Final Final Year TPrevalence of MDR Strains from the Touchscreen of Automated Teller Machinehesis...

7/23/2019 Final Final Year TPrevalence of MDR Strains from the Touchscreen of Automated Teller Machinehesis Akshi Nandini

http://slidepdf.com/reader/full/final-final-year-tprevalence-of-mdr-strains-from-the-touchscreen-of-automated 1/44

1

1. INTRODUCTION

Infectious diseases pose a major threat to human health and are the leading cause of death

worldwide (Cohen et al.; 2000; Avila et al .; 2008).An infection begins when a diseases

causing microorganism successfully colonizes by entering the body, growing and

multiplying. Infectious diseases are caused as a result of infection by pathogenic microbes

including species of bacteria, parasites, viruses or fungi. Communicable diseases like

tuberculosis is caused by a bacterial species of Mycobacterium tuberculosis, while infectious

diseases like AIDS and Aspergillosis are caused by Human immunovirus (HIV) and

Aspergillus species(Avila et al .,2008). Communicable diseases like diarrhoea, respiratory

tract infections and urinary tract infections commonly caused by Klebsiella spp., Esherichia

coli and Staphylococcus spp. are major disease burden in India (Roy et al., 2013).

Infectious diseases are transmissible and can be spread from one person to another or from an

animal to a person.The spread often happen via airborne viruses or bacteria, but also through

blood or other bodily fluid. It is transmitted through the contact with microorganisms and the

common carriers of the microorganisms that transmit the disease from one host to another

include humans, animals, food, water, surfaces and air.

A reservoir of infection is basically an environment in which the pathogen can be

permanently maintained and from which infection is transmitted to the defined target

population(Vianaet al., 2014) .It can be an animate or inanimate object on which pathogens

multiply and survive and is of great importance in the epidemiology of any bacterial disease

(Wayne et al ., 2002).Many epidemiological studies have confirmed that many contaminated

surfaces play a major role in the spread of infectious diseases. The reservoir plays a major

role in disease transmission and depending upon the pathogen, the reservoir can be humans,

animals or the environment.

Plant, soil and water mostly serve as a reservoir of infection for a variety of infectious

diseases .Most fungal pathogens live in soil and bacteria responsible for Legionnaire’s

disease lives inwater. Agents that cause tetanus, anthrax and botulism are also transmitted

through soil. Examples of environmentally transmitted pathogens exist for viruses, for

example avian influenza in water , parvovirus in faeces ,hanta virus in nesting material

;bacteria, for example bovine tuberculosis and fungi, for example Geomyces species.(Dobson,A et al., 2001; Frick et al., 2010)



2

Humans also prove to be very important carriers of infection, they have a tendency to pick up

microorganisms from environmental objects mostly by dermal contact and hand has been

shown to play a major role in the transmission of organisms(Nworie et al., 2012

).Hand serves as a very important vehicle for transmission of several microbes including the

Enterobactericeae family(Kapdi M et al., 2008). Moreover the microbial population of the

hand is extremely complex and variable, consisting of gram positive organisms like

Staphylococcus aureus or gram negative bacteria like Pseudomonas aeruginosa which may

survive on the hand for quite a period of time and may hence act as a reservoir or shelter of

infection (Nester EWet al., 2004).Studies have shown that even at low concentrations

Salmonella species and Escherichia coli can be transferred from hands to raw processed and

cooked foods(Humphreyet al., 1994; Rusinet al.,2002 ) .Staphylococcus aureus can cause

illness from pimples, boils to meningitis and is a close relative of MRSA (Methicillin

resistant Staphylococcus aureus).Studies also show that the main reservoir of Staphylococcus

aureus is the hand from where it is introduced into food during handling and preparation [15].

Pathogens live on fomites and epidemiological studies have shown that contaminated

surfaces are mainly responsible for infectious disease transmission (Hendleyet al.,

1997).Moreover these pathogens tend to persist on the environmental surfaces for quite sometime, ranging from a few hours to a few months. Hence cross infection between the microbes

and a host is equally established (Frenchet al., 2004; Hardyet al., 2006).Pathogenic bacteria

are most commonly found on nonporous surfaces like telephones, taps doorknobs etc, so

public utility devices like telephone booths, cell phones, ATMs, public restrooms are the

most common media for transmission of bacterial pathogens.

Bacteria from public restroom are of public health importance when they enter the body

through hand to mouth contact or hand to food contact (Nester et al., 2004).Sinks, toilet seats

and the floor are found to be the major reservoirs of the microbes. Studies show that infants

shed a lot of bacteria in their faeces and these are transmitted to another individual mainly

through improperly washed hands and hand washing is the primary line of defence to prevent

the spread of the disease (Dancer et al., 2007).However research shows that many people do

not wash their hands properly after using the restrooms, they tend to simply run water over

their hands without the use of soap. In recent years there have been outbreaks of SARS,

Salmonella etc. that could be transmitted through flushing toilet (Greedet al., 2006).Urinary



3

tract infections, diarrhoea, venereal diseases, SARS are among the most common diseases

spread through public restrooms.

Public telephone booths are another common media for spread of disease causing

microorganisms since they are constantly used by a wide range users .Studies have also

confirmed that the door knobs, the mouth piece, key pad harbour many microbes including

pathogens like S. epidermidis, S. aureus, S. alpha haemolyticus, E. faecalis, B. subtilis,

coryneforms , P. aeruginosa, E. coli and A. calcoaceticus (Mujkićet al., 2006).

Convenient hand held devices like mobile phones are found to be sources of infection. Many

mobile phone users do not have regard for their personal hygiene and the constant handling

of phones by users in all places and occasions makes phones an open array for microbes and

a breeding ground for potential pathogenic microbes and become a source of infection and

public health hazard. (Kapdiet al., 2008;Guranget al., 2008)

Studies have also proved computer keyboards and mouse to be highly contaminated by

microorganisms. The ability of a computer to act as fomites has been previously documented

in healthcare and hospital environment (Huber et al., 2005; Buers et al., 2000). In work place,

contamination of the office environment (including the computer keyboard and mouse) with

bacteria is also recognized (Hirsch et al., 2005).Since the computers are not cleaned ordisinfected on a regular basis the chance of transmission of the contaminating microbes is

potentially great (Enemuor et al., 2012).Several works also report that computer keyboards

and mouse showed positive for Streptococcus, Clostridium perfingens, Enterococcus,

Staphylococcus aureus and fungi.

The Automated teller machines (ATM) also serve as a vehicle for disease transmission since

they are most likely to be contaminated with various microorganisms due to vast dermal

contact (Nworie et al., 2012).According to a survey conducted, in India 95% of people prefer

modern channel to traditional mode of banking and 60% of the people use ATMs at least

once a week. Hence ATMs are also known as any time microbes , as ATM centres are usually

air conditioned and the cold and damp environment favours the growth of a wide range of

microorganisms from pathogens to harmless microbes.



4

There is a possibility that the ATMs may be contaminated with MDR strains of bacteria,

however very few works have been reported on the same .Hence our study was conducted to

find out the prevalence of Multi drug resistance strains on the touch screen of ATMs.

1.1 Antibiotics

Antibiotics are substances that kill or inhibit the growth of other microorganisms and are used

in the treatment of external or internal infections.Penicillin, the first antibiotic, was

discovered in 1929 by Sir Alexander Fleming. In 1939, penicillin was isolated by Ernst Chain

and Howard Florey and it was used to treat infections in the Second World War. New

antibiotics such as streptomycin, chloramphenicol and tetracycline etc. were introduced in

late 1940s and early 1950s and the age of antibiotics came into full being.

Most of the natural antibiotics are produced by eukaryotic moulds and spore forming

bacteria. Penicillium and Cephalosporium moulds produce beta-lactam antibiotics such as

penicillin and cephalosporin. They also produce the base molecule for development of

semisynthetic beta-lactam antibiotics like ampicillin and amoxicillin. Actinomycetes,

mainlyStreptomyces species produce tetracyclines, aminoglycosides, macrolides,

chloramphenicol and most other clinically useful antibiotics that are not beta-lactams. Bacillus

species, such as B.polymyxa and B.subtilis produce polypeptide antibiotics such as polymyxinand bacitracin. B.cereus produces zwittermicin.

Most of the microorganisms that produce antibiotics are resistant to the action of their own

antibiotic, although the organisms are affected by other antibiotics, and their antibiotic may

be effective against closely-related strains.

Antibiotics are classified according to site of action or mechanism, such as inhibitors of cell

wall synthesis (Penicillins, cephalosporins, vanomycin, carbapenems, aztreonam, polymycin

and bacitracin), protein synthesis inhibitors (Aminoglycosides, tetracyclines, macrolides,

chloramphenicol, and linezolid), DNA synthesis inhibitors (Fluoroquinolones),RNA

synthesis inhibitors (Rifampin), Mycolic Acid synthesis inhibitors(Isoniazid) and Folic Acid

synthesis inhibitors (Sulfonamides).

They can also be classified according to their spectrum of action. A broad spectrum antibiotic

is one that is affective against a wide range of disease causing bacteria and it acts against both

gram- negative and gram-positive bacteria. Few examples of broad spectrum antibiotics are:carbapenams, chloramphenicol, tetracyclines etc.Broad spectrum antibiotics are usually used

http://www.businessdictionary.com/definition/microorganism.html

http://oascentral.businessdictionary.com/RealMedia/ads/click_lx.ads/www.businessdictionary.com/businessdictionary/banking_standalone/391594120/Bottom/default/empty.gif/374e706872464e687a64634143793241?x

http://www.businessdictionary.com/definition/microorganism.html



5

prior to the formal identification of the causative bacteria and when there is a wide range of

possible illnesses and a potential serious illness would result if treatment is delayed. They are

also used for drug-resistant bacteria that do not respond to other, narrow spectrum antibiotics,

and in the case of superinfections, where there are multiple types of bacteria causing illness.

The narrow spectrum antibiotics on the other hand are effective against only specific families

of bacteria.An extended spectrum antibiotic is one, which as a result of chemical

modification, affects additional types of bacteria, usually those that are gram-negative. They

are fourth generation antibiotic that functions well in the presence of beta-lactamse.This

allows it to be affective against a number of gram-positive and gram-negative bacteria that

third generation antibiotics are not as good against.

Another way of classifying Antibiotics is according to their type of action – bactericidal, that

kills the bacteria and bacteriostatic, that inhibits the growth of bacteria.

1.2 Antibiotic Resistance

Antibiotic resistance is resistance of microorganisms to antibiotics to which it was originally

sensitive. The global spread of microbial resistance is a predominant reason why infectious

diseases have not been conquered. After acquiring antibiotic resistance microorganisms, are

able to survive after exposure to one or more antibiotics.It is a natural phenomenon.

According to laws of Darwinian evolution, use of antibiotics creates selection pressure on

microorganisms. The weak ones, i.e. the ones susceptible to antibiotics, die whereas the ones

that adapt and become resistant to it survive (Davies et al., 1996)

With each passing decade the bacteria that defy multiple antibiotics have become

increasingly common(Stuart B. Levy). The standard treatments become ineffective against

resistant organisms and infections persist increasing risk of spread to others.It increases the

cost of treatment and also the rate of morbidity and mortality from such diseases (Breathnach

et al., 1998).

Some level of antibiotic resistance occurs without human action. However the current higher

levels of emergence of resistant organisms is due to over use and abuse of antibiotics. The

unrestrained use of antibiotics in human health, agriculture and animal husbandry has played

a major role in increase of antibiotic resistant organisms worldwide.

http://en.wikipedia.org/wiki/Microorganism

http://en.wikipedia.org/wiki/Antibiotic

http://en.wikipedia.org/wiki/Antibiotic

http://en.wikipedia.org/wiki/Microorganism



6

When an antibiotic attacks a group of bacteria, cells that are highly susceptible to the

medicine will die. But cells that have resistance or have acquired resistance through mutation

or gene exchange will survive especially if too little drug is given. Thus the resistant cells

will survive and proliferate. Also when the antibiotic is attacking the pathogenic bacteria,

they also affect the benign bacteria in their path. Thus they eliminate drug susceptible

bystanders, which could otherwise limit the expansion of pathogens, and encourage the

growth of resistant bystanders. This becomes a problem when the growing population of

bystanders themselves become agents of disease and this also increases the reservoir of

resistance traits in the bacterial population.

A number of corrective measures can be taken to prevent the antibiotic resistance such as

prescribing antibiotics only when needed. Non-antibiotic therapies should be considered for

minor conditions. Also the causative pathogen should be identified before the beginning of

the therapy so that antibiotic targeted specifically to that microbe can be prescribed instead of

a broad spectrum antibiotic which may kill other non-pathogenic bystanders as well. When

antibiotics are prescribed for an infection, proper dosage should be taken and care must be

taken to ensure that the full course of antibiotic therapy is completed. Proper hand washing

also plays a role in curbing the spread of antibiotic resistance (Stuart B. Levy).

1.3 Multi Drug Resistance

Some organisms have even developed resistance to multiple drugs. This condition called

Multiple drug resistance (MDR) enables disease-causing microorganisms (bacteria, viruses,

fungi or parasites) to resist distinct antimicrobials, such as antibiotics, antifungal drugs,

antiviral medications, antiparasitic drugs etc targeted at eradicating the organism (Siegelet al.,

2006) Some common multidrug resistant organisms are:- Vanomycin-resistant

Enterococci(VRE),Methicillin resistant Staphylococcus aureus( MRSA),Extended spectrum

beta-lactamase(ESBL’s) producing gram-negative bacteria and Klebsiella pneumonia

carbapenemase(KPC) producing gram-negative bacteria.

There are two mechanisms by which multidrug resistance can be acquired in bacteria.

Bacteria can become multi drug resistant by accumulation of genes coding resistance to a

single drug on the R plasmid. This is achieved by mechanisms provided by integrons,

http://en.wikipedia.org/wiki/Antimicrobials

http://en.wikipedia.org/wiki/Antibiotics

http://en.wikipedia.org/wiki/Antifungal_drug

http://en.wikipedia.org/wiki/Antiviral_medication

http://en.wikipedia.org/w/index.php?title=Antiparasitic_drugs&action=edit&redlink=1

http://en.wikipedia.org/w/index.php?title=Antiparasitic_drugs&action=edit&redlink=1

http://en.wikipedia.org/wiki/Antiviral_medication

http://en.wikipedia.org/wiki/Antifungal_drug

http://en.wikipedia.org/wiki/Antibiotics

http://en.wikipedia.org/wiki/Antimicrobials



7

transposons and ISCR elements. These R plasmids are maintained well and often transferred

from cell to cell (Lewis et al., 2005).

Another mechanism of multidrug resistance in bacteria is active pumping out of drugs by

multidrug efflux pump. The RND(resistance-nodulation-division) superfamily pumps are

present in gram negative bacteria. They are usually coded by chromosomal genes and they

can pump out most of the antibiotics currently in use (Revet al., 2009).

Multidrug resistance can also be caused due to altered physiological states of the

bacteria.Some bacterial population can survive even at high antibiotic concentration. These

are known as the persister population and are genetically identical with the susceptible cell

(Lewis et al., 2005). The presence of persisters is a strategy whereby bacteria naturally

generate mixtures of phenotypically different populations, so that one of them can be

advantageous to a changing environmental demand (Dhar et al., 2007). Persisters limit the

efficacy of antibiotic therapy.

There is a continuing need to understand the mechanism of resistance as this may lead to

useful inhibitors of multidrug efflux pumps or to inhibitors of the R plasmid transfer process.

Various steps also need to be taken to prevent the further increase in multidrug resistant

bacteria. Because the usage of antibiotics was the cause of natural selection of these bacteria,

one logical conclusion is to minimize antibiotic usage. Also simultaneous administration of

more than one drug as is done with tuberculosis should be considered (Revet al., 2009).

1.4 Resistant pathogens found around the globe

Antibiotic resistance has become a growing problem globally. The appearance and spread of

bacteria that are resistant to most or all commonly available antibiotics has raised the

spectrum of untreatable bacterial infections. For example, methicillin resistant

Staphylococcus aureus (MRSA) that causes skin and wound infections is resistant to most

antibiotics including β- lactams (ampicillin, methicillin, oxacillin, cephalosporin,

carbapenems, etc. It was one of the earliest bacteria in which penicillin resistance was found.

By 1950s, almost half of Staphylococcus aureus strains became resistant to penicillin and by

1970s methicillin resistant Staphylococcus aureus (MRSA) also developed. Vancomysin was

developed to kill this superbug. By in 1996 the first case of vancomysin resistant



8

Staphylococcus aureus (VRSA) was reported. In 2000, another antibiotic, linezolid was

developed to combat both MRSA and VRSA but a year later linezolid resistant

Staphylococcus aureus was reported (Tsiodras et al., 2001).

Mycobacterium tuberculosis is another major pathogen which causes Tuberculosis in

humans. Streptomycin and isoniazid were the drugs used in the treatment of TB but it has

developed resistance to these drugs. Treatment regimen on TB includes a cocktail of anti-TB

drugs but multi drug resistance of Mycobacterium tuberculosisstillcompromisesthe TB

therapy. Strains resistant to four or more front line antibiotics called Extremely drug resistant

strains (XDR) have appeared recently (Shah et al., 2007; Sotgiu et al.,2009). Totally drug

resistant (TDR) strains have also been reported recently (Velayatiet al.,2009).

Another example is vancomycin resistant enterococci (VRE). Enterococci bacteria live in our

intestines and on our skin, usually without causing any problems. But if they become resistant

to antibiotics, they can cause serious infections like bloodstream infection(sepsis), urinary

infection, abscesses, wound infections, pneumonia and heart infections like meningitis or

endocarditis. To become vanomycin resistant, vanomycin-sensitive enterococci typically

obtain new DNA in the form of transposons or plasmids which encodes genes that confer

vanomycin resistance. There are only a few antibiotics that are able to treat it.Quinipristin-

dalfopristin, tigecycline and daptomycin still retain some activity against VRE. Linezolid is

effective only when given orally. However there have been reports suggesting resistance to

these antibiotics (Leavis et al., 2006). A new antibiotic molecule, Platensimycin has been

reported to be active against VRE and MRSA (Wang et al., 2006).

Another prevalent pathogen is Pseudomonas aeruginosa. It is highly persistent and can avoid

human immune system. Antipseudomonad beta-lactams, aminoglycosides, and

Fluoroquinolones are the drugs commonly used to cure the Pseudomonas

aeruginosainfection. But most of the MDR stains are resistant to these antibiotics(Reinhardt

et al., 2007). It is a concern for patients suffering from cystic fibrosis and it develops

resistance with the lengthy antibiotic treatment of cystic fibrosis patients (Horrevortset

al.,1990) Colistin has been reported to be active against MDR Pseudomonas

aeruginosa(Reinhardt et al., 2007).



9

Another pathogenic group of big concern is extended spectrum beta lactamase (ESBL)

producing gram-negative bacteriasuch as Escherichia coli, Salmonella enterica, and

Klebsiella pneumonia(Dahbi et al ., 2013).They produce beta-lactamases that are capable of

hydrolysing penicillins,broad spectrum cephalosporins and monobactams. Currently,

carbapenems such as imipenem and meropenem are the treatment of choice for serious

infections due to ESBL-producing organism, yet carbapenem-resistant isolates have been

reported (Pitout et al., 2008).

Klebsiella pneumoniae carbapenemase (KPC)-producing bacteria are a group of emerging,

highy drug-resistant Gram-negative bacilli. The best therapeutic approach to KPC-producing

organisms is yet to be defined: however common treatments are the polymyxins, tigecycline,

and aminoglycoside antibiotics.

The most common bacteria that make the enzyme, New Delhi metallo beta-lactamase (NDM-

1) are gram-negative Escherichia coli and Klebsiella pneumonia. This enzyme makes the

bacteria resistant to a broad range of beta-lactam antibiotics, which includes the carbapenem

family, which are a mainstay for the treatment of antibiotic-resistant bacterial infections.

http://en.wikipedia.org/wiki/Beta-lactamase#KPC_.28K._pneumoniae_carbapenemase.29_.28Class_A.29

http://en.wikipedia.org/wiki/Beta-lactamase#KPC_.28K._pneumoniae_carbapenemase.29_.28Class_A.29



10

MDR

ORGANISMS

AGENT RESERVOIR MODE OF

TRANSMISSION

COMMENTS

MRSA Methicillin-

resistant

S.aureus

Colonized and

infected patients.Colonized health

care workers.

Environment and

fomites.

Person to person

Health care worker’shands

Environment.

CA-MRSA

infections as mostoften present as

skin infections.

HA-MRSA- most

invasive

infections.

VISA

VRSA

Vanomycin-

intermediate/

resistant)

S.aureus

Colonized and

infected patients.

Colonized health

care workers.

Environment and

fomites.

Person to person

Health care worker’s

hands

Environment.

Prolonged

vancomycin use

is a risk factor.

VRE Vancomycin-

resistant

Enterococcus

faecalis or

faecium

Gastrointestinal,

Genitourinary

Environment

Person to person


hands

Environment.

Often multi-drug

resistant to

penicillins and

aminoglycosides

ESBL Extended -

spectrum beta

lactamase

producing gram

negative

bacteria

Gastrointestinal

Long term care

facility particular

concern as

reservoir for acute

care facilities.

Person to person


hands

Environment.

Important ESBL

gram negative

bacteria include

Klebsiella,

Pseudomonas,Ser

ratia.

MDRSP Multidrug –

resistant

S.pneumoniae

Nasopharynx Direct contact

Droplet spread

MDRSP is often

resistant to

penicillin,

erythromycin,

trimethroprim,

sulfamethoxazole,

fluoroquinolones

Table 1 :Examples of clinically relevant MDR organisms



11

1.5 Preventing the spread of antibiotic resistant pathogens

Preventing spread of antibiotic resistant pathogens a necessary step. A well-documented

approach to prevent transmission of antibiotic resistant pathogens in hospitals is through

active surveillance that involves testing of patients to detect the presence of antibiotic

resistant pathogens. This helps in identifying colonized patients. Early detection of the

reservoir can prevent spread as contact and droplet precaution can be taken and the patient

can be kept in an isolated ward (Jernigan et al., 1996).

Hand hygiene is another important measure that can prevent the transmission of multidrug

resistance as hand is often the responsible for transmission. Although hand hygiene will help

prevent transmission, it by itself will not result in control of antibiotic resistant pathogens

such as MRSA, VRE and VRSA.

Since excessive use of antibiotics is one of the major reasons of development of antibiotic

resistance, inappropriate and excessive use of antibiotic should be avoided. Also correct

dosage and duration of antibiotic therapy should be carried on (Kunin et al., 1973).But

limiting the antimicrobial use alone cannot control multi drug resistance. Care should be

taken to ensure that the infections and not contaminates that are treated, also using narrow

spectrum and not broad spectrum antibiotics for serious infections when the pathogen is not

known or other effective drugs are unavailable. The antimicrobial utilisation and local

susceptibility patterns should be studied. And should try to avoid excessive duration of

treatment. Strategies for influencing antimicrobial prescribing patterns should also be looked

in to.



12

2. REVIEW OF LITERATURE

According to the research paper by Nworie et al.,2013, ATMs are likely to be contaminated

by a number of microorganisms due to the large number of people using this facility on a

daily basis. They examined the metallic keypads of 20 ATMs for source of bacterial

contamination and the antibiogram of isolated organisms were identified. They found the

keypads contaminated with Staphylococcus aureus , Klebsiella and Escherichia coli.

Study bySaroja et al.,2013, involved collection of samples from ATM centres in Chennaiusing cotton swabs. Out of the 65 samples analysed, 27 were found to contain Escherichia

coli, 25 for Klebsiella , 8 for Shigella sp, and 6 for Vibrio sp. The obtained results were

confirmed by using Amplification of target genes Lac z and Lam b and were performed by

using Lac z and Lam b primers.

The potential infection risk originated from ATMs is the focus of the study by Tekerekoğlu et

al., 2012. Samples were collected from 100 ATMs from Malatya city. Antimicrobial

susceptibility of the pathogens was investigated .All devices were found positive for Bacillus

sp and coagulase negative Staphylococci (CNS) were isolated from nine devices.

Staphyloccocus aureus grew in two devices, where one of them was identified as methicillin

resistant (MRSA). Three devices were found positive for Escherichia coli.

A similar study was conducted by Mabel et al., 2013 involved collection of samples from

ATM centres in Madurai city, Tamil Nadu. A total of 200 samples (ATM button (50), screen

(50) and floor (50), user’s hands (20) from each location and direct plate exposure (20) in

ATM, and from ladies toilets (10)) were collected. Ten species of microorganisms:

Staphylococcus, Serratia, Escherichia, Klebsiella, Pseudomonas, and Salmonella,

Micrococcus, Mucor Fusarium and Aspergillus were found to contaminate the fingers of

people withdrawing cash from ATMs. Staphylococcus and fungal isolates such as Mucor,

Penicillin and Aspergillus were found on the ATM screens, floor as well as ATM keypads.

The results of Antibiogram study of bacteria showed that most of the organisms were

resistant.



13

According to study conducted by Chairman et al.,2011, surfaces of public utility devices are

likely to be contaminated by pathogenic organism. For the study, samples were collected

from public computers, ATMs, public telephone booths etc. The samples were found to

contain Salmonella typhi, Klebsiella pneumonia, Escherichia coli, Vibrio sp and

Staphylococcus aureus. These organisms were then tested for sensitivity to 6 types of

antibiotics and Escherichia coliwere observed to be resistant.

Identification and quantification of bacterial contamination on the surface of ATM counters

in Vellore was the aim of the study conducted by Chandrasekhar et al .Thirteen ATM

counters of different Banks were chosen for the study and sample was collected from ATM

surfaces such as door, touch screen and key pad. Staphylococcus aureus, Staphylococcus

epidermidis and Klebsiella pneumonia were the main isolates identified. Staphylococcus

aureus and Staphylococcus epidermidis was found to be resistant to penicillin and

ciprofloxacin. Klebsiella pneumoniae was found to be resistant to chloramphenicol.

A study conducted by Abban et al ., 2011, focuses on potential sources of food-borne pathogens present on ATM machines. Five automatic teller machines of three different banks,

situated on the University of Ghana main campus were used for the study. Seven species of

microorganisms: Aeromonas,Bacillus, Enterobacter, Escherichia, Klebsiella, Pseudomonas

and Salmonella, were isolated from keypad of ATMs.

Onuoha et al ., 2014 conducted a study to assess bacterial contamination of ATMs and public

health risk associated with the spread of infections from the ATMs in Ebonyi State, Nigeria.

The results of this study indicated that Automated Teller Machines were positive for the

presence Staphylococcus auerus 4 (28.57%), Coagulase-negative staphylococcus 3 (21.43%),

Streptococcus species 2 (14.29%), Pseudomonas species 1 (7.14%), Enterobacter species 1

(7.14%) and Escherichia coli 3 (21.43%). Staphylococcus. aureus, Streptoccus spp and P.

aeruginosa showed 68.75% resistance to the antibiotics, whilst E. coli (56.25%),

Enterobacter spp (50%) and CNS showed 18.75% susceptibility each.



14

A study conducted by Mujkic et al., 2013, focuses on the pathogens present on public

telephones. Sixty samples were collected from the area of Sarajevo and the microbes were

isolated and identified using microbiological, biochemical and serological methods. The

samples were found to be contaminated with Staphylococcus epidermis (73.3%), Bacillus

subtilis(40%), Pseudomonas aeruginosa(3.3%), Escherichia coli(1.67%), Acinetobacter

calcoaceticus(1.67%).

Microorganisms associated with public restrooms were investigated byAgbagwa et al., 2010.

Hundred samples were collected from sink taps, flush handles, ,toilet seats and door handles

in the University of Port Harcourt campus .The isolated bacteria that included Staphylococcus

sp(45%), Escherichia coli(26.25%), Pseudomonas sp(18.75%)and Streptococcus sp(45%)

were subjected to antibiotic sensitivity tests .The gram negative bacteria were found to show

more resistance to Ampicillin , Norfloxacin ,Ciprofloxacin and Floxacin, while the gram

negative bacteria showed more resistance Malidixic ,Ampicillin and Septrin.

The main aim of the study conducted by Yeh et al., 2011, was to screen for antibiotic

resistant Staphylococcus spp. in a public transportation system. A total of 70 samples were

collected from seven different areas in buses and trains from Portland, USA.A range of

pathogenic Staphylococcus species were isolated from the samples. Six different strains of

Staphylococcus species were identified. Eleven isolates were found to be sensitive to

Trimethoprim-sulfamethoxazole, vanomycin and tetracycline. Five isolates showed resistance

to ampicillin and penicillin and two isolates showed intermediate resistance to bacitracin.

A study was conducted by Famurewa et al., 2009 on isolation of bacteria from cell phones.

150 samples were collected from the cell phones of the volunteers in the university premises,

commercial centres, hospital personnel (doctors and nurses) and hospitalized patients. Out of

the 150 phones screened in this study, 124 showed bacterial growth. The isolated bacteria,

Escherichia coli (28.2%), Pseudomonas aeruginosa (22.6%), Klebsiella sp (14.5%), Serratia

sp (13.7), Staphylococcus aureus (12.9%) and Proteus vulgaris (8.1%) were subjected to



15

antibiotic sensitivity tests. It was found that all the isolates were resistant to more than three

antibiotics.

Bacterial contamination of mobile phones and their antimicrobial susceptibility pattern was

investigated in the study conducted by Tagoe et al ., 2011.Samples were collected from the

surfaces of 100 mobiles and all samples were found to show 100% bacterial contamination.

Bacteria isolates include Klebsiella pneumonia (10%), Staphylococcusaureus (4%),

Coagulase negative Staphylococci (15%), Pseudomonas aeruginosa (4%), Bacillus cereus

(23%), Proteus mirabilis (19%), Escherichia coli (8%), Streptocccus pneumonia( 10%),

Salmonella spp. (3%) and Shigella spp. (2%).The isolated bacteria showed complete

resistance to Ampicillin ,Penicillin, Cloxacillin and Cefuroxime. While Gentamycin (27.3%),

Cotrimoxazole (27.3%), Amikacin (14.3%) were the most effective bacteria.

Another similar study was conducted by Roy et al., 2013. This study focuses on isolation and

identification of bacteria from mobile phones of fish and animal handlers of Kashmir, India.

150 samples were collected from mobile phones of veterinarians, students (veterinary

sciences), laboratory attendants, shepherds, meat and fish handlers of Kashmir valley.96.66%

of the samples collected were found to harbour pathogenic bacteria. Escherichia coli,

Bacillus cereus, Proteus spp., Streptococcus spp., Staphylococcus spp., Klebsiella were

isolated from the mobile phones. All the isolates were found to be highly resistant to

Amoxycillin/ Clavulonic acid, Amoxycillin, Ampicillin and Gentamicin.

The effect of constant handling of public handsets by various users was studied in the work

done by Ekrakene et al ., 2007. Fifteen samples in total were collected from public call centers

along the Benin-Sapele Expressway. The major bacterial species isolated from the samples

included Staphylococcus aureus (60%), Bacillus subtilis(100%), Enterobacter aerogenes

(40%).Fungal isolates including Apergillis niger (100%) and Rhizopus spp(60%) were also

obtained from the samples.

Study conducted by Bhat et al., 2011also focuses on determining the incidence of bacterial

colonization on mobile phones of Healthcare workers. Out of the 204 samples screened, 201

samples showed bacterial growth. Coagulase negative Staphylococcus obtained from 154

samples was the most commonly isolated organism. The samples were also found to contain



16

isolates of Pseudomonas aeruginosa(43), Escherichia coli( 34),Methicillin sensitive

Staphylococcus aureus (29), Klebsiella pneumonia(16),Methicillin resistant Staphylococcus

aureus(10).Pathogens isolated also included Acinetobacter spp(12), Enterococcus

spp(10),Citrobacter spp(1) and Proteus spp(1).

A similar work was done by Arora et al., 2009, to study the microbial population on cell

phones belonging to do doctors, paramedical staff working at governments, medical college

and hospitals. Samples were collected from 160 cell phones. Bacterial growth was obtained

on 65 mobile phones ,out of the total number of organisms isolated, coagulase negative

Staphylococcus(27) was the most common followed by Staphylococcus aureus(22) and

Escherichia coli (15).Species of Klebsiella(7), Micrococcus (7), Bacillus (5) , Acinetobacter (2)

and Citrobacter (1) were also isolated from the samples.

Isolation and identification of microbes present on computer keyboards and mouse was of

primary focus in the study carried out by Kumar et al., 2012 .Fifty samples were collected

from five computer labs in Himachal Institutes Paonta Sahib. Five bacterial isolates were

identified, which included Staphylococcus aureus,Staphylococcus epidermis, Micrococcus

sp, Streptococcus sp and Escherichia coli.

According to the study conducted by Eltablawy et al., 2009 , computer keyboards and mouse

are likely to be contaminated by pathogenic microorganisms. For this study, samples were

collected from 24 computers (keyboard and mouse). All the tested computer mouse and

keyboard were found positive for microbial contamination. The isolated pathogens which

included Bacillus cereus (60% susceptible and 10% resistant); Pseudomonas putida (90%

susceptible and 10% resistant) and Escherichia tarda (90% susceptible and 0% resistant)

were tested against the 10 different antibiotics.

The aim of the study by Tagoe et al ., 2010, was to investigate and compare the level, types

and antibiotic susceptibility of bacterial contaminants of keyboards and mice in general

offices and internet cafés. A total of 100 samples were collected for the study. All surfaces of

keyboard and mice were contaminated. Eight (8) different bacteria were isolated from the

samples of which seven (7) were pathogenic ( Bacillus cereus, P. mirabilis, K. pneumonia, S.

aureus, E. coli, S. pneumoniae, Enterococcus spp) and one, Coagulase Negative

Staphylococcus was non-pathogenic.



17

In a study conducted by Kassem et al ., 2007, it was determined that computer keyboards used

by students of a metropolitan university are reservoirs ofantibiotic-resistant staphylococci. 24

computer keyboards in three, open-access, student computer facilities were sampled for

bacteria. Of the 24 keyboards surveyed, 17 were contaminated with staphylococci that grew

in the presence of oxacillin (2mgl_1). Methicillin (oxacillin)-resistant Staphylococcus aureus

(MRSA), -S. epidermidis (MRSE) and -S. hominis (MRSH) were present on two, five and

two keyboards, respectively, while all three staphylococci co-contaminated one keyboard.

Microbial contamination of laptop or keyboards in dental settings was investigated by

Anjumn et al ., 2011. Specimens were collected from 25 laptops that were located in the

clinical section of a dental college in Andra Pradesh, India. The laptops selected were those

which were in use for a minimum period of one year and above.Potential pathogens were

cultured from more than 80% of the computers which included coagulase-negative

staphylococci (88% of keyboards), diphtheroids (80% of keyboards), Micrococcus species

(40% of keyboards), and Bacillus species (60% of keyboards), Oxacillin Resistant

Staphylococcus Aureus (ORSA) (8% of keyboards), Oxacillin Susceptible Staphylococcus

Aureus (OSSA) (4% of keyboards), vancomycin-susceptible Enterococcus species (16% of

keyboards), Streptococci (29% of keyboards) and Aspergillus (36% of keyboards).

In a study carried out by Anderson et al ., 2009, the keyboards of multiple-user (student) and

single-user (staff) computers located on a Hawthorn campus of Swinburne University of

Technology in Melbourne, Australia, were sampled to assess microbial contamination. Ten

keyboards were sampled at random from 3 separate multiple-user student computer

laboratories. The samples were collected at least at least 12 hours after the laboratories were

last occupied by students. Five single-user computer keyboards (located in staff offices) were

also sampled. All computers had been in use for a period of 1 to 3 years. The average number

of microorganisms present as well as the number of potential pathogens present was found to

be more on multiple-user computer keyboards than on single-user keyboards. They

isolatedStaphylococcus aureus, Escherichia coli and Enterococcus faecalis. The isolation of

Bacillus cereus, a common soil bacterium, is evidence of environmental contamination.



18

The presence of pathogenic bacteria in different public environmental sites in Mecca City

was the reported in a study conducted by Ashgar et al ., 2012. Samples were collected

fromshopping trolleys in supermarkets, the handles of the doors of ATM, refrigerated water

taps in the streets. Samples were also collected from mike, pens and keyboards in the public

halls; and from surface of cans of carbonated drinks. Bacillus spp. recorded the highest

percentage as compared to other isolated bacteria. Acinetobacter haemolyticus, Morganella

morganii, multidrug resistant Pseudomonas aeruginosa, E. coli, Enterobacter aerogenes and

Citrobacter freundii were also isolated from the environmental sites.

Chimezie et al ., 2013, carried out bacteriological examination of computer keyboards and

mouse and their susceptibility pattern to disinfectants. Samples were collected from surfaces

of 250 computer keyboards and mouse. It was found that all the tested computer keyboards

and mouse devices, were positive for microbial contamination. They isolated Staphylococcus

spp., Escherichia spp., Pseudomonas spp. and Bacillus spp from these computer keyboards

and mouse. The isolated bacteria were tested against the 6 different disinfectants (Dettol, Isol,

Izal, JIK, Purit and Septol®). The overall result of this study showed that Dettol®, followed

by JIK® was highly effective against all the bacterial isolates tested while Septol and Izal®

were least effective. Isol and Purit® showed moderate antibacterial effects.

The study carried out by Oluduro et al., 2011 was conducted to assess the bacterial

contaminants associated with open access user interfaces (mouse, computer keyboards,

ATMs) in various establishments in the town of Ile-Ife , Nigeria. A total of 313 swab samples

were collected from various interfaces. A number of 669 samples comprising of 11 distinct

bacterial species were isolated. The isolates included Aerococcus viridians(9.4%), Bacillus

spp. (8.4%), Enterobacter aerogenes (4.9%), Gaffkya tetragena (2.1%), Klebsiella

pneumoniae (11.1%), Micrococcus luteus (10.9%), Moraxella catarrhalis (1.6%), Proteus

spp. (10.6%), Pseudomonas aeruginosa (16.0%), Staphylococcus aureus (16.7%) and

Staphylococcus epidermidis (8.2%). The Antibiogram indicated that most isolates were found

to be resistant to Amoxicillin,Augmentin,Nitrofurantoin and Ceftriazone and multiple

antibiotic resistance was observed in 89.1% of the bacterial isolates.

Bacterial contamination of computer keyboards and mouse devices was reported in the study

undertaken by Chukwudi et al., 2013.A total number of 250 samples were collected from the

surfaces of computer keyboards and mouse devices from cyber cafes of three campuses



19

(Presco ,CAS ,Ishieke).158 bacterial isolates were identified which included Staphylococcus

spp.(63), Bacillus spp.(11), Escherichia spp.(47), Pseudomonas spp.(27).The isolated bacteria

were tested against 6 different disinfectants(Dettol, Isol, Izal, JIK, Purit and Septol).The

results indicated that Dettol and JIK were highly effective against bacterial isolates, while

Isol and Purit showed moderate antibacterial effects .Septol and Izal found to be least

effective.

The study carried out by Enemuor et al., 2012, involves the isolation and identification of

microorganisms associated with computer keyboards and mouse devices in computer centres

and cyber cafes in Kogi University, Nigeria. A total of 30 samples were collected from the

surfaces of the keyboards and mice. The microorganisms obtained included bacterial isolates

such as Staphylococcus aureus, Staphylococcus epidermis, Enterococcus spp., Streptococcus

spp.fungal isolates including Mucor spp., Pencillium spp., Aspergillus niger , Rhizopus spp.



20

3. MATERIALS AND METHODS

3.1 Study Area

This study was conducted in Vellore, Tamil Nadu.The study was undertaken for a period of

three months from January 2014 to March 2014.

3.2 Sample Collection

Forty seven Automated Teller Machines (ATMs) of 12different banks (City Union Bank,

State Bank of India, Union bank, Lakshmi vilas bank, Denabank, Indian bank, Federal

bank,ICICI bank,TMB bank, HDFC bank,IOB, Canara bank) was used for the study.The

ATM on main roads having most of the people visiting was selected for the presentstudy.Verbal permission for procedure was obtained from the concerned authority.

Samples were collected from the touch screen and keypad of ATM with sterileswabs. These

swabs were then immediately transferred back to the microbiology laboratory within one

hour of collection in tubes. The test tubes containing the swab were then incubated overnight

to allow the growth of organisms (Nworie et al., 2012).

3.3 Standardization of Test Organisms

0.5 Mac Farlands were used as a reference to adjust the turbidity of bacterial suspensions.

McFarland standards were prepared from suspensions of latex particles and they were

adjusted to an acceptable transmission range using a spectrophotometer at a wave length of

either 600 or 625 nm. The bacterial suspension was adjusted to the same turbidity of a

McFarland Standard to produce expected bacterial plate count (Nworie et al.,2012).

Table 2: McFarland Standard and cell density count

McFarland Standard Approximate Cell Count

Density (x108

cells)

0.5 1.5

1.0 3.0

2.0 6.0

3.0 9.0

4.0 12.0

http://en.wikipedia.org/wiki/Turbidity

http://en.wikipedia.org/wiki/Bacteria

http://en.wikipedia.org/wiki/Suspension_%28chemistry%29

http://en.wikipedia.org/wiki/Latex

http://en.wikipedia.org/wiki/Latex

http://en.wikipedia.org/wiki/Suspension_%28chemistry%29

http://en.wikipedia.org/wiki/Bacteria

http://en.wikipedia.org/wiki/Turbidity



21

3.4 Sample processing

All samples were collected processed in the research laboratory according to the standard

microbiological methods under complete aseptic conditions. The swabs were inoculated on

appropriate media and incubated at 37°C under aerobic conditions for 24 - 48 h. To

determine the types of microorganisms present, the remainder of the was sampled with a

moistened sterile cotton swab, which was then placed into 4 ml of Nutrient broth and

incubated at 37ºC for 48 hours. A variety of selective and differential microbiological media

was used for presumptive identification of contaminating microorganisms (Joshaline et al.,

2014)

3.5 Characterization of samples

Bacterial isolates were examined for colony morphology and gram

reaction as per the standard procedures given by Bergeys Manual, 2009.

Table 3: Colony morphology of isolates (Nworie et al.,2012)

3.6 Susceptibility Testing

The isolates were tested for antimicrobial susceptibility using Kirby Bauer agar disc diffusion

method (Cheesbroughet al., 2006) on Mueller-Hilton agar. Various antimicrobial agents used

were ampicillin, cefotaxime, ceftazidime, ceftriaxone and meropenem. The diameter of the

zones of inhibition surrounding the antimicrobial disc was measured to the nearest

millimetre. Isolates were considered resistant only when the zone of inhibition was less or

equal to the resistance breakpoint.

Isolates Cultural Characteristics Gram positive

Escherichia coli Flat and smooth colonies on

MacConkey agar

Negative

Klebsiella species Round mucoid colonies on

MacConkey agar

Negative

Pseudomonas species Colourless and irregular

colonies in MacConkey agar

Negative

Acinetobacter species Colourless colony and

irregular shape in

MacConkey agar

Negative

Proteus species Colourless in

MacConkeyagar

Negative



22

3.7 Plate Assay Method

In the plate assay we have amended 2µg/ml concentration of Cefotaxime and 4µg/ml

concentration of Meropenem in MH agar. If the isolates grown in the plate it is considered as

resistance Suresh et al., 2007.

3.8 Genomic DNA Isolation

DNA isolation was carried out by Ausubel Method, 1995. LB broth was inoculated with the

culture surrounding different antibiotic disc and allowed to grow overnight at room

temperature. The culture grown in the LB broth was centrifuged and TE buffer, 10% SDS

and Proteinase K were added to the pellet. Then 5M NaCl was added after an hour of

incubation. After addition of CTAB/NaCl solution, it was kept in water bath at 65ºC for 10

minutes. Equal volume of chloroform/isoamyl alcohol was added in the ratio of 24:1 and it

was centrifuged.Aqueous viscous supernatant was transferred to fresh tube and equal volume

of phenol/chloroform/isoamyl alcohol was added and centrifuged. To the supernatant ice

isopropanol was added and tube was inverted until stringy white DNA precipitate became

very clear. DNA was then washed with 70% ethanol and centrifuged. The supernatant was

discarded and the pellet was air dried. The pellet was then resuspended in TE buffer and gel

electrophoresis was carried out and DNA bands were observed under the UV illuminator.

3.5 Polymerase chain reaction

3.6

PCR for the Detection of NDM-1 Genes

PCR amplification for NDM-1 gene was carried out on the isolates with an Applied

Biosystem 9902 Thermo Cycler instrument using PCR conditions and primers as previously

described (Suresh et al ., 2012). Reaction was accomplished in 50μl reaction, approximately

10ng of genomic DNA as a template, reaction volume containing: 10pmol of each primer,

200μm dNTP, 1.5mM MgCl2, 1X Taq buffer and 2U of Taq polymerase (Genei, Bangalore,

India).



23

Multiplex PCR for the Detection of CTX-M Group Genes

PCR amplification for blaCTX-M group genes was carried out on the isolates with an

Applied Biosystem 9902 ThermoCycler instrument using PCR conditions and primers as

previously described (Woodford et al., 2006). The primers used are listed in the Table 1

Primer Name Primer Sequence (5'-3') Product Size

CTX-M group 1 – f AAAAATCACTGCGCCAGTTC 415-bp

CTX-M group 1 – r AGCTTATTCATCGCCACGTT 415-bp

CTX-M group 2 – f CGA CGC TAC CCC TGC TAT T 552-bp

CTX-M group 2 – r CCA GCG TCA GAT TTT TCA GG 552-bp

CTX-M group 9 – f CAAAGAGAGTGCAACGGATG 205-bp

CTX-M group 9 – r ATTGGAAAGCGTTCATCACC 205-bp

CTX-M group 26 – f GCA CGA TGA CAT TCG GG 327-bp

CTX-M group 8/26 – r AAC CCA CGA TGT GGG TAG C 327-bp or 666-bp

CTXM group 8 fwdII TCG CGT TAA GCG GAT GAT GC 666-bp

Table 5 : CTX-M group genes primers

Stage Temperature Duration

Initial Denaturation 95ºC 5 minutes

Denaturation 95ºC 30 seconds

Annealing 65ºC 1 minute

Extension 72ºC 1 minute

Final Extension 72ºC 1 minute

Store at 4ºC. These steps are carried out for 35 cycles.

Table 4 : PCR conditions followed for the detection of the NDM-1 gene



24

Table 4 : PCR conditions followed for the detection of the CTX-M group gene

Agarose Gel Electrophoresis

Amplified products were analysed by agarose gel electrophoresis according to the procedure

described by Sambrook et al ., 1989. 1.5 per cent Agarose gel was prepared in 0.5X TBE

buffer using Agarose. Required quantity of agarose was suspended in TBE, dissolved by

heating in a microwave oven, cooled to about 50°C, then about 2-4µl of ethidium bromide

(Et-Br) was added and poured into a gel casting tray fitted with the required comb. The

solidified gel was immersed in an electrophoresis tank containing 0.5X TBE buffer. The PCR

products were mixed with a 1X loading dye (1 per cent bromophenol blue and 40 per cent

sucrose in water) and the mixture was loaded into the gel. Electrophoresis was carried out at

50V for about 2 hour until the tracking dye reached the end of the gel. Amplified DNA was

visualized under the UV trans-illuminator. The molecular sizes of the DNA samples were

analysed using a 100-3000k bp DNA ladder. The gel image was captured using a

GelDocumentation System.

Stage Temperature Duration

Initial Denaturation 94 3 minutes

Denaturation 94 20 seconds

Annealing 62 30 seconds

Extension 72 40 seconds

Final Extension 72 5 minutes

Store at 4ºC. These steps are carried out for 30 cycles.



25

4. RESULTS

A total of 47 samples were collected from touch screen of ATMs. On culturing of these

samples on MacConkey agar plates, 488strains were identified. Among 488 strains, 239

Escherichia coli (48.97%) strains, 148 Klebsiella sp(30.32%), 77 Pseudomonas sp.(15.77%),

17 Acinetobacter sp.(3.48%) and 7 Proteus sp. (1.43%) were identified (Refer Table 4 :

Frequency of bacterial occurrence in ATMs).

Table 7: Frequency of bacterial occurrence in ATMs

These strains were subjected to antibiotic disc sensitivity by Kirby Bauer disc sensitivity

method. Samples were screened for resistance to six antibiotics which included Cefotaxime,

Ceftriaxone, Ceftazidime, Ampicillin and Meropenem. The zone of inhibition of the

antibiotics was measured in millimetre. Among the 488 strains, 120 of them showed

phenotypic resistance to these drugs. Out of these 120 strains we selected 46 strains that

showed high level of resistance. These 46 strains were then subjected to Plate assay method.

Isolates Frequency of occurrence in ATMs

Escherichia coli 239(48.97%)

Klebsiella species 148(30.32%)

Pseudomonas sp. 77(15.77%)

Acinetobacter sp. 17(3.48%)

Proteus sp. 7(1.43%)

TOTAL 488



26

Name of

isolates

Total

no.of

isolates

Ampicillin Cefotaxime Ceftriaxone Ceftizidime Meropenem

E.coli 239 74.89% 60.87% 71.96% 75.73% 10.04%

Klebsiella 148 72.97% 69.59% 75.67% 74.32% 9.45% Pseudomonas 77 74.02% 76.62% 80.51% 83.11% 11.68%

Acinetobacter 17 70.58% 82.35% 70.5% 64.70% 17.64%

Proteus 7 72.42% 74.02% 71.42% 85.71% 14.28%

Table 8 : Antibiotic Resistance Percentage of Isolates

Fig 1 : Antibiotic Sensitivity Pattern of Escheri chia Col i

Fig 2 : Antibiotic Sensitivity Pattern of Klebsiella sp



27

Fig 3 : Antibiotic Sensitivity Pattern of Pseudomonas sp

Fig 4 : Antibiotic Sensitivity Pattern of Acetobacter sp

Fig 5 :Antibiotic Sensitivity Pattern of Proteus sp



28

Fig 6 : Antibiotic Susceptibility Test by Kirby Bauer Disc



29

Fig 7 : Plate Assay Method



30

Genomic DNA was isolated from the 46 strains that showed high level of phenotypic

resistance. Then these samples were subjected to polymerase chain reaction (PCR). For each

of the 46 samples, PCR was performed using NDM-1 and CTX-M group gene primers. All

the 46 strains were not amplified for NDM-1 and CTX-M 1,2,8,9,25/26 group genes.

Fig 8: Gel Electrophoresis showing genomic DNA bands



31

Fig 9: PCR screening of NDM-1 gene

Fig 10 : PCR screening for samples using CTX-M primer



32

5. DISCUSSION

An Automated Teller Machine (ATM) is a computerized telecommunications device that

enables the clients of a financial institution to perform financial transactions without the need

for cashier, human clerk or bank teller (Rasiah et al., 2010). It is a public utility device which

is used by millions of people in a day. Like all surfaces, colonization of surface of ATMs

such as touch screens, metallic keypad etc by microorganisms is inevitable. The cold and

damp environment of air conditioned ATM centers favours the growth of a wide variety of

microorganisms, both pathogens and harmless microbes (Sarojaet al., 2012). The ATM

machine is also likely to be contaminated with various microorganisms due to their vast

contact by multiple users. There is no restriction as to who has access to the facility and noguideline to ensure hygienic usage. Hence ATMs are reservoir of pathogens.

The literature search has revealed that very few studies have been carried out in India on

isolation and identification of microbes on ATM. Hence the present study was designed to

isolate and identify the bacteria present on ATM surfaces and also to determine the presence

of multi drug resistant strains on these ATM within the town of Vellore, Tamil Nadu. The

aim of the study is to create awareness to the general public and ATM users on the possible

spread of diseases due to the presence of pathogens, especially multi drug resistant pathogens

on ATM touch screen and keypads.

The results of this study showed high level of contamination on the surface of ATMs with

Escherichia coli, Klebsiella spp., Pseudomonas spp., Acinetobacter and Proteus spp.The

percentage distribution of the bacterial isolates showed that Escherichia coli was the most

common isolate with percentage occurrence of 48.97% followed by Klebsiella spp., 30.32%,

Pseudomonas spp., 15.77%, Acinetobacter spp., 3.48% and Proteus spp., 1.43%.

The number of microorganism present on the surface as well as the type of microorganism

present will determine the possibility of occurrence of infection (Neelyet al., 2002 ;

Oluduroet al., 2011). Although the counts of these microorganisms on the ATM surfaces

were not determined, but there is a good chance of spread of infection as even low levels of

Escherichia coli strains can easily be transferred from the fingers to food surfaces. Klebsiella

spp. and Pseudomonas spp. are highly pathogenic, and can even cause death in some major



33

outbreaks and infections.Microbial transmission can occur from the hands of users to the

touch screen and keypad, or vice versa.

Although phenotypic resistance was observed during Kirby Bauer disc susceptibility method,

all the isolates did not show amplification during PCR using NDM-1 and CTX-M primers.

The bacterial contaminants seen in this study is similar to bacteria that have been recovered

from surfaces and objects by other investigators. Nworie et al ;2012 , reported the presence of

Klebsiella spp. and Escherichia coli on the key pad of ATMs.Besides these , Staphylococcus

aureus, was also isolated by them. According to this study, ATMs are likely to be

contaminated by a number of microorganisms due to large number of people using this

facility on a daily basis. Our study is also in agreement with the study bySaroja et al ;2012

who reported the presence pathogenic bacterium such as E.coli, Klebsiella spp.Shigella spp..

and Vibrio spp were also isolated by them in ATM centers in Chennai. But these microbes

were not present in the ATMs screened in this study.

High rates of microbial contamination were found on other public utility devices such as

telephone booths, mobile phones and computer’s keypad and mouse. Anesa et al ;2013 ,

reported that a variety of pathogens are present on public telephones such as Staphylococcus

epidermis, Bacillus subtilis, Pseudomonas aeruginosa, Escherichia coli, Acinetobacter

calcoaceticus. Ashok et al ; 2012, identified and isolated microbes present on computer

keyboards and mouse. The bacterial strains isolated included Staphylococcus epidermis,

Bacillus subtilis, Pseudomonas aeruginosa, Escherichia coli, Acinetobacter calcoaceticus.

Thus, similar to the results found in our study, Escherichia coli and Pseudomonas sp were the

major contaminants found on public telephones and computers.

Escherichia coli are the commonest isolates recovered in our study. Escherichia coli is an

enteric pathogen that spread diseases through touch, improper sanitary activities of

individuals. Escherichia coli can cause diseases like gastroenteritis, urinary tract infection,

septicaemia, dysentery, vomiting, stomach cramps and flatulence. Other bacteria like

Acinetobacter and Proteus spp., were the least frequent bacterial contaminants.

Antibiotic susceptibility of bacterial isolates has been observed to be dynamic and it varies

with time and environment (Rahman et al., 2007). There is the need for periodic screening of



34

common bacterial pathogens for their antibiotic susceptibility profiles in different

communities (Joshaline et al., 2013). The antibiogram result of this study revealed that

majority of the bacteria is highly resistant to standard antibiotics. A total of 5 standard

antibiotics were used with the predominant isolates. And the results showed that organisms

showed mostly resistant. Escherichia coli showed resistance to ampicillin (74.89%),

cefotaxime (60.87%), ceftriazone (71.96%),ceftizidime (75.73%) and meropenem (10.04%).

Whereas, Klebsiella spp. showed resistance to ampicillin (72.97%), cefotaxime (69.59%),

ceftriazone (75.67%), ceftizidime (74.32%) and meropenem (9.45%). Pseudomonas spp.

showed resistance to ampicillin (74.02%),cefotaxime (76.62%), ceftriaxone (80.51%),

ceftizidime (83.11%) and meropenem (11.68%). Acinetobacter spp. showed resistance to

ampicillin (70.58%), cefotaxime (82.35%), ceftriazone (70.5%), ceftizidime (64.70%) and

meropenem(17.64%). Proteus spp.showedresistance to ampicillin (72.42%), cefotaxime

(74.02%), ceftriaxone (71.42%), ceftizidime (85.71%) and meropenem (14.28%).This

indicates that species of E.coli, Klebsiella spp., Pseudomonas spp. and Acinetobacter spp.

showed high level resistance to the tested antibiotics. While Proteus spp. were found to be

susceptible to cefotaxime, ceftriaxone and meropenem and showed comparatively less

resistance to ampicillin and ceftizidime. This indicates that the isolated bacterial strains

showed multiple antibiotic resistance patterns. This result is in agreement with the results of

the study conducted by Olduro et al ., 2011 where multiple antibiotic resistance patterns were

observed in the isolates from samples collected from user interfaces like ATMs, computer

keyboards and mouse devices. Klebsiella spp. showed 100% resistance to erythromycin,

tetracycline (83%), ampicillin (83%), penicillin (83%), gentamycin (54%), cefixime (50%),

cloxacilline (50%) and tarivid acid (50%), but showed high level susceptibility to

cotrimoxazole (65%), followed by ciprofloxacin (64%),augmentine (64%), peflacine (50%)

and ceporex (50%). Escherichia coli were 100% resistant to tetracycline and penicillin,

followed by augmentine (90%), ampicillin (85%), cefixime (65%), cloxacilline

(65%),cotrimoxazole (65%)erythromycin (65%) and nalidixicacid (65%), but 70%

susceptible to ceporex, followed by peflacine (65%) and ciprofloxacin (65%).

This study is also found to be similar to the study conducted by Nworie et al ., 2013, who

isolated Staphylococcus aureus, Klebsiella spp. and Escherichia coli from the metallic

keypads of ATMs. All the organisms showed resistance to certain drugs while the results

indicated that the isolated Staphylococcus aureus were multiple drug resistant.



35

Staphylococcus aureus was 89% resistant to ampicillin followed by penicillin (78%),

nalidixicacid (78%),augmentine (70%), cefixime (68%), tetracycline (68%), erythromycin

(68%), ceporex (65%), gentamycin (60%), ciprofloxacin (60%), peflacin (57%), cloxacilline

(55%) and tarivid (55%).

Similarly, Famurewa et al.;2009, also reported the presence of multi drug resistant bacteria

on the surfaces of mobile phones.The occurrence of resistance in pathogens may reduce the

effectiveness of previously efficient antibiotics (Torogluet al., 2008) .And our research

reveals that the ATMs are potential carriers of dangerous pathogens including drug resistant

ones. Moreover clinically relevant bacteria like E.coli can grow in different

environments(Joshaline et al., 2013) where in the presence of environmental concentrations

of antibiotics may face a selective pressure and may gradually lead to the increase in

prevalence of resistance (Torogluet al., 2008).Hence there’s great risk of transmitting

antibiotic resistant bacteria through contact with such highly contaminated public devices like

the ATM machines. Maintaining personal hygiene like washing hands regularly using soap or

alcohol based sanitizers and wiping the screens and keypads of the ATMs using disinfectants

on a regular basis may help in reducing the spread of microbes.



37

REFERENCES

1

Agbagwa, ObakpororoEjiro and Nwechem Daughter.(2010).Public healthsignificance of microorganisms associated with public restrooms in University of

Port Harcourt.Scientia Africana, Vol. 9 (No.1), March, 2010 pp 126-132.

2 Anesa Jerković-Mujkić, Renata Bešta and Sabina Memišević.(2013).Bacterial

contamination of public telephones in the downtown area of Sarajevo . African journal

of microbial research. 7(17): 1664-1667.

3

Anjana Chandrasekhar, Aparna K P, PriyankaAjithkumar, M P Aarathy,

SabahaFathima, Badari, AnandPremRajan . International Journal of Chemtech

Applications Vol. 2; Issue 1; Page 71-76

4

Annu Rev Biochem. 2009 ;78:119 146.doi:1 0.1146/ annurev.biochem. 78.082907.1

45923

5

AnyimChukwudi, IlangDonatus C, Okonkwo Eucharia C.. BacteriologicalExamination of Computer Keyboards and Mouse Devices and their Susceptibility

Patterns to Disinfectants. American Journal of Bioscience and Bioengineering. Vol. 1,

No. 3, 2013, pp. 36-43.doi: 10.11648/j.bio.20130103.11.

6 Ashok Kumari and Meena Srivastava.(2012).Computer components in college and its

surroundings encompass the pathogenic bacteria.Vol 7(1): 43-47.

7 Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K

8 (1994) Current Protocols in Molecular Biology, pp 2.0.1-2.14.8, John Wiley and

Sons,New York.

9 Bergey's Manual of Determinative Bacteriology / Edition 9 John G. Holt, Peter H.

Sneath (Editor), Noel R. Krieg (Editor), John G. Holt (Editor), John G. Holt (Editor)

10 Bhat SS, Hegde SK, Salian S. Potential of Mobile Phones to Serve as a Reservoir in

Spread of Nosocomial Pathogens.Online J Health Allied Scs. 2011;10(2):14.



38

11 Breathnach AS, de Ruiter A, Holdsworth GM, et al.: An outbreak of multi-drug-

resistant tuberculosis in a London teaching hospital. J Hosp Infect 1998, 39(2):111-

117.

12 Buers S, Fishbain JT, Uyehara CFT, Parker JM, Berg MW (2000). Computer

keyboards and faucet handles as reservoirs of nosocomial pathogens in the intensive

care unit. Am. J. Infect. Control, 28: 465-470.

13 Cheesebrough, M.(2006): District Laboratory practice in tropical countries (Part II). C

ambridge University, P19‐110.

14 Dahbi G, Mora A, López C, Alonso MP, Mamani R, Marzoa J, Coira A, Garcia-

Garrote F, Pita JM, Velasco D, Herrera A, Viso S, Blanco JE, Blanco M and Blanco J.

2013. Emergence of new variants of ST131 clonal group among extraintestinal

pathogenic Escherichia coli producing extended-spectrum ß-lactamases. Int J

Antimicrobial Agents,42(4):347-351.

15

Davies J: Bacteria on the rampage. Nature 1996, 383:219-220.

16 Dhar N, McKinney JD. Microbial phenotypic heterogeneity and antibiotic tolerance.

Curr. Opin. Microbiol 2007;10:30 – 38. [PubMed: 17215163].

17 Dobson, A., and J. Foufopoulos. 2001. Emerging infectious pathogens of wildlife.

Philos. Transac. R. Soc. Lond. Ser. B ,Biol. Sci. 356:1001 – 1012.

18

Ekrakene, T. and C.L. Igeleke .Micro-organisms Associated with Public Mobile

Phones along Benin-sapele Express Way, Benin City, Edo State of Nigeria. Journal of

Applied Sciences Research, 3(12): 2009-2012, 2007.

19 Famurewa, O. and David, O. M.Cell Phone: A Medium of Transmission of Bacterial

Pathogens.(2009). vo1 (2): 69-72.

20 Francis, J. 1971. Susceptibility to tuberculosis and the route of infection. Aust. Vet. J.

47:414 – 414.



39

21 French, G.L., J.A. Otterb, K.P. Shannona, N.M.T. Adamsb and D. Watlingb et al .,

2004. Tackling contamination of the hospital environment by Methicillin-Resistant

Staphylococcus aureus(MRSA): A comparison between conventional terminal

cleaning and hydrogen peroxide vapour decontamination. J. Hosp. Infect., 57: 31-37.

DOI: 10.1016/j.jhin.2004.03.006.

22 Frick, W. F., J. F. Pollock, A. C. Hicks, K. E. Langwig, D. S.,Reynolds, G. G. Turner,

C. M. Butchkoski, T. H. Kunz. 2010.An emerging disease causes regional population

collapse of a common North American bat species. Science 329:679 – 682.

23

Fulford, G. R., M. G. Roberts, and J. A. P. Heesterbeek. 2002. The metapopulation

dynamics of an infectious disease: tuberculosis in possums. Theor. Popul. Biol.

61:15 – 29.

24

Greed, C. (2006). The role of the public restroom: Pathogen Transmitter. Building

Serv. Eng. Res. Technol. 27(2): 1-13.

25

Gurang B, Bhati P, Rani U,Chawla K,Mukhopodhyay C, Barry I (2008). Do mobiles

carry pathogens. Microcon. Oct. 3.

26 Hardy, K.J., B.A. Oppenheim, S. Gossain, F. Gao and P.M. Hawkey, 2006. A study

of the relationship between environmental contamination with Methicillin-Resistant

Staphylococcus Aureus (MRSA) and patients’ acquisition of MRSA. Infect Control

Hosp. Epidemiol., 27: 127-132. PMID: 16465628.

27

Hassan, S.H. Sensitivity of Salmonella and Shigella to antibiotics and

chemotherapeutic agents in Sudan. J. Trop Med Hyg, 88: 243-248. 1995.

28 Hendley, J. O., Wenzel, R. P. and Gwaltney, J.M. J. (1997). Trasnsmission of

rhinovirus colds by self-inoculation. New. Eng. J. Med .288: 1361-1664.

29 Hirsch S (2005). Germs are working overtime at the office (hppt/www.latimes.com).



40

30 Huber JS, Pelon W (2005). Low cost screening for microbial contamination in

aerosols generated in a dental office. Gen. Dent., 53: 270-271.

31 Humphrey, T.J., K.W. Martin and A. Whitehead, 1994.Contamination of hands and

work surfaces with Salmonella enteritidis PT4 during the preparation of egg dishes.

Epidemiol. Infect., 113: 403-409. DOI: 10.1017/S0950268800068412.

32 Horrevorts, A. M., J. Borst, R. J. T. Puyk, R. D. Ridder, G. Dzoljic- Danilovic, J. E.

Degener, K. F. Kerrebijn, and M. F. Michel. 1990. Ecology of Pseudomonas

aeruginosa in patients with cystic fibrosis. J. Med. Microbiol. 31:119 – 124.

33

Issmat I Kassem,Von Sigler and Malak A Esseili. Public computer surfaces are

reservoirs for methicillin – resistant staphylococci.The ISME Journal (2007) 1,265-

268.

34 Jernigan JA, Titus MG, Groschel DHM, Getchell-White SI, Farr BMEffectiveness of

contact isolation during a hospital outbreak of methicillin- resistant Staphylococcus

aureus. Am J Epidemiol 1996;143:496-504.

35 Kapdi M, Hoskote S, Joshi SR (2008). Health hazards of mobile phones: an Indian

perspective. JAPI. 56:893-897.

36 K. Chairman, Elizabath Mathew. K, Padmalatha. C and Ranjit Singh.

37

A .J.A,(2011).Beware of pathogens on public utility devices.J. Microbiol. Biotech.

Res., 2011, 1 (3): 85-90

38

34. Kunin CM, Tupasi T, Craig WA. Use of antibiotics: a brief exposition of the problem and some tentative solutions. Ann Intern Med 1973;79:555-560.

39 Leavis HL, Bonten MJ, Willems RJ: Identification of high-risk enterococcal clonal

complexes: global dispersion and antibiotic resistance. Curr Opin Microbiol 2006,

9:454-460.

40

Lewis K. Persister cells and the riddle of biofilm survival. Biochemistry

2005;70:267 – 74. [PubMed: 15807669]



41

41 L.P., Dancer, S.J., Robertson, C. (2007). Microbiological Evaluation of Hospital

Cleaning Methods. International Journal Environ Health Res. 17(4): 285 – 295

42 Mabel Joshaline C.1, Subathra M.2, Shyamala M.1, Padma S.2,

Rekha.(2014).Automated Teller Machine (ATM)- A “pathogen city” – A Surveillance

Report from Locations in and around Madurai city, Tamil Nadu, India.

43 Mafalda Viana, Rebecca Mancy, Roman Biek, Sarah Cleaveland, Paul C. Cross,

James O., Lloyd Smith, Daniel T.Haydon(2014).Assembling evidence for identifying

reservoirs of infection.

44 Management of Multidrug-Resistant Organisms In Healthcare Settings, 2006 Jane D.

Siegel, MD; Emily Rhinehart, RN MPH CIC; Marguerite Jackson, PhD; Linda

Chiarello, RN MS; the Healthcare Infection Control Practices Advisory Committee

45 Maria Avila, Najwane Said, David M. Ojcius.The book reopened on infectious

diseases, Microbes and Infection 10 (2008) 942-947.

46

Mehmet SaitTekerekoğlu, Yusuf Yakupogullari, BarisOtlu, YucelDuman and

NilayGucluer .(2012).Bacteria found on banks’ automated teller machines

(ATMs), African journl microbial research. Vol. 7(16),pp. 1619-1621, 16 April, 2013.

47 M.L. Cohen, Changing patterns of infectious disease, Nature 406 (2000)762-767.

48 M.ShakeelAnjumn , P.Parthasarathi Reddy, Irram Abbas, M.Monica,Yadav Rao.

Microbial Contamination of laptop/keyboards in dental settings.(2011). International

Journal for health and dentistry.

49 Neely, A.N. and D.F. Sittig, 2002. Basic microbiologic and infection control

information to reduce the potential transmission of pathogens to patients via computer

hardware. J. Am. Med. Inform. Assoc., 9:500-508. PMID: 12223502

50 Nester EW, Evans CR, Nancy P, Denise GA, Martha TT (2004). The Genus:

Staphylococcus In: Nester EW ed. Microbiology – a Human Perspective. 2nd McGrew

Hill, New York, pp. 693-695.



42

51 Okoro Nworie, Mbaba Mercy,Anyim Chukwudi, Inya Oko, S. Okoli Chukwudum,

Victor Maduka Agah and Uchechukwu Onyeukwu Ekuma .Antibiogram of Bacteria

isolated from Automated Teller Machines within Abakaliki Metropolis. American

Journal of Infectious Diseases, 2012, 8 (4), 168-174.

52 Oluduro, A.O., A.O. Ubani and I.E. Ofoezie, 2011. Bacterial assessment of electronic

hardware user interfaces in Ile-Ife, Nigeria. J. Basic Applied Pharmaceut. Sci., 32:

323-334.

53 Oluduro, A. O ; Ubani, E. K.; Ofoezie, I. E. Journal of Basic and Applied

Pharmaceutical Sciences . 2011;32(3):323-334.

54 Onochie Charles Chimezie, AnyimChukwudi, Alo Moses Nnaemeka,

55 OnwaNdubuisi Collins, Okonkwo EuchariaChinyere and AfiukwaFelicitasNgozi.

Bacterial examination of computer keyboards and mouse devices and their

susceptibility patterns to disinfectants. American Journal of Microbiology 4 (1): 9-19,

2013.

56

Pamela J. Yeh , Dawn M. Simon , Jess A. Millar , H. Forrest Alexander , Darleen

Franklin Public Health Res Perspect 2011 2(3), 202-209.

57 Pitout JDD, Laupland KB. Extended-spectrum β-lactamase producing

Enterobacteriaceae; an emerging public health concern. Lancet Infect Dis 2008; 8:

159 – 66.

58 Rahman, m., Rahman, B., Rahman, T., Khan, F.R and Hosen, M.J. Pattern of

antimicrobial resistance and plasmid profiles of Escherichia coli isolates obtained

from calf, cattle and diarrheic children in Mymensingh-Bangledish. J. Am. Sci.., 3:

74-84. 2007.

59 Rasiah, D. ATM Risk Management and Controls. Eur. d. Econ. Finance Admin. Sci.,

1: 161-171. 2010.

60

Reinhardt A, Kohler T, Wood P, Rohner P, Dumas JL, Ricou B, van Delden C:Development and persistence of antimicrobial resistance in Pseudomonas aeruginosa:



43

a longitudinal observation in mechanically ventilated patients. Antimicrob Agents

Chemother 2007, 51:1341-1350.

61

Rusin, P., S. Maxwell and C. Gerba, 2002. Comparative surface-to-hand and

fingertip-to-mouth transfer efficiency of gram-positive bacteria, gram-negative bacteria and phage. J. Applied Microbiol., 3: 585-592. PMID: 12234341.

62 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Gel electrophoresis of DNA. In:

Sambrook, J., Fritsch, E.F. and Maniatis, T. (Eds.) Molecular Cloning: a Laboratory

Manual. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,

USA, chapter 6.

63 Samy S. Ashgar, Hamdy M. El-Said.Pathogenic Bacteria Associated with Different

Public.Open Journal of Medical Microbiology, 2012, 2, 133-137 .

64 S. C. Enemuor, T. A. Apeh and O. O. Oguntibeju.Microorganisms associated with

computer keyboards and mice in a university environment. (2012). African Journal

of Microbiology Research. 6(20): 4424-4426.

65

Seuli Saha Roy, Siddhartha Sarathi Misra and Malik Mehboob Willayat .Isolation

and identification of bacteria of public health importance from mobile phones of fish

and animal handlers of Kashmir. African journal of microbiology research (2013).

66 Shah, N. S., A. Wright, G. H. Bai, L. Barrera, F. Boulahbal, N. Martin-Casabona, F.

Drobniewski, C. Gilpin, M. Havelkova, R. Lepe, R. Lumb, B. Metchock, F. Portaels,M. F. Rodrigues, S. Rusch-Gerdes, A. V. Deun, V. Vincent, K. Laserson, C. Wells,

and J. P. Cegielski. 2007. Worldwide emergence of extensively drug-resistant

tuberculosis. Emerg. Infect. Dis. 13:380 – 387.

67 Sotgiu, G., G. Ferrara, A. Matteelli, M. D. Richardson, R. Centis, S. Ruesch- Gerdes,

O. Toungoussova, J.-P. Zellweger, A. Spanevello, D. Cirillo, C. Lange, and G. B.

Migliori. 2009. Epidemiology and clinical management of XDR-TB: a systematic

review by TBNET. Eur. Respir. J. 33:871 – 881.

68

Stanley ChukwudozieOnuoha,KayodeFatokun. Bacterial Contamination and PublicHealth risk Associated with the Use of Banks’ Automated Teller Machines(Atms) in

EbonyiState,Nigeria. American Journal Of Public Health Research ,2014,Vol

2,No.2,46-50 .

69

Stephen Abban 1, 2, KwakuTano-Debrah.Automatic teller machines (ATMs) as

potential sources of food-borne pathogens – a case from Ghana. Nature and Science,

2011;9(9)



70 S.Y. Eltablawy and H.N. Elhifnawi. Microbial Contamination of Some Computer

Keyboards and Mice in National Center for Radiation Research and

Technology(NCRRT).World Applied Sciences Journal 6(2):162,2009.

71 The Challenge of Antibiotic Resistance by Stuart B. Levy

72 D Tagoe, F Kumi – Ansah. Computer Keyboard and Mice: Potential Sources of

Disease Transmission and Infections. The Internet Journal of Public Health. 2010

Volume 1 Number 2.

73 Tagoe D N, Gyande V K, Ansah E O. Bacterial Contamination of Mobile Phones:

When Your Mobile Phone Could Transmit More Than Just a Call . WebmedCentral

MICROBIOLOGY 2011;2(10):WMC002294.

74 Toroglu, S. and S. Dincer, 2008. Elimination and conjugal transfer of their resistance

in isolated gram negative bacteria from Aksu River(Kahramanmaras-Turkey). Adv.

Environ. Biol., 2:124-131.

75 Tsiodras S, Gold H, et al.: Linezolid resistance in a clinical isolate of Staphylococcus

aureus. Lancet 2001, 358:207-208.

76 Usha Arora, Pushpa Devi, Aarti Chadha, Sita Malhotra.Cellphones A Modern

Stayhouse For bacterial pathogens. Vol. 11 No. 3.2009.

77 Velayati, A. A., M. R. Masjedi, P. Farnia, P. Tabarsi, J. Ghanavi, A. H. ZiaZarifi, and

S. E. Hoffner. 2009. Emergence of new forms of totally drug-resistant tuberculosis

bacilli: super extensively drug-resistant tuberculosis or totally drug-resistant strains in

Iran. Chest 136:420 – 425.

78 Wang J, Soisson SM, Young K, Shoop W, Kodali S, Galgoci A, Painter R,

Parthasarathy G, Tang YS, Cummings R et al.: Platensimycin is a selective FabF

inhibitor with potent antibiotic properties. Nature 2006, 441:358-361.

79 Woodford, N., Fagan, E. J. & Ellington, M. J. (2006). Multiplex PCR for rapid

detection of genes encoding CTX-M extended-spectrum β -lactamases. J Antimicrob

Chemother 57, 154 – 155.

80

Wayne, Pa. Daniel, T., Haydon, Cleaveland, S.,Taylor, L. H. and Karen, L.M (2002).

Identifying reservoirs of infection: A conceptual and practical challenge. Emmer.

Infect. Dis.

Final Final Year TPrevalence of MDR Strains from the Touchscreen of Automated Teller Machinehesis...

Documents

Transcript of Final Final Year TPrevalence of MDR Strains from the Touchscreen of Automated Teller Machinehesis...