Fulltext Paper 1

Arch Microbiol (2009) 191:721–733
DOI 10.1007/s00203-009-0498-3
ORIGINAL PAPER

Yeast protein phosphatases Ptp2p and Msg5p are involved in G1–S transition, CLN2 transcription, and vacuole morphogenesis

Hermansyah · Minetaka Sugiyama · Yoshinobu Kaneko · Satoshi Harashima

Received: 25 March 2009 / Revised: 16 July 2009 / Accepted: 22 July 2009 / Published online: 14 August 2009© Springer-Verlag 2009

Abstract We previously reported that double disruption ofprotein phosphatase (PPase) genes PTP2 (phosphotyrosine-speciWc PPase) and MSG5 (phosphotyrosine and phosphothre-onine/serine-PPase) causes Ca2+ sensitive growth, whereasthe single disruptions do not. This Wnding suggests that Ptp2pand Msg5p are involved in Ca2+-induced stress response in aredundant manner. To gain insight into the molecular mecha-nism causing calcium sensitivity of the �ptp2 �msg5 doubledisruptant, we performed Xuorescence-activated cell sortinganalysis and found a delayed G1 phase. This delayed G1 wasconsistent with the defect in bud emergence, and reducedCLN2 transcription upon addition of CaCl2. We also foundthat Slt2p is hyper-phosphorylated in the �ptp2 �msg5 doubledisruptant and that the vacuole of the �ptp2 �msg5 doubledisruptant is fragmented even in the absence of Ca2+. TheseWndings suggest that both Ptp2p and Msg5p are involved inthe G1 to S transition and vacuole morphogenesis possiblythrough their regulation of Slt2 pathway.

Keywords Saccharomyces cerevisiae · Protein phosphatase · PTP2 · MSG5 · Calcium sensitivity · Delayed G1

AbbreviationsPPase Protein phosphataseMAPK Mitogen-activated protein kinaseCas Calcium sensitiveCWI Cell wall integrity

Introduction

In eukaryotic cells from humans to yeast, reversible phos-phorylation and dephosphorylation of regulatory factors,controls the majority of cellular pathways, including cellsignaling, cell cycle, and gene expression (Zolnierowiczand Bollen 2000). Target proteins are phosphorylated atspeciWc site(s) by one or more protein kinases (PKases),and speciWc protein phosphatases (PPases) remove thosephosphate residues. To understand the possible physiologi-cal roles of PPases, we constructed 30 �ppase disruptants(all but two essential PPase genes) while to study the redun-dant functions of these PPases, 435 double disruptants cov-ering all possible combinations of the 30 viable genedisruptions were constructed (Sakumoto et al. 1999, 2002).We discovered that the �ptp2 �msg5 double disruptant hada calcium sensitive (Cas)-phenotype, whereas the singledisruptant of either PTP2 or MSG5 did not (Sakumoto et al.2002). These phenotypes demonstrated that Ptp2p andMsg5p are involved in cellular processes triggered by cal-cium-stress response in a redundant manner. Both Ptp2pand Msg5p are classiWed into the PTP family, but they areclassiWed into diVerent sub-families. Ptp2p belongs to theprotein tyrosine phosphatase sub-family which dephospho-rylates tyrosine residues of a phosphorylated protein (Guanet al. 1992). Msg5p belongs to dual-speciWcity proteinphosphatases (DSPs) sub-family which dephosphorylatesboth threonine/serine and tyrosine residues (Doi et al.1994). Ptp2p has been known to be a negative regulator ofSlt2p of the cell wall integrity (CWI) pathway, the Hog1pof the high-osmolarity glycerol (HOG) MAPK sensingpathway and the Fus3p of the MAPK pheromone pathway.On the other hand, Msg5p inactivates both CWI MAPKand the Fus3p MAPK pheromone pathways (Mattison et al.1999; Gustin et al. 1998). Interestingly, Msg5p is inversely

Communicated by Axel Brakhage.

Hermansyah · M. Sugiyama · Y. Kaneko · S. Harashima (&)Department of Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871, Japane-mail: [email protected]

123

722 Arch Microbiol (2009) 191:721–733

regulated by Slt2p in the CWI pathway (Flandez et al.2004). The CWI MAPK cascade is comprised of Pkc1p andthree other PKases, i.e., Bck1p (MAPKKK), a pair ofredundant PKases Mkk1p/Mkk2p (MAPKK), and Slt2p(MAPK). Activation of these MAPKs needs to be con-trolled tightly and precisely because hyper-activation ofMAP kinases of the CWI pathway causes severe growthdefects (Martin et al. 2000).

Calcium-triggered signaling mechanisms regulate a widevariety of cellular processes, such as the response to matingpheromone (Muller et al. 2001) and the adaptation to envi-ronmental stress (Batiza et al. 1996; Denis and Cyert 2002).In an eVort to gain insight into the molecular mechanism bywhich Cas-phenotype is caused by the �ptp2 �msg5 doubledisruption we characterized the �ptp2 �msg5 double dis-ruptant in more detail. We found that the severe growthdefect of the �ptp2 �msg5 double disruptant in the pres-ence of Ca2+ occurs at the G1 phase and that CLN2 isdown-regulated and Slt2p is hyper-phosphorylated in thisstrain. Furthermore, the �ptp2 �msg5 double disruptioncaused fragmented vacuoles even when calcium levelswere not elevated. These observations suggest that, possi-bly through the known regulation of Slt2p, both PTP2 andMSG5 are involved in the G1 to S transition and in vacuolemorphogenesis.

Materials and methods

Yeast strains, plasmids, and culture conditions

Strains used in this study are described in Table 1. Yeaststrains SH5209 (=FY833) and SH5210 (=FY834) (Winstonet al. 1995) were used as a wild-type and parental strains.The rich medium YPAD was prepared by supplementingYPD broth (Sigma-Aldrich Co.) with 0.4 mg/ml adenine.SC medium consisted of 0.67% yeast nitrogen base withoutamino acids, 2% glucose and the required auxotrophic sup-plements. SPM medium contained 0.30% potassium ace-tate, 0.02% raYnose and was supplemented with 10 �g/mlof adenine, arginine, histidine, isoleucine, leucine, lysine,methionine, phenylalanine, threonine, tryptophan, uracil,

and valine. Unless indicated otherwise, yeast strains weregrown at 30°C. Plasmids were propagated in Escherichiacoli strain DH5� cultivated on LB-medium containing100 �g/ml ampicillin at 37°C. Plasmid pCgHIS3 (Sakum-oto et al. 1999; Kitada et al. 1995) carrying a 1.8-kbp frag-ment of the Candida glabrata HIS3 (CgHIS3) gene andp3005 constructed by subcloning a 1.7 kbp BamHI–XhoIfragment containing CgLEU2 (a kind gift from K. Kitada)into pT7Blue-T vector (Novagen) were used as template forthe PCR-ampliWcation of PTP2 and MSG5 disruption cas-settes.

Construction of yeast single and double disruptants

Single and double gene disruptants were constructed by tar-geted gene replacement, crossing and tetrad analysis asdescribed previously (Sakumoto et al. 1999, 2002). Disrup-tant �ptp2::CgHIS3 (SH6790) was generated by transfor-mation of SH5209 using a disruption cassette ampliWedfrom plasmid pCgHIS3 with primers Kf-PTP2 (5�-ATAACGGCAA TAGAATGGCT TCTTCCGCTA TATCGGAAAA CACAGGAAAC AGCTATGACC-3�) and Kr-PTP2(5�-GTAGCAATAT ACTTGAAATC AGGATTAATTTGCGTGAGCT GTTGTAAAAC GACGGCCAGT-3�).Disruptant �msg5::CgLEU2 (SH6791) was constructedanalogously from SH5210 using a disruption cassette gen-erated with plasmid p3005 and primers Kf-MSG5 (5�-ACATCGATTT CAAGCCAAAC TCACCGCGTT CCTTACAAAA CACAGGAAAC AGCTAT GACC-3�) and Kr-MSG5 (5�-TCGTTGTCCA CAGAAGCTTC CAGTGAATCT GCGGGTTGAG GTTGTAAAAC GACGGCCAGT-3�). Correct disruption of PTP2 and MSG5 was veriWedby PCR using primers Kfc PTP2 (5�-CTC AAGCTTGGACACT CGTTTAATTTAGC CA-3�) and Krc-PTP2(5�-CTC AAGCTT ATTCGGTATT GGCACAAACT TT-3�), and Kfc-MSG5 (5�-CTC GGATCC GTAGTGATGGATAATGTGAT TT-3�) and Krc-MSG5 (5�-CTCGGATCC GTGCCCATGG TAATTTTTGA CG-3�),respectively. The double disruptant �ptp2 �msg5 (SH6793)was isolated by tetrad analysis of the diploid strain resultingfrom the cross of �ptp2::CgHIS3 (SH6790) with�msg5::CgLEU2 (SH6791) (Sherman and Hicks 1991).

Table 1 Strains used in this study

a NBRP/YGRC, National BioResource Project/Yeast Genetic Research Center, Japan (http://yeast.lab.nig.ac.jp/nig/index_en.html)

Strains Genotype Source

SH5209 MATa ura3-52 his3�200 leu2�1 lys2�202 trp1�63 NBRP, YGRCa

SH5210 MAT� ura3-52 his3�200 leu2�1 lys2�202 trp1�63 NBRP, YGRCa

SH6790 MATa �ptp2::CgHIS3 ura3-52 his3�200 leu2�1 lys2�202 trp1�63 SH5209 disruptant

SH6791 MAT� �msg5::CgLEU2 ura3-52 his3�200 leu2�1 lys2�202 trp1�63 SH5210 disruptant

SH6793 MATa �ptp2::CgHIS3 �msg5::CgLEU2 ura3-52 his3�200 leu2�1 lys2�202 trp1�63 SH6790 £ SH6791

123

http://yeast.lab.nig.ac.jp/nig/index_en.html

Arch Microbiol (2009) 191:721–733 723

Spot assay of salt sensitivity

From yeast cells grown in YPAD medium to mid logarith-mic phase, suspensions containing equal cell-numbers wereprepared on the basis of OD660 and 10-fold serial dilutionswere spotted onto YPAD plates supplemented with 0.6 Msalt (either CaCl2, KCl, NaCl, MgCl2, or LiCl) that wereincubated for 1–2 days.

Synchronization of cell cycle

Cells grown in YPAD with or without 0.3 M CaCl2 to midlogarithmic phase were arrested in G1 phase by exposure to20 �g/ml �-factor (Sigma) for 3–4 h, after which cells werewashed Wve times with YPAD and transferred into freshmedium. At least 200 cells were counted to determine thepercentage of budded cells, which was repeated at 15, 30,and 45 min after release from the �-factor arrest.

Fluorescent-activated cell sorting (FACS) analysis

A 0.25 ml aliquot of yeast cells (OD660 = 1.0) grown inYPAD with or without 0.3 M CaCl2 media was harvestedby centrifugation, and, after being resuspended by gentlevortexing, Wxed with cold ethanol (¡20°C) for at least 12 h.Cells were pelleted and resuspended in the dark with 300 �lof 0.2 M Tris–HCl (pH 7.5) with 100 �g/ml propidiumiodide, and then subjected to FACS analysis (Epix XL,Beckman Coulter) as described (Haase and Lew 1997).

DNA microarray analysis

The yeast DNA microarray used was in Toray IndustrialInc. (Kanagawa, Japan) and the experiment was carried outaccording to the manufacturer’s instruction. BrieXy, RNAwas isolated by the hot phenol methods (Ausubel et al.1989), cDNA was synthesized and puriWed with AminoAllyl MessageAmpTMII aRNA ampliWcation kit (Ambion,Applied Biosystems) and labeled with Cy3-dUTP or Cy5-dUTP (Amersham Bioscience) for hybridization with theDNA microarray. The Xuorescence intensities of Cy3 andCy5 were scanned with a microarray scanner (ScanArrayLite; Perkin Elmer).

Transcriptional analysis

RNA isolated by the hot phenol method (Ausubel et al.1989) was used for quantitative analysis of mRNA contentby real time (RT) PCR. First-strand cDNA was synthesizedusing a High Capacity cDNA Archive kit (Applied Biosys-tems) and used as the template for quantitative RT PCRwith a 7300 Real Time PCR system (Applied Biosystems)and primers KfRT-CLN2 (5�-TTACGGGACCAAGCC

AAATT-3�) and KrRT-CLN2 (5�-TTACAACCGCCCCAAGTT TTA-3�).

Vacuolar staining with FM4-64

Vacuoles were stained with FM4-64 as previouslydescribed (Vida and Emr 1995) with minor modiWcations.Cells grown in YPAD to an OD660 = 1.0 were concentrated20-fold in YPAD containing 40 �M FM4-64 (MolecularProbes™ Invitrogen) and incubated for 30 min at 4°C withshaking. The cells were harvested at 4°C, resuspended intofresh YPAD to an OD660 = 10, and incubated at 30°C withvigorous shaking for 60 min. These cells were centrifuged,resuspended into fresh YPAD and immediately analyzedwith a Xuorescence microscope (BX61-34-FL-I-D, Olym-pus) using a MWIG2 (520–550 nm) Wlter (Olympus), CCDcamera (CCD-Exi, Molecular Devices) and MetaMorphversion 6.1 software (Molecular Devices).

Immunoblot analysis of (phosphorylated) Slt2p

For Western blot analysis, protein extracts were preparedusing trichloroaceticacid (TCA) (An et al. 2006) and frac-tionated on 10% SDS-PAGE. Proteins were transferred toPVDF Immobilon membrane (Millipore corporation) andprobed overnight at 4°C in the presence of 1% skim milk(Difco™) with either antiphospho-p44/42 MAPK (Thr202/Tyr204) (Cell Signaling Technology) or anti-Mpk1(yC-20):sc-6830 (Santa Cruz Biotechnology, Inc) antibodies at1:1,000 dilution to detect phosphorylated or total Slt2p,respectively. These primary antibodies were detected using1:10,000 diluted horseradish peroxidase-conjugated anti-rabbit or antigoat antibodies, respectively, and WesternLightning™ Chemiluminescence Reagent Plus (PerkinEl-mer LAS, Inc).

Results

�ptp2 �msg5 double disruptant displays delayed G1 to S transition

In a previous study, we discovered that double disruption ofPTP2 and MSG5 caused a Cas phenotype (Fig. 1a) (Sakum-oto et al. 2002). The �ptp2 �msg5 double disruptant, how-ever, is not sensitive to other cations (K+, Mg2+, Na+, andLi+), as this strain grew as wild-type on media containing0.6 M KCl, MgCl2, NaCl, or LiCl (Fig. 1b), suggesting thatPtp2p and Msg5p are speciWcally involved in Ca2+-inducedstress response in a redundant manner.

To investigate whether the �ptp2 �msg5 double disrup-tant exhibits growth arrest at any speciWc point of the cellcycle, particularly in the presence of exogenous Ca2+ we

123

724 Arch Microbiol (2009) 191:721–733

conducted FACS analysis. We found that growth progres-sion of the �ptp2 �msg5 double disruptant slowed down atthe G1 to S transition even in the absence of CaCl2, and thisdelay was pronounced in the presence of CaCl2 (Fig. 2a).Delay in G1 to S transition in the �ptp2 �msg5 double dis-ruptant was conWrmed by monitoring over time the percent-age of budded cells in cultures synchronized with �-factor,a natural cell cycle inhibitor of S. cerevisiae (Zarzov et al.1996) which arrests the cell cycle at G1. After release fromthe �-factor arrest, the percentages of budded cells in theculture of the �ptp2 �msg5 double disruptant were 2- to2.5-fold lower in the presence of 0.3 M CaCl2 compared tothose in the wild type or in strains grown in the absence ofcalcium (Fig. 2b). We conclude that the double disruptionof PTP2 and MSG5 causes signiWcant retardation of G1 toS transition in the presence of a high external concentrationof CaCl2.

We noted that in the presence of 0.3 M Ca2+, the transcrip-tion of CLN2 was down-regulated signiWcantly in the �ptp2�msg5 double disruptant compared to that in the wild-typestrain. Out of more than 300 genes in which the transcriptionwas altered (Tables 2, 3) signiWcantly (transcription ratio ofgene in the �ptp2 �msg5/wild type is ¸2.0 or ·0.6), about228 ORFs had signiWcant increase or decrease in transcrip-tion in the �ptp2 �msg5 double disruptant, but not in single�ptp2 and �msg5 disruptant (Tables 2, 3).

Real-time RT-PCR analysis revealed that CLN2 wasdown-regulated 2-fold in the presence of 0.3 M Ca2+ in the�ptp2 �msg5 double disruptant. An increase in the concen-tration of Ca2+ to 0.6 M resulted in an approximately 4-fold

decrease of CLN2 levels (Fig. 2c), suggesting that higherexogenous Ca2+ concentrations cause a more severe down-regulation of CLN2 in the absence of Ptp2p and Msg5p.

�ptp2 �msg5 double disruption increases expression of Slt2p and also leads to hyper-activation of the Slt2 pathway

Over-expression of PTP2 and MSG5 is known to suppressthe growth defect caused by hyper-activation of the Slt2pathway (Mattison et al. 1999; Watanabe et al. 1995). Thisis expected because Ptp2p and Msg5p are negative regula-tors for the Slt2 pathway (Flandez et al. 2004; Martin et al.2000). These reports motivated us to investigate theinvolvement of the Slt2 pathway in the defective growth ofthe �ptp2 �msg5 double disruptant in the presence of exog-enous Ca2+ although DNA microarray analysis revealedthat transcriptional level of SLT2 had no signiWcant alter-ation in the �ptp2 �msg5 double disruptant. This resultsuggested that Ptp2p and Msg5p may regulate the Slt2pathway at the post-transcriptional level. However, itsmolecular mechanism still remains to be elucidated.

Therefore, we determined the level of Slt2p by perform-ing immunoblot analysis using two kinds of antibodies oneof which distinctively detects the phosphorylated form ofSlt2p and the other detects Slt2p irrespective of its phos-phorylation status. Results showed that phosphorylatedSlt2p was induced in the wild-type, the single �ptp2 and�msg5 disruptants, and the �ptp2 �msg5 double disruptantby addition of Ca2+ (Fig. 2d), indicating that 0.3 M Ca2+

Fig. 1 Calcium sensitivity of the �ptp2 �msg5 double disrup-tant. a Streak test. Cells of the wild-type strain (SH5209), �ptp2 (SH6790), �msg5 (SH6791), and the �ptp2 �msg5 double disruptant (SH6793) were streaked on a YPAD plate containing 0.6 M CaCl2 and incubated at 30°C for 2 days. b Spot test for sensitivity to various cations. Ten-fold serial dilutions of wild type (SH5209), �ptp2 (SH6790), �msg5 (SH6791), and �ptp2 �msg5 (SH6793) were spotted on YPAD plates containing 0.6 M CaCl2, KCl, MgCl2, NaCl, or LiCl, and incubated at 30°C for 2 days

(A)Wild type∆ ptp2

∆ptp2 ∆msg5∆msg5

YPAD + 0.6M CaCl2

(B)

Wild type ptp2

msg5

ptp2 msg5

+ 0.6 M KCl

+ 0.6 M MgCl2 + 0.6 M NaCl + 0.6 M LiCl

+ 0.6 M CaCl2 YPAD

106 cells

∆∆

∆ ∆

123

Arch Microbiol (2009) 191:721–733 725

Fig. 2 EVect of high, exogenous concentration of Ca2+ on �ptp2�msg5 cell cycle. a FACS proWle of propidium iodide stained cells ofthe �ptp2 �msg5 double disruptant (SH6793) and wild-type strain(SH5209). Cells were cultivated in YPAD medium containing 0.3 MCaCl2 at 30°C to OD660 = 1.0 and subjected to FACS analysis. b Per-centage of bud emergence. Cells were grown to reach mid-log phaseand treated to arrest in G1 phase by addition of 20 �g/ml �-factor for3–4 h, then released into either YPAD with or without 0.3 M CaCl2. Atleast 200 cells were counted to estimate the percentage of budded cells.c Transcript levels of CLN2 in strains, wild type (SH5209), and �ptp2�msg5 (SH6793) cultivated in YPAD medium containing 0, 0.3, and

0.6 M CaCl2 as determined by real-time PCR analysis. d Detection ofSlt2p phosphorylation and expression levels. Top panel anti-phospho-Slt2p immunoblot analysis of wild type (SH5209), �ptp2 �msg5(SH6793), �ptp2 (SH6790), �msg5 (SH6791), and �slt2. Proteins ex-tracted from cells grown in media with or without 0.3 M CaCl2 to anOD660 = 1.0 at 30°C were separated on SDS-PAGE, and immunoblot-ted with anti-phospho-p44/42 MAPK (Thr202/Tyr204) antibody. Midpanel identical samples were used to detect total Slt2p by immunoblotwith anti-Mpk1p/Slt2p. Bottom lane panel identical samples were usedto detect actin by immunoblot with anti-actin antibody

(A) (B)

3040506070

Wild type (0 M CaCl2)

Wild type (0.3 M CaCl2)

∆ t 2 ∆ 5 (0 M C Cl )

-CaCl2 +CaCl2

Wild type

0102030

0 10 20 30 40 50

Minutes

% b

udde

d ce

lls

p p2 ∆ msg a 2

∆ptp2∆msg5 (0.3 M CaCl2)

1C 2C 1C 2C

(C)∆ptp2 ∆msg5

0 8

1

1.2

1.4

tive

toA

CT

1

1C 2C1C 2C0

0.2

0.4

0.6

.

NA

CL

N2

rela

t

∆ptp2∆msg5

(D)- + - + - + - + - +WT ∆ptp2∆msg5 ∆ptp2 ∆msg5 ∆slt2

0.3 M CaCl2

0 M CaCl2 0.3 M CaCl2 0.6 M CaCl2mR

Phospho-Slt2p

Slt2pSlt2p

Actin

Wild type

Table 2 The transcription of genes which increased signiW-cantly (transcriptional level ¸2.0) in the �ptp2 �msg5 double disruptant in the presence of 0.3 M Ca2+

ORF Gene Molecular function Expression level

YJL052W TDH1 Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity

2.0

YMR015C ERG5 C-22 sterol desaturase activity 2.0

YKR024C DBP7 ATP-dependent RNA helicase activity 2.0

YMR223W UBP8 Ubiquitin-speciWc protease activity 2.0

YDR096W GIS1 Transcription factor activity 2.0

YOR279C RFM1 Unfolded protein binding 2.0

YOL101C IZH4 Metal ion binding 2.0

YEL039C CYC7 Electron carrier activity 2.0

YKL025C PAN3 Poly(A)-speciWc ribonuclease activity 2.0

YGR060W ERG25 C-4 methylsterol oxidase activity 2.1

YDL131W LYS21 Homocitrate synthase activity 2.1

YHR011W DIA4 Serine-tRNA ligase activity 2.1

YPL254W HFI1 Transcription coactivator activity 2.1

YJR066W TOR1 Protein binding 2.1

123

726 Arch Microbiol (2009) 191:721–733

Table 2 continued ORF Gene Molecular function Expressionlevel

YOL115W PAP2 Polynucleotide adenylyltransferase activity 2.1

YBR041W FAT1 Long-chain-fatty-acid-CoA ligase activity 2.1

YOL091W SPO21 Structural molecule activity 2.1

YJL157C FAR1 Cyclin-dependent protein kinase inhibitor activity 2.1

YDL181W INH1 Enzyme inhibitor activity 2.1

YOR208W PTP2 Protein tyrosine phosphatase activity 2.1

YNL126W SPC98 Structural constituent of cytoskeleton 2.1

YML065W ORC1 ATPase activity 2.1

YJL127C SPT10 Histone acetyltransferase activity 2.1

YDR508C GNP1 Amino acid transporter activity 2.1

YBR006W UGA2 Succinate-semialdehyde dehydrogenase [NAD(P) +] activity 2.1

YHR052W CIC1 Protein binding, bridging 2.1

YJL125C GCD14 tRNA (adenine-N1-)-methyltransferase activity 2.1

YBR021W FUR4 Uracil permease activity 2.1

YKL005C BYE1 Transcriptional elongation regulator activity 2.2

YLR300W EXG1 Glucan 1,3-beta-glucosidase activity 2.2

YOL145C CTR9 RNA polymerase II transcription elongation factor activity

2.2

YPL088W – Aryl-alcohol dehydrogenase activity 2.2

YMR294W JNM1 Structural constituent of cytoskeleton 2.2

YKL148C SDH1 Succinate dehydrogenase (ubiquinone) activity 2.2

YCR093W CDC39 3�–5�-exoribonuclease activity 2.2

YJR043C POL32 Delta DNA polymerase activity 2.2

YPL095C EEB1 Hydrolase activity, acting on ester bonds 2.2

YPL280W HSP32 Unfolded protein binding 2.2

YGR129W SYF2 RNA splicing factor activity, transesteriWcation mechanism

2.2

YJR156C THI11 Protein binding 2.2

YBR180W DTR1 Multidrug transporter activity 2.2

YBR034C HMT1 Protein-arginine N-methyltransferase activity 2.3

YKL194C MST1 Threonine-tRNA ligase activity 2.3

YNL275W BOR1 Anion transporter activity 2.3

YNL192W CHS1 Chitin synthase activity 2.3

YER075C PTP3 Protein tyrosine phosphatase activity 2.3

Q0080 ATP8 Hydrogen-transporting ATP synthase activity, rotational mechanism

2.3

YPL146C NOP53 rRNA binding 2.3

YJL071W ARG2 Amino-acid N-acetyltransferase activity 2.3

YEL004W YEA4 UDP-N-acetylglucosamine transporter activity 2.4

YOR180C DCI1 Dodecenoyl-CoA delta-isomerase activity 2.4

YJL098W SAP185 Protein serine/threonine phosphatase activity 2.4

YBR106W PHO88 Phosphate transporter activity 2.4

YDR297W SUR2 Sphingosine hydroxylase activity 2.4

YOR348C PUT4 L-proline permease activity 2.5

YML130C ERO1 Electron carrier activity 2.5

YLR222C UTP13 snoRNA binding 2.5

YOR330C MIP1 Gamma DNA-directed DNA polymerase activity 2.5

YOR100C CRC1 Carnitine:acyl carnitine antiporter activity 2.5

123

Arch Microbiol (2009) 191:721–733 727

Table 2 continued ORF Gene Molecular function Expression level

YEL003W GIM4 Tubulin binding 2.5

YGR184C UBR1 Ubiquitin-protein ligase activity 2.5

YNL180C RHO5 GTPase activity 2.5

YOR032C HMS1 Transcription factor activity 2.5

Q0250 COX2 Cytochrome-c oxidase activity 2.6

YBR158W AMN1 Protein binding 2.7

YNL065W AQR1 Monocarboxylic acid transporter activity 2.7

YMR192W GYL1 Protein binding 2.7

YDR218C SPR28 Structural constituent of cytoskeleton 2.7

YKL216W URA1 Dihydroorotate dehydrogenase activity 2.9

YNL117W MLS1 Malate synthase activity 2.9

YOL136C PFK27 6-Phosphofructo-2-kinase activity 2.9

YOL126C MDH2 L-malate dehydrogenase activity 3.0

Q0050 AI1 Endonuclease activity 3.1

YPR186C PZF1 RNA polymerase III transcription factor activity 3.1

YJR159W SOR1 L-iditol 2-dehydrogenase activity 3.4

YDR243C PRP28 RNA splicing factor activity, transesteriWcation mechanism

3.6

YMR028W TAP42 Protein binding 3.7

YGL028C SCW11 Glucan 1,3-beta-glucosidase activity 3.8

YGL209W MIG2 SpeciWc RNA polymerase II transcription factor activity 3.9

YML091C RPM2 Ribonuclease P activity 4.0

YNL181W – Oxidoreductase activity 4.0

YKR034W DAL80 Transcription factor activity 4.6

YKR103W NFT1 ATPase activity, coupled to transmembrane movement of substances

5.3

YKR039W GAP1 L-proline permease activity 5.4

YOL152W FRE7 Ferric-chelate reductase activity 6.9

YFR012W – Molecular function unknown 2.0

YDR482C CWC21 Molecular function unknown 2.0

YGL057C – Molecular function unknown 2.0

YDR381C-A – Molecular function unknown 2.0

YER044C-A MEI4 Molecular function unknown 2.0

YJR122W CAF17 Molecular function unknown 2.1

YHL039W – Molecular function unknown 2.1

YMR018W – Molecular function unknown 2.1

YNL334C SNO2 Molecular function unknown 2.1

YPR030W CSR2 Molecular function unknown 2.1

YGR168C – Molecular function unknown 2.1

YJR082C EAF6 Molecular function unknown 2.1

YOR287C – Molecular function unknown 2.1

YBR272C HSM3 Molecular function unknown 2.1

YJR119C – Molecular function unknown 2.1

YGR174C CBP4 Molecular function unknown 2.1


YOL019W – Molecular function unknown 2.1

YGL236C MTO1 Molecular function unknown 2.2

YJR083C ACF4 Molecular function unknown 2.2

123

728 Arch Microbiol (2009) 191:721–733

activates the Slt2 pathway, by enhancing Slt2p translationand phosphorylation, which has not been reported before.These observations suggest that the Cas delay of the G1 to Stransition of the �ptp2 �msg5 double disruptant, presum-ably caused by a decrease in CLN2 expression, is related tohyper-activation of the Slt2 pathway (Fig. 2a, d).

Double disruption of PTP2 and MSG5 causes a defect in vacuole morphology

The vacuole serves as a storage organelle for excess cal-cium and its defect leads to sensitivity to Ca2+ (HoVman-Sommer et al. 2005). We examined vacuole morphology of


YBL054W – Molecular function unknown 2.2

YNL146C-A – Molecular function unknown 2.2

YGL262W – Molecular function unknown 2.3

YMR075W RCO1 Molecular function unknown 2.3


YBR105C VID24 Molecular function unknown 2.3

YGL080W FMP37 Molecular function unknown 2.3

YJL052C-A – Molecular function unknown 2.4


YOL166W-A – Molecular function unknown 2.4

YNL146W – Molecular function unknown 2.4

YBR296C-A – Molecular function unknown 2.4

YOR020W-A – Molecular function unknown 2.5

YKL124W SSH4 Molecular function unknown 2.5

YPL192C PRM3 Molecular function unknown 2.5

YHR033W – Molecular function unknown 2.5

YHR175W-A – Molecular function unknown 2.6

YLR456W – Molecular function unknown 2.6

YML066C SMA2 Molecular function unknown 2.6

YMR052W FAR3 Molecular function unknown 2.6

YOR381W-A – Molecular function unknown 2.7

YDR532C – Molecular function unknown 2.8

YKR075C – Molecular function unknown 2.9


YIL070C MAM33 Molecular function unknown 2.9

YDR055W PST1 Molecular function unknown 3.1

YNL182C IPI3 Molecular function unknown 3.1

YAL063C-A – Molecular function unknown 3.2

YPL201C YIG1 Molecular function unknown 3.3

YNR071C – Molecular function unknown 3.3

YJL193W – Molecular function unknown 3.3

YHR214C-E – Molecular function unknown 3.4

YBR184W – Molecular function unknown 3.7


YGL169W SUA5 Molecular function unknown 4.2

YGL188C-A – Molecular function unknown 5.0

YOL019W-A – Molecular function unknown 5.6

YGR035C – Molecular function unknown 6.7

YAR061W – Molecular function unknown 6.8

YDR034C-D Molecular function unknown 4.7

YOR068C VAM10 Molecular function unknown 8.1

Expression level is ratio of gene expression in the �ptp2 �msg5/in wild-type strain

123

Arch Microbiol (2009) 191:721–733 729

Table 3 The transcription of genes which decreased signiW-cantly (transcriptional level · 0.6) in the �ptp2 �msg5 double disruptant in the presence of 0.3 M Ca2+

ORF Gene Molecular function Expression level

YDR210W-B – Molecular function unknown 0.2

YLR157C-B – Molecular function unknown 0.2

YDR261C-D – Molecular function unknown 0.2

YDR380W ARO10 Pyruvate decarboxylase activity 0.3

YDR365W-B – Molecular function unknown 0.3

YLR234W TOP3 DNA topoisomerase type I activity 0.3

YAR009C – Molecular function unknown 0.3

YML117W NAB6 Molecular function unknown 0.3

YDR210C-D – Molecular function unknown 0.3

YBL101W-A – Molecular function unknown 0.3

YOR083W WHI5 Transcriptional repressor activity 0.4



YEL075C – Molecular function unknown 0.4

YFR015C GSY1 Glycogen (starch) synthase activity 0.4

YOL104C NDJ1 Telomeric DNA binding 0.4

YCR021C HSP30 Molecular function unknown 0.4

YLR154W-E – Molecular function unknown 0.4

YBR012W-B – Molecular function unknown 0.4

YDL059C RAD59 Protein binding 0.4

YBL005W-B – Molecular function unknown 0.4

YFL064C Molecular function unknown 0.4

YJL213W Molecular function unknown 0.4

YDR540C IRC4 Molecular function unknown 0.5

YJR153W PGU1 Polygalacturonase activity 0.5

YCR105W ADH7 Alcohol dehydrogenase (NADP+) activity 0.5

YLR045C STU2 Structural constituent of cytoskeleton 0.5

YIL166C Transporter activity 0.5

YNL029C KTR5 Mannosyltransferase activity 0.5

YLR154W-B – Molecular function unknown 0.5

YBL005W-A – Molecular function unknown 0.5

YBL111C – Molecular function unknown 0.5

YDL012C – Molecular function unknown 0.5

YCL064C CHA1 L-serine ammonia-lyase activity 0.5

YGR126W – Molecular function unknown 0.5

YHL049C – Molecular function unknown 0.5

YHL021C FMP12 Molecular function unknown 0.5

YJL165C HAL5 Protein kinase activity 0.5

YOR394C-A – Molecular function unknown 0.5


YBL113C – Helicase activity 0.5

YHR105W YPT35 Molecular function unknown 0.5

YIL152W – Molecular function unknown 0.5

YDR098C-B – Molecular function unknown 0.5

YER180C-A SLO1 Small GTPase regulator activity 0.5

YAL016C-B – Molecular function unknown 0.5

YCR068W ATG15 Lipase activity 0.5

123

730 Arch Microbiol (2009) 191:721–733

the �ptp2 �msg5 double disruptant by staining the vacuolarmembrane with FM4-64, a lypophilic styryl dye. Micro-scopic observation revealed that even in the absence ofCa2+ the vacuole of the �ptp2 �msg5 double disruptant wasfragmented, whereas that of either �ptp2 or �msg5 was not(Fig. 3). Consistent with this observation, single �ptp2 and�msg5 disruptants were not among the genes with a vacuo-lar fragmentation phenotype listed in a previous systematicstudy of a S. cerevisiae single-gene knock-out collection(Seeley et al. 2002). These observations suggest that thereis a relationship between redundant activities of Ptp2p andMsg5p and vacuole fragmentation. A fragmented vacuolewas also observed in wild-type cells in the presence of

0.2 M Ca2+ (Kellermayer et al. 2003) and strains with muta-tions causing fragmented vacuoles under normal growthconditions became sensitive to high extracellular calciumconcentrations (Kellermayer et al. 2003; Kane 2006).Therefore, the abnormal morphology of the vacuole of the�ptp2 �msg5 double disruptant contributes to its Cas-phe-notype.

Discussion

Ptp2p and Msg5p are known to negatively regulate theMAPK Slt2 pathway (Mattison et al. 1999; Flandez et al.


YMR153W NUP53 Structural molecule activity 0.6

YOR216C RUD3 Molecular function unknown 0.6

YEL019C MMS21 SUMO ligase activity 0.6

YFL047W RGD2 Rho GTPase activator activity 0.6

YKL187C – Molecular function unknown 0.6

YML010W SPT5 RNA polymerase II transcription elongation factor activity 0.6

YOL016C CMK2 Calcium- and calmodulin-dependent protein kinase activity 0.6

YOL067C RTG1 Transcription coactivator activity 0.6

YER153C PET122 Translation regulator activity 0.6

YDL220C CDC13 Single-stranded dna binding 0.6

YGR136W LSB1 Molecular function unknown 0.6

YPL233W NSL1 Molecular function unknown 0.6

YLL052C AQY2 Water channel activity 0.6

YLR132C – Molecular function unknown 0.6

YLR106C MDN1 ATPase activity 0.6

YGL137W SEC27 Molecular function unknown 0.6

YMR273C ZDS1 Protein binding 0.6

YGL061C DUO1 Structural constituent of cytoskeleton 0.6

YIL149C MLP2 Ribonucleoprotein binding 0.6

YIR041W PAU15 Molecular function unknown 0.6

YIL137C TMA108 Metalloendopeptidase activity 0.6

YPL256C CLN2 Cyclin-dependent protein kinase regulator activity 0.6

YBL029C-A – Molecular function unknown 0.6

YIL078W THS1 Threonine-tRNA ligase activity 0.6

YIR039C YPS6 Aspartic-type endopeptidase activity 0.6

YFR034C PHO4 Transcription factor activity 0.6

YJL059W YHC3 Basic amino acid transporter activity 0.6

YPR013C – Molecular function unknown 0.6

YKR011C – Molecular function unknown 0.6

YNR003C RPC34 DNA-directed RNA polymerase activity 0.6

YOR385W – Molecular function unknown 0.6

YCR104W PAU3 Molecular function unknown 0.6

YHR129C ARP1 Structural constituent of cytoskeleton 0.6

YNL088W TOP2 DNA topoisomerase (ATP-hydrolyzing) activity 0.6

YLL053C – Molecular function unknown 0.6

YGR013W SNU71 RNA binding 0.6

Expression level is ratio of gene expression in the �ptp2 �msg5/in wild-type strain

123

Arch Microbiol (2009) 191:721–733 731

2004), which is activated during G1 to S transition concom-itant with bud emergence (Zarzov et al. 1996). InS. cerevisiae, G1 cyclins (CLN1, CLN2, and CLN3) play anessential role to activate Cdc28p, the primary cyclin-depen-dent kinase (CDK) that controls cell cycle progression andis required for G1 to S progression (Wittenberg et al. 1990).Cln2p disruption has been suggested to cause a delay of theG1–S transition (Queralt and Igual 2004); Mizunuma et al.2005) and although all three cyclins function in a redundantmanner (Huang et al. 1997), it seems that the strong G1–Stransition delay observed in the �ptp2 �msg5 double dis-ruptant in the presence of exogenous Ca2+ is caused bydown-regulation of CLN2.

Although higher Ca2+ concentration causes more severedelay in G1/S of the �ptp2 �msg5 double disruptant, slightG1/S delay is exhibited in the �ptp2 �msg5 double disrup-tant in the absence of Ca2+ also (Fig. 2a). On other hand, weobserved that the CLN2 expression was down-regulatedonly in the presence of Ca2+. This result indicates that Ca2+-induced CLN2 down-regulation was involved only in thepronounced delay in G1/S of the �ptp2 �msg5 double dis-ruptant. Furthermore, microarray analysis suggested thatother genes, such as FAR1 and FAR3 may be implicated inG1/S delay of the �ptp2 �msg5 double disruptant in thepresence of calcium. However, further study to elucidatethe detailed mechanism including identiWcation of other

genes that are involved in Cas phenotype of the �ptp2�msg5 double disruptant is currently underway.

On other hand, we found that disruption of PPases PTP2and MSG5 genes, either by themselves or in combination,caused induced phosphorylation of Slt2p compared to thewild-type strain in the presence of Ca2+. In the case of thedouble disruptant this phosphorylation was remarkablyenhanced and was detectable even in the absence of Ca2+,suggesting a synthetic eVect of both disruptions (Fig. 2d).We suppose that double disruption of the PTP2 and MSG5genes in combination with high concentration of Ca2+

strongly activated Slt2 pathway, leading to calcium sensi-tivity. It is known that Slt2p and Mlp1p positively regulatesa transcription factor SBF (Swi4p/Swi6p) which in turnactivates G1 cyclin genes including CLN2 (Madden et al.1997; Kim et al. 2008). However, we found in this studythat hyper-activation of Slt2p did not result in up- (Fig. 2c,d) but rather down-regulation of CLN2 in the �ptp2 �msg5double disruptant, suggesting a diVerent pathway by whichCLN2 expression was regulated in these circumstances. Thehyper-activation of Slt2p might reXect a situation in whichits initial function of dealing with high exogenous calciumlevels is not properly regulated by lack of the PPase activi-ties of Ptp2p and Msg5p, possibly establishing an constitu-tive cell-wall stress response that results in reduced budformation and growth retardation.

Fig. 3 Vacuole fragmentation in the �ptp2 �msg5 double dis-ruptant. Wild type (SH5209), �ptp2 (SH6790), �msg5 (SH6791), and �ptp2 �msg5 (SH6793) were stained with FM4-64 and photographed as described in the “Materials and methods”. Bar 5 �m

DIC FM4-64

Wild type

∆ptp2 ∆ msg5

∆ptp2

∆ msg5

123

732 Arch Microbiol (2009) 191:721–733

In conclusion, we propose that the Cas-phenotpe of the�ptp2 �msg5 double disruptant is caused by three diVerenteVects (Fig. 4) that could either reXect independent path-ways or be part of a single cascade; (a) In the presence ofCa2+ insuYcient activation of Cln2-Cdc28p complex medi-ated by down-regulation of Cln2p (Fig. 2c) results in adefect in G1 to S progression, (b) Ca2+-mediated and �ptp2�msg5 double disruption-mediated hyper-activation ofSlt2p (Fig. 2d) leads to a growth defect, and (c) fragmentedvacuoles (Fig. 3) disable the �ptp2 �msg5 double disrup-tant to tolerate high concentrations of exogenous Ca2+.How hyper-activation of Slt2p due to absence of PTP2 andMSG5 is linked to down-regulation of CLN2 and vacuolefragmentation awaits further analysis.

Acknowledgment This work was supported by a Grant-in-Aid forScientiWc Research B, 2007 to 2009, to S.H. from the Ministry of Edu-cation, Science, Sports and Culture of Japan.

References

An X, Zhang Z, Yang K, Huang M (2006) Cotransport of the heterodi-mer small subunit of the Saccharomyces cerevisiae ribonucleo-tide reductase between the nucleus and the cytoplasm. Genetics173:63–73

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, SmithJA, Struhl K (1989) Current protocols in molecular biology, vol2. Wiley, Boston

Batiza AF, Schulz T, Masson PH (1996) Yeast response to hypotonicshock with a calcium pulse. J Biol Chem 271:23357–23362

Denis V, Cyert MS (2002) Internal Ca2+ release in yeast is triggered byhypertonic shock and mediated by a TRP channel homologue.J Cell Biol 156:29–34

Doi K, Gartner A, Ammerer G, Errede B, Shinkawa H, Sugimoto K,Matsumoto K (1994) MSG5, a novel protein phosphatase pro-motes adaptation to pheromone response in S. cerevisiae. EMBOJ 13:61–70

Flandez M, Cosano IC, Nombela C, Martin H, Molina M (2004)Reciprocal regulation between Slt2 MAPK and isoforms of Msg5dual-speciWcity protein phosphatase modulates the yeast cellintegrity pathway. J Biol Chem 279:11027–11034

Guan KL, Deschenes RJ, Dixon JE (1992) Isolation and characteriza-tion of a second protein tyrosine phosphatase gene, PTP2, fromSaccharomyces cerevisiae. J Biol Chem 267:10024–10030

Gustin MC, Albertyn J, Alexander M, Davenport K (1998) MAP ki-nase pathways in the yeast Saccharomyces cerevisiae. MicrobiolMol Biol Rev 70:177–191

Haase SB, Lew DJ (1997) Flow cytomerotic analysis of DNA contentin budding yeast. Methods Enzymol 283:322–332

HoVman-Sommer M, Migdalski A, Rytka J, Kucharczyk R (2005)Multiple function of the vacuolar sorting protein Ccz1 in Saccha-romyces cerevisiae. Biochem Biophys Res Commun 329(1):197–204

Huang KN, Odinsky SA, Cross FR (1997) Structure-function analysisof the Saccharomyces cerevisiae G1 Cyclin Cln2. Mol Cel Biol17:4654–4666

Kane PM (2006) The where, when, and how of organelle acidiWcationby the yeast vacuolar H+-ATPase. Microbiol Mol Biol Rev70:177–191

Kellermayer R, Aiello DP, Miseta A, Bedwell DM (2003) Extracellu-lar Ca2+ sensing contributes to excess Ca2+ accumulation and vac-uolar fragmentation in a pmr1� mutant of S. cerevisiae. J Cell Sci116:1637–1646

Kim KY, Truman AW, Levin DE (2008) Yeast Mpk1 mitogen-acti-vated protein kinase actives transcription through Swi4/Swi6 by anoncatalytic mechanism that requires upstream signal. Mol CellBiol 28:2579–2589

Kitada K, Yamaguchi E, Arisawa M (1995) Cloning of the candidaglabrata TRP1 and HIS3 genes, and construction of their disrup-tant strains by sequential integrative transformation. Gene165:203–206

Madden K, Sheu YJ, Baetz K, Andrews B, Snyder M (1997) SBF cellcycle regulator as a target of the yeast PKC-MAP kinase pathway.Science 275:1781–1784

Martin H, Rodriguez-Pachon JM, Ruiz C, Nombela C, Molina M(2000) Regulatory mechanism for modulation of signalingthrough the cell integrity Slt2-mediated pathway in Saccharomy-ces cerevisiae. J Biol Chem 18:1511–1519

Mattison CP, Spencerm SS, Kresge KA, Lee J, Ota IM (1999) DiVer-ential regulation of the cell wall integrity mitogen-activated pro-tein kinase pathway in the budding yeast by the protein tyrosinephosphatase Ptp2 and Ptp3. Mol Cell Biol 19:7651–7660

Mizunuma M, Hirata D, Miyakawa T (2005) Implication of Pkc1p pro-tein kinase C in sustaining Cln2p level and polarized bud growthin response to calcium signaling in Saccharomyces cerevisiae.J Cell Sci 118:4219–4229

Muller EM, Locke EG, Cunningham KW (2001) DiVerential regula-tion of two Ca2+ inXux systems by pheromone signaling in Sac-charomyces cerevisiae. Genetics 159:1527–1538

Queralt E, Igual JC (2004) Functional distinction between Cln1p andCln2p cyclins in the control of the Saccharomyces cerevisiae mi-totic cycle. Genetics 168:129–140

Sakumoto N, Mukai Y, Uchida K, Kouchi T, Kuwajima J, NakagawaY, Sugioka S, Yamamoto E, Furuyama T, Mizubuchi H, OhsugiN, Sakuno T, Kikuchi K, Matsuoka I, Ogawa N, Kaneko Y,

Fig. 4 Model for the Cas-phenotype of the �ptp2�msg5 double dis-ruptant. PTP2 and MSG5 are involved in CLN2 transcription and vac-uole fusion positively and hyper-activation of Slt2 pathway negativelyin terms of calcium sensitivity/resistance. In the �ptp2 �msg5, CLN2transcription is down-regulated by Ca2+ (Fig. 2a, b, c). Both Ptp2p andMsg5p negatively regulate the Slt2 pathway, therefore the absence ofboth Ptp2p and Msg5p causes hyper-activation of Slt2 pathway, andthis hyperactivation of the Slt2 pathway with the addition of Ca2+ leadsto growth retardation (Fig. 2d). The �ptp2 �msg5 double disruptionalso causes vacuole fragmentation (Fig. 3) and cells with a fragmentedvacuole become calcium sensitive

Hyper-activation of Slt2 pathway

CLN2transcription

Vacuole fusion

G1-S transition Ca2+

Ca2+

Ca2+ sensitivity

Ptp2p Msg5p

Ca2+

123

Arch Microbiol (2009) 191:721–733 733

Harashima S (1999) A series of protein phosphatase gene disrup-tants in Saccharomyces cerevisiae. Yeast 15:1669–1679

Sakumoto N, Matsuoka I, Mukai Y, Ogawa N, Kaneko Y, HarashimaS (2002) A series of double disruptants for protein phosphatasegenes in Saccharomyces cerevisiae and their phenotypic analysis.Yeast 19:587–599

Seeley ES, Kato N, Margolis N, Wickner W, Eitzen G (2002) Genomicanalysis of homotypic vacuole fusion. Mol Bio Cell 13:782–794

Sherman F, Hicks J (1991) Micromanipulation and dissection of Asci.Methods Enzymol 194:21–37 Guide to yeast genetics and molec-ular biology

Vida TA, Emr SD (1995) A new stain for visualizing vacuolar mem-brane dynamics and endocytosis in yeast. J Cell Biol 128:779–792

Watanabe Y, Irie K, Matsumoto K (1995) Yeast RLM1 encodes aserum response factor-like protein that may function downstream

of the Mpk1 (Slt2) mitogen-activated protein kinase pathway.Mol Cell Biol 15:5740–5749

Winston F, Dollard C, Ricupero-Hovasse SL (1995) Construction of aset of convenient Saccharomyces cerevisiae strains that are iso-genic to S288C. Yeast 11:53–55

Wittenberg C, Sugimoto K, Reed SI (1990) G1-speciWc cyclins ofS. cerevisiae: cell cycle periodicity, regulation by mating phero-mone, and association with the p34CDC28 protein kinase. Cell62:225–237

Zarzov P, Mazzoni C, Mann C (1996) The SLT2 (MPK1) MAP kinaseis activated during periods of polarized cell growth in yeast.EMBO J 15:83–91

Zolnierowicz S, Bollen M (2000) Protein phosphorylation and proteinphosphatases. EMBO J 19:483–488

123

Fulltext Paper 1

Documents

Transcript of Fulltext Paper 1