase (Stengel 2007; Stengel 2009), Y family DNA polymerase DinB is

unable to utilize templates containing the modified base tC, suggesting that DinB may

specifically discriminate against major groove adducts. Moreover, DinB is remarkably

114

asymmetric with respect to tC, efficiently incorporating tCTP in the primer strand, while

strongly discriminating against tC in the template. It remains to be determined the extent

to which this is a general property of DinB.

115

3.5 References

Beese, L. S., V. Derbyshire and T. A. Steitz (1993). "Structure of DNA polymerase I Klenow fragment bound to duplex DNA." Science 260(5106): 352-355.

Bellon, S., D. Gasparutto, C. Saint-Pierre and J. Cadet (2006). "Guanine-thymine intrastrand cross-linked lesion containing oligonucleotides: from chemical synthesis to in vitro enzymatic replication." Organic & Biomolecular Chemistry 4(20): 3831-3837.

Beuning, P. J., S. M. Simon, V. G. Godoy, D. F. Jarosz and G. C. Walker (2006). "Characterization of Escherichia coli translesion synthesis polymerases and their accessory factors." Methods Enzymology 408: 318-340.

Boudsocq, F., S. Iwai, F. Hanaoka and R. Woodgate (2001). "Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion-bypass properties akin to eukaryotic pol eta." Nucleic Acids Research 29(22): 4607-4616.

Boudsocq, F., R. J. Kokoska, B. S. Plosky, A. Vaisman, H. Ling, T. A. Kunkel, W. Yang and R. Woodgate (2004). "Investigating the role of the little finger domain of Y-family DNA polymerases in low fidelity synthesis and translesion replication." Journal of Biological Chemistry 279(31): 32932-32940.

Broyde, S., L. H. Wang, O. Rechkoblit, N. E. Geacintov and D. J. Patel (2008). "Lesion processing: high-fidelity versus lesion-bypass DNA polymerases." Trends Biochemical Sciences 33(5): 209-219.

Carver, T. E., R. A. Hochstrasser and D. P. Millar (1994). "Proofreading DNA - Recognition of Aberrant DNA Termini by the Klenow Fragment of DNA-Polymerase-I." Proceedings of the National Acadamy of Sciences of the United States of America 91(22): 10670-10674.

Chandani, S., C. Jacobs and E. L. Loechler (2010). "Architecture of y-family DNA polymerases relevant to translesion DNA synthesis as revealed in structural and molecular modeling studies." Journal of Nucleic Acids 2010.

Einolf, H. J., N. Schnetz-Boutaud and F. P. Guengerich (1998). "Steady-state and pre-steady-state kinetic analysis of 8-oxo-7, 8-dihydroguanosine triphosphate incorporation and extension by replicative and repair DNA polymerases." Biochemistry 37(38): 13300-13312.

Engman, K. C., P. Sandin, S. Osborne, T. Brown, M. Billeter, P. Lincoln, B. Norden, B. Albinsson and L. M. Wilhelmsson (2004). "DNA adopts normal B-form upon incorporation of highly fluorescent DNA base analogue tC: NMR structure and UV-Vis spectroscopy characterization." Nucleic Acids Research 32(17): 5087-5095.

Eoff, R. L., K. C. Angel, M. Egli and F. P. Guengerich (2007a). "Molecular basis of selectivity of nucleoside triphosphate incorporation opposite O-6-benzylguanine by Sulfolobus solfataricus DNA polymerase Dpo4 - Steady-state and pre-steady-state kinetics and X-ray crystallography of correct and incorrect pairing." Journal of Biological Chemistry 282(18): 13573-13584.

Eoff, R. L., A. Irimia, M. Egli and F. P. Guengerich (2007b). "Sulfolobus solfataricus DNA polymerase Dpo4 is partially inhibited by "wobble" pairing between O-6-

116

methylguanine and cytosine, but accurate bypass is preferred." Journal of Biological Chemistry 282(2): 1456-1467.

Favicchio, R., A. I. Dragan, G. G. Kneale and C. M. Read (2009). "Fluorescence spectroscopy and anisotropy in the analysis of DNA-protein interactions." Methods in Molecular Biology 543: 589-611.




Humphrey, W., A. Dalke and K. Schulten (1996). "VMD: Visual molecular dynamics." Journal of Molecular Graphics & Modeling 14(1): 33-38.

Jager, S., G. Rasched, H. Kornreich-Leshem, M. Engeser, O. Thum and M. Famulok (2005). "A versatile toolbox for variable DNA functionalization at high density." Journal of American Chemical Society 127(43): 15071-15082.



Jarosz, D. F., V. G. Godoy and G. C. Walker (2007). "Proficient and accurate bypass of persistent DNA lesions by DinB DNA polymerases." Cell Cycle 6(7): 817-822.

Johnson, S. J., J. S. Taylor and L. S. Beese (2003). "Processive DNA synthesis observed in a polymerase crystal suggests a mechanism for the prevention of frameshift mutations." Proceedings of the National Acadamy of Sciences of the United States of America 100(7): 3895-3900.

Kobayashi, S., M. R. Valentine, P. Pham, M. O'Donnell and M. F. Goodman (2002). "Fidelity of Escherichia coli DNA polymerase IV. Preferential generation of small deletion mutations by dNTP-stabilized misalignment." Journal of Biological Chemistry 277(37): 34198-34207.

Kool, E. T. (2002). "Replacing the nucleobases in DNA with designer molecules." Accounts of Chemical Research 35(11): 936-943.

Kornberg, A. and T. A. Baker, Eds. (1992). DNA Replication. New York, W.H. Freeman & Company.

Kuchta, R. D., P. Benkovic and S. J. Benkovic (1988). "Kinetic Mechanism Whereby DNA-Polymerase-I (Klenow) Replicates DNA with High Fidelity." Biochemistry 27(18): 6716-6725.


117

Lin, K. Y., R. J. Jones and M. Matteucci (1995). "Tricyclic 2'-Deoxycytidine Analogs - Syntheses and Incorporation into Oligodeoxynucleotides Which Have Enhanced Binding to Complementary RNA." Journal of the American Chemical Society 117(13): 3873-3874.

Lin, K. Y. and M. D. Matteucci (1998). "A cytosine analogue capable of clamp-like binding to a guanine in helical nucleic acids." Journal of the American Chemical Society 120(33): 8531-8532.


Ling, H., J. M. Sayer, B. S. Plosky, H. Yagi, F. Boudsocq, R. Woodgate, D. M. Jerina and W. Yang (2004). "Crystal structure of a benzo[a]pyrene diol epoxide adduct in a ternary complex with a DNA polymerase." Proceedings of the National Acadamy of Sciences of the United States of America 101(8): 2265-2269.

Lutz, M. J., H. A. Held, M. Hottiger, U. Hubscher and S. A. Benner (1996). "Differential discrimination of DNA polymerases for variants of the non-standard nucleobase pair between xanthosine and 2,4-diaminopyrimidine, two components of an expanded genetic alphabet." Nucleic Acids Research 24(7): 1308-1313.

Maniatis, T. (1982). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory.

Marquez, L. A. and L. J. Reha-Krantz (1996). "Using 2-aminopurine fluorescence and mutational analysis to demonstrate an active role of bacteriophage T4 DNA polymerase in strand separation required for 3' --> 5'-exonuclease activity." Journal of Biological Chemistry 271(46): 28903-28911.

McCulloch, S. D. and T. A. Kunkel (2008). "The fidelity of DNA synthesis by eukaryotic replicative and translesion synthesis polymerases." Cell Research 18(1): 148-161.

Miller, H. and A. P. Grollman (1997). "Kinetics of DNA polymerase I (Klenow fragment exo(-)) activity on damaged DNA templates: Effect of proximal and distal template damage on DNA synthesis." Biochemistry 36(49): 15336-15342.


Motulsky, H. M. D. (1995). Intuitive Biostatistics, Oxford University Press, USA. Napolitano, R., R. Janel-Bintz, J. Wagner and R. P. Fuchs (2000). "All three SOS-

inducible DNA polymerases (Pol II, Pol IV and Pol V) are involved in induced mutagenesis." EMBO Journal 19(22): 6259-6265.

Ogawa, M., A. Tosaka, Y. Ito, S. Yoshida and M. Suzuki (2001). "Enhanced ribonucleotide incorporation by an O-helix mutant of Thermus aquaticus DNA polymerase I." Mutation Research 485(3): 197-207.


118


Prakash, S., R. E. Johnson and L. Prakash (2005). "Eukaryotic translesion synthesis DNA polymerases: specificity of structure and function." Annual Review of Biochemistry 74: 317-353.

Reha-Krantz, L. J. (2009). "The use of 2-aminopurine fluorescence to study DNA polymerase function." Methods in Molecular Biology 521: 381-396.

Sandin, P., P. Lincoln, T. Brown and L. M. Wilhelmsson (2007). "Synthesis and oligonucleotide incorporation of fluorescent cytosine analogue tC: a promising nucleic acid probe." Nature Protocols 2(3): 615-623.

Sandin, P., G. Stengel, T. Ljungdahl, K. Borjesson, B. Macao and L. M. Wilhelmsson (2009). "Highly efficient incorporation of the fluorescent nucleotide analogs tC and tCO by Klenow fragment." Nucleic Acids Research 37(12): 3924-3933.

Sandin, P., L. M. Wilhelmsson, P. Lincoln, V. E. Powers, T. Brown and B. Albinsson (2005). "Fluorescent properties of DNA base analogue tC upon incorporation into DNA--negligible influence of neighbouring bases on fluorescence quantum yield." Nucleic Acids Research 33(16): 5019-5025.


Seo, K. Y., A. Nagalingam, S. Miri, J. Yin, S. Chandani, A. Kolbanovskiy, A. Shastry and E. L. Loechler (2006). "Mirror image stereoisomers of the major benzo[a]pyrene N2-dG adduct are bypassed by different lesion-bypass DNA polymerases in E. coli." DNA Repair (Amst) 5(4): 515-522.

Shibutani, S. and A. P. Grollman (1993). "On the Mechanism of Frameshift (Deletion) Mutagenesis In vitro." Journal of Biological Chemistry 268(16): 11703-11710.

Sinkeldam, R. W., N. J. Greco and Y. Tor (2010). "Fluorescent analogs of biomolecular building blocks: design, properties, and applications." Chemical Reviews 110(5): 2579-2619.

Steitz, T. A. (1999). "DNA polymerases: structural diversity and common mechanisms." Journal of Biological Chemistry 274(25): 17395-17398.

Steitz, T. A., L. Beese, P. S. Freemont, J. M. Friedman and M. R. Sanderson (1987). "Structural studies of Klenow fragment: an enzyme with two active sites." Cold Spring Harbors Symposium in Quantitative Biology 52: 465-471.

Stengel, G., J. P. Gill, P. Sandin, L. M. Wilhelmsson, B. Albinsson, B. Norden and D. Millar (2007). "Conformational dynamics of DNA polymerase probed with a novel fluorescent DNA base analogue." Biochemistry 46(43): 12289-12297.

Stengel, G., B. W. Purse, L. M. Wilhelmsson, M. Urban and R. D. Kuchta (2009). "Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment." Biochemistry 48(31): 7547-7555.

Stengel, G., M. Urban, B. W. Purse and R. D. Kuchta (2010). "Incorporation of the Fluorescent Ribonucleotide Analogue tCTP by T7 RNA Polymerase." Analytical Chemistry 82(3): 1082-1089.

Sutton, M. D. and G. C. Walker (2001). "umuDC-mediated cold sensitivity is a manifestation of functions of the UmuD2C complex involved in a DNA damage checkpoint control." Journal of Bacteriology 183(4): 1215-1224.

119

Swillens, S. (1995). "Interpretation of binding curves obtained with high receptor concentrations: practical aid for computer analysis." Molecular Pharmacology 47(6): 1197-1203.

Tahmassebi, D. C. and D. P. Millar (2009). "Fluorophore-quencher pair for monitoring protein motion." Biochemistry and Biophysics Research Communications 380(2): 277-280.

Tang, M., P. Pham, X. Shen, J. S. Taylor, M. O'Donnell, R. Woodgate and M. F. Goodman (2000). "Roles of E. coli DNA polymerases IV and V in lesion-targeted and untargeted SOS mutagenesis." Nature 404(6781): 1014-1018.

Thum, O., S. Jager and M. Famulok (2001). "Functionalized DNA: A new replicable biopolymer." Angewandte Chemie-International Edition 40(21): 3990-+.

Urban, M., N. Joubert, M. Hocek, R. E. Alexander and R. D. Kuchta (2009). "Herpes Simplex Virus-1 DNA Primase: A Remarkably Inaccurate yet Selective Polymerase." Biochemistry 48(46): 10866-10881.

Urban, M., N. Joubert, B. W. Purse, M. Hocek and R. D. Kuchta (2010). "Mechanisms by Which Human DNA Primase Chooses To Polymerize a Nucleoside Triphosphate." Biochemistry 49(4): 727-735.


Washington, M. T., K. D. Carlson, B. D. Freudenthal and J. M. Pryor (2010). "Variations on a theme: eukaryotic Y-family DNA polymerases." Biochimica et Biophysica Acta 1804(5): 1113-1123.

Wilds, C. J., M. A. Maier, M. Manoharan and M. Egli (2003). "Structural basis for recognition of guanosine by a synthetic tricyclic cytosine analogue: Guanidinium G-clamp." Helvetica Chimica Acta 86(4): 966-978.

Wilds, C. J., M. A. Maier, V. Tereshko, M. Manoharan and M. Egli (2002). "Direct observation of a cytosine analogue that forms five hydrogen bonds to guanosine: guanidino G-clamp." Angewandte Chemie International Edition English 41(1): 115-117.

Wilhelmsson, L. M. (2010). "Fluorescent nucleic acid base analogues." Quarterly Reviews of Biophysics 43(2): 159-183.

Wilhelmsson, L. M., A. Holmen, P. Lincoln, P. E. Nielsen and B. Norden (2001). "A highly fluorescent DNA base analogue that forms Watson-Crick base pairs with guanine." Journal of American Chemical Society 123(10): 2434-2435.

Wilhelmsson, L. M., P. Sandin, A. Holmen, B. Albinsson, P. Lincoln and B. Norden (2003). "Photophysical characterization of fluorescent DNA base analogue, tC." Journal of Physical Chemistry B 107(34): 9094-9101.

Yamada, M., T. Nunoshiba, M. Shimizu, P. Gruz, H. Kamiya, H. Harashima and T. Nohmi (2006). "Involvement of Y-family DNA polymerases in mutagenesis caused by oxidized nucleotides in Escherichia coli." Journal of Bacteriology 188(13): 4992-4995.

Yang, W. (2003). "Damage repair DNA polymerases Y." Current Opinion in Structural Biology 13(1): 23-30.


120

Yang, W. and R. Woodgate (2007). "What a difference a decade makes: insights into translesion DNA synthesis." Proceedings of the National Acadamy of Sciences of the United States of America 104(40): 15591-15598.


121

Chapter 4: Discrimination against major groove adducts by Y family polymerases of the DinB subfamily

4.1 Introduction

The Y family DNA polymerases were first identified as a class of DNA

polymerases in 2001 (Ohmori 2001) and are conserved throughout all domains of life

(Yang 2005; Friedberg 2006; Pata 2010). They are characterized by their ability to copy

damaged DNA in process known as translesion synthesis (TLS). The polymerase

domains of Y family polymerases resemble a right hand, with domains identified as the

thumb, palm, finger, and little finger (Yang 2005; Friedberg 2006). In contrast with high

fidelity polymerases, the finger domains in Y family polymerases tend to be smaller,

leading to virtually no major groove contacts at the nascent base pair (Pata 2010); thus,

major groove adducts are not subjected to the same steric constraints as minor groove

adducts, as they seem to protrude into a solvent-accessible area. The little finger, which is

unique to the Y family, makes contacts on the major groove side of the DNA, although

not at the nascent base pair. Large major groove DNA adducts often lie in the solvent-

accessible area caused by the structural gap between the little finger and the fingers

domains (Ling 2001; Shen 2002; Bauer 2007; Lone 2007)

Y family DNA polymerases bypass a wide variety of DNA damage (Suzuki 2001;

Shen 2002; Jarosz 2006; Seo 2006; Bauer 2007; Godoy 2007; Yuan 2008; Jarosz 2009;

Pence 2011), including interstrand DNA crosslinks (Kumari 2008), protein-DNA

crosslinks (Minko 2008), other bulky adducts (Shen 2002; Choi 2006a; Bauer 2007),

thymine-thymine dimers (Ling 2001), and damage induced by reactive oxygen species

(Rechkoblit 2006; Zang 2006; Hori 2010). E. coli Y family DNA polymerase IV (DinB)

122

is proficient in its ability to bypass minor groove N2 adducts of guanosine, in particular

DinB bypasses N2-furfuryl-dG ~15 fold more efficiently than it bypasses templates

containing the natural nucleotide dG (Jarosz 2006). Human pol κ, a DinB ortholog that

shares 35% sequence identity with DinB comparing their polymerase domains, is

proficient in bypassing bulky adducts such as benzo[a]pyrene at the N2 position (Zhang

2000; Rechkoblit 2002; Suzuki 2002; Choi 2006a; Choi 2006b). Substitution of palm

domain residue F171 with Ala in human pol κ led to more efficient bypass of N2-

benzo[a]pyrene-dG (Sassa 2011). S. solfataricus Dpo4, also considered a DinB ortholog

and whose polymerase domain shares 33% sequence identity with DinB, has a similar

preference to bypass modified dG as it incorporates dCTP opposite 8-oxo-dG

approximately ten times more efficiently than opposite unmodified dG (Zang 2006).

Dpo4 has been shown to bypass N2-dG adducts 1,N2-ethenodeoxyguanosine, as well as 7-

(2-oxoheptyl)-ethenodeoxyguanosine (Christov 2010). Minor groove N2-dG lesions may

block DNA synthesis by replicative polymerases, but are bypassed readily by these Y

family DNA polymerases.

Adducts at the N6 position of dA, or the O6 position of dG, as well as extended

extracyclical systems on cytosine analogs are considered to lie on the major groove side

of DNA (Figure 4.1). One cytosine analog with a bulky major groove modification, 1-

3,diaza-2-oxophenothiazine (tC), has been shown previously to inhibit primer extension

by DinB (Walsh 2011). On the other hand, Dpo4 has been shown to bypass O6-

methylguanine, incorporating dCTP a majority of the time, but also misincorporating A

and T (20% and 10% respectively) (Eoff 2007b). Human pol κ has also been shown to

bypass O6-methylguanine efficiently (Haracska 2002). Human DNA pols κ, η, ι and yeast

123

pol ζ have been previously tested for their ability to accomplish TLS on both

stereoisomers of the bulky benzo[a]pyrene at the N6 position of dA, and only pol η was

capable of fully extending DNA beyond the (+)-trans-benzo[a]pyrene steroisomer

(Rechkoblit 2002).

A T

CC

A

C

TA

CG

N

NR

N

N

H

NR

N

H O

N H

O

NR

N

HN

NR

N

N

N

H

O H

H N

OH

11

11

2

2

2

2

3

3

3

3

4

4

4

4

55

55

6

6

6

6

7

78

89

9

N N

NN

NH

dR

O

N6-furfuryl-dA etheno-dA (εA)

N

NN

dR

N

N

Pyrrolo-dC dP

O

N

N

dR

NH

O

NH

N

dR

NO

(a)

(b)

Figure 4.1 (a) The canonical Watson-Crick base pairing of G:C and cytosine analogs pyrrolo-dC and dP (b) The canonical Watson-Crick base pairing of A:T and adenosine analogs N6-furfuryl-dA and etheno-dA.

124

In this report we investigate the ability of DinB, Dpo4 and pol κ to carry out TLS

on two major groove-modified pyridimines, dP and pyrrolo-dC, as well as two major

groove adducts of adenosine, 1,N6-ethenodeoxyadenosine (εdA) and N6-furfuryl-

deoxyadenosine (fA) (Figure 4.1). The εdA adduct is a result of exposure to the

carcinogen vinyl chloride (Bartsch 1994), as well as endogenous aldehyde derived from

lipid peroxidation. Human pol κ has been shown to perform very weak TLS on templates

containing εA (Levine 2001), which we also observe; however, DinB is inactive on this

adduct while Dpo4 is able to bypass it. N6-furfuryl-deoxyadenosine was chosen as the

other major groove purine adduct in this study because N2-furfuryl-dG is considered to be

a cognate lesion of DinB; it is possible that the furfuryl adducts of dG and dA could arise

through similar mechanisms (Scopes 1976; Barciszewski 1999; Barciszewski 2000;

Rechkoblit 2002; Jarosz 2006; Barciszewski 2007).


DinB was purified as described previously by Beuning, et al. (Beuning 2006), and

stored in single-use aliquots at -80°C. Purification of Dpo4 (Wu 2011) and pol κ (Irimia

2009) were carried out as described. The DNA template containing a single N6-furfuryl-

deoxyadenosine was prepared as described from O6-phenyl-dI (Glen Research) (Larson

1992). Pyrrolo-dC, ethenodA, and dP phosphoramidites and pyrrolo-dCTP were from

Glen Research. Etheno-dATP was from Chemgenes. DNA sequences used in primer

extension assays are as follows: standing start primer, 31-mer 5ʹ-

GCATATGATAGTACAGCTGCAGCCGGACGCC-3ʹ; MatchT primer, 32-mer,5ʹ-

GCATATGATAGTACAGCTGCAGCCGGACGCCT-3ʹ; MatchT+1 primer, 33-mer,5ʹ-

GCATATGATAGTACAGCTGCAGCCGGACGCCTA-3ʹ; MatchT+2 primer, 34-

125

mer,5ʹ-GCATATGATAGTACAGCTGCAGCCGGACGCCTAG-3ʹ; MatchT+3 primer,

35-mer,5ʹ-GCATATGATAGTACAGCTGCAGCCGGACGCCTAGG-3ʹ; MatchT+4

primer, 36-mer,5ʹ-GCATATGATAGTACAGCTGCAGCCGGACGCCTAGGT-3ʹ; and

template 61-mer, 5ʹ-GGTTACTCAGATCAGGCCTGCGAAGACCTNGGCGT

CCGGCTGCTGTACTATCATATGC-3ʹ, where N = A, C, N6-furfuryl-deoxyadenosine,

or 1,N6-ethenodeoxyadenosine, pyrrolo-dC, or dP (Glen Research). DNA primer

(standing start or MatchT) and the template containing the indicated adduct were

combined to a final ratio of 1:1 (100 nM) and annealed in annealing buffer

[20 mM Hepes (pH 7.5) and 5 mM Mg(OAc)2] by heating for 2 min at 95 °C, incubating

at 50 °C for 60 min, and then cooling to 37 °C. The reactions were carried out with 100

nM 32P-end-labeled primer/template in a reaction buffer containing final concentrations

of 30 mM Hepes (pH 7.5), 20 mM NaCl, 7.5 mM MgSO4, 2 mM β-mercaptoethanol, 1%

bovine serum albumin, and 4% glycerol (Beuning 2006). Experiments were carried out

with dNTP concentrations ranging from 1 μM-5000 μM, unless otherwise noted, and

DinB concentration was 25 nM unless noted. Dpo4 and polymerase κ concentrations

were 25 nM for damaged templates and 1 nM for unmodified templates due to their

higher activity in general as compared to DinB. An aliquot for the zero point was

removed before reactions were initiated by the addition of dNTP (Beuning 2006). The

final reaction volumes were 30 μL. Time points were typically taken from 0.5 min to

30 min and reactions were quenched with 85% formamide, 50 mM

ethylenediaminetetraacetic acid, 0.025% xylene cyanol, and 0.025% bromophenol blue

(Beuning 2006). To determine kinetic parameters, conditions were chosen such that less

than 25% of the substrate was converted to product. Quenched reaction products were

126

analyzed on denaturing (8 M urea) 16% polyacrylamide gels, which were subsequently

imaged on a Molecular Dynamics storage phosphor imaging screen with a Storm 860

imager. ImageQuant software (GE Healthcare) was used to analyze data. Kinetic

parameters Vmax and Km were determined by assessing the percentage of primer extended

at various time points in the experiment and were derived using GraphPad Prism®

nonlinear regression analysis software (Segel 1993).

4.3 Results

4.3.1 Cytosine analogs dP and pyrrolo-dC modestly inhibit DinB

In order to extend our observation that the bulky modified pyrimidine tC blocks

replication by E. coli DinB, we assayed the activity of DinB as well as that of human pol

κ and Dpo4 in bypass of pyrrolo-dC and dP. Pyrrolo-dC and dP (Figure 4.1) were chosen

because they are slightly smaller than tC with only one additional ring in the major

groove and because they are commercially available.

127

Pyrrolo-dC

+d

NT

P

hpol κDinB Dpo4

+d

AT

P

+d

GT

P+

dT

TP

+d

CT

PP

+d

NT

P

+d

GT

P+

dT

TP

+d

CT

PP

+d

AT

P

+d

NT

P

+d

GT

P+

dT

TP

+d

CT

PP

+d

AT

P

hpol κDinB Dpo4

+d

NT

P

+d

NT

P

+d

NT

P

dP

O

N

N

dR

NH

O

NH

N

dR

NO

Figure 4.2 Primer extension as well as fidelity of incorporation of Y family polymerases E. coli DinB, human DNA polymerase κ and S. solfataricus Dpo4 on templates containing pyrrolo-dC. P indicates the position of the primer. Fidelity is not shown for dP because it was designed to base pair with dG or dA

In primer extension assays with Pyrrolo-dC and dP, DinB was more active than on DNA

containing tC (Walsh 2011), although DinB and Dpo4 showed stalling 2-3 nucleotides

after the site of the modification (Figure 4.2). Human pol κ was able to efficiently bypass

both pyrollo-dC and dP (Figure 4.2). No misinsertion was observed opposite the cytosine

analogs (Figure 4.2) with the exception that both purines were added opposite dP (data

not shown), which was not unexpected as dP was specifically designed to be a universal

purine acceptor (Thoo 1992).

128

4.3.2 N6-furfuryl-deoxyadenosine inhibits TLS

All three polymerases demonstrated weak bypass with templates containing fA

with both running start (not shown) and standing start primers (Figure 4.3).

+dNTP +dNTP X=N

6 -fu

rfur

yl-d

AX

=Eth

eno-

dA

C X

T C

C A

(N

25)

G

hpol κDinB Dpo4

+dNTP

hpol κ Dpo4DinB

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+dNTP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+dNTP +dNTP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

(a)

(b)

(c)

(d)

C X

T C

C A

(N

25)

G

Figure 4.3 (a) Primer extension of Y family polymerases E. coli DinB, human polymerase κ and S. solfataricus Dpo4 on templates containing N6-furfuryl-dA. (b) Fidelity of incorporation of Y family polymerases E. coli DinB, human polymerase κ and S. solfataricus Dpo4 on templates containing N6-furfuryl-dA. (c) Primer extension of Y family polymerases E. coli DinB, human polymerase κ and S. solfataricus Dpo4 on templates containing etheno-dA (d) Fidelity of incorporation of Y family polymerases E. coli DinB, human polymerase κ and S. solfataricus Dpo4 on templates containing etheno-dA.

129

Human pol κ and Dpo4 were modestly active, whereas DinB showed very weak activity.

All three polymerases incorporate predominantly dT opposite N6-furfuryl-dA, although

slight misincorporation of dA and dC by pol κ and dA by Dpo4 is seen (Figure 4.3).

Steady-state kinetic parameters were determined, which show that there is less than a 10-

fold difference among the three different DNA polymerases in efficiency of incorporation

of dT opposite N6-furfuryl-dA (Table 4.1).

Table 4.1: Steady state kinetic parameters for dTTP incorporation opposite N2-f-dA and A by DinB, DinB R35A, polymerase kappa and Dpo4

dTTP : fA Km

(μM) kcat

(min-1) Vmax

(μM*min-1) kcat/Km

(min-1*μM-1) Fold Decrease

Pol κ 12 ± 1.7 2.5 0.025 ± 0.002 8.6 x 10-2 --

DinB 39 ± 14 0.76 0.019 ± 0.00014 2.0 x 10-2 4.4

Dpo4 710 ± 210 9.7 0.24 ± 0.032 1.4 x 10-2 6.3

DinB R35A 27 ± 12 2.4 0.029 ± 0.006 8.9 x 10 -2 0.97

dTTP : A

Pol κ 8.5 ± 6.9 47 0.047 ± 0.002 5.5 --

DinB 310 ± 140 31 0.15 ± 0.093 1.0 x 10-1 54

Dpo4 5.9 ± 2.5 15 0.015 ± 0.003 2.6 2.1

DinB R35A 304 ± 89 29 0.029 ± 0.006 9.7 x 10-2 57

However, DinB is far less efficient in incorporation of dT opposite undamaged template

dA than are pol κ or Dpo4 (Table 4.1). Notably, DinB is also less efficient (25 fold) in

bypass of N6-furfuryl-dA than N2-furfuryl-dG (Table 4.2) (Jarosz 2006).

Table 4.2: Steady state kinetic parameter comparison of DinB addition of dCTP from N2-f-dG and N6-f-dA

DinB Km

(μM) kcat

(min-1) Vmax

(μM*min-1) kcat/Km

(min-1*μM-1) Fold Decrease

dCTP*fG 49. ± 22 24 0.24 ± 0.074 0.49 --

dTTP*fA 39 ± 14 0.76 0.019 ± 0.00014 2.0 x 10-2 25

dTTP*A 310 ± 140 31 0.15 ± 0.093 1.0 x 10-1 --

dCTP*G 147 ± 57 4.6 0.046 ± 0.016 3.2 x 10-2 3.7

130

Because of the poor primer extension on templates containing N6-furfuryl-dA and

the relatively modest decrease in catalytic efficiency of insertion opposite N6-furfuryl-dA

relative to undamaged dA, especially in the case of DinB, we suspected that the lack of

primer extension could be due to a defect in extension from the new primer terminus after

addition of the first nucleotide opposite N6-furfuryl-dA. Therefore, we determined the

activity of the DNA pols with a primer that has dT properly base paired with N6-furfuryl-

dA at its terminus. When the adducts were correctly base paired with the primer MatchT,

TLS by DinB is still hindered dramatically, while Dpo4 and pol κ are less disrupted

(Figure 4.4).

131

MatchT+3 MatchT+3 MatchT+4MatchT+1 MatchT+2 MatchT+4 MatchT+1 MatchT+2

X = N6-furfuryl-dA X = etheno-dA DinB

pol κ

Dpo4

X = N6-furfuryl-dA X = etheno-dA

X = N6-furfuryl-dA X = etheno-dA

dNTP

X

NX

NX

dNTPDinB

Dpo4

Pol κ

(a)

(b)

(c)



Figure 4.4: Primer extension of Y family polymerases (a) E. coli DinB, (b) human polymerase κ, or (c) S. solfataricus Dpo4 on templates containing N6-furfuryl-dA and etheno-dA with primers that start from one nucleotide beyond the analog to four nucleotides beyond the analog, as illustrated at the top.

132

When the primer terminus is two or more nucleotides beyond the N6-furfuryl-dA adduct

there is only a slight difference in extension abilities between the three polymerases

(Figure 4.4). DinB is still disrupted by fA when DinB begins synthesis at least one

nucleotide beyond the lesion, but initiating synthesis further beyond the lesion, with the

MatchT+2 MatchT+3 primers, is more conducive to bypass and extension. Pol κ and

Dpo4 more efficiently added nucleotides and completed synthesis to the end of the

template when the primer terminus was beyond the fA adduct. At MatchT+1, which is

only one nucleotide beyond the adduct, pol κ and Dpo4 efficiently synthesize DNA to the

end of the template (Figure 4.4).

4.3.3 1,N6-ethenodeoxyadenosine (εdA) strongly inhibits TLS

DinB, Pol κ, and Dpo4 are strongly or completely inhibited by the presence of

εdA in the DNA template with both running (not shown) and standing start (Figure 4.3)

primers. Pol κ was only weakly active but was accurate, incorporating only dT (Figure

4.3). Dpo4 showed the most activity, albeit still quite weak, of the three pols, but

incorporated dA opposite template εdA (Figure 4.3).

Extension from the damaged duplex DNA was then examined with primers that

extend beyond the damaged site. Ethenodeoxyadenosine inhibits TLS by DinB even

when the primer extends beyond the adduct. DinB showed no primer extension when

MatchT+1, or MatchT+2 are annealed to a template containing εdA. With a DNA duplex

of MatchT+3 and template containing εdA, DinB only completes primer extension very

weakly. When assayed with the analogous DNA duplex with MatchT+4, DinB activity is

restored sufficiently to extend the primer to the end of the template, although its activity

is still weaker with εdA than with N6-furfuryl-dA (Figure 4.4). The need for a primer that

133

is extended at least three nucleotides beyond εdA, which strongly inhibits DinB activity,

is consistent with our previous observations with tC, which also strongly inhibits DinB

(Walsh 2011).

This requirement for an extension of the primer several nucleotides beyond the

damage that we observed with DinB is more moderate with its homologs Dpo4 and pol κ

(Figure 4.4). With the MatchT+1 primer and εdA template, both pol κ and Dpo4 show

slight disruption in primer extension, but both eventually extend to the end of the

template. The disruption is slightly less with MatchT+2/εdA, while MatchT+3/εdA and

MatchT+4/εdA are extended efficiently.

4.3.4 DinB R35A mutation allows bypass of N6-furfuryl-dA but not εdA

We attempted to identify residues of DinB that could play a role in modulating

bypass of major groove adducts by examining a homology model of DinB. Fingers

domain residue R35 is likely to be positioned to bind the template strand as it enters the

active site, albeit not in the major groove. We hypothesized that the mutation R35A could

remove specific contacts with the template and allow more flexibility at the template base

to allow DinB to accommodate bulky major groove lesions. DinB R35A was able to

bypass N6-furfuryl-dA more efficiently than wild-type DinB, but was not able to bypass

εdA (Figure 4.5).

134

DinB WT DinB R35A

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

+d

AT

P

+d

GT

P

+d

TT

P

+d

CT

PP

X=N6-furfuryl-dA X=Etheno-dA

C X

T C

C (

N26

)G

(a) (b)

(c)

DinB WT DinB R35A

time time

DinB 32GGSR-ERRGVISTA44

Dpo4 33FSGRFEDSGAVATA46

polk131GSM-----SMLSTS139

Figure 4.5 Primer extension and fidelity of incorporation of wild-type DinB (25 nM) and DinB R35A (12.5 nM) with templates containing (a) N6-furfuryl-dA or (b) etheno-dA. (c) Position of residue R35 in DinB (Walsh 2012), shown in blue, compared to positions on Dpo4 (1JX4) (Ling 2001), shown in green and pol κ (2OH2) (Lone 2007), shown in red complexed with the DNA from the DinB homology model (Walsh 2012). R35 lies in a loop region around the active site, and Dpo4 has a similar arginine residue at position 36. Polymerase κ has a much smaller loop near this position, residues of which are highlighted from S132-M135. The inset shows a sequence alignment of the region of interest.

135

Both wild-type DinB and DinB R35A insert dTTP opposite N6-furfuryl-dA as expected,

with R35A being ~4.5 fold more efficient than wild-type DinB. There seems to be minor

incorporation of A opposite N6-furfuryl-dA by both wild-type DinB and DinB R35A as

well, however this could be due to addition of dATP opposite the following nucleotide in

the template, which is T, as DinB is known to form bulges in the template and insert a

nucleotide opposite the next base in the sequence, generating deleterious -1 frameshifts

(Foti 2010). Steady-state kinetics analysis provides an explanation for the improved

activity of DinB R35A with N6-furfuryl-dA, as wild-type DinB shows a ~5-fold decrease

in catalytic efficiency relative to insertion of dTTP opposite dA, while DinB R35A shows

nearly the same efficiency for insertion of dTTP opposite N6-furfuryl-dA or dA (Table

4.1). Thus, the R35A mutation eliminates discrimination against N6-furfuryl-dA relative

to undamaged dA.

4.4 Discussion

DNA is constantly subject to damage from both internal and external sources. Y

family DNA polymerases allow tolerance of DNA damage by replicating damaged DNA.

The Y family polymerase DinB is specialized for bypass of minor groove adducted bases,

such as at the N2 position of G which is susceptible to damage from a variety of chemical

compounds (Suzuki 2001; Shen 2002; Jarosz 2006; Seo 2006; Bauer 2007; Godoy 2007;

Yuan 2008; Jarosz 2009; Pence 2011). Other Y-family DNA polymerases are capable of

bypassing major groove adducts (Levine 2001; Rechkoblit 2002; Nair 2006; Eoff 2007a;

Eoff 2007b; Jia 2008). We previously showed that the synthetic major groove modified

base tC inhibits DinB, although DinB readily utilizes dtCTP as the incoming nucleotide

(Walsh 2011). In this work, we used two synthetic nucleotide analogs, pyrrolo-dC and

136

dP, and two naturally-occurring modified bases, N6-furfuryl-dA and etheno-dA, to probe

discrimination of major groove modifications by the Y family polymerases E. coli DinB,

human pol κ, and Sulfolobus solfataricus Dpo4. The furfuryl moiety is thought to form

from the metabolism of ribose (Scopes 1976), as well as from treatment with

nitrofurazone, a veterinary antibiotic and suspected carcinogen (Hiraku 2004). The

damaged base εdA arises from both environmental sources such as vinyl chloride (Yang

2000) and endogenous sources such as the peroxidation of lipids (Chung 1996). Of the

three polymerases studied, DinB showed the least proficiency in bypassing the major

groove adducts. While base pair formation with the natural bases (dTTP with A vs. dCTP

with G) occurred with similar catalytic efficiency by DinB, differing by only ~4 fold

(Table 4.2), DinB incorporates the respective nucleotide triphosphate opposite fG or fA

with a 25-fold preference for dCTP opposite fG relative to dTTP opposite fA. While

DinB R35A had virtually identical activity to wild-type DinB in incorporation of dTTP

opposite unmodified dA, the R35A variant was 4.5 fold more efficient at adding dTTP

opposite fA (Table 4.1). Strikingly, DinB R35A has essentially the same catalytic

efficiency on undamaged and damaged DNA containing N6-furfuyl-dA (Table 4.1). Thus,

this single amino acid change is sufficient to eliminate discrimination by DinB against

the N6-furfuyl-dA major groove modification. Upon generation of an alignment of the

structures of Dpo4 (Ling 2001) and pol κ (Lone 2007) with the homology model of DinB

(Walsh 2012) (Figure 4.5), it is apparent that Dpo4 R36 aligns well with DinB R35, yet

wild-type Dpo4 was generally proficient in bypass of the major groove modified bases

tested here. Moreover, pol κ has a very different loop structure in this region of the

protein, which is much smaller than those of Dpo4 and DinB.

137

In general, human polymerase κ was the most efficient in bypass of the modified

pyrimidines, and showed the highest catalytic efficiency for incorporation of dTTP

opposite fA, although all three polymerases had catalytic efficiencies within 10 fold.

Dpo4 was the most proficient in bypass of the two modified purines, even though it

showed a large increase in Km when performing addition of dTTP opposite fA, but a

corresponding ~10-fold increase in Vmax compared to pol κ and DinB (Table 4.1). Both

pol κ and Dpo4 are more efficient in insertion of dTTP opposite natural A compared to

fA with pol κ being ~64 fold more efficient and Dpo4 being ~186 fold more efficient.

However DinB is only five fold more efficient at insertion of dTTP opposite A compared

to fA. Y family polymerases are specialized for copying damaged DNA and, in

particular, DinB and pol κ are more efficient in replication of N2-furfuryl-dG than

unmodified dG. However, this work is evidence that the ability of Y-family polymerases

to copy damaged DNA is specific to particular adducts, as certain major groove adducts

strongly inhibit their activity.

These observations support the findings of Rechkoblit, et al. (Rechkoblit 2002),

who found that human pol η was able to bypass the major groove adduct N6-

benzo[a]pyrene-dA, whereas pol κ could not carry out TLS when encountering this

adduct (Rechkoblit 2002). Eukaryotic DNA polymerase ι is known to rotate the εdA to

the syn conformation to present a Hoogsteen face for hydrogen bonding, and can

incorporate either dTTP (major product) or dCTP (minor product) (Nair 2006).

Polymerase ι can also complete primer extension beyond both correct and incorrect

primer termini with εdA base paired with a T or a C, respectively (Nair 2006). TLS in

eukaryotes involves a division of labor, with one polymerase inserting a nucleotide

138

opposite the lesion and a second Y-family polymerase extending the newly-generated

primer terminus (Haracska 2002; Prakash 2002). In addition, different Y-family

polymerases appear to be specialized for bypass of distinct sets of lesions.

139

4.5 References

Barciszewski, J., M. Z. Barciszewska, G. Siboska, S. I. Rattan and B. F. Clark (1999). "Some unusual nucleic acid bases are products of hydroxyl radical oxidation of DNA and RNA." Molecular Biology Reports 26(4): 231-238.

Barciszewski, J., F. Massino and B. F. Clark (2007). "Kinetin--a multiactive molecule." International Journal of Biological Macromolecules 40(3): 182-192.

Barciszewski, J., M. Mielcarek, M. Stobiecki, G. Siboska and B. F. Clark (2000). "Identification of 6-furfuryladenine (kinetin) in human urine." Biochemical & Biophysical Research Communications 279(1): 69-73.

Bartsch, H., A. Barbin, M. J. Marion, J. Nair and Y. Guichard (1994). "Formation, detection, and role in carcinogenesis of ethenobases in DNA." Drug Metabolism Reviews 26(1-2): 349-371.

Bauer, J., G. Xing, H. Yagi, J. M. Sayer, D. M. Jerina and H. Ling (2007). "A structural gap in Dpo4 supports mutagenic bypass of a major benzo[a]pyrene dG adduct in DNA through template misalignment." Proceedings of the National Acadamy of Sciences of the United States of America 104(38): 14905-14910.

Beuning, P. J., S. M. Simon, V. G. Godoy, D. F. Jarosz and G. C. Walker (2006). "Characterization of Escherichia coli translesion synthesis polymerases and their accessory factors." Methods in Enzymology 408: 318-340.

Choi, J. Y., K. C. Angel and F. P. Guengerich (2006a). "Translesion synthesis across bulky N2-alkyl guanine DNA adducts by human DNA polymerase kappa." Journal of Biological Chemistry 281(30): 21062-21072.

Choi, J. Y., H. Zang, K. C. Angel, I. D. Kozekov, A. K. Goodenough, C. J. Rizzo and F. P. Guengerich (2006b). "Translesion synthesis across 1,N-2-ethenoguanine by human DNA polymerases." Chemical Research in Toxicology 19(6): 879-886.

Christov, P. P., K. V. Petrova, G. Shanmugam, I. D. Kozekov, A. Kozekova, F. P. Guengerich, M. P. Stone and C. J. Rizzo (2010). "Comparison of the in vitro replication of the 7-(2-oxoheptyl)-1,N2-etheno-2'-deoxyguanosine and 1,N2-etheno-2'-deoxyguanosine lesions by Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4)." Chemical Research in Toxicology 23(8): 1330-1341.

Chung, F. L., H. J. Chen and R. G. Nath (1996). "Lipid peroxidation as a potential endogenous source for the formation of exocyclic DNA adducts." Carcinogenesis 17(10): 2105-2111.

Eoff, R. L., K. C. Angel, M. Egli and F. P. Guengerich (2007a). "Molecular basis of selectivity of nucleoside triphosphate incorporation opposite O-6-benzylguanine by Sulfolobus solfataricus DNA polymerase Dpo4 - Steady-state and pre-steady-state kinetics and X-ray crystallography of correct and incorrect pairing." Journal of Biological Chemistry 282(18): 13573-13584.

Eoff, R. L., A. Irimia, M. Egli and F. P. Guengerich (2007b). "Sulfolobus solfataricus DNA polymerase Dpo4 is partially inhibited by "wobble" pairing between O-6-methylguanine and cytosine, but accurate bypass is preferred." Journal of Biological Chemistry 282(2): 1456-1467.

140

Foti, J. J., A. M. Delucia, C. M. Joyce and G. C. Walker (2010). "UmuD2 inhibits a non-covalent step during DinB-mediated template slippage on homopolymeric nucleotide runs." Journal of Biological Chemistry 285(30): 23086-23095.



Haracska, L., L. Prakash and S. Prakash (2002). "Role of human DNA polymerase kappa as an extender in translesion synthesis." Proceedings of the National Acadamy of Sciences of the United States of America 99(25): 16000-16005.

Hiraku, Y., A. Sekine, H. Nabeshi, K. Midorikawa, M. Murata, Y. Kumagai and S. Kawanishi (2004). "Mechanism of carcinogenesis induced by a veterinary antimicrobial drug, nitrofurazone, via oxidative DNA damage and cell proliferation." Cancer Letters 215(2): 141-150.


Irimia, A., R. L. Eoff, F. P. Guengerich and M. Egli (2009). "Structural and functional elucidation of the mechanism promoting error-prone synthesis by human DNA polymerase kappa opposite the 7,8-dihydro-8-oxo-2'-deoxyguanosine adduct." Journal of Biological Chemistry 284(33): 22467-22480.



Jia, L., N. E. Geacintov and S. Broyde (2008). "The N-clasp of human DNA polymerase kappa promotes blockage or error-free bypass of adenine- or guanine-benzo[a] pyrenyl lesions." Nucleic Acids Research 36(20): 6571-6584.


Larson, C. J. and G. L. Verdine (1992). "A high-capacity column for affinity purification of sequence-specific DNA-binding proteins." Nucleic Acids Researchearch 20(13): 3525.

Levine, R. L., H. Miller, A. Grollman, E. Ohashi, H. Ohmori, C. Masutani, F. Hanaoka and M. Moriya (2001). "Translesion DNA synthesis catalyzed by human pol eta and pol kappa across 1,N6-ethenodeoxyadenosine." Journal of Biological Chemistry 276(22): 18717-18721.

141


Lone, S., S. A. Townson, S. N. Uljon, R. E. Johnson, A. Brahma, D. T. Nair, S. Prakash, L. Prakash and A. K. Aggarwal (2007). "Human DNA polymerase kappa encircles DNA: implications for mismatch extension and lesion bypass." Molecular Cell 25(4): 601-614.


Nair, D. T., R. E. Johnson, L. Prakash, S. Prakash and A. K. Aggarwal (2006). "Hoogsteen base pair formation promotes synthesis opposite the 1,N6-ethenodeoxyadenosine lesion by human DNA polymerase iota." Nature Structural Molecular Biology 13(7): 619-625.



Pence, M. G., P. Blans, C. N. Zink, J. C. Fishbein and F. W. Perrino (2011). "Bypass of N(2)-ethylguanine by human DNA polymerase kappa." DNA Repair (Amst) 10(1): 56-64.

Prakash, S. and L. Prakash (2002). "Translesion DNA synthesis in eukaryotes: A one- or two-polymerase affair." Genes Dev 16(15): 1872-1883.

Rechkoblit, O., L. Malinina, Y. Cheng, V. Kuryavyi, S. Broyde, N. E. Geacintov and D. J. Patel (2006). "Stepwise translocation of Dpo4 polymerase during error-free bypass of an oxoG lesion." PLoS Biol 4(1): e11.

Rechkoblit, O., Y. B. Zhang, D. Y. Guo, Z. G. Wang, S. Amin, J. Krzeminsky, N. Louneva and N. E. Geacintov (2002). "trans-lesion synthesis past bulky benzo[a]pyrene diol epoxide N-2-dG and N-6-dA lesions catalyzed by DNA bypass polymerases." Journal of Biological Chemistry 277(34): 30488-30494.

Sassa, A., N. Niimi, H. Fujimoto, A. Katafuchi, P. Gruz, M. Yasui, R. C. Gupta, F. Johnson, T. Ohta and T. Nohmi (2011). "Phenylalanine 171 is a molecular brake for translesion synthesis across benzo[a]pyrene-guanine adducts by human DNA polymerase kappa." Mutat Res 718(1-2): 10-17.

Scopes, D. I. C., U. Zarnack, N. J. Leonard, R. Y. Schmitz and F. Skoog (1976). "Alternative Routes for Genesis of Kinetin - Synthetic Intramolecular Route from 2'-Deoxyadenosine to Kinetin." Phytochemistry 15(10): 1523-1526.


Seo, K. Y., A. Nagalingam, S. Miri, J. Yin, S. Chandani, A. Kolbanovskiy, A. Shastry and E. L. Loechler (2006). "Mirror image stereoisomers of the major

142

benzo[a]pyrene N2-dG adduct are bypassed by different lesion-bypass DNA polymerases in E. coli." DNA Repair (Amst) 5(4): 515-522.


Suzuki, N., E. Ohashi, K. Hayashi, H. Ohmori, A. P. Grollman and S. Shibutani (2001). "Translesional synthesis past acetylaminofluorene-derived DNA adducts catalyzed by human DNA polymerase kappa and Escherichia coli DNA polymerase IV." Biochemistry 40(50): 15176-15183.

Thoo, P. K. and D. M. Brown (1992). "Synthesis of oligodeoxyribonucleotides containing degenerate bases and their use as primers in the polymerase chain reaction." Nucleic Acids Research 20(19): 5149-5152.


Walsh, J. M., R. Parasuram, P. R. Rajput, E. Rozners, M. J. Ondrechen and P. J. Beuning (2012). "Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB (DNA polymerase IV)." Environmental and Molecular Mutagenesis: 53:766-776.

Wu, Y. F., R. C. Wilson and J. D. Pata (2011). "The Y-Family DNA Polymerase Dpo4 Uses a Template Slippage Mechanism To Create Single-Base Deletions." J Bacteriol 193(10): 2630-2636.


Yang, Y., J. Nair, A. Barbin and H. Bartsch (2000). "Immunohistochemical detection of 1,N(6)-ethenodeoxyadenosine, a promutagenic DNA adduct, in liver of rats exposed to vinyl chloride or an iron overload." Carcinogenesis 21(4): 777-781.


Zang, H., A. Irimia, J. Y. Choi, K. C. Angel, L. V. Loukachevitch, M. Egli and F. P. Guengerich (2006). "Efficient and high fidelity incorporation of dCTP opposite 7,8-dihydro-8-oxodeoxyguanosine by Sulfolobus solfataricus DNA polymerase Dpo4." Journal of Biological Chemistry 281(4): 2358-2372.

Zhang, Y., F. Yuan, X. Wu, M. Wang, O. Rechkoblit, J. S. Taylor, N. E. Geacintov and Z. Wang (2000). "Error-free and error-prone lesion bypass by human DNA polymerase kappa in vitro." Nucleic Acids Research 28(21): 4138-4146.

143

Chapter 5: Future Considerations

This research has been focused on elucidating how E. coli Y-family DNA

polymerase IV (DinB) functions. Y-family DNA polymerases are specialized DNA

polymerases (Ohmori 2001) that are able to copy damaged DNA in a process known as

translesion synthesis (TLS). DinB is especially proficient in bypassing adducts at the N2

position of guanosine (Jarosz 2006), which lies on the minor groove side of DNA. Here

we have shown that the DinB subfamily is inefficient at dealing with major groove

adducts at the N6 position on adenine, as well as certain cytosine analogs that contain

extrahelical systems lying in the major groove (Walsh 2011). Y family DNA polymerases

also exhibit relatively low fidelity when copying undamaged DNA. These DNA

polymerases have roles in the prevention of cancer due to their ability to accurately copy

DNA damage, as well as in generating antibiotic resistance because of their ability to

generate point mutations when replicating undamaged DNA. I have made progress in

many areas regarding this important family of proteins. One of my major findings is that

DinB is unable to copy DNA containing bulky adducts that lie on the major groove side

of DNA (Walsh 2011). This shifts the previously held paradigm of the Y family

polymerases as promiscuous enzymes. My findings also reinforce the very specific nature

of the DinB subfamily, as they not only prefer to bypass bulky minor groove adducts

(Jarosz 2006), they are strongly blocked by bulky major groove adducts (Walsh 2011).

It would be of interest to expand the finding that DinB discriminates against bulky

major groove adducts. A growing library of commercially-available DNA adducts that

represent the products of environmental toxins or that are novel synthetic nucleotides will

allow future researchers to probe discrimination against DNA damage by various DNA

144

polymerases. It could be investigated how efficiently different adducts are bypassed by

both replicative polymerases as well as Y-family polymerases from a number of

organisms that have not yet been thoroughly examined. This project could then be

expanded by using site-directed mutagenesis to determine protein regions that are

important for activity and specificity. Surprisingly, major groove adducts seem to lie in a

solvent-exposed pocket in the DinB active site, even though bulky major groove adducts

are blocks to replication by DinB. The work has shown that DinB displays a duality in its

ability to utilize some synthetic nucleotides, showing varying activity depending on

whether the adduct is located on the template strand or if it is the incoming nucleotide

triphosphate being added to the growing primer strand (Walsh 2011). Investigation into

the importance of the little finger could also be explored.

Chapter 2 describes work to experimentally characterize the roles that distal

amino acid residues play in enzyme efficacy. Originally the theoretical work involved

calculations to determine the rank of importance of amino acid residues on enzymes with

small molecule substrates (including Ketosteroid isomerase and Phosphoglucose

isomerase), work which then experimentally demonstrated the importance of distal

residues to activity in the case of PGI but not KSI, as predicted (Somarowthu 2011a). A

key question about the computational methods is whether they could be applied to a DNA

polymerase, which has a much larger substrate (DNA) with which the DNA polymerase

makes many contacts. We demonstrated that the amino acid residues that are highly

ranked in the computational predictions of activity, which are distant from the active site,

impact the activity of DinB (Walsh 2012). The next step in this project would be to

examine the function of the remote residue mutations on DNA polymerase function in

145

vivo. This is particularly important because it was determined that remote residue

mutations in DinB specifically affect the extension step, rather than the insertion step

(Figure 5.1), of TLS, which has been shown to be as important if not more important than

insertion (Jarosz 2009). Biological function could be characterized by assaying the

survival of cells harboring the DinB variants in the presence of nitrofurazone, which is

thought to generate the N2-furfuryl adduct of deoxyguanosine. The results of the in vivo

studies of the effect of distal residue mutations would then be compared to the

biochemical data in order to determine the importance of the extension step of TLS to

cellular survival in the face of DNA damage. Another direction of this project is to

perform the POOL and THEMATICS calculations on other DNA polymerases, either

those involved in TLS or normal replication, to determine how those remote residues

impact activity.

Figure 5.1 Diagram of the two phases of translesion synthesis (TLS): insertion opposite the lesion, and extension beyond it. The extension step may be as important as insertion in TLS (Jarosz 2009); distal residues of DinB have an impact on extension (Walsh 2012).

Finally, protein-protein interactions are important for regulation of DinB and

other Y family polymerases. The UmuD2 protein regulates mutagenesis and has been

shown to interact with DinB to prevent deleterious -1 frameshift activity of DinB (Godoy

2007). The nature and mechanism of this interaction has not been established. By

335

5

335

5

335

5

Insertion

Extension

146

carrying out primer extension assays with DinB and a variety of UmuD2 constructs

including a monomeric version (Ollivierre 2011) and a noncleaveable version (Nohmi

1988; Battista 1990) that are in hand, the interaction between DinB and UmuD2 can be

probed at the molecular level. Different UmuD2 and DinB fragments could be purified to

isolate the sites of interaction using fluorescence quenching assays. UmuD2 naturally

contains one cysteine per monomer and lacks tryptophan, making it amenable to a variety

of fluorescence-based assays. These experiments will allow a determination of the roles

of protein interactions in DinB activity.

147

5.2 References Battista, J. R., T. Ohta, T. Nohmi, W. Sun and G. C. Walker (1990). "Dominant negative

umuD mutations decreasing RecA-mediated cleavage suggest roles for intact UmuD in modulation of SOS mutagenesis." Proceedings of the National Acadamy of Sciences of the United States of America 87(18): 7190-7194.




Nohmi, T., J. R. Battista, L. A. Dodson and G. C. Walker (1988). "RecA-mediated cleavage activates UmuD for mutagenesis: mechanistic relationship between transcriptional derepression and posttranslational activation." Proceedings of the National Acadamy of Sciences of the United States of America 85(6): 1816-1820.


Ollivierre, J. N., J. L. Sikora and P. J. Beuning (2011). "The dimeric SOS mutagenesis protein UmuD is active as a monomer." Journal of Biological Chemistry 286(5): 3607-3617.

Somarowthu, S., H. R. Brodkin, J. A. D'Aquino, D. Ringe, M. J. Ondrechen and P. J. Beuning (2011). "A tale of two isomerases: compact versus extended active sites in ketosteroid isomerase and phosphoglucose isomerase." Biochemistry 50(43): 9283-9295.


Walsh, J. M., R. Parasuram, P. R. Rajput, E. Rozners, M. J. Ondrechen and P. J. Beuning (2012). "Effects of non-catalytic, distal amino acid residues on activity of E. coli DinB (DNA polymerase IV)." Environmental and Molecular Mutagenesis: In press 10.1002/em.21730.

Function of damage inducible DNA polymerase IV from ...738/fulltext.pdf · past and present....

Documents

Transcript of Function of damage inducible DNA polymerase IV from ...738/fulltext.pdf · past and present....