EPIDEMIOLOGY OF BOVINE TUBERCULOSIS AND...

EPIDEMIOLOGY OF BOVINE TUBERCULOSIS AND ITS

PUBLIC HEALTH SIGNIFICANCE IN PESHAWAR

IRFAN KHATTAK

2011-VA-562

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

REQUIREMENTS FOR THE DEGREE

OF

DOCTOR OF PHILOSOPHY

IN

EPIDEMIOLOGY AND PUBLIC HEALTH

UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES,

LAHORE

2016

The Controller of Examinations,

University of Veterinary and Animal Sciences,

Lahore.

We, the supervisory committee, certify that the contents and form of the thesis,

submitted by Mr. Irfan Khattak, Regd. No. 2011-VA-562 have been found satisfactory and

recommend that it be processed for the evaluation by the External Examiner(s) for the award of

the degree.

SUPERVISOR _______________________________

Dr. Muhammad Hassan Mushtaq

CO-SUPERVISOR ______________________________

Prof. Dr. Umer Sadique

MEMBER _______________________________

Prof. Dr. Mansur-ud-Din Ahmad

MEMBER _______________________________

Prof. Dr. Muhammad Sarwar Khan

i

DEDICATED

To

My Teachers and Family

ii

ACKNOWLEDGEMENTS

All praise and thanks to Allah the exalted, the Lord of the universe, May the choicest

blessings and peace of Allah be upon the last Messenger and Prophets, Muhammad, his family,

Companions and all those who follow his footsteps till the end of this universe.

I would like to thank all the people who contributed in some way to the work described in

this thesis. First and foremost, I would like to express my sincere gratitude to my supervisor,

mentor, philosopher and guide Dr. Muhammad Hassan Mushtaq, Department of Epidemiology

and Public Health, for his Support, timely and scholarly advice, guidance, scientific approach

and provisions during my Ph. D study and related research. Without his incredible patience and

timely wisdom and counsel, my thesis work would have been a frustrating and overwhelming

pursuit.

Besides my supervisor, I would like to thank Prof. Dr. Mansur ud Din Ahmad, member

of my supervisory committee for valuable comments, suggestions, meticulous scrutiny and

demanding a high quality of work in all my endeavors. In addition, I owe my thanks to the rest of

my committee members Prof. Dr. Muhammad Sarwar Khan and Prof. Dr. Umer Sadique for

their time, insightful comments and encouragement.

My sincere thanks also goes to Mr. Sajid Ali and Anwar sheed, who provided me

technical support during my work at Provincial Tuberculosis Reference Laboratory, Peshawar

and without their efforts my job would have undoubtedly been more difficult. I thank my fellow

labmates Dr. Sajjad Khan, Dr. Kamal Shah and Muhammad Sohail for fruitful suggestions

during my research.

I need to offer my heartiest thanks to my friends and colleagues especially Kashif

sadique, Obaid ur Rehman, Muhammad Raashed, Ramsha Saeed, Muhammad Nauman Akhtar,

Bilal Munir, Amjad Khan, Asghar Khan and Abid Hussain for their precious time and moral

support during the Ph. D studies.

I need to offer my heartiest thanks to Pathology Lab University of Agriculture Peshawar

and Provincial Tuberculosis Reference Lab Peshawar for providing research facilities and

iii

working environment during my research. I am grateful to Higher Education Commission,

Pakistan for financial support.

Last but not the least, I would like to thank my family: my grandfather, my parents and to

my brothers and sister for their unconditional love and support.

Irfan Khattak

iv

TABLE OF CONTENTS

DEDICATION …………………………………………………………. (i)

ACKNOWLEDGEMENTS …………………………………………… (ii)

TABLE OF CONTENTS………………………………………………. (iv)

LIST OF TABLES ……………………………………………………… (v)

LIST OF FIGURES …………………………………………………….. (vi)

ABSTRACT ……………………………………………………………... (vii)

S R. NO. CHAPTERS PAGE NO.

1 INTRODUCTION 01

2 REVIEW OF LITERATURE 10

3 EXPERIMENT -1 58

4 EXPERIMENT -2 85

5 EXPERIMENT -3 106

6 EXPERIMENT -4 128

7 SUMMARY 151

v

LIST OF TABLES

TABLE NO. TITLE PAGE NO.

3.1 Mechanisms known to livestock farmers for the Transmission of

TB from Animal to Human. 66

3.2 Prevalence of bTB in four towns (administrative units) of

Peshawar district 68

3.3 Bivariate frequency analysis of various parameters in positive

and negative tuberculin reactors 69

3.4 Multivariable logistic regression analysis of parameters that

showed significant association with bTB positivity 72

3.5 Stepwise binary logistic regression model of independent

variables 73

4.1

Association of Socio demographic characteristics and

knowledge regarding tuberculosis among M. bovis contaminated

milk consumers (n=800)

90

4.2 Participant’s health status and knowledge about signs and

symptoms of tuberculosis 92

4.3 Participants knowledge about transmission, prevention and

treatment of TB (n= 800) 93

4.4 Attitude and practices about TB in Peshawar District (n= 800) 96

5.1 Distribution of samples and PCR results 109

5.2 Bivariate frequency analysis of various parameters of abattoir

workers in Peshawar, Pakistan. 111

5.3 Distribution of signs and symptoms of TB known to the abattoir

workers, butchers and livestock farmers 114

5.4 Education status and age distribution of the livestock farmers in

Peshawar, Pakistan 119

6.1 Growth and isolation of Mycobacterium tuberculosis and

Mycobacterium bovis on solid media 134

6.2 Drug Susceptibility Testing of Mycobacterium bovis isolates

from human active pulmonary tuberculosis patients 135

6.3

Bivariate frequency analysis of various parameters in

Mycobacterium tuberculosis and Mycobacterium bovis infected

patients 136

6.4 Self-reported clinical signs and symptoms in TB patients 138

6.5 Participants knowledge about transmission of TB 139

6.6 Participants knowledge about prevention and treatment of TB 140

vi

LIST OF FIGURES

FIGIGURE NO. TITLE PAGE NO.

3.1 Age distribution of livestock farmers 63

3.2 Education status of livestock farmers 64

3.3 Distribution of livestock farmers on basis socio-economic

status 65

3.4 Distribution of signs and symptoms of TB known to

livestock farmers 67

5.1 Percentile Distribution of Mechanisms known to Abattoir

workers for the Transmission of TB from Animal to Human 113

5.2 Age distribution of the butchers 116

5.3 Education status of abattoir worker 117

5.4 Percentile Distribution of Mechanisms known to butchers for

the Transmission of TB from Animal to Human 118

5.5 Percentile Distribution of Mechanisms known to livestock

farmers for the Transmission of TB from Animal to Human 120

6.1 Molecular detection, sequence and Phylogenetic analysis of

Mycobacterium bovis isolates 133

vii

ABSTRACT

A cross-sectional study of bovine tuberculosis (bTB) was carried in Peshawar, Pakistan. A total

of 556 cattle and buffalo were screened for bovine tuberculosis. Out of 556 animals screened,

5.75% (3.9-8.0%) were found positive. The prevalence was higher in old animals (P= 0.001) as

compared to younger animals. Prevalence also varied with source of animal (either raised on

farm or purchased), stay of animals at night (indoor or outdoor) and herd size. Farmer’s

knowledge about transmission of TB from animals to human as well as signs and symptoms of

TB was extremely low. Only 3.6% farmers correctly stated the combination of three major

symptoms of TB. For assessment of presence of Mycobacterium bovis (M. bovis) in milk sold at

retail shops, milk samples were obtained from 92 milk shops and analysed for presence of M.

bovis. Data on socio-demographic characteristics and KAP about TB was obtained from 800 M.

bovis contaminated milk consumers. Mycobacterium bovis was detected in 8.7% (8/92) milk

samples. Although 97.4% of the participants had heard of TB but only 39.6% knew that cough

lasts for more than 3 weeks was one symptom. Only 79.2% have awareness that TB can be

prevented and the most frequently stated (48.4%) method of TB prevention was good nutrition.

Participants believed that TB can be cured by prayers/ eating well (41.8%) and also by herbal

cures/ consulting Hakeem (35.7%). Mean knowledge score for the participants was 12.1± 2.47

out of maximum 22. Mean knowledge score varied significantly with ethnicity, level of

education and residential status (Urban vs rural). Overall knowledge about TB was low. Next

part of the study was conducted to determine the occurrence of active pulmonary tuberculosis

due to M. bovis in abattoir workers, butchers, livestock farmers and veterinarians and to

document the Knowledge and practices of these professional regarding bTB. The cross sectional

study included 141 abattoir workers, 317 butchers, 50 livestock farmers, 5 veterinary doctors and

viii

3 veterinary assistants. Sputum samples were collected from those respondents who had chronic

cough that last for more than 2 weeks. Four out of 16 suspected abattoir workers and 1 out of 50

livestock farmers were found positive for M. bovis by Polymerase chain reaction analysis.

Duration of work as abattoir worker was found significantly associated (p<0.05) with occurrence

of zoonotic TB. The knowledge of abattoir workers, butchers, livestock farmers and veterinary

assistants regarding transmission of bTB from animal to human and symptoms of TB in human

was very low. Most of these professional did not use protective material/ techniques and are

considered at high risk of acquiring zoonotic tuberculosis. The last part of study aimed to

determine the proportion of zoonotic TB cases out of overall human TB patients and school

children, drug resistance of M. bovis isolates and knowledge, attitude and practices about TB.

Total 300 human TB patients and 100 school children were included in the study. Sputum

samples were processed by PCR for presence of Mycobacterium tuberculosis and M. bovis.

Sputum samples from TB patients were cultured and M. bovis isolates were subjected to drug

susceptibility testing. Data on knowledge, attitude and practices were obtained from TB patients

by administering pre-tested questionnaire. Among TB patietns 4% (12/300) were infected with

M. bovis. None of the school children was positive for M. bovis. Residence, occupation, presence

of animals at home and sleeping in shed at night was found significantly associated with

occurrence of zoonotic TB. Except one all M. bovis isolates were resistant to Pyrazinamide.

Among other drugs resistance to streptomycin and isoniazid was high. Low level of knowledge

and practices were observed.

1

CHAPTER 1

INTRODUCTION

Pakistan is an agricultural country where the livestock contributes 11.8% to the national GDP

and 55.9% to overall agriculture value added. There are approximately 41.2 million heads of

cattle and 35.6 million buffaloes (Anonymous 2014). In Pakistan 30-35 million people in rural

areas are engaged in livestock farming. Majority of the livestock is in small herds of 2-3

cattle/buffalo and 5-6 sheep/goats (Mansoor et al. 2012). These animals are reared under

traditional management systems that are very far from modern animal husbandry techniques. The

animals share close interface with the owners, sometime share same roof as well. The livestock

of Pakistan is affected by several infectious and non-infectious diseases. Many of these

infectious diseases are zoonotic and thus having potential to be transmitted to livestock handlers

by direct as well as indirect contact.

Tuberculosis (TB) is one of the major public health problems in Pakistan. Pakistan ranks fifth

amongst TB high-burden countries worldwide. Approximately 0.5 million new TB cases emerge

every year in the country and 48 thousand people die annually. Pakistan is also estimated to have

the fourth highest prevalence of multidrug-resistant TB (WHO 2014). Naturally, the occurrence

of zoonotic TB is greatly dependent on the presence of TB in animals. Global estimated

prevalence of zoonotic TB is 3.1% of total human TB cases that accounts for 2.1% of the

pulmonary TB cases and 9.4% of the extra-pulmonary TB cases (Cosivi et al. 1998). In

industrialized countries human infection due to M. bovis is minimized as a result of control of

bovine tuberculosis in farm animals. Assessment of the worldwide consequences of zoonotic TB

has not yet been done. This may have been partially due to the incapability of most of the

laboratories to differentiate TB caused by M. tuberculosis or M. bovis, which requires

Introduction

2

mycobacterial culture and the subsequent use of biochemical or molecular (e.g., genotyping)

diagnostic methods. Also the clinical picture, radiographical presentation and pathological

lesions of zoonotic TB are similar to the TB caused by M. tuberculosis. Therefore, low-income

countries are unable to identify the causative agent of TB (Muller et al. 2013) and zoonotic TB in

humans is under-reported (Ayele et al. 2004). Data on occurrence and distribution of zoonotic

TB in WHO region of South Asia is scarce.

Bovine TB is a chronic infectious disease caused by Mycobacterium bovis, a member of the

Mycobacterium tuberculosis complex (MTC). MTC includes M. tuberculosis, M. canettii, M.

africanum, M. bovis, M. microti, M. caprae, M. mungi and M. pinnipedii (Soolingen et al. 1994;

Brosch et al. 2002; Huard et al. 2006; Alexander et al. 2010). Mycobacterium bovis has wide

host range (Nugent 2011). Bovine species are the main host. However, nearly all mammalian

species are susceptible to varying degrees to bTB and the disease has been reported in various

caged and free ranging wildlife species, domesticated animals and human beings (Lisle et al.

2001; Ayele et al. 2004). Bovine TB is considered to be of socio-economic and/or public health

importance and significant in the international trade of animals and animal products by the world

organization for animal health (OIE). Bovine TB has much more importance in rural areas in

developing countries where humans and animals share the same dwelling premises and micro-

environment (Shitaye et al. 2007). Transmission can occur by various routes however aerosol

route is considered the main transmission pathway of bTB (Neill et al. 1994) thus such infections

are common among meat industry and slaughterhouse workers (Thoen et al. 2006). Milk is

another important source of M. bovis transmission and results in extra-pulmonary presentations

of TB(Wedlock et al. 2002). Mycobacterium bovis has been detected earlier from

raw/unpasteurized milk and lesions of slaughtered animals (Leite et al. 2003; Ereqat et al. 2013;

Introduction

3

Mekibeb et al. 2013). Distinguishing between the various members of the Mycobacterium

tuberculosis Complex (MTBC) is important for epidemiological investigation, implementation of

preventive measures and better management of human TB cases (Domenech 2006; Twomey et

al. 2007; Vazquez et al. 2015). Absence of specific identification of M. bovis may have adverse

consequences for TB patient management (Allix-Beguec et al. 2010).

Tuberculosis due to M. bovis is found in cattle almost all over the world however in some

developing countries of Asia, Africa and South America the occurrence of bTB is very high

(Thoen et al. 2009). Peshawar district is located in sub-tropical continental lowlands close to

Pak-Afghan border. The latitude and longitude of Peshawar is 34.0167° N and 71.5833° E

respectively. Pakistan and Afghanistan has porous border and people along with their animals

move across the border. This transboundary movement of animals may increase the risk of

bovine tuberculosis (BTB) in Peshawar district as Afghanistan is lacking bTB prevalence studies

and status of bTB is greatly unknown there. Bovine TB has been reported in many parts of the

country (Javed et al. 2006; Khan et al. 2008; Javed et al. 2011; Tipu et al. 2012). Data regarding

bTB prevalence in developing countries is minimal and the information available may not

represent the true epidemiological status of the disease (Anonymous 2012). Surveys of the

limited data available show that the cases reported in developing countries may be the tip of an

iceberg (Grange 2001). The primary screening tool for detecting bTB in live animals is

Tuberculin Skin Test. It has been extensively applied in eradication campaigns with satisfactory

results in most of the countries (Olea-Popelka et al. 2008). The skin test measures a delayed

hypersensitivity reaction mediated by sensitized T-cells after the intradermal injection of

tuberculin (Monaghan et al. 1994). Hypersensitivity to tuberculin (Purified protein derivative)

develops in cattle usually between three and six weeks post-infection with tubercle bacilli (Roug

Introduction

4

et al. 2014). Therefore recently infected animals do not react to the tuberculin test. However, the

test is able to detect sub-clinical infection (Domenech et al. 2006).

Tuberculosis in human cannot be effectively controlled unless misconceptions among people are

identified and corrected. Better understanding of the treatment methods which TB patients first

adopt and factors responsible for delay is important in policy making for improving case finding

and early treatment (Khan et al. 2000).

Introduction

5

REFERENCES

Alexander KA, Laver PN, Michel AL, Williams M, van Helden PD, Warren RM, Gey van

Pittius NC. 2010. Novel Mycobacterium tuberculosis complex pathogen, M. mungi.

Emerg Infect Dis. 16 (8): 1296-1299.

Allix-Beguec C, Fauville-Dufaux M, Stoffels K, Ommeslag D, Walravens K, Saegerman C,

Supply P. 2010. Importance of identifying Mycobacterium bovis as a causative agent of

human tuberculosis. Eur Respir J. 35 (3): 692-694.

Anonymous 2012. EMPRES Transboundary Animal Diseases Bulletin. 40 (40): 1- 43.

Anonymous 2014. Economic survey of Pakistan.

Ayele WY, Neill SD, Zinsstag J, Weiss MG, Pavlik I. 2004. Bovine tuberculosis: an old disease

but a new threat to Africa. Int J Tuberc Lung Dis. 8 (8): 924-937.

Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, Garnier T, Gutierrez

C, Hewinson G, Kremer K, Parsons LM, Pym AS, et al. 2002. A new evolutionary

scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci U S A. 99 (6):

3684-3689.

Cosivi O, Grange JM, Daborn CJ, Raviglione MC, Fujikura T, Cousins D, Robinson RA,

Huchzermeyer HF, de Kantor I, Meslin FX. 1998. Zoonotic tuberculosis due to

Mycobacterium bovis in developing countries. Emerg Infect Dis. 4 (1): 59-70.

Domenech RDL 2006. Human Mycobacterium bovis infection in the United Kingdom:

Incidence, risks, control measures and review of the zoonotic aspects of bovine

tuberculosis. Tuberculosis. 86 (2): 77-109.

Domenech RDL, Goodchild AT, Vordermeier HM, Hewinson RG, Christiansen KH, Clifton-

Hadley RS. 2006. Ante mortem diagnosis of tuberculosis in cattle: a review of the

Introduction

6

tuberculin tests, gamma-interferon assay and other ancillary diagnostic techniques. Res

Vet Sci. 81 (2): 190-210.

Ereqat S, Nasereddin A, Levine H, Azmi K, Al-Jawabreh A, Greenblatt CL, Abdeen Z, Bar-Gal

GK. 2013. First-Time Detection of Mycobacterium bovis in Livestock Tissues and Milk

in the West Bank, Palestinian Territories. PLoS Negl Trop Dis. 7 (9): e2417.

Grange JM 2001. Mycobacterium bovis infection in human beings. Tuberculosis (Edinb). 81 (1-

2): 71-77.

Huard RC, Fabre M, de Haas P, Lazzarini LC, van Soolingen D, Cousins D, Ho JL. 2006. Novel

genetic polymorphisms that further delineate the phylogeny of the Mycobacterium

tuberculosis complex. J Bacteriol. 188 (12): 4271-4287.

Javed MT, Irfan M, Ali I, Farooqi FA, Wasiq M, Cagiola M. 2011. Risk factors identified

associated with tuberculosis in cattle at 11 livestock experiment stations of Punjab

Pakistan. Acta Trop. 117 (2): 109-113.

Javed MT, Usman M, Irfan M, Cagiola M. 2006. A study on tuberculosis in buffaloes: some

epidemiological aspects, along with haematological and serum protein changes. Vet.

arhiv. 76 (3): 193- 206.

Khan A, Walley J, Newell J, Imdad N. 2000. Tuberculosis in Pakistan: socio-cultural constraints

and opportunities in treatment. Soc Sci Med. 50 (2): 247-254.

Khan IA, Khan A, Mubarak A, Ali S. 2008. Factors affecting prevalence of bovine tuberculosis

in nili ravi buffaloes. Pak V J. 28 (4): 155-158.

Leite CQ, Anno IS, Leite SR, Roxo E, Morlock GP, Cooksey RC. 2003. Isolation and

identification of mycobacteria from livestock specimens and milk obtained in Brazil.

Mem Inst Oswaldo Cruz. 98 (3): 319-323.

Introduction

7

Lisle GWD, Mackintosh CG, Bengis RG. 2001. Mycobacterium bovis in free-living and captive

wildlife, including farmed deer. Rev Sci Tech. 20 (1): 86-111.

Mansoor, Chaudhry KM, Muhammad S, Ashraf I, Ghafoor U. 2012. Farmer’s perceptions of

livestock production practices introduced by Punjab rural rupport program (PRSP). Pak.

J. Agri. Sci. 49 (2): 233-235.

Mekibeb A, Fulasa TT, Firdessa R, Hailu E. 2013. Prevalence study on bovine tuberculosis and

molecular characterization of its causative agents in cattle slaughtered at Addis Ababa

municipal abattoir, Central Ethiopia. Trop Anim Health Prod. 45 (3): 763-769.

Monaghan ML, Doherty ML, Collins JD, Kazda JF, Quinn PJ. 1994. The Tuberculin Test. Vet

Microbiol. 40 111-124.

Muller B, Durr S, Alonso S, Hattendorf J, Laisse CJ, Parsons SD, van Helden PD, Zinsstag J.

2013. Zoonotic Mycobacterium bovis-induced tuberculosis in humans. Emerg Infect Dis.

19 (6): 899-908.

Neill SD, Pollock JM, Bryson DB, Hanna J. 1994. Pathogenesis of Mycobacterium bovis

infection in cattle. Vet Microbiol. 40 (1-2): 41-52.

Nugent G 2011. Maintenance, spillover and spillback transmission of bovine tuberculosis in

multi-host wildlife complexes: A New Zealand case study. Veterinary Microbiology. 151

(1–2): 34-42.

Olea-Popelka FJ, Costello E, White P, McGrath G, Collins JD, O'Keeffe J, Kelton DF, Berke O,

More S, Martin SW. 2008. Risk factors for disclosure of additional tuberculous cattle in

attested-clear herds that had one animal with a confirmed lesion of tuberculosis at

slaughter during 2003 in Ireland. Prev Vet Med. 85 (1-2): 81-91.

Introduction

8

Roug A, Perez A, Mazet JA, Clifford DL, VanWormer E, Paul G, Kazwala RR, Smith WA.

2014. Comparison of intervention methods for reducing human exposure to

Mycobacterium bovis through milk in pastoralist households of Tanzania. Prev Vet Med.

115 (3-4): 157-165.

Shitaye JE, Tsegaye W, Pavlik I. 2007. Bovine tuberculosis infection in animal and human

populations in ethiopia: a review. Veterinarni Medicina. 52 (8): 317- 332.

Soolingen DV, Haas PED, Haagsma J, Eger T, Hermans PW, Ritacco V, Alito A, van Embden

JD. 1994. Use of various genetic markers in differentiation of Mycobacterium bovis

strains from animals and humans and for studying epidemiology of bovine tuberculosis. J

Clin Microbiol. 32 (10): 2425-2433.

Thoen C, LoBue P, de Kantor I. 2006. The importance of Mycobacterium bovis as a zoonosis.

Vet Microbiol. 112 (2–4): 339-345.

Thoen CO, Lobue PA, Enarson DA, Kaneene JB, de Kantor IN. 2009. Tuberculosis: a re-

emerging disease in animals and humans. Vet Ital. 45 (1): 135-181.

Tipu MY, Chaudhary ZA, Younus M, Rabbani M. 2012. A cross sectional study of

Mycobacterium bovis in dairy cattle in and arround Lahore city, Pakistan. Pakistan J.

Zool. 44 (2): 393-398.

Twomey DF, Crawshaw TR, Anscombe JE, Farrant L, Evans LJ, McElligott WS, Higgins RJ,

Dean G, Vordermeier M, Jahans K, de la Rua-Domenech R. 2007. TB in llamas caused

by Mycobacterium bovis. Vet Rec. 160 (5): 170.

Vazquez CCA, Martinez GA, Couvin D, Gonzalez YMJA, Rivera-Gutierrez S, Escobar-

Gutierrez A, De-la-Cruz Lopez JJ, Gomez-Bustamante A, Gonzalez-Macal GA,

Introduction

9

Goncalves Rossi LM, Muniz-Salazar R, Rastogi N, et al. 2015. Human multidrug-

resistant Mycobacterium bovis infection in Mexico. Tuberculosis (Edinb).

Wedlock DN, Skinner MA, de Lisle GW, Buddle BM. 2002. Control of Mycobacterium bovis

infections and the risk to human populations. Microbes Infect. 4 (4): 471-480.

WHO 2014. Global Tuberculosis Report. World Health Organization.

10

CHAPTER 2

REVIEW OF LITERATURE

Bovine tuberculosis

Bovine Tuberculosis (bTB is a chronic infectious disease caused by Mycobacterium bovis (M.

bovis), a member of the Mycobacterium tuberculosis complex (MTC). Mycobacterium bovis has

a wide host range and has been isolated from, camelidae (Twomey et al. 2007), suidae

(Woodford 1982; Parra et al. 2003; Naranjo et al. 2008), ovidae (Malone et al. 2003), bovidae

(Bengis et al. 1996; Keet et al. 2001; Rodwell et al. 2001; Vos et al. 2001; Tipu et al. 2012),

mustelidae (Caley and Hone 2004; Lisle et al. 2008), cervidae (Thoen et al. 1992; Jacques et al.

2003; Mackintosh et al. 2004; O'Brien et al. 2004; Nishi et al. 2006), caprinae (Cadmus et al.

2009), rodents (Delahay et al. 2002; Mathews et al. 2006), lagomorphs (Coleman and Cooke

2001), marsupials (Lisle et al. 2008), primates (Sapolsky and Else 1987; Keet et al. 2000;

Ramdas et al. 2015), perrissodactyls (Stetter et al. 1995), felidae (Briones et al. 2000; Lantos et

al. 2003), canidae (Himes et al. 1980; Bruning-Fann et al. 2001), procyonidae (Palmer et al.

2002), ursidae (Bruning-Fann et al. 2001) and elephant (Lyashchenko et al. 2006).

Comparatively M. bovis is more resistant as compared to other members of Mycobacterium

Complex (MTC) and can survive for more than 5 months in bovine feaces and up to 2 years in

soil depending on environmental conditions (Mitserlich and Marth 1984; Jackson et al. 1995;

Young et al. 2005; Courtenay et al. 2006).

Diseased animals shed the bacilli via milk, in feces, urine, saliva and discharges from lesions

(Phillips et al. 2003; Neill et al. 2005; Jha et al. 2007). Transmission by inhalation is considered

the main transmission pathway of bTB (Neill et al. 1994) and needs lower doses of M. bovis as

compared to alimentary route and majority of lesions occur in respiratory track (Dean et al.

Review of Literature

11

2005). Infection by oral route is considered the second most common pathway of transmission

because the lesions in mesenteric lymph nodes are not frequently observed (Neill et al. 2005).

Infection by oral route is more likely to occur in calves sucking milk from bTB infected cattle or

by ingesting infected sputum (Francis 1948; Palmer et al. 2002). The practice of using manure as

fertilizer in developing countries might be a source of infection for humans and animals through

contaminated vegetables and pastures (Ayele et al. 2004). Less described pathways of bTB

transmission are genital and vertical transmission (Morris et al. 1994; Menzies and Neill 2000;

Neill et al. 2005).

The minimum bacterial dose required for infection is not accurately known. Different studies

have reported different minimum bacterial doses required for infection. These variations may be

due to differences in hot species, individual animals, route of inoculation and bacterial strain.

The findings of numerous studies conducted on guinea pigs have revealed that infection through

ingestion required higher doses of bacilli than required for causing infection through aerosol

route. As low as 1–5 bacilli and 10–20 million bacilli caused infection via aerosol and oral route

respectively (Palmer and Waters 2006). Bacterial dose as well as size of the inhaled droplet

containing bacilli are important in establishing the disease (Neill et al. 1991; Menzies and Neill

2000; Palmer and Waters 2006). Neill et al. (2005) described that one colony forming unit (CFU)

that contained 6 to 10 viable bacteria was able to cause bTB through intra-tracheal route. The

investigator further observed that the severity of pathology that resulted from 1 CFU and up to

1000 CFU were equivalent. Similarly one CFU of M. bovis has equivalent strength of

intradermal tuberculin test and IFN-gamma response to higher doses of M. bovis (Neill et al.

2005). Cattle to cattle transmission and pathogenesis of bTB have been explored in many

experimental studies. Pollock et al. (2006) reviewed previous studies that have experimentally


12

reproduced infection and disease in cattle. From these studies it was reported that infection with

doses ranging from 106 to 108 CFU through sub-cutaneous, intravenous or oral route caused

generalised systemic lesions that were atypical to those of field cases (Pollock et al. 2006).

Majority of lesions found in the upper respiratory tract and some in lower respiratory tract when

the infection was given to cattle through intra-tonsillar route. The infection doses were ranging

from 106 to 108 CFU (Palmer et al. 1999). Buddle et al. (1994) reported that the dose of M. bovis

has significant effect on the lesions severity and distribution. High doses of challenge induce

generalized tuberculosis while low dose challenge induces small lesions limited to mainly

thoracic region. The low dose induced pathology was similar to that seen in the field as a result

of natural disease (Buddle et al. 1994).

Transmission to humans also occurs by inhalation of dust particles and bacteria-containing

aerosols shed by infected animals. Ingestion of infectious material (usually meat and milk) may

provide another route of transmission (Guerrero et al. 1997; Cosivi et al. 1998; Dankner and

Davis 2000; Chaddock 2002; Wedlock et al. 2002; Gibson et al. 2004; Esteban et al. 2005).

The probability that a bacilli transmitted via the inhalation route will initiate infection is

dependent on various factors besides its airborne survival characteristics. These include the rate

at which the infectious agent is released, number of bacilli inhaled, aerosol droplet size and

infectious dose (Gannon et al. 2007). M. bovis is a major cause of gastrointestinal TB in human

in developing countries where milk pasteurization is not commonly practiced (Bonsu et al.

2000). Mycobacterium bovis has been detected earlier from raw/unpasteurized milk and lesions

of slaughtered animals (Leite et al. 2003; Ereqat et al. 2013; Mekibeb et al. 2013).

Mycobacterium bovis in milk and meat is detected on the basis of bacteriological examination or

more modern nucleic acid diagnostic techniques (Tipu et al. 2012; Ereqat et al. 2013).


13

Clinical picture, radiographical presentation and pathological lesions of zoonotic TB are similar

to the TB caused by M. tuberculosis. Their causative organisms can only be differentiated by

bacteriological culture and further typing of the organism according to biochemical properties,

resistance to pyrazinamide, growth characteristics, and molecular techniques. Polymerase Chain

Reaction (PCR) is currently the most widely used technique for early detection and species

differentiation of Mycobacteria (Bhattacharya et al. 2003). Absence of specific identification

of M. bovis may have adverse consequences for TB patient management (Allix-Beguec et al.

2010).

Tuberculin Skin Test is the standard method for detection of bTB (OIE 2009) and is widely used

in Europe and other countries in the world. The test effectively detect bTB at pre-clinical stage in

cattle and buffaloes. This enables the rapid removal of infected animals, thus limiting

transmission of the disease. The test has been widely used in bTB eradication programs in

Europe and other countries in the world. This test is very likely to remain the primary screening

test for M. bovis infection in cattle and buffaloes as it is a simple, robust and inexpensive

(Buddle et al. 2009). At the same time the test has certain limitations including difficulties in

interpretation of test results and inadequate test accuracy (Domenech 2006). These limitations

can hinder progress in a herd sanitation program adopting test and slaughter strategy (Michel et

al. 2009). Unnecessary culling of false positive animals may also have serious effects on cattle

management (Humblet et al. 2009). Interferon Gamma Assay is another test that has been

developed for improving the screening and diagnosis of bTB (Lilenbaum et al. 1999). In this test

whole blood is incubated for 16 to 24 hours with tuberculin purified protein derivative antigens.

The plasma is then separated and IFN-gamma production by T-lymphocytes is detected (Rothel

et al. 1992). Increase sensitivity and specificity of this test have significantly improved the


14

detection of M. bovis in domestic and wildlife populations. However, the INF-Gamma Assay is

not routinely used for screening and diagnosis of bTB and it appears impractical for use in

developing countries as it requires the samples to be delivered to the laboratory within 24 hours

for processing and is relatively expensive and sophisticated techniques (Domenech 2006;

Michel et al. 2010). Carcass inspection at slaughter house for bTB lesions is also an important

surveillance tool. Although its sensitivity is low but it can be used as a cost efficient method.

Another method used for diagnosis of TB is bacteriological examination. It includes staining and

microscopic examination, mycobacteria isolation on selective culture media and final

confirmation by biochemical tests (OIE 2004). Although culture method is considered as gold

standard, but it is very time consuming due to the slow growth of mycobacterium species. As

compared to the above mentioned conventional methods, advanced nucleic acid based techniques

are more sensitive, specific and rapid means of identification of the micro-organism. These

advanced techniques have also some limitations which make it impractical for use in developing

countries (Bhattacharya et al. 2003).

Prevalence bovine tuberculosis

Bovine TB is a global disease, 128 of 155 countries reported M. bovis or clinical signs and

symptoms of disease in their cattle during the period 2005 to 2008 to the World Organization for

Animal Health (OIE) (Michel et al. 2010). Australia, Iceland, Denmark, Norway, Sweden,

Finland, Netherlands, Germany, France, Belgium, Austria, Luxembourg, Switzerland, Latvia,

Slovakia, Estonia, the Czech Republic, Lithuania, Canada, Singapore, Jamaica, Barbados and

Israel are currently classified as Bovine Tb free countries (Mfinanga et al. 2004; CFSPH 2015).

All other countries are affected by bTB and the prevalence varies greatly among the countries.

The prevalence of bTB is high in developing countries because the control strategies are either


15

lacking or are poorly implemented (Cosivi et al. 1995; Cosivi et al. 1998; Domenech 2006). The

individual animal prevalence of bovine TB has been reported to be 10.0%, 13.5% and14.3% in

Pakistan, Ethiopia and India respectively (Ameni et al. 2007; Khan et al. 2008; Aneesh et al.

2010). The prevalence of bTB is directly linked with the control program. It is high in

developing countries because of the lacking or poor implementation of control programs. (Cosivi

et al. 1995; Cosivi et al. 1998; Domenech 2006). Bovine TB is prevalent in Pakistan and all its

neighboring countries India, Iran, Afghanistan and China. No national screening and or control

program has ever been implemented in Pakistan and currently the actual prevalence of bTB at

national level is unknown. In Pakistan the zoonotic importance and economic impacts of bTB are

either not well studied or documented. Various studies conducted by different researchers have

shown varied prevalence in different areas of Pakistan.

Khilji (1974) observed 0.53% prevalence of bTB in Rohri area and 5.31% prevalence in Quetta

in buffalos on the basis of tuberculin skin testing (Khilji 1974). In Lahore area 815 buffaloes and

185 cows were subjected to CIDT, 57 (6.91%) buffalos and 16 (8.64%) cattle were found

positive (Jalil et al. 2003). Total of 165 and 163 buffalos were screened for bTB using CIDT in

2006 at two experimental livestock farms located in Punjab Province, The prevalence of bTB in

buffalos was 2.45% and 8.48% at two farms (Javed et al. 2006). Another study conducted in

surroundings of the three big cities of Punjab i.e., Lahore, Faisalabad and okara and 10

Government livestock research farms reported 12.72% prevalence of bTB in female Nili Ravi

buffaloes (Khan and Khan 2007). A study conducted at Livestock Experiment Station, Khushab

revealed 10.06% prevalence in Nili Ravi buffaloes.Mycobacterium bovis was isolated from 4

(44.44%) milk samples, M. tuberculosis from 1 faecal and 2 milk samples (33.33%), while

atypical mycobacteria were isolated from 2 (22.22%) milk samples (Khan et al. 2008). Similar


16

study conducted in 2009 in Punjab province reported prevalence of 2.2% in buffalos and found

that occurrence of bTB in buffalos was also associated with (Javed et al. 2009). In Faisalabad

and Okara, herd level prevalence was calculated to be 14% and 3% in buffaloes respectively.

While the animal-level prevalence of bTB was 2.7% and 2.3% in Faisalabad and Okara,

respectively. The study indicated that bTB transmission within herds was low as the individual

animal-level prevalence was not very high in bTB positive herds (Javed et al. 2010). In Punjab

province of Pakistan, 7.6% animal-level prevalence and 100% herd level prevalence has been

reported in Government livestock research farms (Javed et al. 2011). In 2012, 11.3% animal-

level prevalence and 86% herd prevalence of bTB was reported in buffalo at 7 livestock research

farms, Punjab (Javed et al. 2012). The prevalence of TB in buffaloes was recorded as 2.47 % in

the villages within 15 kilometer radius from Clock Tower of Faisalabad City. The temporal

distribution over a period of years revealed that the disease is endemic in buffalo population in

peri-urban areas of Faisalabad city (Arshad et al. 2012). Screening of 59 herds (230 cattle) at

Faisalabad and 38 herds (291 cattle) at Okara through CIDT indicated 9% prevalence at herd

level and 2% at animal level (Javed et al. 2013). Overall prevalence of 24.7% was estimated in

cattle and buffaloes at two livestock farms in Punjab Province, Pakistan using CIDT. The

prevalence was 22.5% on one farm while 25.9% on the other ofarm (Akhtar et al. 2015). In

Meskan Woreda district of Ethiopia, 6.8% animal level prevalence and 100% herd prevalence

has been reported in cattle population (Tschopp et al. 2011). Another study revealed 3% animal

level prevalence by screening 2216 cattle in 24 kebeles (administrative units) of Ethiopia with

CIDT, highest prevalence (7.9%) was reported in Meskan Mareko and lowest (1.2%) in Woldia

(Tschopp et al. 2009). Bovine TB in dairy cattle in Asmara, Eritrea, was studied by (Omer et al.

2001) using Comparative Intradermal Tuberculin Test. Out of 1813 animals tested, 14.5%


17

were reactors. Thirty (41.7%) herds had at least one reactor, while 19 (26.4%) herds had two or

more reactors (Omer et al. 2001). The prevalence of bTB and non-specific infection was 1.3%

and 6% respectively in Tanzania using Single Intradermal Tuberculin Test (SITT). The

prevalence of both bTB and non-specific infection was higher in the intensive production

systems as compared to pastoral systems (Shirima et al. 2003). Prevalence of 0.4%, 2.0% and

0.2% was recorded in camels, cattle and goats, respectively using CIDT in Somali region of

southeast Ethiopia. The difference in bTB positivity between different livestock species was not

significant. Percentage of Avian purified protein derivative (PPD) reactors was 0.7%, 10.0% and

1.9% in cattle, camels, and goats respectively (Gumi et al. 2012). Study conducted by (Awah-

Ndukum et al. 2012) in Cameroon confirmed the presence of bTB in live cattle and abattoirs.

The CIDT revealed 4.67% bTB prevalence in live cattle. The prevalence was higher in the

Western highlands (χ2 = 17.50, P ≤ 0.001) than Adamawa plateaux. The monthly bTB detection

rate based on lesions ranged from 0.30% to 0.81% and annual rates ranged from 0.04% to

1.46%. The rates did not vary with seasons (Awah-Ndukum et al. 2012). In western Uganda, Of

the 525 cattle from 63 herds tested by CIDT, 2.1 % animal level prevalence and 14.28% herd

level prevalence was calculated (Kazoora et al. 2014). Overall prevalence of 39.6% was

estimated in the Southeast of Mozambique (Moiane et al. 2014). Total of 685 cattle at two farms

in Ghana were screened for bTB using CIDT in. The prevalence of bTB was estimated as 2.48%

(Asante-Poku et al. 2014). Tuberculin testing of 1,288 cattle in Mikumi-Selous ecosystem,

Tanzania revealed 3.7 % animal level prevalence (Mwakapuja et al. 2013) and 1,103 cattle

testing from 32 herds in the Serengeti ecosystem, Tanzania revealed 2.4% animal level and \

50% herd prevalence (Katale et al. 2013). An extensive study conducted in central Ethiopia

showed that around 30% of 2956 tested dairy cattle were positive for bTB while the herd


18

prevalence was over 50% (Firdessa et al. 2012). The overall individual animal prevalence of bTB

was 3.6% in rural livestock system of Torodi (Niger) (Boukary et al. 2011). In Southern Ethiopia

the individual animal level and herd level prevalence were 11.6% and 48.7% respectively

(Regassa et al. 2010).In 2007 and 2008, prevalence of bTB was 7.10% and 6.91% in same cattle

herds in North of Ecuador (Proano-Perez et al. 2009). Animal level prevalence of bTB was 6.8%

in cattle in Zambia (Munyeme et al. 2009).Of total 106 farms tested, 46 contained at least one

tuberculin test reactors and of 1,869 animals among these farm, 443 (23.7%) were bTB positive

(Elias et al. 2008). In southern Tanzania 13.2% of the animals were classified as Tuberculin

reacters (Kazwala et al. 2001).

Risk factors of bovine tuberculosis

Age

Akhtar et al. (2015) studied various risk factors of bTB in cattle and buffaloes and reported that

age greater than 8 years was highly associated with bTB occurrence (Akhtar et al. 2015). Similar

findings were obtained in abattoir based study in central Ethiopia; age above 8 years was

significantly associated with bTB (Mekibeb et al. 2013). Positivity to Tuberculin increases with

age (p<0.05) and is highest in cattle over 4 years (Katale et al. 2013). The prevalence of bTB

varied significantly among age groups in cattle and animals of age over 4 years had higher odds

for bTB positivity (Regassa et al. 2010). Proaño-Perez et al. (2009) reported significant positive

correlation between Tuberculin skin positivity and the age of the animals (P = 0.03). In Southeast

of Mozambique, age was a major risk factor for bTB; animals of age more than 4 years were

more likely to be Tuberculin reactors (Moiane et al. 2014). Adult animals older than 10 years had

fourfold more risk of bTB positivity as compared to younger animals in Central Ethiopia

(Firdessa et al. 2012). Munyeme et al. (2009) reported that prevalence of bTB increased


19

significantly with increasing age and Javed et al. (2012) found higher proportion of Tuberculin

reactors in animals above 13 years of age. Bovine TB prevalence was found higher in old and

young cattle as compared to middle age group (Demelash et al. 2009). Cattle age greater than 4

years had higher prevalence of bTB compared to younger animals (Ramirez-Villaescusa et al.

2009). Similarly Elias et al. (2008) associated old age and bTB occurrence in animals. Cattle of

age greater than 3 years were more effected by bTB as compared to younger animals (Kazwala et

al. 2001). while Javed et al. (2013) reported high bTB prevalence in animals of age 10 years or

more. Age was associated significantly with bTB occurrence i-e older animals had more CIDT

reactors as compared to younger animals (Awah-Ndukum et al. 2012). The animals of age 5-8

years were at highest risk of disease and all animals under one year of age were negative in

Faisalabad city, Pakistan (Arshad et al. 2012). Similarly it has been reported that risk of having a

positive Tuberculin test in cattle increase with the increase in age (OR = 1.2)(Javed et al. 2011).

Significantly higher percentage of positive reactors was found in buffaloes aged 8 years and

above (Khan and Khan 2007; Khan et al. 2008).

Lactation

Ameni and Erkihun (2007) reported higher prevalence of bTB in lactating as compared to non-

lactating animals. Similar findings has been reported by Kazwala et al. (2001) that lactation

status and Tuberculin positivity have positive association. Javed et al. (2010) revealed that

lactating animals were at higher risk of having positive Tuberculin test. Another study reported

that lactating animals are more likely to have positve Tuberculin test than non-lactating (Javed et

al. 2009).


20

Herd size

Herd size showed significant association with Tuberculin positivity and large herds (P < 0.01)

had higher prevalence of bTB (Proano-Perez et al. 2009). In south west England the prevalence

of bTB was higher in herds having more than 150 animals (Ramirez-Villaescusa et al. 2009).

Large herd size increased the risk of bTB in Addis Ababa dairy farms (Elias et al. 2008). Herd

level prevalence was higher in herds having 6 or more animals (Ameni and Erkihun 2007).

Firdessa et al. (2012) reported increase risk of of having Tuberculin reactors in medium and large

farms (p-value 0.001) while Javed et al. (2006) indicated increased risk in large herds. Small

herds were less affected by bTB as compared to large herds (Awah-Ndukum et al. 2012).

Similarly Omer et al. 2001 associated large herd size with Tuberculin positivity in animals. Javed

et al. (2013) reported higher prevalence of Tuberculin reactors in herds having 20 or more

animals at Faisalabad and Okara.

Body mass

Body mass was significantly associated with bTB occurrence and the prevalence was highest in

animals of weight greater than 500 kg (Akhtar et al. 2015). According to Munyeme et al. (2009)

poor body condition score was associated with bTB occurrence while Ameni and Erkihun (2007)

associated good body condition score with bTB positivity. Javet et al. (2013) indicated higher

prevalence of Tuberculin reacters in animals having body weight 400-500 kg and Khan and

Khan (2007) reported higher prevalence in animal having more than 550 kg live weight. The

animals with poor physical conditions had 2.8 times higher prevalence than the animals with

good health conditions (Arshad et al. 2012). Animals of body mass greater than 600 Kg were

more likely to contract bTB (Javed et al. 2012) while other studies reported higher prevalence of


21

bTB in buffalo of 300-500 kg live weight (Javed et al. 2010) and cattle weight more than 500 kg

(Javed et al. 2009).

Parity

Javed et al. (2011) associated numbers of calving with Tuberculin skin positivity (OR = 1.5). In

another study Javed et al. (2012) showed that more than 5 calving increased the occurrence of

bTB in animals. Similarly more than 6 calving were significantly associated with Tuberculin

positivity as stated by Javed et al. (2013) and Javed et al. (2009). A significantly higher number

of CIDT positive animals had 3-6 parities (Khan and Khan 2007; Khan et al. 2008)

Relationship between parity and age

Average age of puberty in buffalo and cow heifers is 37 and 34 months respectively (Bashir

2006; Rehman 2006). Age at calving in Nili-Ravi buffaloes, Sahiwal and Holstein cows is 55, 46

and 29 months, respectively (Moore et al. 1990; Bashir 2006; Rehman 2006) and average calving

interval of dairy cattle is 400 days (Silva et al. 1992). It means after every 400 days of first

calving new offspring is produced. It shows direct relation between age and parity.

Purchase of animal

The herds that introduced new cattle were 5.6 times more likely to be bTB infected (Proano-

Perez et al. 2009). Ramirez-Villaescusa et al. (2009) reported that bTB had high prevalence in

cattle that were purchased as compared to those that were homebred. Similarly introduction of

new cattle on the farm were associated with increased risk of bTB in cattle (Kazoora et al. 2014).

In Ethiopia purchase of cattle was found significantly associated with bTB occurrence (Tschopp

et al. 2009).


22

Burden of zoonotic tuberculosis in human tuberculosis patients

Human TB due to M. bovis (Zoonotic TB) is poorly studied in low and middle resource countries

(Torres-Gonzalez et al. 2013). The increased resistance of M. bovis to anti-tuberculous drugs has

severe implications for public health (Vazquez-Chacon et al. 2015). Mycobacterium bovis needs

more consideration because of its MDR strains, higher proportional morbidity of M. bovis in

children, Higher mortality from M. bovis infection than M. tuberculosis and widespread co-

infection with Human Immunodeficiency Virus (HIV) (Timothy et al. 2008; Majoor et al. 2011) .

In France, 2% of human TB is caused by M. bovis and human to human transmission of M. bovis

in immunocompetent persons has also been identified (Mignard et al. 2006; Sunder et al.

2009). In USA, M. bovis is responsible for 34.9% of HIV and TB coinfection cases (Park et al.

2010). 11.8% (11/102) of the sputum samples from farm workers were positive for M. bovis in

Maxico (Milian-Suazo et al. 2010). At National Mycobacterial Reference Laboratory, Spain,

1.9% of MTBC isolates were identified as M. bovis. Most of the M. bovis infected patients either

belonged to agriculture and livestock farming communities or were immigrants from bTB

endemic countries (Rodriguez et al. 2009). Over all 1–2% of human TB cases in United States

are due to M. bovis (Hlavsa et al. 2008) but the share of M. bovis varies across communities and

geographic regions. In California 10% TB isolates were identified as M. bovis during 2001-2005

and 54% of those belonged to children (upto 15 years). Almost all (97%) M. bovis infected

patients were among the Hispanic community, and 60% of them were Mexico born (Timothy et

al. 2008). Other studies have also reported higher prevalence of TB due to M. bovis in Hispanic

population and revealed that Maxico born M. bovis infected patients accounted for 57% of all M.

bovis infected patients in USA. Most of the M. bovis infected patients (83%) had consumed

unpasteurized milk products (chees) produced in Maxico (Mark et al. 2015).


23

In a cross sectional study conducted between 2006 and 2010, 126 TB patients that were

revieving treatment in Bamako, Mali were tested using spoligotyping for identification of MTC

strains. Three members of the MTC were isolated, M. tuberculosis, M. bovis and M. africanum.

The percentage of M. tuberculosis, M. bovis and M. africanum was 71.4%, 0.8% and 27.8%

respectively. The occurrence of MDR was high among treatment (25%) and retreatment (81.8%)

failure patients as compared to new untreated patients (2.9%) (Traore et al. 2012).

Mycobacterium bovis has been detected in sputum samples and fine needle aspirate specimens

from pastoralists that were suspected of pulmonary TB and from those suspected of TB

lymphadenitis in Oromia and Somali Regional States of Ethiopia. Out of 173 isolates from

human sputum and FNA samples subjected to molecular typing confirmed 160 isolates as M.

tuberculosis, three as M. bovis, and the remaining 10 were typed as non-tuberculous

mycobacteria (NTMs). During same study suspected TB lesions were collected from cattle,

camels and goats at abattoirs. Molecular typing of 39 isolates from livestock revealed 24 M.

bovis, 14 NTMs and 1 M. tuberculosis strains (Gumi et al. 2012).

Mycobacterium bovis isolates were identified in humans and cattle by PCR, and the

clinical and epidemiological importance of Zoonotic Tuberculosis (zTB) in humans was

established in a study conducted from 1995 to 2009 in Mexican patients. Analysis of 124 isolates

from human TB patients and 60 isolates of cattle origin revealed that 28% (35/124) of human

isolates and 97% (58/60) cattle isolates were M. bovis. Most of the zTB patients (74%) had extra-

pulmonary TB (EPTB) presentation, half (51%) were children and half (51%) patients had

consumed unpasteurized milk. Small number (6%) of zTB patients were in contact with animals

and most (69%) had malnutrition (Portillo-Gomez and Sosa-Iglesias 2011). In a cross-sectional

study conducted between 2008-2010 in an urban area in Brazil, 189 specimens from human TB


24

patients were characterized using phenotypic molecular speciation methods. The percentage of

M. bovis isolates was 1.6% (Silva et al. 2013). Of 576 pulmonary TB Patients in Burkina Faso, 7

(1.2%) were infected with M. bovis (Sanou et al. 2014). In Buenos Aires, Argentina, a total of 39

TB patients were identified to be infected by M. bovis and accounted for 0.4% of all TB cases

reported during the study period. Most of these (93%) were exposed to at least one risk factor for

M. bovis i.e occupational exposure (65%), living in a rural area (31%) and consumption of

unpasteurised milk. Pulmonary TB was more common than Extra pulmonary TB. Rifampicin

resistance and MDR were observed in two patients with HIV infection (Cordova et al. 2012).

During 1998–2006, M. bovis caused 3% of human TB cases in southwest Ireland and 9 out of

11 M. bovis strains were similar to animal spoligotypes (Ojo et al. 2008). In the Netherlands,

1.4% of human TB cases are caused by M. bovis and delayed diagnosis of the exact causative

agent of TB led to inadequate treatment (Majoor et al. 2011). In Pakistan, conventional and

molecular techniques were used to differentiate randomly selected 100 MTBC isolates of human

origin. Out of these 100 isolates conventional method identified 4 isolates (4%) as M. bovis

while PCR identified 2 isolates as M. bovis (Jabbar et al. 2015). The overall prevalence of latent

TB infection (LTBI) was 76.2% and 58.5% by Tuberculin skin test and Interferon-gamma

release assay among dairy farmers, abattoir workers and household contacts in Mexico. Two

individuals were diagnosed having pulmonary TB and M. bovis was detected in their sputum

samples. Occupational exposure was shown to be associated with LTBI (Torres-Gonzalez et al.

2013).

Pasteurization of milk, application of sanitary controls to dairy products, and strict meat

inspection at abattoirs could protect the human health. However, occupational exposure to bTB

infected animals and their carcasses may remain a source of infection (de Kantor et al. 2008).


25

Detection of Mycobacterium bovis in bovine milk

The consumption of M. bovis contaminated raw milk and unpasteurized dairy products

are considered to be a major contributor to zoonotic TB for several reasons: 1) the near absence

of zoonotic TB among infants less than 12 months of age; 2) a high proportion of

extrapulmonary presentation of TB, particularly gastro-intestinal among zoonotic TB cases; and

3) an association between positive interferon-γ release assay results and raw milk/ unpasteurized

dairy products consumption (Dankner and Davis 2000; Besser et al. 2001; LoBue et al. 2003;

Hlavsa et al. 2008; Timothy et al. 2008; Garfein et al. 2011; Majoor et al. 2011). The stomach

acid has strong anti-bacterial activity and tends to destroy most of the Mycobacterium ingested

but it is also fact that milk play effective role in many food-borne infections. The fat molecules

in milk stimulate emulsification and thus prevent M. bovis/tuberculosis destruction. Due to the

liquid nature of milk, it experiences shortest exposure in the acidified environment of the

stomach .Once in intestine, Mycobacterium easily cross the mucus membrane during the routine

nutrients uptake (Michel et al. 2015). Mycobacterium bovis remains alive in souring and fresh

milk for some duration and could infection human as well as those wild or domestic animals that

get chance to consume unpasteurized/ raw milk and dairy products (Michel et al. 2015). Children

and immune-compromised individuals are considered to be at highest risk of contracting bTB

through milk consumption (Ayele et al. 2004; Mfinanga et al. 2004) Zoonotic TB has been

reported in immigrant communities in United States, particularly in those who consumed

previously unpasteurized dairy products (Timothy et al. 2008). Milk sold at retail shops in São

Paulo state in Brazil were found contaminated by mycobacteria. Out of 78 raw milk samples 14

(17.9%) were found positive for mycobacterial species. Mycobacterium bovis was isolated only

from one milk sample(Leite et al. 2003). Tipu et al. (2012) found 454 (45.4%) bovine milk


26

samples positive for M. bovis out of 1000 samples by PCR in his study conducted in Lahore,

Pakistan. The study concluded that presence of M. bovis in milk was a risk for milk handlers and

consumers (Tipu et al. 2012). Serrano-Moreno et al. evaluated various cow secretions by PCR

for presence M. bovis. Analysis of milk and colostrum from herd with high prevalence (48%) of

bTB revealed that 62% of the colostra and 18% of the milk samples were positive for M. bovis

(Serrano-Moreno et al. 2008). According to sreevatsan et al. (2000), multiplex amplification and

screening of pooled milk samples could be cost effective. They identified M. bovis in 32.6% milk

pools (n= 46), each of the milk pool contained milk from 10 animals. . In contrast, the Argentine

cattle (n= 70) had a low prevalence of M. bovis shedding in milk (1.4%) (Sreevatsan et al. 2000).

In a study, 300 bovine milk samples were obtained from both individual and collective bulk

tanks and informal milk sale points of sale. Of the 300 bovine milk samples, 24 were positively

identified as Mycobacterium spp. Molecular identification detected 15 unique mycobacterial

specie including M. bovis. Mycobacterial species were isolated from 9% of the individual bulk-

tank samples, 8% of the trade samples and 7% of the collective bulk-tank samples. The study

suggested microbiological cultures and PCR-based identification tests a better tool for the

detection and identification of Mycobacterium spp. in milk samples (Franco et al. 2013). In the

west bank Palestinian territories, 208 tissue samples and 150 raw milk samples obtained from

cows and goats were screened by PCR and the Mycobacterium isolates were genotyped. Total of

2.9% tissue samples and 2.7% milk samples were found positive for M. bovis. The study

suggested that presence of M. bovis in tissues and milk of apparently healthy animals was a risk

to human health (Ereqat et al. 2013). In Argentina, 177 milk samples were collected from herds

officially certified as bTB free and 80 samples from herds with unknown certification status or

certified as TB infected. Mycobacterium bovis was detected in overall102 (40%) of the milk


27

samples, whereas 155 (60%) of the samples were found negative. Importantly, 44% of samples

from TB infected herds and 38% of samples from TB free herds were positive (Zumarraga et al.

2012). In Turkey 145 raw milk samples from cattles were processed by Ziehl–Neelsen (ZN)

staining, culture and PCR. Results showed that 0.7% samples were positive for acid fast bacilli

by staining, 7.6% by culture and 4.1% were positive for M. bovis by PCR (Aydin et al. 2012).

Figueiredo et al.(2012) reported the identification of M bovis DNA in 12 % of the milk samples

obtained from Tuberculin positive test cattles in Brazil (Figueiredo et al. 2012) while Zarden et

al. (2013) reported that in Brazil 62.5% (5/8) of the milk samples from tuberculin test negative

were positive to M. bovis. Four of the milk samples were positive by PCR only and one sample

by culture only (Zarden et al. 2013). In Tunisia, milk of 4.9% (5/102) cows were found to

contain M. bovis and the consumers of the infected milk were identified as at high risk of getting

zoonotic infection (Ben Kahla et al. 2011). Of the 400 raw milk samples of pastoral cattle in

Nigeria, four (1.0%) were positive both by culture and molecular analysis (Cadmus et al. 2010).

One out of 16 milk samples collected from Tuberculin skin test positive cattle in Southern

Ethiopia was culture positive (Regassa et al. 2010) and 8.5% milk samples from Tuberculin

reactive animals in Addis Ababa farms were positive for M. bovis (Elias et al. 2008).

Mycobacterium bovis were detected in 18.2% milk samples of Tuberculin reactor cattle (Ameni

and Erkihun 2007).

Knowledge, Attitude and Practices about tuberculosis

Though TB is preventable and curable, its global burden still remains tremendous. A high level

of community awareness and positive attitude toward TB and its management is imperative for

the success of any prevention and control strategy. Knowledge and perception of newly


28

diagnosed TB patients prior to the treatment is associated with treatment default, so awareness

and counseling are required to improve patients' compliance to TB treatment (Putera et al. 2015).

A cross-sectional survey was conducted including 825 participants in Jharkhand, India. The

study showed low level of knowledge about TB causes, symptoms , routes of transmission and

moderate awareness about government TB services. Half of the participants stated local liquor as

the cause of TB, 61% considered TB as a communicable disease and one third mentioned that

sharing of food is responsible for TB transmission. Awareness was high regarding availability of

free treatment services at Public Health Centers, but respondents did not knew about DOTS

strategy. Differences were also observed among gender regarding knowledge and awareness

(Kulkarni et al. 2014). Poor knowledge about TB was demonstrated among non-medical

university students. Among 839 students most of the respondents (94.4 %) had heard about TB at

some point in life, among them half of students got information from electronic media. More

than half of the students believed that TB is a transmissible disease, 42.8 % knew that bacteria is

responsible for causing TB, most of the students (93 %) had awareness about TB vaccination and

97.6 % respondents believed that TB is curable. However, respondents had poor knowledge

about latent TB and DOTs program. Statistical analysis associated gender, type of family,

residence, and parents education with students' knowledge of TB (Rana et al. 2015). In Brazil

110 relatives of TB patients were interviewed to know their knowledge and attitude about the

disease. Among 110 respondents, 90.9% mentioned chronic cough as a symptom of TB, and

symptomatic respiratory as the most frequent source of infection. The respondents believed that

TB can also be transmitted by sharing of clothes (79.1%), sharing household utensils (60%) and

sexual relations (50%). Illiterate relatives, those with no or little exposure to television, and also

those who do not have access to internet were more likely to have low level of knowledge


29

regarding TB. (de Freitas et al. 2015). In inner Mongolia, China, 10581 individuals were

interviewed for evaluating knowledge, attitude and health care-seeking behaviors. Majority of

the respondents (86.7%) mentioned that TB is an infectious disease. Only 26.9% correctly stated

that cough lasts for 3 weeks or more is suggestive of TB. Most of the respondents (68.3%) had

awareness about TB treatment facilities in their areas and more than half (57.5%) of the

respondents knew about the free TB diagnosis and treatment policy. About 52.5% of respondents

would stigmatize TB patients. Television was the major source of respondents’ information.

Signification differences in TB related knowledge was observed among majority Han and

minority ethnic groups (Ma et al. 2015). Although non-Hispanic blacks population represents 13

% of the total U.S.-born population but account for 37 % of TB cases reported in U.S.-born

people. Blacks had low level of knowledge about TB and more misconceptions about its

transmission and latent TB infection as compared to whites. This suggest association between

occurrence of TB and lack of awareness about TB (Howley et al. 2015). In Antananarivo

Madagascar high level of knowledge about TB symptoms and less awareness about the disease

duration and free treatment has been reported. The Knowledge was obtained at school or from

relatives/neighbors with TB disease. TB related attitude and practices indicated that stigma is

attached to TB in the area (Rakotosamimanana et al. 2014). Males and adults age 21-35 years

were described to have better knowledge about modes of transmission and methods of

prevention as compared to females and adults above age 35 years in Rajshahi City, Bangladesh.

High level of education and urban residence were also significantly associated with better

knowledge of TB. Good knowledge about TB prevented delay in seeking TB treatment (Mondal

et al. 2014). About half of the TB patients in Federal Capital Territory, Nigeria, first sought

health care in a government hospital, 26% with a medicine vendor and 22% in a private hospital.


30

Less than half (41%) of the patients had unsatisfactory knowledge of TB and 42% seeked

delayed treatment. Unsatisfactory knowledge of TB was contributing to delay in treatment

seeking (Biya et al. 2014). Among participants 74.7% had ever of TB and 76.9% among those

who had ever heard of TB demonstrated that TB can be cured. Few (19.6%) participants stated

that they would not like to disclose the TB diagnosis of family members and 63.1% mentioned

correctly that TB spread from person to person through coughing or sneezing. Statistical analysis

indicated that poor knowledge and negative attitude towards TB was more common among the

poor households, north central regions, illiterate respondents, non-working group, young adults

(15-19 years), and residents of rural areas (Agho et al. 2014). Among the residents of Shinile

town, Ethiopia 94.9% had ever heard about TB. Only 22.9% respondents believed that TB is

caused by bacteria. Most of the respondents (80%) indicated that TB is communicable and

79.3% knew that TB can be prevented. Persistence cough was the most commonly mentioned

symptom of TB and modern drugs used in health centers was the preferred choice of treatment.

Most of the participants (71.0%) stated that they would seek medical treatment at health care

facility if they realized that they had TB related symptoms. More than half of the participants

(55.4%) considered TB a very serious disease and 69.3% indicated that they would experience

fear if they were diagnosed with TB. Overall good knowledge of TB was associated with

education level (grade 8 up to grade 12) of the respondents (Tolossa et al. 2014). In Gezira,

Sudan, Age, education level, residence and occupation type were significantly associated with

awareness about TB, whereas marital status had no effect on TB knowledge (Suleiman et al.

2014).

In a Nigerian rural community, 97.3% of the respondents had previously heard about TB. About

half (51.6%) of the respondents considered TB a result of HIV/AIDS outbreaks or malnutrition,


31

and 38% believed that it can be treated with Western medicine. An overwhelming majority

(97%) was not willing to relate with TB patients (Anochie et al. 2013). In another rural

community of Nigeria, awareness and attitude toward TB was poor. About 86% participants had

heard of TB with a greater proportion being females (55.7%). Mean knowledge score for the

participants was 16.26+/-5.8 (range 0-35) and more than half (55.1%) had poor knowledge.

Males had better awareness than females but the difference was not statistically significant.

Although attitude toward TB did not influenced care for sick relatives but it disturbed social

interactions and marriage prospects with TB patients (Tobin et al. 2013). In Madhya Pradesh,

India, 80% respondents had awareness of the TB symptoms. About 25% of the participants did

not knew about any method of TB prevention. Though most of the participants (68.2%) believed

that TB is a curable but majority of them (67.2%) had no knowledge of DOTS program. There

was need for extensive health awareness education program to increase the communities

knowledge about TB (Rao et al. 2012). In rural Tamil Nadu 1985 individuals were interviewed,

56% had heard of TB, but 80% did not knew about the cause and mode of spread of TB.

Television was mentioned most frequently (45%) as source of information. Only 34%

respondents were aware that TB treatment was available free of cost. Few people (about 10%)

felt the need to maintain confidentiality, if diagnosed with TB. Majority (80%) of the

participants preferred to seek medical care at Government hospital, if contracted TB (Kar and

Logaraj 2010). Misconceptions regarding TB are common in Pakistani TB patients and lack of

awareness on TB is alarming in Karachi, Pakistan. Fever, cough, bloody sputum and chest pain

were mention as the main symptoms of TB. Few (7%) patients believed TB was not an infectious

disease and 10.6% considered TB a non-preventable disease. Contaminated food was indicated

by 47.6% and emotional stress/ trauma by 57% patients as the source of TB. Half of the patients


32

had not received counseling about preventing the spread of the disease and more than half (57%)

mentioned separating dishes as an effective means of preventing TB transmission. Few (18%)

patients indicated that they would discontinue medication following disappearance of symptoms.

About one quarter of the respondents believed that TB lead to infertility and 38.8% thought that

TB reduce chances of getting married (Khan et al. 2006). In Delhi Only 83.6% had heard of TB

mainly from neighbors (64.9%) and friends (62.1%). Only 2.3% knew that TB was caused by a

germ. Literates had high level of awareness than illiterates regarding some signs and symptoms

of TB i.e breathlessness, low grade fever, loss of appetite and factors favoring TB e.g.

overcrowding (56.4%) and poor diet (45.4%). Very few (12.6%) respondents knew about the

duration of TB treatment and only 1.7% knew about the preventive role of Bacillus Calmette–

Guérin (BCG). Discrimination of TB patients was predicted from the responses e.g 71%

participants were agreed upon isolating TB patients, 74.1% preferred not sharing food with TB

patient, 33% suggested quitting job by the patient, 27.6% were of the view to prohibit marriage

of the TB patients and 18% agreed upon shunning him from attending social events. (Singh et al.

2002). In Addis Ababa, Ethiopia, 83% respondents were aware that TB was a transmissible

disease and most (80.1%) of the respondents perceived the disease as a very severe disease.

Majority (81.5%) mentioned cold was the cause of TB, 69.0% indicated TB patients were not

accepted in the society and 78.3% revealed that they avoid touching TB patients. Participants of

agreed that TB was communicable, very dangerous, but treatable disease and the community has

negative attitude towards those with TB. They also revealed that TB was associated with

HIV/AIDS in the community (Gelaw et al. 2001). Majority of the respondents from South

Western Ethiopia did not knew the causative agent and main symptoms of TB. Moreover, low

level of knowledge, attitudes and practices regarding TB were found associated with gender


33

(female). Only 3.3% indicated germ/ bacteria as a causative agent of TB and 9.9% stated cough

lasingt two weeks or more as suggestive of TB. Taking the mean knowledge score as the cut-off

value, 57.6% of the respondents had good level of knowledge, 40.8% had favorable attitude and

45.9% had good practices. Female respondents had low level of knowledge, did not have

favorable attitude and had not good practices compared to male respondents (Bati et al. 2013). In

India majority (92.7%) of the Medical Colleges interns ranked DOTS programme as very

successful for treatment of TB. However, only 4.2% interns correctly mentioned all modes of the

disease transmission. Demonstration of AFB in sputum smear was indicated by 65.9% interns as

the most effective test for pulmonary TB diagnosis. Total of 141 different treatment regimens

were stated by the interns and of those only 11 were scientifically acceptable (Rajpal et al. 2007).

Statement of problem

Bovine TB is a chronic infectious disease caused by Mycobacterium bovis, a member of the

Mycobacterium tuberculosis complex (MTC). Mycobacterium bovis has wide host range

(Nugent 2011). Bovine species are the main host however, nearly all mammalian species are

susceptible to varying degrees to bTB (Lisle et al. 2001; Ayele et al. 2004). Tuberculosis due to

M. bovis is found in cattle and buffloes almost all over the world however in some developing

countries of Asia, Africa and South America the occurrence of bTB is very high (Thoen et al.

2009). Data regarding bTB prevalence in developing countries is minimal and the information

available may not represent the true epidemiological status of the disease (Anonymous 2012).

No national screening and or control program has ever been implemented in Pakistan and

currently the actual prevalence of bTB at national level is unknown. Various patchy studies

conducted by different researchers have shown varied prevalence in different areas of Pakistan.

In Pakistan the zoonotic importance and economic impacts of bTB are either not well studied or


34

documented. The present study was planned with the objectives: To study the prevalence and

risk factors of bTB. To assess the burden of zoonotic TB in human TB patients. Asses the burden

of zoonotic TB in occupationally exposed groups.


35

References

Agho KE, Hall J, Ewald B. 2014. Determinants of the knowledge of and attitude towards

tuberculosis in Nigeria. J Health Popul Nutr. 32 (3): 520-538.

Akhtar F, Javed MT, Aziz ur R, Khan MN, Akhtar P, Hussain SM, Aslam MS, Kausar R, Qamar

M, Cagiola M. 2015. The use of PCR technique in the identification of Mycobacterium

species responsible for bovine tuberculosis in cattle and buffaloes in Pakistan. Trop Anim

Health Prod. 47 (6): 1169-1175.

Allix-Beguec C, Fauville-Dufaux M, Stoffels K, Ommeslag D, Walravens K, Saegerman C,

Supply P. 2010. Importance of identifying Mycobacterium bovis as a causative agent of

human tuberculosis. Eur Respir J. 35 (3): 692-694.

Ameni G, Aseffa A, Engers H, Young D, Gordon S, Hewinson G, Vordermeier M. 2007. High

prevalence and increased severity of pathology of bovine tuberculosis in Holsteins

compared to zebu breeds under field cattle husbandry in central Ethiopia. Clin Vaccine

Immunol. 14 (10): 1356-1361.

Ameni G, Erkihun A. 2007. Bovine tuberculosis on small-scale dairy farms in Adama Town,

central Ethiopia, and farmer awareness of the disease. Rev Sci Tech. 26 (3): 711-719.

Aneesh T, Sharma. M, Katoch VC, Dhar P, Katoch RC. 2010. A study on the prevalence of

Bovine Tuberculosis in farmed dairy cattle in Himachal Pradesh. Vet World. 3 (9): 409-

414.

Anochie PI, Onyeneke EC, Onyeozirila AC, Igbolekwu LC, Onyeneke BC, Ogu AC. 2013.

Evaluation of public awareness and attitude to pulmonary tuberculosis in a Nigerian rural

community. Germs. 3 (2): 52-62.


36

Anonymous 2012. Emergency Prevention System for Animal Health. Transboundary Animal

Diseases Bulletin. 40 (40): 1- 43.

Arshad M, Ifrahim M, Ashraf M, Rehman SU, Khan HA. 2012. Epidemiological studies on

tuberculosis in buffalo population in villages around faisalabad. J. Anim Plant Sc. 22 (3):

246- 249.

Asante-Poku A, Aning KG, Boi-Kikimoto B, Yeboah-Manu D. 2014. Prevalence of bovine

tuberculosis in a dairy cattle farm and a research farm in Ghana. Onderstepoort J Vet Res.

81 (2): E1-6.

Awah-Ndukum J, Kudi AC, Bradley G, Ane-Anyangwe I, Titanji VPK, Fon-Tebug S,

Tchoumboue J. 2012. Prevalence of bovine tuberculosis in cattle in the highlands of

Cameroon based on the detection of lesions in slaughtered cattle and tuberculin skin tests

of live cattle. Veterinarni Medicina. 57 (2): 59–76.

Aydin FE, Ulger M, Emekdas G, Aslan G, Gunal S. 2012. [Isolation and identification of

Mycobacterium bovis and non-tuberculous mycobacteria in raw milk samples in Mersin

province]. Mikrobiyol Bul. 46 (2): 283-289.



Bashir M. Genetic and phenotypic aspects of some performance traits of Nili-Ravi buffaloes in

Pakistan. PhD Thesis, Dept. Anim. Breed. Genet., Univ. Agri. Faisalabad, Pakistan;

2006.

Bati J, Legesse M, Medhin G. 2013. Community's knowledge, attitudes and practices about

tuberculosis in Itang Special District, Gambella Region, South Western Ethiopia. BMC

Public Health. 13 734.


37

Ben Kahla I, Boschiroli ML, Souissi F, Cherif N, Benzarti M, Boukadida J, Hammami S. 2011.

Isolation and molecular characterisation of Mycobacterium bovis from raw milk in

Tunisia. Afr Health Sci. 11 Suppl 1 S2-5.

Bengis RG, Kriek NP, Keet DF, Raath JP, de Vos V, Huchzermeyer HF. 1996. An outbreak of

bovine tuberculosis in a free-living African buffalo (Syncerus caffer--sparrman)

population in the Kruger National Park: a preliminary report. Onderstepoort J Vet Res. 63

(1): 15-18.

Besser RE, Pakiz B, Schulte JM, Alvarado S, Zell ER, Kenyon TA, Onorato IM. 2001. Risk

factors for positive mantoux tuberculin skin tests in children in San Diego, California:

evidence for boosting and possible foodborne transmission. Pediatrics. 108 (2): 305-310.

Bhattacharya B, Karak K, Ghosal AG, Roy A, Das S, Dandapat P, Khetawat D, Mondal DK,

Bhattacharya S, Chakrabarti S. 2003. Development of a new sensitive and efficient

multiplex polymerase chain reaction (PCR) for identification and differentiation of

different mycobacterial species. Trop Med Int Health. 8 (2): 150-157.

Biya O, Gidado S, Abraham A, Waziri N, Nguku P, Nsubuga P, Suleman I, Oyemakinde A,

Nasidi A, Sabitu K. 2014. Knowledge, care-seeking behavior, and factors associated with

patient delay among newly-diagnosed pulmonary tuberculosis patients, Federal Capital

Territory, Nigeria, 2010. Pan Afr Med J. 18 Suppl 1 6.

Bonsu OA, Laing E, Akanmori BD. 2000. Prevalence of tuberculosis in cattle in the Dangme-

West district of Ghana, public health implications. Acta Trop. 76 (1): 9-14.

Boukary AR, Thys E, Abatih E, Gamatie D, Ango I, Yenikoye A, Saegerman C. 2011. Bovine

tuberculosis prevalence survey on cattle in the rural livestock system of Torodi (Niger).

PLoS One. 6 (9): e24629.


38

Briones V, de Juan L, Sánchez C, Vela AI, Galka M, Montero, Goyache J, Aranaz A,

Domìnguez L. 2000. Bovine tuberculosis and the endangered Iberian lynx. Emerg Infect

Dis. 6 (2): 189-191.

Bruning-Fann CS, Schmitt SM, Fitzgerald SD, Fierke JS, Friedrich PD, Kaneene JB, Clarke KA,

Butler KL, Payeur JB, Whipple DL, Cooley TM, Miller JM, et al. 2001. Bovine

tuberculosis in free-ranging carnivores from Michigan. J Wildl Dis. 37 (1): 58-64.

Buddle BM, Aldwell FE, Pfeffer A, Lisle GWD, Corner LA. 1994. Experimental

Mycobacterium bovis infection of cattle: effect of dose of M. bovis and pregnancy on

immune responses and distribution of lesions. N Z Vet J. 42 (5): 167-172.

Buddle BM, Livingstone PG, de Lisle GW. 2009. Advances in ante-mortem diagnosis of

tuberculosis in cattle. N Z Vet J. 57 (4): 173-180.

Cadmus SI, Adesokan HK, Jenkins AO, van Soolingen D. 2009. Mycobacterium bovis and M.

tuberculosis in Goats, Nigeria. Emerg Infect Dis. 15 (12): 2066-2067.

Cadmus SI, Yakubu MK, Magaji AA, Jenkins AO, van Soolingen D. 2010. Mycobacterium

bovis, but also M. africanum present in raw milk of pastoral cattle in north-central

Nigeria. Trop Anim Health Prod. 42 (6): 1047-1048.

Caley P, Hone J. 2004. Disease transmission between and within species, and the implications

for disease control. Journal of Applied Ecology. 41 (1): 94-104.

CFSPH 2015. The centre for food security and public health.

www.cfsph.iastate.edu/Factsheets/pdfs/bovine _tuberculosis.pdf. Accessed on 08 July

2015.

Chaddock MH 2002. Tuberculosis. Large animal internal medicine. 3rd Edition. Mosby

Publications, London. 588-589.

http://www.cfsph.iastate.edu/Factsheets/pdfs/bovine


39

Coleman JD, Cooke MM. 2001. Mycobacterium bovis infection in wildlife in New Zealand.

Tuberculosis (Edinb). 81 (3): 191-202.

Cordova E, Gonzalo X, Boschi A, Lossa M, Robles M, Poggi S, Ambroggi M. 2012. Human

Mycobacterium bovis infection in Buenos Aires: epidemiology, microbiology and

clinical presentation. Int J Tuberc Lung Dis. 16 (3): 415-417.

Cosivi O, Grange JM, Daborn CJ, Raviglione MC, Fujikura T, Cousins D, Robinson RA,

Huchzermeyer HF, de Kantor I, Meslin FX. 1998. Zoonotic tuberculosis due to

Mycobacterium bovis in developing countries. Emerg Infect Dis. 4 (1): 59-70.

Cosivi O, Meslin FX, Daborn CJ, Grange JM. 1995. Epidemiology of Mycobacterium bovis

infection in animals and humans, with particular reference to Africa. Rev Sci Tech. 14

(3): 733-746.

Courtenay O, Reilly LA, Sweeney FP, Hibberd V, Bryan S, Ul-Hassan A, Newman C,

Macdonald DW, Delahay RJ, Wilson GJ, Wellington EM. 2006. Is Mycobacterium bovis

in the environment important for the persistence of bovine tuberculosis? Biol Lett. 2 (3):

460-462.

Dankner WM, Davis CE. 2000. Mycobacterium bovis as a significant cause of tuberculosis in

children residing along the United States-Mexico border in the Baja California region.

Pediatrics. 105 (6): E79.

de Freitas IM, Popolin MP, Touso MM, Yamamura M, Rodrigues LB, Santos Neto M, Crispim

Jde A, Arcencio RA. 2015. Factors associated with knowledge about tuberculosis and

attitudes of relatives of patients with the disease in Ribeirao Preto, Sao Paulo, Brazil. Rev

Bras Epidemiol. 18 (2): 326-340.


40

de Kantor IN, Ambroggi M, Poggi S, Morcillo N, Da Silva Telles MA, Osorio Ribeiro M,

Garzon Torres MC, Llerena Polo C, Ribon W, Garcia V, Kuffo D, Asencios L, et al.

2008. Human Mycobacterium bovis infection in ten Latin American countries.

Tuberculosis (Edinb). 88 (4): 358-365.

Dean GS, Rhodes SG, Coad M, Whelan AO, Cockle PJ, Clifford DJ, Hewinson RG,

Vordermeier HM. 2005. Minimum infective dose of Mycobacterium bovis in cattle.

Infect Immun. 73 (10): 6467-6471.

Delahay RJ, De Leeuw AN, Barlow AM, Clifton-hadley RS, Cheeseman CL. 2002. The status of

Mycobacterium bovis infection in UK wild mammals: a review. Vet J. 164 (2): 90-105.

Demelash B, Inangolet F, Oloya J, Asseged B, Badaso M, Yilkal A, Skjerve E. 2009. Prevalence

of bovine tuberculosis in Ethiopian slaughter cattle based on post-mortem examination.

Trop Anim Health Prod. 41 (5): 755-765.



tuberculosis. Tuberculosis. 86 (2): 77-109.



tuberculosis. Tuberculosis (Edinb). 86 (2): 77-109.

Elias K, Hussein D, Asseged B, Wondwossen T, Gebeyehu M. 2008. Status of bovine

tuberculosis in Addis Ababa dairy farms. Rev Sci Tech. 27 (3): 915-923.


GK. 2013. First-Time Detection of Mycobacterium bovis in Livestock Tissues and Milk

in the West Bank, Palestinian Territories. PLoS Negl Trop Dis. 7 (9): e2417.


41

Esteban J, Robles P, Soledad Jimenez M, Fernandez Guerrero ML. 2005. Pleuropulmonary

infections caused by Mycobacterium bovis: a re-emerging disease. Clin Microbiol Infect.

11 (10): 840-843.

Figueiredo EES, Júnior ACC, Furlanetto LV, Silva FGS, Duarte RS, Silva JT, Lilenbaum W,

Paschoalin VMF. 2012. Molecular techniques for identification of species of the

Mycobacterium tuberculosis complex: The use of multiplex PCR and an adapted HPLC

method for identification of Mycobacterium bovis and diagnosis of bovine tuberculosis.

Understanding Tuberculosis – Global Experiences and Innovative Approaches to the

Diagnosis. 411–432.

Firdessa R, Tschopp R, Wubete A, Sombo M, Hailu E, Erenso G, Kiros T, Yamuah L,

Vordermeier M, Hewinson RG, Young D, Gordon SV, et al. 2012. High prevalence of

bovine tuberculosis in dairy cattle in central ethiopia: implications for the dairy industry

and public health. PLoS One. 7 (12): e52851.

Francis J 1948. Bovine tuberculosis: including a contrast with human tuberculosis. Aust Vet J.

24 (2): 47-48.

Franco MM, Paes AC, Ribeiro MG, de Figueiredo Pantoja JC, Santos AC, Miyata M, Leite CQ,

Motta RG, Listoni FJ. 2013. Occurrence of mycobacteria in bovine milk samples from

both individual and collective bulk tanks at farms and informal markets in the southeast

region of Sao Paulo, Brazil. BMC Vet Res. 9 85.

Gannon BW, Hayes CM, Roe JM. 2007. Survival rate of airborne Mycobacterium bovis. Res Vet

Sci. 82 (2): 169-172.

Garfein RS, Burgos JL, Rodriquez-Lainz A, Brodine S, Pietrucha A, Rondinelli A, Laniado-

Laborin R, Ibarra E, Canez A, Fraga M. 2011. Latent tuberculosis infection in a migrant


42

agricultural community in Baja California, Mexico. J Immigr Minor Health. 13 (5): 940-

947.

Gelaw M, Genebo T, Dejene A, Lemma E, Eyob G. 2001. Attitude and social consequences of

tuberculosis in Addis Ababa, Ethiopia. East Afr Med J. 78 (7): 382-388.

Gibson AL, Hewinson G, Goodchild T, Watt B, Story A, Inwald J, Drobniewski FA. 2004.

Molecular epidemiology of disease due to Mycobacterium bovis in humans in the United

Kingdom. J Clin Microbiol. 42 (1): 431-434.

Guerrero A, Cobo J, Fortun J, Navas E, Quereda C, Asensio A, Canon J, Blazquez J, Gomez-

Mampaso E. 1997. Nosocomial transmission of Mycobacterium bovis resistant to 11

drugs in people with advanced HIV-1 infection. Lancet. 350 (9093): 1738-1742.

Gumi B, Schelling E, Berg S, Firdessa R, Erenso G, Mekonnen W, Hailu E, Melese E, Hussein J,

Aseffa A, Zinsstag J. 2012. Zoonotic transmission of tuberculosis between pastoralists

and their livestock in South-East Ethiopia. Ecohealth. 9 (2): 139-149.

Gumi B, Schelling E, Firdessa R, Erenso G, Biffa D, Aseffa A, Tschopp R, Yamuah L, Young

D, Zinsstag J. 2012. Low prevalence of bovine tuberculosis in Somali pastoral livestock,

southeast Ethiopia. Trop Anim Health Prod. 44 (7): 1445-1450.

Himes EM, Luchsinger DW, Jarnagin JL, Thoen CO, Hood HB, Ferrin DA. 1980. Tuberculosis

in fennec foxes. J Am Vet Med Assoc. 177 (9): 825-826.

Hlavsa MC, Moonan PK, Cowan LS, Navin TR, Kammerer JS, Morlock GP, Crawford JT,

Lobue PA. 2008. Human tuberculosis due to Mycobacterium bovis in the United States,

1995-2005. Clin Infect Dis. 47 (2): 168-175.


43

Howley MM, Rouse CD, Katz DJ, Colson PW, Hirsch-Moverman Y, Royce RA. 2015.

Knowledge and Attitudes About Tuberculosis Among U.S.-Born Blacks and Whites with

Tuberculosis. J Immigr Minor Health. 17 (5): 1487-1495.

Humblet MF, Boschiroli ML, Saegerman C. 2009. Classification of worldwide bovine

tuberculosis risk factors in cattle: a stratified approach. Vet Res. 40 (5): 50.

Jabbar A, Khan J, Ullah A, Rehman H, Ali I. 2015. Detection of Mycobacterium tuberculosis

and Mycobacterium bovis from human sputum samples through multiplex PCR. Pak J

Pharm Sci. 28 (4): 1275-1280.

Jackson R, Cooke MM, Coleman JD, Morris RS, de Lisle GW, Yates GF. 1995. Naturally

occurring tuberculosis caused by Mycobacterium bovis in brushtail possums (Trichosurus

vulpecula): III. Routes of infection and excretion. N Z Vet J. 43 (7): 322-327.

Jacques CN, Jenks JA, Jenny AL, Griffin SL. 2003. Prevalence of chronic wasting disease and

bovine tuberculosis in free-ranging deer and elk in South Dakota. J Wildl Dis. 39 (1): 29-

34.

Jalil H, Das P, Suleman A. 2003. Bovine tuberculosis in dairy animals at Lahore: threat to the

public health. Metropolitan Corporation Lahore, Pakistan. Available at http://priory.com/

vet/bovinetb.htm.

Javed MT, Ahmad L, Feliziani F, Pasquali P, Akhtar M, Usman M, Irfan M, Severi G, Cagiola

M. 2012. Analysis of some of the epidemiological risk factors affecting the prevalence of

tuberculosis in buffalo at seven livestock farms in Punjab Pakistan. Asian Biomed. 6 (1):

35–42.

Javed MT, Farooqi AF, Ullah H. 2009. Epidemiological basis of bovine tuberculosis in

buffaloes. Pak J Zool. suppl 9 417–420.

http://priory.com/


44

Javed MT, Irfan M, Ali I, Farooqi FA, Wasiq M, Cagiola M. 2011. Risk factors identified

associated with tuberculosis in cattle at 11 livestock experiment stations of Punjab

Pakistan. Acta Trop. 117 (2): 109-113.

Javed MT, Shahid AL, Farooqi FA, Akhtar M, Cardenas GA, Wasiq M, Cagiola M. 2010. Risk

factors associated with the presence of positive reactions in the SCCIT test in water

buffalo around two cities in Punjab, Pakistan. Acta Trop. 115 (3): 242-247.


epidemiological aspects, along with haematological and serum protein changes. Vet.

arhiv. 76 (3): 193- 206.

Javed MT, Wasiq M, Farooqi FA, Shahid AL, Kausar R, Cagiola M. 2013. Certain risk factors

associated with positive SCCIT test for tuberculosis in cattle at two cities in Pakistan.

Asian Biomed. 7 (2): 267–274.

Jha VC, Morita Y, Dhakal M, Besnet B, Sato T, Nagai A, Kato M, Kozawa K, Yamamoto S,

Kimura H. 2007. Isolation of Mycobacterium spp. from milking buffaloes and cattle in

Nepal. J Vet Med Sci. 69 (8): 819-825.

Kar M, Logaraj M. 2010. Awareness, attitude and treatment seeking behaviour regarding

tuberculosis in a rural area of Tamil Nadu. Indian J Tuberc. 57 (4): 226-229.

Katale BZ, Mbugi EV, Karimuribo ED, Keyyu JD, Kendall S, Kibiki GS, Godfrey-Faussett P,

Michel AL, Kazwala RR, van Helden P, Matee MI. 2013. Prevalence and risk factors for

infection of bovine tuberculosis in indigenous cattle in the Serengeti ecosystem,

Tanzania. BMC Vet Res. 9 267.


45

Kazoora HB, Majalija S, Kiwanuka N, Kaneene JB. 2014. Prevalence of Mycobacterium bovis

skin positivity and associated risk factors in cattle from western Uganda. Trop Anim

Health Prod. 46 (8): 1383-1390.

Kazwala RR, Kambarage DM, Daborn CJ, Nyange J, Jiwa SF, Sharp JM. 2001. Risk factors

associated with the occurrence of bovine tuberculosis in cattle in the Southern Highlands

of Tanzania. Vet Res Commun. 25 (8): 609-614.

Keet DF, Kriek NP, Bengis RG, Grobler DG, Michel A. 2000. The rise and fall of tuberculosis in

a free-ranging chacma baboon troop in the Kruger National Park. Onderstepoort J Vet

Res. 67 (2): 115-122.

Keet DF, Kriek NP, Bengis RG, Michel AL. 2001. Tuberculosis in kudus (Tragelaphus

strepsiceros) in the Kruger National Park. Onderstepoort J Vet Res. 68 (3): 225-230.

Khan IA, Khan A. 2007. Prevalence and risk factors of bovine tuberculosis in Nili Ravi buffaloes

in the Punjab, Pakistan. Ital J Anim Sci. 6 (Suppl. 2): 817-820.

Khan IA, Khan A, Mubarak A, Ali S. 2008. Factors affecting prevalence of bovine tuberculosis

in nili ravi buffaloes. Pak V J. 28 (4): 155-158.

Khan JA, Irfan M, Zaki A, Beg M, Hussain SF, Rizvi N. 2006. Knowledge, attitude and

misconceptions regarding tuberculosis in Pakistani patients. J Pak Med Assoc. 56 (5):

211-214.

Khilji IA 1974. Incidence of tuberculosis amongst Kundi buffaloes. Pak J Anim Sci. 13 27–31.

Kulkarni P, Kudale A, Arasu K, Lab M, Darby W, Rangan S. 2014. Tuberculosis knowledge and

awareness in tribal-dominant districts of Jharkhand, India: implications for ACSM.

Public Health Action. 4 (3): 189-194.


46

Lantos Á, Niemann S, Mezősi L, Sós E, Erdélyi K, Dávid S, Parsons LM, Kubica T, Rüsch-

Gerdes S, Somoskövi Á. 2003. Pulmonary Tuberculosis due to Mycobacterium bovis in

Captive Siberian Tiger. Emerg Infect Dis. 9 (11): 1462-1464.




Lilenbaum W, Schettini JC, Souza GN, Ribeiro ER, Moreira EC, Fonseca LS. 1999. Comparison

between a gamma-IFN assay and intradermal tuberculin test for the diagnosis of bovine

tuberculosis in field trials in Brazil. Zentralbl Veterinarmed B. 46 (5): 353-358.

Lisle GWD, Kawakami RP, Yates GF, Collins DM. 2008. Isolation of Mycobacterium bovis and

other mycobacterial species from ferrets and stoats. Vet Microbiol. 132 (3-4): 402-407.

Lisle GWD, Mackintosh CG, Bengis RG. 2001. Mycobacterium bovis in free-living and captive

wildlife, including farmed deer. Rev Sci Tech. 20 (1): 86-111.

LoBue PA, Betacourt W, Peter C, Moser KS. 2003. Epidemiology of Mycobacterium bovis

disease in San Diego County, 1994-2000. Int J Tuberc Lung Dis. 7 (2): 180-185.

Lyashchenko KP, Greenwald R, Esfandiari J, Olsen JH, Ball R, Dumonceaux G, Dunker F,

Buckley C, Richard M, Murray S, Payeur JB, Andersen P, et al. 2006. Tuberculosis in

elephants: antibody responses to defined antigens of Mycobacterium tuberculosis,

potential for early diagnosis, and monitoring of treatment. Clin Vaccine Immunol. 13 (7):

722-732.

Ma E, Ren L, Wang W, Takahashi H, Wagatsuma Y, Ren Y, Gao F, Bi L. 2015. Demographic

and socioeconomic disparity in knowledge about tuberculosis in Inner Mongolia, China. J

Epidemiol. 25 (4): 312-320.


47

Mackintosh CG, de Lisle GW, Collins DM, Griffin JF. 2004. Mycobacterial diseases of deer. N

Z Vet J. 52 (4): 163-174.

Majoor CJ, Magis-Escurra C, van Ingen J, Boeree MJ, van Soolingen D. 2011. Epidemiology of

Mycobacterium bovis disease in humans, The Netherlands, 1993-2007. Emerg Infect Dis.

17 (3): 457-463.

Malone FE, Wilson EC, Pollock JM, Skuce RA. 2003. Investigations into an outbreak of

tuberculosis in a flock of sheep in contact with tuberculous cattle. J Vet Med B Infect Dis

Vet Public Health. 50 (10): 500-504.

Mark G, Neha S, Jennifer F. 2015. Epidemiology of Human Mycobacterium bovis Disease,

California, USA, 2003–2011. Emerging Infectious Disease journal. 21 (3): 435.

Mathews F, Macdonald DW, Taylor GM, Gelling M, Norman RA, Honess PE, Foster R, Gower

CM, Varley S, Harris A, Palmer S, Hewinson G, et al. Bovine tuberculosis

(Mycobacterium bovis) in British farmland wildlife: the importance to agriculture. 2006.

Mekibeb A, Fulasa TT, Firdessa R, Hailu E. 2013. Prevalence study on bovine tuberculosis and

molecular characterization of its causative agents in cattle slaughtered at Addis Ababa

municipal abattoir, Central Ethiopia. Trop Anim Health Prod. 45 (3): 763-769.

Menzies FD, Neill SD. 2000. Cattle-to-cattle transmission of bovine tuberculosis. Vet J. 160 (2):

92-106.

Mfinanga SG, Morkve O, Kazwala RR, Cleaveland S, Sharp MJ, Kunda J, Nilsen R. 2004.

Mycobacterial adenitis: role of Mycobacterium bovis, non-tuberculous mycobacteria,

HIV infection, and risk factors in Arusha, Tanzania. East Afr Med J. 81 (4): 171-178.


48

Michel AL, Coetzee ML, Keet DF, Mare L, Warren R, Cooper D, Bengis RG, Kremer K, van

Helden P. 2009. Molecular epidemiology of Mycobacterium bovis isolates from free-

ranging wildlife in South African game reserves. Vet Microbiol. 133 (4): 335-343.

Michel AL, Geoghegan C, Hlokwe T, Raseleka K, Getz WM, Marcotty T. 2015. Longevity of

Mycobacterium bovis in Raw and Traditional Souring Milk as a Function of Storage

Temperature and Dose. PLoS One. 10 (6): e0129926.

Michel AL, Muller B, van Helden PD. 2010. Mycobacterium bovis at the animal-human

interface: a problem, or not? Vet Microbiol. 140 (3-4): 371-381.

Mignard S, Pichat C, Carret G. 2006. Mycobacterium bovis Infection, Lyon, France. Emerg

Infect Dis. 12 (9): 1431-1433.

Milian-Suazo F, Perez-Guerrero L, Arriaga-Diaz C, Escartin-Chavez M. 2010. Molecular

epidemiology of human cases of tuberculosis by Mycobacterium bovis in Mexico. Prev

Vet Med. 97 (1): 37-44.

Mitserlich E, Marth EH. 1984. Microbial Survival in the Environment. Springer, Berlin.

Moiane I, Machado A, Santos N, Nhambir A, Inlamea O, Hattendorf J, Kallenius G, Zinsstag J,

Correia-Neves M. 2014. Prevalence of bovine tuberculosis and risk factor assessment in

cattle in rural livestock areas of Govuro District in the Southeast of Mozambique. PLoS

One. 9 (3): e91527.

Mondal MN, Nazrul HM, Chowdhury MR, Howard J. 2014. Socio-demographic factors

affecting knowledge level of Tuberculosis patients in Rajshahi City, Bangladesh. Afr

Health Sci. 14 (4): 855-865.


49

Moore R, Kennedy B, Schaeffer L, Moxley J. 1990. Relationships between reproduction traits,

age and body weight at calving, and days dry in first lactation Ayrshires and Holsteins. J

Dairy Sci. 73 (3): 835-842.

Morris RS, Pfeiffer DU, Jackson R. 1994. The epidemiology of Mycobacterium bovis infections.

Vet Microbiol. 40 (1-2): 153-177.

Munyeme M, Muma JB, Samui KL, Skjerve E, Nambota AM, Phiri IG, Rigouts L, Tryland M.

2009. Prevalence of bovine tuberculosis and animal level risk factors for indigenous

cattle under different grazing strategies in the livestock/wildlife interface areas of

Zambia. Trop Anim Health Prod. 41 (3): 345-352.

Mwakapuja RS, Makondo ZE, Malakalinga J, Bryssinckx W, Mdegela RH, Moser I, Kazwala

RR, Tanner M. 2013. Prevalence and significant geospatial clusters of bovine

tuberculosis infection at livestock-wildlife interface ecosystem in Eastern Tanzania. Trop

Anim Health Prod. 45 (5): 1223-1230.

Naranjo V, Gortazar C, Vicente J, de la Fuente J. 2008. Evidence of the role of European wild

boar as a reservoir of Mycobacterium tuberculosis complex. Vet Microbiol. 127 (1-2): 1-

9.

Neill SD, O'Brien JJ, Hanna J. 1991. A mathematical model for Mycobacterium bovis excretion

from tuberculous cattle. Vet Microbiol. 28 (1): 103-109.

Neill SD, Pollock JM, Bryson DB, Hanna J. 1994. Pathogenesis of Mycobacterium bovis

infection in cattle. Vet Microbiol. 40 (1-2): 41-52.

Neill SD, Skuce RA, Pollock JM. 2005. Tuberculosis--new light from an old window. J Appl

Microbiol. 98 (6): 1261-1269.


50

Neill SD, Skuce RA, Pollock JM. 2005. Tuberculosis – new light from an old window. Journal

of Applied Microbiology. 98 (6): 1261-1269.

Nishi JS, Shury T, Elkin BT. 2006. Wildlife reservoirs for bovine tuberculosis (Mycobacterium

bovis) in Canada: Strategies for management and research. Veterinary Microbiology. 112

(2–4): 325-338.

Nugent G 2011. Maintenance, spillover and spillback transmission of bovine tuberculosis in

multi-host wildlife complexes: A New Zealand case study. Veterinary Microbiology. 151

(1–2): 34-42.

O'Brien DJ, Schmitt SM, Berry DE, Fitzgerald SD, Vanneste JR, Lyon TJ, Magsig D, Fierke JS,

Cooley TM, Zwick LS, Thomsen BV. 2004. Estimating the true prevalence of

Mycobacterium bovis in hunter-harvested white-tailed deer in Michigan. J Wildl Dis. 40

(1): 42-52.

OIE 2004. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. 5th ed. office des

international epizooties paris.

OIE 2009. Bovine Tuberculosis. Chapter. 2.4.7 1.

Ojo O, Sheehan S, Corcoran GD, Okker M, Gover K, Nikolayevsky V, Brown T, Dale J, Gordon

SV, Drobniewski F, Prentice MB. 2008. Mycobacterium bovis strains causing smear-

positive human tuberculosis, Southwest Ireland. Emerg Infect Dis. 14 (12): 1931-1934.

Omer MK, Skjerve E, Woldehiwet Z, Holstad G. 2001. A cross-sectional study of bovine

tuberculosis in dairy farms in Asmara, Eritrea. Trop Anim Health Prod. 33 (4): 295-303.

Palmer MV, Waters WR. 2006. Advances in bovine tuberculosis diagnosis and pathogenesis:

what policy makers need to know. Vet Microbiol. 112 (2-4): 181-190.


51

Palmer MV, Waters WR, Whipple DL. 2002. Susceptibility of raccoons (Procyon lotor) to

infection with Mycobacterium bovis. J Wildl Dis. 38 (2): 266-274.

Palmer MV, Waters WR, Whipple DL. 2002. Aerosol delivery of virulent Mycobacterium bovis

to cattle. Tuberculosis (Edinb). 82 (6): 275-282.

Palmer MV, Whipple DL, Rhyan JC, Bolin CA, Saari DA. 1999. Granuloma development in

cattle after intratonsilar inoculation with Mycobacterium bovis. American journal of

veterinary research. 60 (3): 310-315.

Park D, Qin H, Jain S, Preziosi M, Minuto JJ, Mathews WC, Moser KS, Benson CA. 2010.

Tuberculosis due to Mycobacterium bovis in patients coinfected with human

immunodeficiency virus. Clin Infect Dis. 51 (11): 1343-1346.

Parra A, Fernandez-Llario P, Tato A, Larrasa J, Garcia A, Alonso JM, Hermoso de Mendoza M,

Hermoso de Mendoza J. 2003. Epidemiology of Mycobacterium bovis infections of pigs

and wild boars using a molecular approach. Vet Microbiol. 97 (1-2): 123-133.

Phillips CJ, Foster CR, Morris PA, Teverson R. 2003. The transmission of Mycobacterium bovis

infection to cattle. Res Vet Sci. 74 (1): 1-15.

Pollock JM, Rodgers JD, Welsh MD, McNair J. 2006. Pathogenesis of bovine tuberculosis: the

role of experimental models of infection. Vet Microbiol. 112 (2-4): 141-150.

Portillo-Gomez L, Sosa-Iglesias EG. 2011. Molecular identification of Mycobacterium bovis and

the importance of zoonotic tuberculosis in Mexican patients. Int J Tuberc Lung Dis. 15

(10): 1409-1414.

Proano-Perez F, Benitez-Ortiz W, Celi-Erazo M, Ron-Garrido L, Benitez-Capistros R, Portaels

F, Rigouts L, Linden A. 2009. Comparative intradermal tuberculin test in dairy cattle in


52

the north of Ecuador and risk factors associated with bovine tuberculosis. Am J Trop

Med Hyg. 81 (6): 1103-1109.

Putera I, Pakasi TA, Karyadi E. 2015. Knowledge and perception of tuberculosis and the risk to

become treatment default among newly diagnosed pulmonary tuberculosis patients

treated in primary health care, East Nusa Tenggara: a retrospective study. BMC Res

Notes. 8 238.

Rajpal S, Mittal A, Dhingra VK, Malhotra R, Gupta R, Malhotra C, Taneja DK. 2007.

Knowledge, attitude and practices regarding tuberculosis and dots among interns in delhi,

India. J Coll Physicians Surg Pak. 17 (8): 457-461.

Rakotosamimanana S, Mandrosovololona V, Rakotonirina J, Ramamonjisoa J, Ranjalahy JR,

Randremanana RV, Rakotomanana F. 2014. Spatial analysis of pulmonary tuberculosis in

Antananarivo Madagascar: tuberculosis-related knowledge, attitude and practice. PLoS

One. 9 (11): e110471.

Ramdas KE, Lyashchenko KP, Greenwald R, Robbe-Austerman S, McManis C, Waters WR.

2015. Mycobacterium bovis Infection in Humans and Cats in Same Household, Texas,

USA, 2012. Emerg Infect Dis. 21 (3): 480-483.

Ramirez-Villaescusa AM, Medley GF, Mason S, Green LE. 2009. Herd and individual animal

risks associated with bovine tuberculosis skin test positivity in cattle in herds in south

west England. Prev Vet Med. 92 (3): 188-198.

Rana M, Sayem A, Karim R, Islam N, Islam R, Zaman TK, Hossain G. 2015. Assessment of

knowledge regarding tuberculosis among non-medical university students in Bangladesh:

a cross-sectional study. BMC Public Health. 15 716.


53

Rao VG, Yadav R, Bhat J, Tiwari BK, Bhondeley MK. 2012. Knowledge and attitude towards

tuberculosis amongst the tribal population of Jhabua, Madhya Pradesh. Indian J Tuberc.

59 (4): 243-248.

Regassa A, Tassew A, Amenu K, Megersa B, Abunna F, Mekibib B, Marcotty T, Ameni G.

2010. A cross-sectional study on bovine tuberculosis in Hawassa town and its

surroundings, Southern Ethiopia. Trop Anim Health Prod. 42 (5): 915-920.

Rehman Z-U. Inter-Herd Performance and Genetic Evaluation of Sahiwal Cattle in Pakistan.

University of Agriculture, Faisalabad; 2006.

Rodriguez E, Sanchez LP, Perez S, Herrera L, Jimenez MS, Samper S, Iglesias MJ. 2009.

Human tuberculosis due to Mycobacterium bovis and M. caprae in Spain, 2004-2007. Int

J Tuberc Lung Dis. 13 (12): 1536-1541.

Rodwell TC, Kriek NP, Bengis RG, Whyte IJ, Viljoen PC, de Vos V, Boyce WM. 2001.

Prevalence of bovine tuberculosis in African buffalo at Kruger National Park. J Wildl

Dis. 37 (2): 258-264.

Rothel JS, Jones SL, Corner LA, Cox JC, Wood PR. 1992. The gamma-interferon assay for

diagnosis of bovine tuberculosis in cattle: conditions affecting the production of gamma-

interferon in whole blood culture. Aust Vet J. 69 (1): 1-4.

Sanou A, Tarnagda Z, Kanyala E, Zingué D, Nouctara M, Ganamé Z, Combary A, Hien H,

Dembele M, Kabore A, Meda N, Van de Perre P, et al. 2014. Mycobacterium bovis in

Burkina Faso: Epidemiologic and Genetic Links between Human and Cattle Isolates.

PLoS Negl Trop Dis. 8 (10): e3142.

Sapolsky RM, Else JG. 1987. Bovine tuberculosis in a wild baboon population: epidemiological

aspects. J Med Primatol. 16 (4): 229-235.


54

Serrano-Moreno BA, Romero TA, Arriaga C, Torres RA, Pereira-Suarez AL, Garcia-Salazar JA,

Estrada-Chavez C. 2008. High frequency of Mycobacterium bovis DNA in colostra from

tuberculous cattle detected by nested PCR. Zoonoses Public Health. 55 (5): 258-266.

Shirima GM, Kazwala RR, Kambarage DM. 2003. Prevalence of bovine tuberculosis in cattle in

different farming systems in the eastern zone of Tanzania. Prev Vet Med. 57 (3): 167-

172.

Silva HM, Wilcox CJ, Thatcher WW, Becker RB, Morse D. 1992. Factors Affecting Days Open,

Gestation Length, and Calving Interval in Florida Dairy Cattle1. J Dairy Sci. 75 (1): 288-

293.

Silva MR, Rocha Ada S, da Costa RR, de Alencar AP, de Oliveira VM, Fonseca Junior AA,

Sales ML, Issa Mde A, Filho PM, Pereira OT, dos Santos EC, Mendes RS, et al. 2013.

Tuberculosis patients co-infected with Mycobacterium bovis and Mycobacterium

tuberculosis in an urban area of Brazil. Mem Inst Oswaldo Cruz. 108 (3).

Singh MM, Bano T, Pagare D, Sharma N, Devi R, Mehra M. 2002. Knowledge and attitude

towards tuberculosis in a slum community of Delhi. J Commun Dis. 34 (3): 203-214.

Sreevatsan S, Bookout JB, Ringpis F, Perumaalla VS, Ficht TA, Adams LG, Hagius SD, Elzer

PH, Bricker BJ, Kumar GK, Rajasekhar M, Isloor S, et al. 2000. A multiplex approach to

molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J

Clin Microbiol. 38 (7): 2602-2610.

Stetter MD, Mikota SK, Gutter AF, Monterroso ER, Dalovisio JR, Degraw C, Farley T. 1995.

Epizootic of Mycobacterium bovis in a zoologic park. J Am Vet Med Assoc. 207 (12):

1618-1621.


55

Suleiman MM, Sahal N, Sodemann M, Elsony A, Aro AR. 2014. Tuberculosis awareness in

Gezira, Sudan: knowledge, attitude and practice case-control survey. East Mediterr

Health J. 20 (2): 120-129.

Sunder S, Lanotte P, Godreuil S, Martin C, Boschiroli ML, Besnier JM. 2009. Human-to-human

transmission of tuberculosis caused by Mycobacterium bovis in immunocompetent

patients. J Clin Microbiol. 47 (4): 1249-1251.

Thoen CO, Lobue PA, Enarson DA, Kaneene JB, de Kantor IN. 2009. Tuberculosis: a re-

emerging disease in animals and humans. Vet Ital. 45 (1): 135-181.

Thoen CO, Quinn WJ, Miller LD, Stackhouse LL, Newcomb BF, Ferrell JM. 1992.

Mycobacterium bovis infection in North American elk (Cervus elaphus). J Vet Diagn

Invest. 4 (4): 423-427.

Timothy CR, Marisa M, Kathleen SM, Stephanie KB, Steffanie AS. 2008. Tuberculosis from

Mycobacterium bovis in Binational Communities, United States. Emerging Infectious

Disease journal. 14 (6): 909.



Zool. 44 (2): 393-398.

Tobin EA, Okojie PW, Isah EC. 2013. Community knowledge and attitude to pulmonary

tuberculosis in rural Edo state, Nigeria. Ann Afr Med. 12 (3): 148-154.

Tolossa D, Medhin G, Legesse M. 2014. Community knowledge, attitude, and practices towards

tuberculosis in Shinile town, Somali regional state, eastern Ethiopia: a cross-sectional

study. BMC Public Health. 14 804.


56

Torres-Gonzalez P, Soberanis-Ramos O, Martinez-Gamboa A, Chavez-Mazari B, Barrios-

Herrera MT, Torres-Rojas M, Cruz-Hervert LP, Garcia-Garcia L, Singh M, Gonzalez-

Aguirre A, Ponce de Leon-Garduno A, Sifuentes-Osornio J, et al. 2013. Prevalence of

latent and active tuberculosis among dairy farm workers exposed to cattle infected by

Mycobacterium bovis. PLoS Negl Trop Dis. 7 (4): e2177.

Traore B, Diarra B, Dembele BP, Somboro AM, Hammond AS, Siddiqui S, Maiga M, Kone B,

Sarro YS, Washington J, Parta M, Coulibaly N, et al. 2012. Molecular strain typing of

Mycobacterium tuberculosis complex in Bamako, Mali. Int J Tuberc Lung Dis. 16 (7):

911-916.

Tschopp R, Bobosha K, Aseffa A, Schelling E, Habtamu M, Iwnetu R, Hailu E, Firdessa R,

Hussein J, Young D, Zinsstag J. 2011. Bovine tuberculosis at a cattle-small ruminant

human interface in Meskan, Gurage region, Central Ethiopia. BMC Infectious Diseases.

11:318 1- 10.

Tschopp R, Schelling E, Hattendorf J, Aseffa A, Zinsstag J. 2009. Risk factors of bovine

tuberculosis in cattle in rural livestock production systems of Ethiopia. Prev Vet Med. 89

(3-4): 205-211.

Twomey DF, Crawshaw TR, Anscombe JE, Farrant L, Evans LJ, McElligott WS, Higgins RJ,

Dean G, Vordermeier M, Jahans K, de la Rua-Domenech R. 2007. TB in llamas caused

by Mycobacterium bovis. Vet Rec. 160 (5): 170.

Vazquez-Chacon CA, Martinez-Guarneros A, Couvin D, Gonzalez YMJA, Rivera-Gutierrez S,

Escobar-Gutierrez A, De-la-Cruz Lopez JJ, Gomez-Bustamante A, Gonzalez-Macal GA,

Goncalves Rossi LM, Muniz-Salazar R, Rastogi N, et al. 2015. Human multidrug-

resistant Mycobacterium bovis infection in Mexico. Tuberculosis (Edinb).


57

Vos VD, Bengis RG, Kriek NP, Michel A, Keet DF, Raath JP, Huchzermeyer HF. 2001. The

epidemiology of tuberculosis in free-ranging African buffalo (Syncerus caffer) in the

Kruger National Park, South Africa. Onderstepoort J Vet Res. 68 (2): 119-130.

Wedlock DN, Skinner MA, de Lisle GW, Buddle BM. 2002. Control of Mycobacterium bovis

infections and the risk to human populations. Microbes Infect. 4 (4): 471-480.

Woodford MH 1982. Tuberculosis in wildlife in the Ruwenzori National Park Uganda (part I).

Trop Anim Health Prod. 14 (2): 81-88.

Young JS, Gormley E, Wellington EM. 2005. Molecular detection of Mycobacterium bovis and

Mycobacterium bovis BCG (Pasteur) in soil. Appl Environ Microbiol. 71 (4): 1946-1952.

Zarden CF, Marassi CD, Figueiredo EE, Lilenbaum W. 2013. Mycobacterium bovis detection

from milk of negative skin test cows. Vet Rec. 172 (5): 130.

Zumarraga MJ, Soutullo A, Garcia MI, Marini R, Abdala A, Tarabla H, Echaide S, Lopez M,

Zervini E, Canal A, Cataldi AA. 2012. Detection of Mycobacterium bovis-infected dairy

herds using PCR in bulk tank milk samples. Foodborne Pathog Dis. 9 (2): 132-137.

58

CHAPTER 3

EXPERIMENT -1

Risk Factors Associated with Mycobacterium Bovis Skin Positivity in Cattle and Buffalo in

Peshawar, Pakistan

Abstract

A cross-sectional study was carried out to determine the prevalence of bovine tuberculosis (bTB)

and associated risk factors in cattle and buffalo in Peshawar, Pakistan. Cattle and buffalo,

randomly selected from all four towns of District Peshawar were screened for bovine

tuberculosis using comparative cervical intradermal tuberculin test (CCIT). For obtaining data on

risk factors, socio-demographic condition, animal characteristics and management, interviewer

administered a pretested questionnaire to animal owners. Multivariable logistic regression

models were used to measure association between risk factors and comparative cervical

intradermal tuberculin reactors. A total of 556 cattle and buffalo were screened for bovine

tuberculosis. Out of 556 animals screened, 5.75% (3.9-8.0%) were found positive. The

prevalence was higher in old animals (P= 0.001) as compared to younger animals. Prevalence

also varied with source of animal (either raised on farm or purchased), stay of animals at night

(indoor or outdoor) and herd size. Farmer’s knowledge about transmission of TB from animals to

human as well as signs and symptoms of TB was extremely low. Only 3.6% farmers correctly

stated the combination of three major symptoms of TB. Results of the study call for immediate

intervention to control bTB in animals as well as its transmission to human population.

Furthermore, it is suggested to emphasize on local epidemiology of bTB and husbandry practices

of cattle and buffalo during the control program.

Key words: Bovine tuberculosis, Prevalence, zoonosis, Buffalo, Cattle, Risk factors

Experiment -1

59

Introduction

Bovine tuberculosis (bTB) cause by Mycobacterium bovis (M. bovis) is a chronic disease that

affects a wide range of mammals, including domestic cattle and humans (Humblet et al. 2009).

The main route of transmission is aerosol while the less common routes include ingestion of

contaminated feed, water and milk (Biet et al. 2005; Gumi et al. 2011; Awan et al. 2014).

Mycobacterium bovis is a zoonotic organism and human get infection through consumption of

raw/ unpasteurized milk from tuberculous animals, through inhalation by direct contact with

infected cattle and through mucous and skin by workers handling carcasses of infected animals

(Domenech 2006; Thoen et al. 2006; Michel et al. 2010). The losses to the cattle industry due to

bTB manifests as 10 to 20 % reduced milk and meat production, infertility, and carcass

contamination (Oliveira et al. 2007). The epidemic of HIV in developing countries in which M.

bovis is present in animals could make zoonotic tuberculosis a serious public health threat to

persons already at risk (Etter et al. 2006; LoBue et al. 2010). Prevalence of bTB varies greatly

among countries. The disease was a major problem few decades ago in developed countries but

following eradication programmes, its incidence has decreased greatly so that some countries are

now considered as disease free. Its prevalence is still high in developing countries because the

control strategies are either lacking or are poorly implemented (Amanfu 2006; Domenech 2006).

The animal level prevalence of bTB has been reported to be 13.5% and14.3% in Ethiopia and

India respectively (Ameni et al. 2007; Thakur et al. 2010). In Pakistan previous study conducted

in and around Faisalabad city using tuberculin skin test reported prevalence of 5.1% in cattle and

1.7% in buffaloes (Ifrahim 2001). In Lahore 6.9% buffaloes showed positive reaction to

tuberculin (Jalil et al. 2003). In Punjab province, 2.45% and 8.48% buffaloes at two farms were

found positive to tuberculin test (Javed et al. 2006). Another study reported 3% tuberculosis

Experiment -1

60

prevalence in buffaloes at Faisalabad and Okara (Javed et al. 2010). Bovine TB in cattle

population was reported to World Organization for Animal Health (OIE) by 128 out of 155

countries during the period 2005 to 2008 (Michel et al. 2010). In previous studies factors like

age, gender, breed, herd size and introduction of infected cattle to a bovine TB-free herd are

found to be associated with bTB occurrence. Increasing cattle age is associated with higher risk

of M. bovis infection as the older animals are more likely to have been exposed to M. bovis than

younger ones (Bernard et al. 2005; Oloya et al. 2006; Inangolet et al. 2008; Humblet et al. 2009).

Risk of M. bovis infection also varies with breed (Inangolet et al. 2008; Humblet et al. 2009;

Vordermeier et al. 2012) and gender (Bernard et al. 2005; Etter et al. 2006). The difference in

occurrence of bTB between breeds is more likely to be due to differences in management

systems. In large herds there are more chances of close contacts between animals thus increasing

the risk of bTB occurrence (Kaneene et al. 2002; Humblet et al. 2009; Humblet et al. 2010).

Arrival of infected cattle in a disease free herd is considered an important risk factors for

introducing the disease (Kaneene et al. 2002; Shirima et al. 2003; Johnston et al. 2005; Gopal et

al. 2006; Oloya et al. 2007).

Extensive efforts have been made internationally to eradicate bTB because of its serious zoonotic

and economic implications. In order to develop an effective national program for bTB

surveillance and control in developing countries, accurate data on bTB prevalence is needed

(Moiane et al. 2014). In Pakistan, data on bTB epidemiology is still scarce. No surveillance and

control programs of bTB have ever been implemented in Pakistan. Additionally, there are no

effective measures for preventing the transmission to human population. National tuberculosis

control program of Pakistan doesn’t take into account the zoonotic transmission of bTB.

Experiment -1

61

Materials and methods

This study was conducted in Peshawar, capital of Khyber Pakhtunkhwa Province. It is situated in

a large valley close to the Pak-Afghan border with an estimated 3.5 million human population.

Peshawar has 4 administrative units i-e Town I, Town II, Town III and Town IV. Sample size

was calculated separately for each town by considering the expected prevalence to be 10% based

on previous study of Khan et al. (2008) in Nili Ravi buffaloes, with confidence limits at 95%

(Thrusfield 2006)

Calculated the n= 139, so 139 cattle and buffalo from each Town and total of 556 (139x4)

animals from all the 4 towns were randomly selected. The sample was composed of 368 cattle

and 188 buffalo. This study was conducted during June 2014. All farmers participated in the

study were sedentary small and medium holders with similar mixed livestock-crop farming

system. Purpose and methodology of the study was explained to the animal owners and informed

consent was obtained. All the selected animals were screened for bTB using comparative

cervical intradermal tuberculin test (CCIT). Two sites 12-14 cm apart on one side of the neck

were shaved using scissors and blade, the sites were then cleaned and disinfected with Pyodine

(Povidone-Iodine, 7.5 % w/w). The skin fold thickness at the two sites was measured by caliper

and recorded. Each animal was then injected 0.1 ml (25,000 IU) avian Purified Protein

Derivative (PPD) at one site and 0.1 ml (20,000 IU) bovine PPD at another site intradermally.

Both avian and bovine PPD were obtained from Veterinary Research Institute, Lahore. The skin

fold thickness at both sites was measured and recorded again after 72 hours of the administration

of PPD. The tuberculin results were interpreted based on standard interpretation as recommended

n=Z21-α/2 P(1-P)/e2

Experiment -1

62

by World Organization for Animal Health (OIE). Animal was considered positive for bTB if

increase in skin thickness at Bovine PPD site (Bov72−Bov0) is 4mm greater than the increase in

skin thickness at Avian PPD site (Av72−Av0). Similarly animal was considered reactor of M.

avium if increase in skin thickness at Avian PPD site (Av72−Av0) is 4mm greater than the

increase in skin thickness at Bovine PPD site (Bov72−Bov0). Interviewer administered a

pretested questionnaire to animal owners and data regarding socio-demographic condition,

animal characteristics and management was obtained. The data collected were analysed by SPSS

software version 15.0. Multivariable logistic regression models were used to measure association

between risk factors and comparative cervical intradermal tuberculin reactors

Results

A total of 556 animals were screened for bovine tuberculosis (bTB) using comparative cervical

intradermal tuberculin test (CCIT). One hundred and forty three (25.72%) animals were from

small holder sector that kept livestock for household milk consumption while 413 (74.28%) were

from commercial sector. About two third of the animals were cattle (368/556) and the remaining

(188/556) were buffalo. Around 87% of the animals included in the study were female and 60%

were lactating. In 99.2% of the herds, tap water was used for drinking and cleaning purposes and

no herd had contact with wild animals. About 35% farmers introduced new stock into their

herds. Goat, donkey and poultry were present with cattle and buffalo on 27%, 4% and 51% farms

respectively. Testing animals for bTB was not done before in any of the herd. Only 28.6% farms

were in rural area, remaining 71.4% were in urban locality. Forty percent of the animal handlers

had age above 50 years, 14% from 41 to 50 years, 26% from 31 to 40 years and 20% between 20

and 30 years (Fig 3.1).

Experiment -1

63

Figure 3.1 Age distribution of livestock farmers.

112

145

78

221

0

50

100

150

200

250

20-30 years 31-40 years 41-50 years > 50 years

Experiment -1

64

Fifty percent animal handlers had secondary education, 28% middle, 13% graduate and 09%

were illiterate (Fig 3.2).

Figure 3.2 Education status of livestock farmers.

50

156

278

72

0

50

100

150

200

250

300

Illiterate Middle Secondary Graduate

Experiment -1

65

The distribution of farmers on the basis of socio-economic status was as follows: 7% very low,

36% low, 44% moderate and 13% high (Fig 3.3). The households were differentiated into

various socio-economic categories on the basis of monthly household income. Households

having income up to PKR 10,000 (95.15 USD) per month were considered “very low”, those

having monthly income from PKR 11,000 to 25,000 (105.8 USD - 240.4 USD) were considered

“low”, those with monthly income from PKR 26,000 to 50,000 (250.0 USD – 480.8USD) were

considered “moderate” and those with monthly income PKR 51,000 (490.4 USD) and above

were considered “high” socio-economic status

Figure 3.3 Distribution of livestock farmers on basis socio-economic status.

About 97% farmers had heard about tuberculosis and 20.3% were of the view that tuberculosis

is transmissible from animal to human. About one third (34%) of the farmers mentioned

correctly that TB is transmitted from animal to human through consumption of raw milk and

39

200

245

72

0

50

100

150

200

250

300

Very low Low Moderate High

Experiment -1

66

14% mentioned aerosol route as a mean of TB transmission. Other routes of transmission stated

by farmers were urine (33% farmers) and contact with feaces of diseased animals (24% farmers)

as shown in table 3.1.

Table 3.1 Mechanisms known to livestock farmers for the Transmission of TB from Animal

to Human.

Yes (%) No (%) Don’t know (%)

Consumption of Raw milk 34.0 57.7 8.3

Consumption of Boiled milk 8.8 84.5 6.7

Consumption of raw meat 11.3 79.9 8.8

Consumption of cooked meat 5.0 85.6 9.4

Though aerosol 14.0 81.1 4.9

Urine 33.1 52.0 14.9

Feaces 24.1 68.5 7.4

In regards to the farmers’ knowledge of the signs and symptoms of TB, 28.8% stated that chronic

cough lasts for more than 3 weeks was one symptom. 75.4% said weight loss was a symptom

and 22.2% mentioned coughing up blood or sputum. Many farmers did not know that certain

signs and symptoms, such as sweating at night (identified only by 14% farmers), were linked to

Experiment -1

67

TB, and also many incorrectly associated some signs and symptoms, like vomiting (8.3%) and

diarrhea (10.6) with TB (Fig. 3.4).

Figure 3.4 Distribution of signs and symptoms of TB known to livestock farmers.

National Tuberculosis Program of Pakistan recommends the combination of three signs “chronic

cough lasts for more than 3 weeks, fever and weight loss” as the main symptom of TB. Only

3.6% respondents correctly stated the combination of three signs of TB which indicated that

knowledge about TB was insufficient. Of 556 animals tested, 32 were classified as bTB positive

giving an overall prevalence of 5.75% (95%CI= 3.9-8.0). Town III had the highest number of

CCIT reactors followed by Town IV, Town I and Town II, however the difference was

statistically non-significant (p=0.416). Results of the CCIT are presented in Table 3.2.

0% 20% 40% 60% 80% 100%

Chronic cough lasts for more than 3 weeks

Pain in the chest

Coughing up blood or sputum

Weakness or fatigue

Weight loss

No appetite

Chills

Fever

Sweating at night

28.8

22.1

21.2

78.1

75.4

80.9

45.1

85.1

14.0

41.2

37.8

39.7

7.9

4.0

11.0

40.8

9.9

69.8

30.0

40.1

39.0

14.0

20.7

8.1

14.0

5.0

16.2

Yes

No

Don’t Know

Experiment -1

68

Table 3.2 Prevalence of bTB in four towns (administrative units) of Peshawar district

Administrative

Unit

Animal

screened

Tested positive Chi-square

N %

Town I 139 7 5.03% P= 0.416

Town II 139 6 4.31%

Town III 139 10 7.19%

Town IV 139 9 6.47%

No significant association was found between CCIT reactors and species of animals (p= 0.108),

gender (p= 0.108), lactation status (P= 0.499), presence of other stock with cattle and buffalo (P=

0.249), breeding methods (P= 0.153), number of old animals in the herd (P= 0.349), manure

disposal (P= 0.256), pet on farm (P= 0.115), ventilation status (P= 0.885), use of combine water

trough (P= 0.353), feeding methods (P= 0.682) or grazing type (P= 0.260). Bivariate (Table 3.3)

and multivariable regression analysis (Table 3.4) showed significant association between

positive reactor and age of animal, source of animal, herd size and night keeping of animals.

Experiment -1

69

Table 3.3 Bivariate frequency analysis of various parameters in positive and negative

tuberculin reactors

Parameter Negative Positive Chi-square

N %

Specie

Cattle 351 17 4.62% p= 0.108

Buffalo 173 15 7.98%

Sex

Male 65 5 7.14% p= 0.549

Female 459 27 5.56%

Age of animals (years)

1-2 91 4 4.21% P= 0.001

2-3 124 4 3.13%

3-5 180 3 1.64%

5 or above 129 21 14.00%

Lactation status

Lactating 312 20 6.02% P= 0.499

Non-Lactating 148 7 4.52%

Animal source

Raised at own farm 354 7 1.94% P= 0.000

Purchased 170 25 12.82%

Herd size

1-5 160 5 3.03% P= 0.001

6-15 151 3 1.95%

16-30 213 14 6.17%

Presence of other stock

with cattle and buffalo

Goat 147 4 2.65% P= 0.249

Donkey 20 3 13.04%

Poultry 287 22 7.12%

Experiment -1

70

None 70 3 4.11%

Breeding of animals

A.I 411 21 4.86% P= 0.153

Owned bull 44 5 10.20%

Not owned bull 69 6 8.00%

Number of old animals in

the herd

0 40 1 2.44% P= 0.349

1 45 2 4.26%

2 99 7 6.60%

3 117 9 7.14%

4 178 7 3.78%

5 or more 45 6 11.76%

Manure Disposal

Twice a day 42 5 10.64% P= 0.256

Daily 447 25 5.30%

Twice a week 35 2 5.41%

Pet on farm

Dog 80 7 8.05% P= 0.115

Backyard Poultry 92 8 8.00%

Other 150 8 5.06%

None 202 9 4.27%

Animals Kept at night

Outdoor 170 5 2.86% P= 0.047

Indoor 354 27 7.09%

Ventilation status (if

indoor at night)

Good 243 14 5.45% P= 0.885

Bad 112 6 5.08%

Water trough

Experiment -1

71

Combine 387 26 6.30% P= 0.353

Separate 137 6 4.20%

Feeding

Only grazing 27 3 10.00% P= 0.682

Only station feeding 312 15 4.59%

Grazing plus station

feeding

185 14 7.04%

Grazing type (if grazing) P= 0.260

Communal 42 2 4.55%

Non-communal 144 16 10.00%

Experiment -1

72

Table 3.4 Multivariable logistic regression analysis of parameters that showed significant

association with bTB positivity

Parameter Odd ratio 95% Confidence Interval p Value


1-2 Reference

2-3 1.142 0.264 - 4.936 0.859

3-5 0.631 0.117 - 3.420 0.594

5 or above 4.122 1.089 - 15.601 0.037

Animal source

Raised at own farm Reference

Purchased 4.388 1.666 - 11.553 0.003

Herd size

1-5 Reference

6-15 2.763 0.581 - 13.133 0.201

16-30 4.065 1.100 - 15.022 0.035


Outdoor Reference

Indoor 3.508 1.190 – 10.339 0.023

Bovine TB was more likely to occur in older animals (5 years and above) as compared to

younger ones (OR= 4.12; CI= 1.09-15.60; p=0.037). The rate of CCIT bTB reactors was higher

in animals that were purchased as compared to animals that were raised at own farm (OR= 4.39;

Experiment -1

73

CI= 1.66-11.55; p=0.003). Similarly the occurrence of bTB was high in large herds with 16-30

animals (OR=4.06; CI=1.10-15.02; p=0.035) and those animals that were kept indoor at night

(OR= 3.51; CI= 1.19-10.34; p= 0.023).

Table 3.5 Stepwise binary logistic regression model of independent variables

Parameter Odd ratio 95% Confidence Interval p Value


1-2 Reference

2-3 79.995 4.233-1511.732 0.003

3-5 123.313 5.431-2799.712 0.003

5 or above 4740.499 169.736-132396.069 0.000

Animal source

Raised at own farm Reference

Purchased 400.137 23.152-6915.525

Herd size

1-5 Reference

6-15 551.351 9.490-32033.968 0.002

16-30 3.169 0.288-34.857 0.346


Outdoor Reference

Indoor 18.176 2.048-161.313 0.009

Sex

Male Reference

Experiment -1

74

Female 0.013 0.000-0.532

Presence of other stock

with cattle and buffalo

Goat Reference

Donkey 1371.818 34.075-55228.514 0.000

Poultry 5.427 0.178-165.666 0.332

None 0.013 0.000-0.535 0.022

Breeding of animals

A.I Reference

Owned bull 1135.417 22.351-57679.334 .000

Not owned bull 193.794 2.339-16058.594 .019

Number of old animals in

the herd

0 Reference

1 4.106 0.084-201.138 0.477

2 24.165 0.189-3096.131 0.198

3 2.974 0.338-26.168 0.326

4 5.990 0.628-57.083 0.120

5 or more 6.978 0.815-59.741 0.076

Manure Disposal

Twice a day Reference

Daily 0.224 0.009-5.444 0.358

Twice a week 0.880 0.058-13.419 0.926

Experiment -1

75

Water trough

Combine Reference

Separate 0.436 0.073-2.598 0.362

Feeding

Only grazing Reference

Only station feeding 0.005 0.000-0.138 0.002

Grazing plus station

feeding

0.021 0.001-0.404 0.011

Discussion

Pakistan is a sub-tropical country and Peshawar district is located in sub-tropical continental

lowlands close to Pak-Afghan border. Pakistan and Afghanistan has porous border and people

along with their animals move across the border. This movement of animals across the border

may increase the risk of bTB in Peshawar district as Afghanistan is lacking bTB prevalence

studies and status of bTB is greatly unknown there. Therefore continuous surveillance of bTB in

Peshawar district is utmost important for timely detection of any change in bTB status.

Furthermore, identification of bTB risk factors is helpful for successful control and eradication

programs. In Peshawar district majority of the farmers keep livestock in mixed herds with

complex management practices that are very far from modern animal husbandry techniques. Risk

factors associated in this area with bTB positivity may differ from that of developed countries.

No test and slaughter program of bTB at national level is being implemented in Pakistan.

Presence of bTB in cattle and buffalo population at such a high level is not only alarming for

animal population but is a serious potential public health risk. In this study the overall animal

Experiment -1

76

level prevalence of CCIT reactors was found to be 5.75% in large ruminants. In our study the

prevalence was 7.98% in buffalo and 4.62% in cattle. Similarly, prevalence reported by Javed et

al. (2006) was 8.48%in buffaloes at a livestock experiment station, Pakistan which is close to our

results. Various studies have reported slightly higher prevalence in buffalo i.e. 9.6% (Mumtaz et

al. 2008), 10.6% (Khan et al. 2008), 11.3% (Javed et al. 2012) and 12.72% (Khan and Khan

2007), while some researchers have reported lower prevalence i.e. 3% (Javed et al. 2010), 2.2%

(Javed et al. 2009) and 1.7% (Ifrahim 2001). (Ghumman et al. 2013) reported higher prevalence

of bTB in cattle (11.71%) at various livestock farms in Punjab district. Animal husbandry

practices in all the 4 towns (administrative units) of district Peshawar were similar. This is reason

that they did not showed significant variation (P= 0.416) in prevalence of bTB. Results of

multivariable analysis showed that age of the animals was strongly associated with bTB

positivity. Animals with age 5 years or above were more effected by bTB as compared to others

(OR= 4.12; CI= 1.08-15.60). Many other studies have reported higher prevalence in older

cattle/buffalo than younger animals(Javed et al. 2006; Khan and Khan 2007; Javed et al. 2009),

which corroborates with our results. Using multivariate logistic regression analysis, link between

age and bTB positivity has been established in previous studies (Javed et al. 2012; Moiane et al.

2014). Previously it has been reported that cattle susceptibility to M. bovis infection increases

with age (Cagiola et al. 2004). With increase in age the risk of exposure to M. bovis increases

(Humblet et al. 2009). The increased prevalence in older animals is consistent with endemic

pattern of bTB as in an endemic situation animals become more likely to expose with time and

hence show increasing positivity with age. In humans the reason of higher rates of TB in old age

is thought to be due to reactivation of latent infection but is not validated yet in animals

(Cleaveland et al. 2007). The animals that were kept indoor at night were more likely to become

Experiment -1

77

infected with bTB (OR=3.50; CI=1.19-10.33) as compared to those that were kept outdoor at

night. Cleaveland et al. (2007) have reported similar findings that herds that were housed inside

at night had greater prevalence of CCIT positives as compared to those that were housed outside

at night. As respiratory route is the major pathway of bTB transmission so the reason behind

higher proportion of CCIT bTB reactors under indoor housing at night might be higher number

of bacilli per unit area of the internal air of the house and more chances of close interaction of

susceptible animals with the infected one. Our findings are also supported by observations of

(Katale et al. 2012) that defective ventilation facilitates transmission of bTB. In current study the

bTB positivity was significantly associated with purchase of animal. These findings are in

accordance with results of various studies conducted in Uganda (Oloya et al. 2007; Kazoora et

al. 2014) and England (Gopal et al. 2006). The higher prevalence of bTB in animals that were

purchased may be due to their exposure to bTB infected animals in live animals market or during

their stay at various farms. This study revealed that occurrence of bTB is high on farms with

larger herd size. (Brooks-Pollock and Keeling 2009) reported that herd size and bTB persistence

has positive correlation. (McGeary 2008) has reviewed that bTB has link with larger herds.

Farms with large herd size may have more chances of having bTB infected animals and

subsequently more chances of transmission to other animals in the herd.

Directly Observed Treatment, Short-course (DOTS) is recommended strategy of World Health

Organization (WHO) for tuberculosis control and is generally effective in treating TB cases,

however lack of knowledge about sign and symptoms of TB and unawareness about free of cost

availability of diagnosis and treatment facilities under this program is contributing to the

increasing incidence of TB in Pakistan. Education about symptoms, transmission as well as

adequate treatment of the TB is direly needed to decrease the burden of disease (Mangesho et al.

Experiment -1

78

2007). McGeary (2008) also reported that TB education is lacking in Tanzania and other African

countries which is in accordance with the findings of our study. Awareness campaigns, seminars,

workshops and use of electronic and print media should be part of Tb control programs,

particularly in developing countries like Pakistan where literacy rate is comparatively low.

The results of the current study provide preliminary information about prevalence and potential

risk factors that were associated with bTB positivity in cattle and buffalo. Therefore, these risk

factors should be considered during any future bTB control strategies.

Experiment -1

79

References

Amanfu W 2006. The situation of tuberculosis and tuberculosis control in animals of economic

interest. Tuberculosis (Edinb). 86 (3-4): 330-335.

Ameni G, Aseffa A, Engers H, Young D, Gordon S, Hewinson G, Vordermeier M. 2007. High

prevalence and increased severity of pathology of bovine tuberculosis in Holsteins

compared to zebu breeds under field cattle husbandry in central Ethiopia. Clin Vaccine

Immunol. 14 (10): 1356-1361.

Awan F, Ali MM, Iqbal U, Khattak I, Mushtaq MH. 2014. Some challenges in progressive

control of livestock originated zoonotic diseases in Pakistan–a pilot survey. Asian Pacific

Journal of Tropical Biomedicine. 4 (10): 821-824.

Bernard F, Vincent C, Matthieu L, David R, James D. 2005. Tuberculosis and brucellosis

prevalence survey on dairy cattle in Mbarara milk basin (Uganda). Prev Vet Med. 67 (4):

267-281.

Biet F, Boschiroli ML, Thorel MF, Guilloteau LA. 2005. Zoonotic aspects of Mycobacterium

bovis and Mycobacterium avium-intracellulare complex (MAC). Vet Res. 36 (3): 411-

436.

Brooks-Pollock E, Keeling M. 2009. Herd size and bovine tuberculosis persistence in cattle

farms in Great Britain. Prev Vet Med. 92 (4): 360-365.

Cagiola M, Feliziani F, Severi G, Pasquali P, Rutili D. 2004. Analysis of possible factors

affecting the specificity of the gamma interferon test in tuberculosis-free cattle herds.

Clin Diagn Lab Immunol. 11 (5): 952-956.

Experiment -1

80

Cleaveland S, Shaw DJ, Mfinanga SG, Shirima G, Kazwala RR, Eblate E, Sharp M. 2007.

Mycobacterium bovis in rural Tanzania: risk factors for infection in human and cattle

populations. Tuberculosis (Edinb). 87 (1): 30-43.



tuberculosis. Tuberculosis (Edinb). 86 (2): 77-109.

Etter E, Donado P, Jori F, Caron A, Goutard F, Roger F. 2006. Risk analysis and bovine

tuberculosis, a re-emerging zoonosis. Ann N Y Acad Sci. 1081 61-73.

Ghumman MA, Manzoor AW, Naz S, Ahmad R, Ahmad R. 2013. Prevalence of Tuberculosis in

Cattle and Buffalo at Various Livestock Farms in Punjab. Int J Vet Medi Res Report.

2013 1-4.

Gopal R, Goodchild A, Hewinson G, de la Rua Domenech R, Clifton-Hadley R. 2006.

Introduction of bovine tuberculosis to north-east England by bought-in cattle. Vet Rec.

159 (9): 265-271.

Gumi B, Schelling E, Firdessa R, Aseffa A, Tschopp R, Yamuah L, Young D, Zinsstag J. 2011.

Prevalence of bovine tuberculosis in pastoral cattle herds in the Oromia region, southern

Ethiopia. Trop Anim Health Prod. 43 (6): 1081-1087.

Humblet MF, Boschiroli ML, Saegerman C. 2009. Classification of worldwide bovine

tuberculosis risk factors in cattle: a stratified approach. Vet Res. 40 (5): 50-73.

Humblet MF, Gilbert M, Govaerts M, Fauville-Dufaux M, Walravens K, Saegerman C. 2010.

New assessment of bovine tuberculosis risk factors in Belgium based on nationwide

molecular epidemiology. J Clin Microbiol. 48 (8): 2802-2808.

Experiment -1

81

Ifrahim M 2001. Epidemiological Studies on Tuberculosis in Cattle and Buffalo Population in

Villages around Faisalabad. Department of Veterinary Microbiology, University of

Agriculture, Faisalabad, Pakistan. Msc (Hons) Thesis.

Inangolet FO, Demelash B, Oloya J, Opuda-Asibo J, Skjerve E. 2008. A cross-sectional study of

bovine tuberculosis in the transhumant and agro-pastoral cattle herds in the border areas

of Katakwi and Moroto districts, Uganda. Trop Anim Health Prod. 40 (7): 501-508.

Jalil H, Das P, Suleman A. 2003. Bovine tuberculosis in dairy animals at Lahore, threat to the

public health. Metropolitan Corporation Lahore, Pakistan.

http://priory.com/vet/bovinetb.htm.

Javed MT, Ahmad L, Felizianib F, Pasqualic P, Akhtard M, Usman M, Irfan M, Severib G,

Cagiola M. 2012. Analysis of some of the epidemiological risk factors affecting the

prevalence of tuberculosis in buffalo at seven livestock farms in Punjab Pakistan. Asian

Biomedicine. 6 (1): 35-42.

Javed MT, Farooqi AF, Ullah H. 2009. Epidemiological basis of bovine tuberculosis in

buffaloes. Pak J Zool. 9 (suppl.): 417-420.

Javed MT, Shahid AL, Farooqi FA, Akhtar M, Cardenas GA, Wasiq M, Cagiola M. 2010. Risk

factors associated with the presence of positive reactions in the SCCIT test in water

buffalo around two cities in Punjab, Pakistan. Acta Trop. 115 (3): 242-247.


epidemiological aspects, along with haematological and serum protein changes. Vet

Arhiv. 76 (3): 193-206.

Johnston WT, Gettinby G, Cox DR, Donnelly CA, Bourne J, Clifton-Hadley R, Le Fevre AM,

McInerney JP, Mitchell A, Morrison WI, Woodroffe R. 2005. Herd-level risk factors

http://priory.com/vet/bovinetb.htm

Experiment -1

82

associated with tuberculosis breakdowns among cattle herds in England before the 2001

foot-and-mouth disease epidemic. Biol Lett. 1 (1): 53-56.

Kaneene JB, Bruning-Fann CS, Granger LM, Miller R, Porter-Spalding BA. 2002.

Environmental and farm management factors associated with tuberculosis on cattle farms

in northeastern Michigan. J Am Vet Med Assoc. 221 (6): 837-842.

Katale BZ, Mbugi EV, Kendal S, Fyumagwa RD, Kibiki GS, Godfrey-Faussett P, Keyyu JD,

Van Helden P, Matee MI. 2012. Bovine tuberculosis at the human-livestock-wildlife

interface: is it a public health problem in Tanzania? A review. Onderstepoort J Vet Res.

79 (2): 463.

Kazoora HB, Majalija S, Kiwanuka N, Kaneene JB. 2014. Prevalence of Mycobacterium bovis

skin positivity and associated risk factors in cattle from western Uganda. Trop Anim

Health Prod. 46 (8): 1383-1390.

Khan IA, Khan A. 2007. Prevalence and risk factors of bovine tuberculosis in Nili-Ravi

buffaloes in the Punjab, Pakistan. Ital J Anim Sci. 6 (suppl 2): 817-820.

Khan IA, Khan A, Mubarak A, Ali S. 2008. Factors Affecting Prevalence Of Bovine

Tuberculosis In Nili Ravi Buffaloes. Pak Vet J. 28 (4): 155-158.

LoBue PA, Enarson DA, Thoen CO. 2010. Tuberculosis in humans and animals: an overview.

Int J Tuberc Lung Dis. 14 (9): 1075-1078.

Mangesho PE, Shayo E, Makunde WH, Keto GB, Mandara CI, Kamugisha ML, Kilale AM,

Ishengoma DR. 2007. Community knowledge, attitudes and practices towards

tuberculosis and its treatment in Mpwapwa district, central Tanzania. Tanzan Health Res

Bull. 9 (1): 38-43.

Experiment -1

83

McGeary A 2008. The Role of Mycobacterium bovis in tuberculosis in Africa. Med J Ther Afr. 2

59-62.



Moiane I, Machado A, Santos N, Nhambir A, Inlamea O, Hattendorf J, Kallenius G, Zinsstag J,

Correia-Neves M. 2014. Prevalence of bovine tuberculosis and risk factor assessment in

cattle in rural livestock areas of Govuro District in the Southeast of Mozambique. PLoS

One. 9 (3): e91527.

Mumtaz N, Chaudhry ZI, Mahmood N, Shakoori AR. 2008. Reliability of PCR for detection of

bovine tuberculosis in Pakistan. Pak J Zool. 40 (5): 347-351.

Oliveira I, Melo H, Câmara A, Dias R, Soto-Blanco B. 2007. Prevalência de tuberculose no

rebanho bovino de Mossoró, Rio Grande do Norte (Prevalence of bovine tuberculosis in a

bovine herd from Mossoró, Rio Grande do Norte). Braz J Vet Res Anim Sci. 44 (6): 395-

400.

Oloya J, Muma JB, Opuda-Asibo J, Djonne B, Kazwala R, Skjerve E. 2007. Risk factors for

herd-level bovine-tuberculosis seropositivity in transhumant cattle in Uganda. Prev Vet

Med. 80 (4): 318-329.

Oloya J, Opuda-Asibo J, Djonne B, Muma JB, Matope G, Kazwala R, Skjerve E. 2006.

Responses to tuberculin among Zebu cattle in the transhumance regions of Karamoja and

Nakasongola district of Uganda. Trop Anim Health Prod. 38 (4): 275-283.

Shirima GM, Kazwala RR, Kambarage DM. 2003. Prevalence of bovine tuberculosis in cattle in

different farming systems in the eastern zone of Tanzania. Prev Vet Med. 57 (3): 167-

172.

Experiment -1

84

Thakur A, Sharma M, Katoch VC, Dhar P, Katoch R. 2010. A study on the prevalence of Bovine

Tuberculosis in farmed dairy cattle in Himachal Pradesh. Vet World. 13 (9): 408-414.

Thoen C, Lobue P, de Kantor I. 2006. The importance of Mycobacterium bovis as a zoonosis.

Vet Microbiol. 112 (2-4): 339-345.

Vordermeier M, Ameni G, Berg S, Bishop R, Robertson BD, Aseffa A, Hewinson RG, Young

DB. 2012. The influence of cattle breed on susceptibility to bovine tuberculosis in

Ethiopia. Comp Immunol Microbiol Infect Dis. 35 (3): 227-232.

85

CHAPTER 4

EXPERIMENT -2

Detection of Mycobacterium Bovis in Bovine Milk And Knowledge, Attitude and Practice

about Tuberculosis in Peshawar, Pakistan

Abstract

This study aims to assess the presence of Mycobacterium bovis (M. bovis) in milk sold at retail

shops and to find the knowledge, attitude and practice about tuberculosis (TB) in the high risk M.

bovis contaminated milk consumers in Peshawar district, Pakistan. Milk samples were obtained

from 92 milk shops and analysed for presence of M. bovis using Polymerase Chain Reaction. M.

bovis was detected in 8.7% (8/92) milk samples. Eight hundred consumers of M. bovis

contaminated milk were interviewed. Although 97.4% of the participants had heard of TB but

only 39.6% knew that cough lasting for more than 3 weeks was one symptom of TB. Only 79.2%

were aware that TB can be prevented and the most frequently stated (48.4%) method of TB

prevention was good nutrition. Participants believed that TB can be cured by prayers/ eating well

(41.8%) and also by herbal cures/ consulting Hakeem (Traditional practitioner) (35.7%). Mean

knowledge score for the participants was 12.1± 2.47 out of maximum 22. Mean knowledge score

varied significantly with ethnicity, level of education and residential status (Urban vs rural).

Overall knowledge about symptom, transmission, prevention and treatment of TB was low.

Therefore community’s health education focused on increasing knowledge of TB must be

initiated.

Key words: Public Health, milk consumers, health-seeking behavior, tuberculosis

Experiment -2

86

Introduction

Tuberculosis (TB), caused by Mycobacterium spp., is considered to be second devastating

diseases in the history of world (WHO 2015). An estimated 9.0 million new cases of TB were

reported globally in 2013 (WHO 2014), while the latent TB infected (LTBI) population is under

reported. Pakistan is ranked 8th among the highest TB burden countries (Mushtaq et al. 2010). In

Pakistan, the incidence of TB is increasing and has reached to 287 cases per 100,000 population

and lack of awareness, policies or appropriate use of resources are contributing factors to this

development (WHO 2015).

TB of zoonotic origin, known as bovine TB, is caused by Mycobacterium bovis (M. bovis) and

commonly contracted through unpasteurized milk consumption (WHO 2007; Borna et al. 2013;

Awan et al. 2014). Although the burden of bovine TB among humans is estimated quite low but

its prevalence varies among continents. Furthermore, its condition worsens in third world

countries due to multiple risk factors i.e. irregular milk pasteurization, improper meat inspection,

high prevalence of bTB in animals, human behavior and HIV infections. In Pakistan, very little is

known about bovine TB among humans. Rise in bovine TB among humans should be considered

especially in developing countries where unpasteurized milk is frequently used for human

consumption. In Pakistan, the general public usually prefers to purchase unpasteurized milk due

to low income instead of the expensive pasteurized and Ultra Heat Treated (UHT) milk.

Improvement of knowledge, attitudes and practices (KAP) among general public could have an

important impact on the reduction of this fatal infection (Khan et al. 2006).

The objective of the current study was to detect M. bovis) in milk sold at retail shops and to

describe and evaluate weak areas in knowledge, attitudes and practices among general public

Experiment -2

87

with regards to tuberculosis in Peshawar District, Pakistan. Such information is essential for

future control programs and public health interventions.


Setting, design and sample size

The study was conducted in Peshawar District, Pakistan between January and May, 2015. This

was a cross-sectional study of retail milk shops and their consumers. There are 92 Union

Councils (administrative units) in the Peshawar District. One retail milk shop was identified

conveniently in each union council and milk from these retail shops were processed by PCR for

presence of M. bovis, Total of 800 consumers (100 consumers of each M. bovis contaminated

milk shop) were interviewed.

Milk samples processing

From each selected shop, 50-100 ml of milk sample was collected in a sterile plastic bag

and was transported in ice-packed cooler to the Provincial Tuberculosis Reference Laboratory

(Biosafety level III), Peshawar where it was stored at 4-8oC until analysis. The DNA was

isolated from milk with the help of Genolyse ® DNA kit. and PCR protocol described by Tipu

et al., (2012) for detection of M. bovis in milk was followed with some modifications using JB

primers (Forward: JB21 TCGTCCGCTGATGCAAGTGC; Reverse: JB22:

CGTCCGCTGACCTCAAGAAAG) (Tipu et al. 2012).

Data collection

A questionnaire was developed by the authors from literature review and local knowledge of the

area. Interviews of the 800 milk consumers were conducted in local languages (Pushto/ Urdu)

Experiment -2

88

during the visit of consumers to milk shops for purchase of milk. All interview participants were

briefed about the aims of the study and verbal consent was obtained before starting the interview.

The study was approved by “Ethical Review of Committee” of University of Veterinary and

Animal Sciences, Lahore, Pakistan.

Knowledge, Attitude and Practices assessment

The questionnaire was composed of 4 parts. First part focused on socio-demographic and general

information about the respondents. The socio-demographic variables included in data analysis

were nationality, age, education, residence and socio-economic status. Second part addressed

knowledge about the cause, signs and symptoms, transmission, prevention and treatment of TB

by asking 10 main questions that were collectively composed of 22 items. A score of 1 was given

for each correct response and a zero score was given for each incorrect and ‘I don’t know’

responses. So the maximum obtainable score was 22. Third part explored attitude and practices

about TB and final part documented the milk consumption habits, previous history of TB,

sources of information regarding TB and information about cost of TB treatment.

Statistical analysis

Data obtained was entered in Excel software (Microsoft) and statistical analyses performed in

SPSS version 16.0 (IBM Corp., USA). Descriptive statistics were employed for computing

demographic characteristics, knowledge, attitude and practices related to TB. Mann–Whitney U

test and one-way ANOVA was applied to find differences in knowledge score for socio

demographic variables having two and three groups respectively.

Experiment -2

89

Results

Presence of Mycobacterium bovis in milk

Total of 8.7% (8/92) milk samples collected from retail milk shops were positive for M. bovis by

Polymerase chain reaction (PCR) analysis.

Socio-demographic characteristics of M. bovis contaminated milk consumers

Out of total 800 consumers, 89.5% were Pakistani national and 10.5% were Afghan refugees.

Majority of the respondents (34.4%) were between 20 to 30 years of age, 22.6% between 30 to

40 years, 15.8% between 41 to 50 years, 12.0% above 50 years and 15.3% were younger than 20

years of age. Consumers living in urban area constituted 73.5%, 43.9% had secondary level of

education and 38.9% belonged to medium socio-economic status (Table 4.1).

Experiment -2

90

Table 4.1 Association of Socio demographic characteristics and knowledge regarding

tuberculosis among M. bovis contaminated milk consumers (n=800)

Characteristics Frequency Percentage Knowledge score Mean± SD P value

Nationality

Pakistani 716 89.5 12.3± 2.3 0.000*

Afghani 84 10.5 10.5± 3.2

Age

<20 Years 122 15.3 12.1± 2.7 0.201**

20-30 Years 275 34.4 12.3± 2.3

31-40 Years 181 22.6 11.9± 2.2

41-50 Years 126 15.8 12.4± 2.0

50 Years 96 12.0 11.8± 3.3

Education Level

Illiterate 74 9.2 10.2± 2.9 0.000**

Middle 239 29.9 11.9± 2.0

Secondary 351 43.9 12.4± 2.3

Graduate or above 136 17.0 12.9± 2.7

Residence

Urban 588 73.5 12.6± 2.4 0.000*

Rural 212 26.5 10.9± 2.1

Socio-economic

Status

Very High 13 1.6 13.2± 2.6 0.258**

High 58 7.3 12.4± 3.3

Medium 311 38.9 12.2± 2.0

Low 325 40.6 12.1± 2.5

Very Low 93 11.6 11.8± 2.8

* Mann–Whitney U test , **One way ANOVA

Experiment -2

91

Knowledge of participants about the cause, signs and symptoms, transmission, prevention and

treatment of TB

Mean knowledge score for the participants was 12.1± 2.47 and median score was 12. Individual

minimum obtained knowledge score was 5 and maximum was 17. Mean knowledge for Pakistani

nationals, those with higher level of education and urban residents were significantly higher than

Afghan refugees, those with lower level of education and rural residents respectively (Table 4.2).

Majority of the participants (n= 779, 97.4%) had heard of TB at some point of life. Among the

respondents, 34.6% mentioned micro-organisms as causative agents of TB while 15.2% stated

TB as a hereditary disease. Regarding the participants knowledge about signs and symptoms of

TB (Table 4.2), weight loss was mentioned by 691 (86.4%), weakness or fatigue 673 (84.1%),

fever 671 (83.9%), no appetite 611 (76.4%), chronic cough lasts for more than 3 weeks 317

(39.6%), chills 255 (31.9%), pain in the chest 249 (31.1%), coughing up blood or sputum 231

(28.9%) and sweating at night 97 (12.1%).

Experiment -2

92

Table 4.2 Participant’s health status and knowledge about signs and symptoms of

tuberculosis

Knowledge of the participants Health of the

participants

Signs and symptoms Yes

Number (%)

No

Number (%)

Don’t Know

Number (%)

Yes

Number (%)

Chronic cough lasts for more

than 3 weeks

317 (39.6) 401 (50.1) 82 (10.2) 13 (1.6)

Pain in the chest 249 (31.1) 498 (62.2) 53 (6.6) 10 (1.2)

Coughing up blood or

sputum

231 (28.9) 504 (63.0) 65 (8.1) 11 (1.4)

Weakness or fatigue 673 (84.1) 87 (10.9) 40 (5.0) 113 (14.1)

Weight loss 691 (86.4) 80 (10.0) 29 (3.6) 95 (11.9)

No appetite 611 (76.4) 169 (21.1) 20 (2.5) 27 (3.4)

Chills 255 (31.9) 470 (58.8) 75 (9.4) 1 (0.1)

Fever 671 (83.9) 69 (8.6) 60 (7.5) 7 (0.9)

Sweating at night 97 (12.1) 635 (79.4) 68 (8.5) 1 (0.1)

The participants’ health status was determined on the basis of self-reported signs and symptoms

of Tb. Participants were asked about the presence/ absence of Tb signs and their responses were

recorded as shown in Table 4.2

Experiment -2

93

About three quarters of participants (73.9%) classified TB as communicable disease (Table 4.3).

Table 4.3 Participants knowledge about transmission, prevention and treatment of TB (n=

800)

Yes No Don’t Know

Number (%) Number (%) Number (%)

Is TB a communicable disease? 591 (73.9) 135 (16.9) 74 (9.2)

TB transmitted through

Cough or sneeze 308 (38.5) 375 (46.9) 117, (14.6)

Hand shake 47 (5.9) 625 (78.1) 128 (16.0)

Sexual relations 75 (9.4) 527 (65.9) 198 (24.8)

Sharing food 265 (33.1) 443 (55.4) 92 (11.5)

Living with patient Tb 575 (71.9) 171 (21.4) 54 (6.8)

Excess work 65 (8.1) 692 (86.5) 43 (5.4)

TB transmitted from animals to human

through

Consumption of un-boiled milk 651 (81.4) 40(5.0) 109 (13.6)

Consumption of raw meat 694 (86.8) 3(3.7) 76 (9.5)

Though aerosol 459 (57.4) 256(32.0) 85 (10.6)

Other (Boiled milk, Cooked meat, Riding, Contact

with feaces)

293 (36.6)

Can TB be prevented? 634 (79.2) 89 (11.1) 77 (9.6)

Preventive methods of TB

Experiment -2

94

Good nutrition 387 (48.4) 251 (31.4) 162 (20.2)

Closing windows 132 (16.5) 252 (31.5) 416 (52.0)

Covering your mouth when sneezing or coughing 305 (38.1) 311 (38.9) 184 (23.0)

Not sharing food 270 (33.8) 436 (54.5) 94 (11.8)

Avoiding use of utensils used by Patient TB 123 (15.4) 535 (66.9) 142 (17.8)

Is TB treatable? 713 (89.1) 40 (5) 47 (5.9)

Treatment method of TB

Adhering to treatment provided by physician 581 (72.6) 118 (14.7) 101 (12.6)

Herbal Cures/ Consulting Hakeem 286 (35.7) 411 (51.4) 103 (12.9)

Resting but not taking medications 275 (34.3) 237 (29.6) 288 (36.0)

Prayers/ Eating well/ Others 334 (41.8) 318 (39.8) 143 (17.9)

The mode of transmission most commonly mentioned by participants was living with TB patient

(71.9%). Significant proportion of respondents correctly stated that transmission from animal to

human can occur through consumption of raw meat (86.8%), un-boiled milk (81.4%) and

through aerosol route (57.4%) while some (36.6%) incorrectly mentioned riding, contact with

feaces, consumption of cooked and boiled milk as route of TB transmission. About cure of TB,

89.1% mentioned that the disease is treatable. Adhering to treatment provided by physician

(72.6%) was the most frequently mentioned method of TB treatment. Other methods of treatment

mentioned were herbal cures/ consulting Hakeem (35.7%), resting but not taking medications

(34.3%), prayers and eating well. Majority of the respondents (79.2%) stated that TB would be

Experiment -2

95

preventable and the responses regarding TB prevention included good nutrition (48.4%),

covering mouth when sneezing or coughing (38.1%), not sharing food (33.8%) and others.

Participants considered smokers (74.0%) at high risk for contracting TB followed by, children

(52.0%), drug users (48.3%), immuno-compromised/ HIV and old age people.

Attitude and Practices of participants about TB

Participants’ attitudes and practice about TB are summarized in Table 4.4. More than half of the

respondents considered TB as a very serious disease. When asked “What feelings you would

have when presented with a diagnosis of TB?” the responses were fear (39.2%), sadness/

hopelessness (28.5%), surprise (8.0%), shame, hurt and others. The participants were asked that

‘how a person with TB is treated in the community’, 14.6% responded that people don’t want TB

patient to play with their children, 13.1% stated that community considers TB patients as

unclean, some (12.3%) responded that people keep distance from TB patients. An overwhelming

majority of the participants (89.2%) revealed that they would go to Health Centre if they thought

they had TB and 18.4% mentioned that they would consult traditional healers

Experiment -2

96

Table 4.4 Attitude and practices about TB in Peshawar District (n= 800)

Variable Number (%)

How serious a TB disease is?

Very serious 452 (56.5)

Somewhat serious 113 (14.1)

Not very serious 53 (6.6)

Don’t know 182 (22.8)

What feelings you would have when presented with a diagnosis of

TB?

Fear 314 (39.2)

Surprise 64 (8.0)

Shame 37 (4.6)

Sadness/ Hopelessness 228 (28.5)

Other (Hurt, don’t fear, etc) 157 (19.6)

What is the community attitudes towards TB patients*

People keep distance from those with TB 98 (12.3)

People do not want those with TB playing with their children 117 (14.6)

People do not want to talk to others with TB 5 (0.6)

People try not to touch others with TB 23 (2.9)

People think that those with TB are unclean 105 (13.1)

Other (don’t now, not sure, support him, no concern) 452 (56.5)

What would you do if you thought you had symptoms of TB?*

Experiment -2

97

Would go to health center 714 (89.2)

Would go to pharmacy 31 (3.9)

Would seek for a traditional healer 147 (18.4)

Others (specify) 35 (4.4)

I don’t know 12 (1.5)

If you had symptoms of TB, at what point would you seek

medical help?

As soon as I realize TB symptoms 365 (45.6)

When TB symptoms last for 2 or more weeks 267 (33.4)

When treatment on my own does not work 132 (16.5)

I don’t know 36 (4.5)

With whom a diagnosis of TB would be shared*

Physician 776 (97.0)

Partner 414 (51.6)

Parent 511 (63.9)

Offspring 395 (49.4)

Friends or relation 251 (31.4)

No person 0 (0.0)

*The respondents can choose more than one answer

Significant proportion of participants (45.6%) said that they will immediately seek medical help

when they realize that they had symptoms of TB and 33.4% revealed that they will seek medical

help only if the symptoms last for 2 or more weeks. When asked about sharing of TB diagnosis,

Experiment -2

98

97% responded that they would share the diagnosis with physician, 63.9% mentioned parents

and 51.6% mentioned partner.

Majority of the participants (97.4%) used boiled milk. Out of total 3 participants (0.38%) were

previously suffered from TB, 2 had pulmonary form of TB and one suffered from gastro

intestinal TB and was still on treatment. Ten participants (1.2%) had TB infected person at

home. With respect to sources of information about TB, most frequently mentioned sources of

information were television (67.1%) and health workers (26.9%). Other sources mentioned were

Pamphlets/ posters/ other printed materials (23.4%), newspapers and journals (22.5%) and family

member, friend or neighbor (17.8%). Only 29.8% of the study participants were aware that TB

treatment is provided free of cost. Remaining participants believed it would be reasonably priced

(37.0%), moderately expensive (22.8%) and very expensive (4.4%). Forty nine (6.1%)

respondents indicated that they have no idea about the cost of TB treatment.

Discussion

Peshawar district is located in Khyber Pakhtunkhwa province close to Pak-Afghan border.

Pakistan has 2500 km long border with war hit country Afghanistan. The illegal transboundry

movement of both human and animals may increase the risk of various diseases in border areas

of Pakistan as control programs for various diseases are either lacking or poorly implemented in

Afghanistan. Pakistan and Afghanistan both have no bTB control programs and some studies

have reported bTB in both cattle and buffalo in Peshawar district. Milk from these infected

animals may contain M. bovis and could be a public health threat for the consumers. The

presence of M. bovis in raw milk in retail shops is not only hazardous for the milk consumers but

also for the livestock farmers that are involved in management of these infected animals (M.

Experiment -2

99

bovis shedding animals). These M. bovis shedding animals would not be detected as bTB

positive during lifetime as no national bTB control program implementing test and slaughter

policy exists in the country and hence will pose risk for all those people that come in contact

with them. HIV pandemic has further increased the significance of M. bovis transmission to and

between human individuals (Ereqat et al. 2013).

Mycobacterium bovis was previously detected in 1.3% bovine raw milk samples in Palestine

(Leite et al. 2003), 1% milk samples in a study in Brazil (Franco et al. 2013), 62.5% milk

samples in another study in Brazil (Zarden et al. 2013), 15% milk samples in India (Srivastava et

al. 2008) and 0.7% milk samples in Argentina (Pérez et al. 2002). These results corroborates our

findings that milk from animals in bTB endemic countries are contaminated to a certain level by

M. bovis.

Mean knowledge score was significantly higher for Pakistani nationals when compared with

Afghan refugees (Non-Pakistani). Previous study that has compared knowledge of TB among

different nationalities have reported similar findings (Solliman et al. 2012).

Level of education was found directly proportional to TB knowledge score similar to several

other studies. (Portero et al. 2002; Armijos et al. 2008; Abebe et al. 2010). A study from

neighboring country Iran also showed the greater levels of knowledge about TB in graduates as

compared to illiterate people (Liefooghe et al. 1997). In Philippines (Portero et al. 2002;

Mushtaq et al. 2010), better knowledge of TB was reported in association with good housing

condition and socio-economic status, but in our study no such association of TB knowledge and

socio-economic status not found. The respondents had little information concerning bacteria/

micro-organisms as causative agent of TB which agrees with previous studies in Pakistan (Khan

Experiment -2

100

et al. 2006), Kenya (Liefooghe et al. 1997), Somali region (Gele et al. 2010; Melaku et al. 2013)

and Southwest Ethiopia (Abebe et al. 2010). Poor knowledge regarding etiology of TB may has

a negative impact on preventive methods and health-seeking behavior of patients as most people

with wrong believes may consult traditional healers/ alternatives and may not visit health care

facilities(Tolossa et al. 2014). In agreement with a study in Pakistan (Mushtaq et al. 2011), most

of the participants were unaware that cough lasts for more than 3 weeks was a symptom of TB.

Furthermore many misconceptions regarding mode of transmission and methods of prevention

prevail. People do not seek early diagnosis and treatment if they do not suspect TB upon

appearance of early symptoms (cough, fever, etc.). So this lack of knowledge about TB and

traditional misbelieves have role in delayed case detection (Shetty et al. 2004; Buregyeya et al.

2011). It was observed that participants were well aware of the transmission of TB from animals

and their products.

More than three quarters of the participants were not aware of the free treatment of TB. Directly

Observed Treatment, Short-course (DOTS) is globally recommended strategy of World Health

Organization (WHO) for tuberculosis control and is generally effective in treating TB cases,

however lack of knowledge about sign and symptoms of TB and unawareness about free of cost

availability of diagnosis and treatment facilities under this program is contributing to the

increasing incidence of TB in Pakistan. In this study television was cited the major sources of

information (67.1%) and small number of participants mentioned other sources like health

workers, newspaper etc. In Bangladesh also television was reported the main sources of TB

information (Tasnim et al. 2012). Pakistan’s TB control policies should target the least educated

and poor people in early diagnosis of disease and treatment continuity (Wandwalo and Morkve

2000). Majority of the participants indicated that they avoid TB patients in some way or other. In

Experiment -2

101

fear of acquiring the contagious disease, the patients are usually marginalised by society (Ali et

al. 2003; Khan et al. 2006).

Conclusions

The study reveals presence of M. bovis in milk readily available for consumers at retail milk

shops. These findings have severe economic and public health consequences. This study calls for

immediate intervention for control of Bovine tuberculosis so as to minimize the public health

risk. Further it is observed that there is lack of good knowledge about TB in study participants

and is related with low education status and rural residence. The findings in current study suggest

that targeted and tailored policies should be designed according to residential status and

educational background. Better targeted policies must be based on proper information of signs

and transmission of TB, free treatment availability, duration of treatment, and social factors that

embarrass the patients in the society.

Experiment -2

102

References

Abebe G, Deribew A, Apers L, Woldemichael K, Shiffa J, Tesfaye M, Abdissa A, Deribie F, Jira

C, Bezabih M, Aseffa A, Duchateau L, et al. 2010. Knowledge, health seeking behavior

and perceived stigma towards tuberculosis among tuberculosis suspects in a rural

community in southwest Ethiopia. PLoS One. 5 (10): e13339.

Ali SS, Rabbani F, Siddiqui UN, Zaidi AH, Sophie A, Virani SJ, Younus NA. 2003.

Tuberculosis: do we know enough? A study of patients and their families in an out-

patient hospital setting in Karachi, Pakistan. Int J Tuberc Lung Dis. 7 (11): 1052-1058.

Armijos RX, Weigel MM, Qincha M, Ulloa B. 2008. The meaning and consequences of

tuberculosis for an at-risk urban group in Ecuador. Rev Panam Salud Publica. 23 (3):

188-197.

Awan F, Ali MM, Iqbal U, Khattak I, Mushtaq MH. 2014. Some challenges in progressive

control of livestock originated zoonotic diseases in Pakistan–a pilot survey. Asian Pacific

Journal of Tropical Biomedicine. 4 (10): 821-824.

Borna M, Salome D, Silvia A, Jan H, Cláudio JML, Sven DCP, Paul DvH, Jakob Z. 2013.

Zoonotic Mycobacterium bovis-induced Tuberculosis in Humans. Emerging Infectious

Disease journal. 19 (6): 899-908.

Buregyeya E, Kulane A, Colebunders R, Wajja A, Kiguli J, Mayanja H, Musoke P, Pariyo G,

Mitchell EM. 2011. Tuberculosis knowledge, attitudes and health-seeking behaviour in

rural Uganda. Int J Tuberc Lung Dis. 15 (7): 938-942.


GK. 2013. First-time detection of Mycobacterium bovis in livestock tissues and milk in

the West Bank, Palestinian Territories. PLoS Negl Trop Dis. 7 (9): e2417.

Experiment -2

103

Franco MM, Paes AC, Ribeiro MG, de Figueiredo Pantoja JC, Santos AC, Miyata M, Leite CQ,

Motta RG, Listoni FJ. 2013. Occurrence of mycobacteria in bovine milk samples from

both individual and collective bulk tanks at farms and informal markets in the southeast

region of Sao Paulo, Brazil. BMC Vet Res. 9 85.

Gele A, Sagbakken M, Abebe F, Bjune G. 2010. Barriers to tuberculosis care: a qualitative study

among Somali pastoralists in Ethiopia. BMC Research Notes. 3 (1): 86.

Khan J, Irfan M, Zaki A, Beg M, Hussain S, Rizvi N. 2006. Knowledge, attitude and

misconceptions regarding tuberculosis in Pakistani patients. J Pak Med Assoc. 56 211-

214.




Liefooghe R, Baliddawa JB, Kipruto EM, Vermeire C, De Munynck AO. 1997. From their own

perspective. A Kenyan community's perception of tuberculosis. Trop Med Int Health. 2

(8): 809-821.

Melaku S, Sharma HR, Alemie GA. 2013. Pastoralist Community's Perception of Tuberculosis:

A Quantitative Study from Shinille Area of Ethiopia. Tuberculosis Research and

Treatment. 2013 8.

Mushtaq MU, Majrooh MA, Ahmad W, Rizwan M, Luqman MQ, Aslam MJ, Siddiqui AM,

Akram J, Shad MA. 2010. Knowledge, attitudes and practices regarding tuberculosis in

two districts of Punjab, Pakistan. Int J Tuberc Lung Dis. 14 (3): 303-310.

Experiment -2

104

Mushtaq MU, Shahid U, Abdullah HM, Saeed A, Omer F, Shad MA, Siddiqui AM, Akram J.

2011. Urban-rural inequities in knowledge, attitudes and practices regarding tuberculosis

in two districts of Pakistan's Punjab province. Int J Equity Health. 10 8.

Pérez A, Reniero A, Forteis A, Meregalli S, López B, Ritacco V. 2002. [Study of

Mycobacterium bovis in milk using bacteriological methods and the polymerase chain

reaction]. Revista Argentina de microbiologia. 34 (1): 45-51.

Portero NJ, Rubio YM, Pasicatan MA. 2002. Socio-economic determinants of knowledge and

attitudes about tuberculosis among the general population of Metro Manila, Philippines.


Shetty N, Shemko M, Abbas A. 2004. Knowledge, attitudes and practices regarding tuberculosis

among immigrants of Somalian ethnic origin in London: a cross-sectional study.

Commun Dis Public Health. 7 (1): 77-82.

Solliman MA, Hassali MA, Al-Haddad M, Hadida MM, Saleem F, Atif M, Aljadhey H. 2012.

Assessment of knowledge towards tuberculosis among general population in North

East Libya. J App Pharm Sci. 2 (4): 24-30.

Srivastava K, Chauhan DS, Gupta P, Singh HB, Sharma VD, Yadav VS, Sreekumaran, Thakral

SS, Dharamdheeran JS, Nigam P, Prasad HK, Katoch VM. 2008. Isolation of

Mycobacterium bovis & M. tuberculosis from cattle of some farms in north India--

possible relevance in human health. Indian J Med Res. 128 (1): 26-31.

Tasnim S, Rahman A, Hoque FMA. 2012. Patient's Knowledge and Attitude towards

Tuberculosis in an Urban Setting. Pulmonary Medicine. 2012 5.

Experiment -2

105



Zool. 44 (2): 393-398.




Wandwalo ER, Morkve O. 2000. Delay in tuberculosis case-finding and treatment in Mwanza,

Tanzania. Int J Tuberc Lung Dis. 4 (2): 133-138.

WHO. World health statistics. In: Organization WH (ed.). Geneva, Switzerland: World Health

Organization; 2007.


WHO 2015. Tuberculosis-Fact sheet N°104. World Health Organization.

Zarden CFO, Marassi CD, Figueiredo EEES, Lilenbaum W. 2013. Mycobacterium bovis

detection from milk of negative skin test cows. Veterinary Record. vr.101054.

106

CHAPTER 5

EXPERIMENT -3

Zoonotic Tuberculosis in Occupationally Exposed Groups in Peshawar, Pakistan

Abstract

Background Bovine tuberculosis (bTB), a chronic infectious disease is still a public health treat

in low income countries. Data on human Tuberculosis (TB) due to Mycobacterium bovis (M.

bovis) is poorly documented in developing countries.

Aims This study was conducted to determine the occurrence of active pulmonary TB due to M.

bovis in abattoir workers, butchers, livestock farmers and veterinarians and to document the

knowledge and practices of these professional regarding bTB.

Methods A cross sectional study was conducted that included 141 abattoir workers, 317

butchers, 50 livestock farmers, 5 veterinary doctors and 3 veterinary assistants. Data on socio-

demographic conditions, knowledge and practices toward TB was obtained. Sputum samples

were collected from those respondents who had chronic cough. Chi2 test was used for statistical

analysis.

Results Four out of 16 suspected abattoir workers and 1 out of 50 livestock farmers were found

positive for M. bovis by Polymerase chain reaction. Duration of work as abattoir worker was

found significantly associated (p<0.05) with occurrence of zoonotic TB. The knowledge of

abattoir workers, butchers, livestock farmers and veterinary assistants regarding transmission of

bTB from animal to human and symptoms of TB in human was very low. Most of these

professional did not use Personal protective equipment/ techniques and were considered at high

risk of acquiring zoonotic TB.

Experiment -3

107

Conclusion This study elucidate/ demonstrates zoonotic TB as a critical public health issue

especially for professionally exposed groups in Peshawar, Pakistan and calls for further detailed

investigations of the disease in the area.

Key words: Public health, Tuberculosis, Zoonotic tuberculosis, Occupational Hazard, M. bovis

Introduction

Human tuberculosis (TB) remains a major cause of mortality worldwide and a serious public

health threat (Adesokan et al. 2012). The World Health Organization (WHO) estimated that in

2014, human TB incidence and mortality was 9.6 million and 1.5 million respectively (WHO

2015). The problem has been aggravated by increase in incidence of human immunodeficiency

virus (HIV) and by the emergence of multidrug resistance (Zumla et al. 1999). Human

immunodeficiency virus (HIV) is considered to play major role in progression of active TB

among those individuals infected both with HIV and TB (Narain and Lo 2004). With a

population of about 190 million, Pakistan is ranked fifth amongst high TB burden countries

(WHO http://www.emro.who.int/pak/programmes/stop-tuberculosis.html). Mycobacterium

tuberculosis (M. tuberculosis) is the most frequent causative agent of TB in human. However

human can also be infected with Mycobacterium bovis (M. bovis), the causative agent of bovine

tuberculosis (bTB) (Hlavsa et al. 2008). Human acquires M. bovis infection by inhalation or

ingestion of the bacilli (Winthrop et al. 2005). Control of the bTB infection in cattle population

and pasteurization of dairy products have minimized its zoonotic significance to a certain

minimum level in developed countries (Torgerson and Torgerson 2008; Michel et al. 2010).

However it is still an important zoonotic disease in those countries where bTB is endemic and

pasteurization of milk is not mandatory (Borna et al. 2013). Data regarding human TB due to M.

bovis (zoonotic TB) is poorly documented in developing countries because the diagnosis of TB

Experiment -3

108

most often relies on sputum cytology only. World Health Organization has recommended the

collection of data about zoonotic TB in these countries (Annon 1994). In Pakistan, animals are

not routinely screened for bTB using test such as tuberculin skin test. Several independent

studies showed varied figures of bTB prevalence in cattle and buffaloes such as 8.6% in Lahore

(Jalil et al. 2003), 2.4-8.5% on various livestock farms in Punjab (Javed et al. 2006) and 10.6% at

a livestock experiment station in Punjab (Khan et al. 2008). Similarly an estimated 14.0%

prevalence has been reported in buffalo and 13.3% in cattle from a slaughterhouse in Peshawar

(Khan et al. 2014). Most of these studies focused on the prevalence in cattle and buffaloes;

however no data is available on the occurrence and risk factors of zoonotic TB in high risk

groups such as livestock workers, veterinarians, abattoir workers and butchers. Unfortunately

due to lack of currently operational national control and prevention strategy for bTB, the trends

and status of bTB existence and dissemination are not predictable, which reflects the risk of

acquiring bTB from infected animals that are living in the close proximity with humans

(Adesokan et al. 2012). Therefore, current study was conducted with objectives to determine the

burden of active pulmonary TB caused by M. bovis in abattoir workers, butchers, veterinarians

and livestock farmers and to document its risk factors. We also report about the knowledge and

practices of these professionals regarding TB.


This study was conducted in Peshawar district, capital of Khyber Pakhtunkhwa province during

January and February, 2015. The Peshawar district has estimated human population of 3.5

million and is situated in a large valley close to the border of Afghanistan. The district has two

government administered abattoirs and few private abattoirs. Several government and private

veterinary hospitals and dispensaries provide treatment services to animals in the area. The study

Experiment -3

109

participants included 141 abattoir workers from two government administered abattoirs, 317

butchers from the 100 meat retail shops, 50 farmers, 5 veterinary assistants and 3 veterinarians.

Sputum samples were collected from participants who had chronic cough lasting for more than 3

weeks and could yield sputum. Distribution of the samples is shown in Table 5.1.

Table 5.1 Distribution of samples and PCR results.

Group Total number

in study area

Number of

individuals

interviewed

Number of

sputum samples

collected

Number of

samples positive

for M. bovis by

PCR

Abattoir workers Data Not

Available

141 16 4

Butchers Data Not

Available

317 29 0

Livestock Farmers Data Not

Available

50 50 1

Veterinarian 25 3 3 0

Veterinary

Assistants

68 5 5 0

Before start of the interview, aim of the study was explained to the participants and due consent

was obtained. The interviews were conducted by one author (Khattak, I) in local language

(Pushto). Oral interviews were conducted on pre-designed questionnaire focused on socio-

demographic conditions along with the knowledge and practices toward TB. Separate

questionnaires were developed for the abattoir workers, butchers, veterinarians/ veterinary

assistants and farmers. The sputum samples were obtained in sterilized sputum cups, properly

labeled and transported to the laboratory in ice packed cooler. The sputum samples were

processed in the Provincial Tuberculosis Reference Laboratory (Biosafety level III), Peshawar.

The DNA was isolated from sputum with the help of Genolyse ® DNA kit. In brief from each

Experiment -3

110

sputum sample, 1 ml was transferred to sterile 1.5 ml microfuge tubes. Each tube was

centrifuged at 13000g for 10 minutes. Supernatant was discarded and 100 µl of lysis buffer was

added to the pellet and incubated at 95oC for 5 minutes. Then 100 µl of neutralization buffer was

added and centrifuged again at 13000g for 5 minutes. Supernatant was collected which contained

DNA and pellet was discarded. The PCR protocol described by Tipu et al., (2012) for detection

of M. bovis was followed with some modifications (Tipu et al. 2012). Briefly, detection of M.

bovis was carried out by amplification of 500 bp PCR product with JB primers (Forward: JB21

TCGTCCGCTGATGCAAGTGC; Reverse: JB22: CGTCCGCTGACCTCAAGAAAG). For

PCR , a 25 µl volume reaction for each sample was prepared which contained 1.75 µl of distilled

water, 0.25 µl of AmpliTaq DNA polymerase, 1.5 µl of forward primer, 1.5 µl of reverse primer,

10 µl of red dye PCR Master Mix (Merck Millipore) and 10 µl of DNA sample. PCR reaction

mixture tubes were transferred to a thermal cycler and 500 bp amplified products over 35 cycles

were obtained by using the conditions: 94oC for 4 minutes, 93oC for 30 seconds, 50oC for 30

seconds, 72oC for 45 seconds and final extension step of 5 minutes at 72oC. The PCR product

was resolved through 1.5% and visualized by staining with ethidium bromide. Data were

processed and analysed through SPSS (Version 15.0) and Microsoft excel (2010). Chi2 with 95%

confidence interval was calculated to assess statistical significance. Frequencies and percentages

were used to present the findings. The study was approved by the “Ethical Review Committee”

of University of Veterinary and Animal Sciences, Lahore.

Results

A total of 141 abattoir workers were interviewed, our results indicated that 16 out of 141 had

chronic cough and we obtained their sputum samples to process for detection of M. bovis. Out of

these 16 sputum samples, 4 were confirmed positive for M. bovis by PCR. Duration of work as

Experiment -3

111

abattoir worker was found significantly associated (p<0.05) with occurrence of zoonotic TB.

Those who worked for more than 15 years in abattoir were more affected by zoonotic TB as

compared to those who worked for the lesser duration. Age, education and type of work carried

out by the workers were not significantly associated with zoonotic TB (Table 5.2).

Table 5.2 Bivariate frequency analysis of various parameters of the abattoir workers in

Peshawar, Pakistan.


N %

Age (Years) NS

<20 8 0 0.0%

20-30 30 0 0.0%

31-40 45 1 2.2%

41-50 37 2 5.4%

Above 50 17 1 5.9%

Education NS

Illiterate 37 2 5.4%

Middle 73 1 1.4%

Secondary 25 1 4.0%

Graduate 2 0 0.0%

Duration of Work (Years) <0.05

< 8 80 0 0.0%

8-15 37 2 5.4%

> 15 20 2 10.0%

Type of work NS

Live animals handling 17 2 11.8%

Skinning & Slaughtering 79 2 2.5%

Cleaning 16 0 0.0%

Other 25 0 0.0%

NS, Not Significant (P>0.05)

Experiment -3

112

All the subjects were male. Response rate of the abattoir workers in the study was around 90%

(141/156). Of these 141 workers, 39 were illiterate (28%), 74 middle (52%), 26 secondary (18%)

and 2 had graduate (1%) education. Nineteen abattoir workers (14%) were involved in live

animals handling, 81 (57%) in slaughtering and skinning, 16(11%) in cleaning and 25(18%) in

other activities like transportation and procurement. None of the abattoir worker had undergone

through any sort of formal training related to their work. Only 3 abattoir workers stated that they

had health certificate. Majority of the workers (83%) mentioned that blood and carcass come in

direct contact with their body parts during work. None of the worker used face mask, head cover

and gloves during work. Fifty seven workers (40%) used gum boots and 29(21%) used apron for

their protection. According to abattoir workers, 133(94%) of them took regular shower before

starting work and all 141 took shower after finishing work during summer season. They further

revealed that during winter season 92 abattoir workers (62%) took regular shower before starting

work and 113 workers (80%) after finishing work. Warm water and sanitizer were not available

for hand washing. Abattoir workers stated that veterinary doctor perform anti-mortem inspection

of animals on regular basis and they also revealed that up to their knowledge no animal has been

culled during anti-mortem inspection for being infected with bTB in the slaughterhouse as

animals were not screened for bTB using Tuberculin skin test. The abattoir workers informed

that meat inspection after slaughtering was not in practice and up to their knowledge no carcass

had been condemned partly or as a whole due to presence of lesions compatible with bTB. One

hundred thirty six (96%) workers answered that they had at some point heard about TB.

Regarding transmission of TB, 41(29%), 87 (62%) and 64 (45%) mentioned correctly that TB

could be transmitted from animals to human through consumption of raw milk, raw meat and

aerosol respectively (Fig 5.1).

Experiment -3

113

Figure 5.1 Percentile Distribution of Mechanisms known to Abattoir workers for the

Transmission of TB from Animal to Human

We found that around one quarter (27%) workers have no knowledge of TB transmission from

animal to human.

0% 20% 40% 60% 80% 100%

Contact with feaces and urine

Though aerosol

Consumption of cooked meat

Consumption of raw meat

Consumption of Boiled milk

Consumption of Raw milk

43.3

45.4

7.1

61.7

13.5

29.1

41.1

36.2

83.7

27.7

70.2

50.4

15.6

18.4

9.2

10.6

16.3

20.6

Yes No Don’t Know

Experiment -3

114

Table 5.3 Distribution of signs and symptoms of TB known to the abattoir workers,

butchers and livestock farmers

Signs and symptoms Group Yes

n (%)

No

n (%)

Chronic cough lasts for more than 3 weeks

Abattoir workers 34 (24) 107 (76)

Butchers 85 (27) 232 (73)

Livestock farmers 11 (22) 39 (78)

Pain in the chest


Butchers 71 (22) 246 (78)


Coughing up blood or sputum Fever


Butchers 79 (25) 238 (75)


Weakness or fatigue


Butchers 201 (63) 116 (37)


Weight loss


Butchers 225 (71) 92 (29)


No appetite


Butchers 252 (80) 65 (20)


Chills


Butchers 75 (24) 242 (76)


Fever


Butchers 273 (86) 44 (14)


Sweating at night


Butchers 43 (14) 274 (86)


Vomiting


Butchers 124 (39) 193 (61)


Diarrhea


Butchers 156 (49) 161 (51)


Experiment -3

115

The level of knowledge regarding signs and symptoms of TB was extremely low (Table 5.3) and

was associated with Tb positive status. All the 5 positive cases of Tb were unaware of the signs

and symptoms of TB and also mentioned vomiting and diarrhea as symptoms of Tb. National

Tuberculosis Control Program of Pakistan recommends the combination of three signs “chronic

cough lasts for more than 3 weeks, fever and weight loss” as the main symptom of TB. Only 2

respondents (1%) correctly stated the combination of these three signs of TB. Majority of the

workers (89%) showed their interest in getting zoonotic diseases related training. Among 317

butchers working in randomly selected 100 meat retail shops, 29 were found suspected of TB

and sputum samples were obtained from them. None of the sample was confirmed positive for

M. bovis by PCR analysis. Out of total 317 butchers, 6% (18/317) were below 20 years age, 25%

(78/317) were between 20-30 years, 39% (125/317) were between 31-40 years, 20% (65/317)

between 41-50 years and 10% (31/317) above 50 years (Fig 5.2).

Experiment -3

116

Figure 5.2 Age distribution of the butchers

5.7%

24.6%

39.4%

20.5%

9.8%

0.0%

5.0%

10.0%

15.0%

20.0%

25.0%

30.0%

35.0%

40.0%

45.0%

<20 Years 20-30 years 31-40 years 41-50 years >50 years

Experiment -3

117

Figure 5.3 Education status of abattoir worker

None of the butcher had obtained any form of formal training related to their work and no one

reproduced health certificate. All the butchers used to wash hands with soap at the beginning and

after finishing work. Among total of 317 butchers, 83% responded that during summer season

they took shower after finishing work while only 36% butchers responded that they took shower

after finishing work during winter season. Ninety butchers (28%) stated that they remove all

visible lesions on carcass and offal while remaining 227 butchers (72%) told that they remove

visible lesions if customers insist to remove it. When asked that what would they do if a carcass

is confirmed to be infected with bTB, all the butchers stated that they would only remove the

lesions of bTB and would not like to condemn the whole carcass. Majority of the butchers (92%)

stated that blood and carcass come in direct contact with their body during work. Apron was

used by 75 butchers (24%), while none of the butcher used gloves, facemask or head cover

during work. All the participants believed that cattle and buffalo can be infected with bTB. More

27.7%

52.5%

18.4%

1.4%

0%

10%

20%

30%

40%

50%

60%

Illiterate Middle Secondary Graduate

Experiment -3

118

than half (60%) of the respondents mentioned that bTB transmission from animals to human

occur through consumption of raw meat, 49% stated aerosol while 45.1% stated feaces and urine

(5.5).

Figure 5.4 Percentile Distribution of Mechanisms known to butchers for the Transmission

of TB from Animal to Human

No one correctly stated the combination of three main signs of TB.

Out of 50 sputum samples collected from livestock farmers, only 1 sample was found positive

for M. bovis by PCR. Age and education of the livestock farmers were not associated with M.

bovis infection (Table 5.4).

0% 20% 40% 60% 80% 100%


Though aerosol



Consumption of boiled milk

Consumption of raw milk

45.1

48.6

7.3

59.6

13.6

28.1

39.4

32.8

83.0

29.7

70.3

51.4

15.5

18.6

9.8

10.7

16.1

20.5

Yes No Don’t Know

Experiment -3

119

Table 5.4 Education status and age distribution of the livestock farmers in Peshawar,

Pakistan.


N Percent

Age (years) NS

<20 9 0 0.0%

20-30 4 0 0.0%

31-40 6 0 0.0%

41-50 8 0 0.0%

>50 22 1 4.5%

Education status NS

Illiterate 10 1 10%

Middle 13 0 0.0%

Secondary 23 0 0.0%

Graduate 3 0 0.0%

NS, Not Significant (P>0.05)

None of the farmer had obtained any form of formal training related to their work. The majority

of farmers (62%) drank boiled daily, 16% drank boiled milk occasionally while 8% farmers

consumed raw milk occasionally. Only 5 farmers (10%) used gum boots and one farmer used

gloves during animal handling and cleaning of animals shed. Soap was used by only 31 farmers

(62%) for cleaning their body. All the farmers had heard about TB at some point of life and

majority of the farmers (88%) were of the view that TB in human can be cured completely by

adhering to treatment. None of the farmer correctly mentioned the combination of three main

symptoms of TB. None of the farmer had screened their animals ever for bTB. Small number of

farmers (4%) correctly stated that bTB is not treatable in animals.

Experiment -3

120

Figure 5.5 Percentile Distribution of Mechanisms known to livestock farmers for the

Transmission of TB from Animal to Human

When asked that what would they do if their animal is diagnosed for bTB, majority (72%)

responded that they will do treatment of their animal as they did not knew that bTB treatment is

not recommended and 13 farmers (26%) responded that they will sold their diseased animal in

live animal market. No one stated that they will cull and burry the diseased animal. Majority of

the farmers (86%) showed interest in getting zoonotic diseases related training.

Sputum samples from 3 veterinarians and 5 veterinary assistants were collected. All the samples

were negative on PCR analysis. The veterinarian’s knowledge about sign and symptoms,

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%


Though aerosol



Consumption of boiled milk

Consumption of raw milk

52

62

6

64

12

72

36

32

82

26

80

14

12

6

12

10

8

14

Yes No Don’t Know

Experiment -3

121

transmission and causative agent was excellent; however veterinary assistants had poor

knowledge about it.

Discussion

The study reported occurrence of zoonotic TB in occupationally exposed groups and low level of

knowledge regarding TB among these groups. The current study had a limitation that we

explored the occurrence of only active pulmonary TB in the occupationally exposed risk groups.

There could be some cases of latent TB and extrapulmonary TB which were not detected as our

diagnosis was based on analysis of sputum samples. Bovine TB and human TB due to M. bovis

are poorly investigated and controlled in Pakistan including Peshawar district. Beside widespread

of bovine TB in buffalo and cattle, M. bovis is also reported from humans in Pakistan (Nawaz et

al. 2012). Zoonotic TB is a real public health problem but it is not investigated considering the

multiple dynamics of disease. Some people are closely related to animals either live or

slaughtered, because of their profession. In countries where bTB is endemic, such professionals

are certainly at greater risk of acquiring TB from animals. In developing countries, most of

zoonotic TB cases have been occurred in abattoir workers, veterinarians, dairy farm workers,

hunters and zoo workers (Robinson et al. 1988; Fanning et al. 1991; Moda et al. 1996; Cousins

and Dawson 1999; Winthrop et al. 2005). Various studies conducted in bTB endemic countries

have reported an increased risk of acquiring M. bovis infection among abattoir workers (Barrera

and De Kantor 1987; Robinson et al. 1988; Georghiou et al. 1989; Cousins and Dawson 1999).

Abattoir workers involved in slaughtering of infected animals are likely at higher risk of

acquiring zoonotic TB than livestock handlers, because of the potential for aerosolization of

bacilli during such procedures (Winthrop et al. 2005). Our study results too indicated that

abattoir workers were most affected by zoonotic TB as compared to other professions under

Experiment -3

122

study. This is because bTB is endemic in the area and the abattoir workers were exposed to both

live animals during pre-slaughter handling and carcasses after slaughtering. Furthermore, abattoir

workers handle large number of animals on daily basis and personal protective equipment are not

available. Many abattoir workers were unaware of the zoonotic nature of bTB, its public health

implications and mode of transmission. None of the abattoir worker has undergone through any

sort of formal training related to their work and is the main reason of their unawareness about

occupational hazards. The level of knowledge of abattoir workers, butchers and livestock farmers

was very low related to signs and symptoms of TB and its means of transmission. One would

expect them to be prioritized with messages pertaining to bTB because of being a part of high

risk occupations (Moda et al. 1996; Anaelom et al. 2010). This is consistent with findings from

few studies that assessed knowledge and attitude amongst high risk groups in some African

countries. A study focused on the knowledge and practices of animals handlers and animal health

workers in Tanzania concluded that, ‘inadequate awareness and low level of knowledge about

zoonoses combined with feeding habits and poor animal husbandry practices are likely to put the

participants at risk of contracting zoonotic diseases (Swai et al. 2010). Another study reported

poor knowledge of TB in 75% of the respondents from rural areas of Tanzania and considered

40% of the respondents practices to be ‘high risk’ for exposure to bTB (Mfinanga et al. 2003).

Lack of accurate knowledge on transmission of zoonotic diseases and the prevalence of risky

behavior, such as unsafe slaughtering practices and consumption of raw animal products have

also been documented in Ethiopia (Amenu et al. 2010). Such studies on knowledge and practices

of livestock handlers, abattoir workers and butchers regarding bTB in Pakistan are scarce.

Among the occupationally exposed groups included in the study, Veterinarians and Veterinary

assistants had obtained formal education related to their job. The good knowledge of

Experiment -3

123

Veterinarians regarding TB may be linked to their formal education. However it was unfortunate

that besides formal education, Veterinary assistants had poor knowledge which indicated the

poor standard of their job related formal education. So the curriculum of Veterinary assistants

needs to be improved with more emphasis on zoonotic diseases and handling of diseased

animals. Bovine and human TB affects all sectors of the community but poor people are most

vulnerable (Awah Ndukum et al. 2010). Livestock population is increasing rapidly in urban and

peri-urban areas of Peshawar but most of the livestock farmers are small-scale herders, poor

and uneducated/less educated. Education, animal husbandry trainings and constant reassessment

of animal handlers are therefore critical to good health (both human and animals) and improving

animal productivity in Peshawar. The study highlighted the need of awareness sessions regarding

zoonotic TB for the livestock workers, abattoir workers and butchers along with work related

formal trainings. Furthermore the findings also call for in-depth investigations of the disease in

Peshawar, Pakistan.

Experiment -3

124

References

Annon 1994. Zoonotic tuberculosis (Mycobacterium bovis): memorandum from a WHO meeting

(with the participation of FAO). Bull World Health Organ. 72 (6): 851-857.

Adesokan HK, Jenkins AO, van Soolingen D, Cadmus SI. 2012. Mycobacterium bovis infection

in livestock workers in Ibadan, Nigeria: evidence of occupational exposure. Int J Tuberc

Lung Dis. 16 (10): 1388-1392.

Amenu K, Thys E, Regassa A, Marcotty T. 2010. Brucellosis and Tuberculosis in Arsi-Negele

District, Ethiopia: Prevalence in Ruminants and People’s Behaviour towards Zoonoses.

Tropicultura. 28 (4): 205-210.

Anaelom NJ, Ikechukwu OJ, Sunday WW, Nnaemeka UC. 2010. Zoonotic tuberculosis: A

review of epidemiology, clinical presentation, prevention and control. Journal of Public

Health and Epidemiology. 2 118-124.

Awah Ndukum J, Caleb Kudi A, Bradley G, Ane-Anyangwe IN, Fon-Tebug S, Tchoumboue J.

2010. Prevalence of Bovine Tuberculosis in Abattoirs of the Littoral and Western

Highland Regions of Cameroon: A Cause for Public Health Concern. Veterinary

Medicine International. 2010 doi:10.4061/2010/495015.

Barrera L, De Kantor IN. 1987. Nontuberculous mycobacteria and Mycobacterium bovis as a

cause of human disease in Argentina. Trop Geogr Med. 39 (3): 222-227.


Zoonotic <em>Mycobacterium bovis</em>–induced Tuberculosis in Humans. Emerging

Infectious Disease journal. 19 (6): 899.

Cousins DV, Dawson DJ. 1999. Tuberculosis due to Mycobacterium bovis in the Australian

population: cases recorded during 1970-1994. Int J Tuberc Lung Dis. 3 (8): 715-721.

Experiment -3

125

Fanning A, Edwards S, Hauer G. 1991. Mycobacterium bovis infection in humans exposed to elk

in Alberta. Can Dis Wkly Rep. 17 (44): 239-240, 243.

Georghiou P, Patel AM, Konstantinos A. 1989. Mycobacterium bovis as an occupational hazard

in abattoir workers. Aust N Z J Med. 19 (4): 409-410.



1995-2005. Clin Infect Dis. 47 (2): 168-175.

Jalil H, Das P, Suleman A. 2003. Bovine tuberculosis in dairy animals at Lahore, threat to the

public health. Metropolitan Corporation Lahore, Pakistan.

http://priory.com/vet/bovinetb.htm.


epidemiological aspects, along with haematological and serum protein changes. Vet

Arhiv. 76 (3): 193-206.

Khan IA, Khan A, Mubarak A, Ali S. 2008. Factors Affecting Prevalence Of Bovine

Tuberculosis In Nili Ravi Buffaloes. Pak Vet J. 28 (4): 155-158.

Khan J, Ayaz S, AbdElsalam NM, Riaz Ullah R, Shah T. 2014. Prevalence of Tuberculosis in

Buffalo and Cattle. Journal of Pure and Applied Microbiology. 8 721-726.

Mfinanga SG, Morkve O, Kazwala RR, Cleaveland S, Sharp JM, Shirima G, Nilsen R. 2003.

Tribal differences in perception of tuberculosis: a possible role in tuberculosis control in

Arusha, Tanzania. Int J Tuberc Lung Dis. 7 (10): 933-941.



http://priory.com/vet/bovinetb.htm

Experiment -3

126

Moda G, Daborn CJ, Grange JM, Cosivi O. 1996. The zoonotic importance of Mycobacterium

bovis. Tuber Lung Dis. 77 (2): 103-108.

Narain JP, Lo YR. 2004. Epidemiology of HIV-TB in Asia. Indian J Med Res. 120 (4): 277-289.

Nawaz A, Chaudhry ZI, M. Shahid M, Gul S, Khan FA, Hussain M. 2012. Detection of

Mycobacterium Tuberculosis and Mycobacterium Bovis in Sputum and Blood Samples

of Human. Journal of animal and plant sciences. 22 (2 suppl): 117-120.

Robinson P, Morris D, Antic R. 1988. Mycobacterium bovis as an occupational hazard in

abattoir workers. Aust N Z J Med. 18 (5): 701-703.

Swai ES, Schoonman L, Daborn CJ. 2010. Knowledge and attitude towards zoonoses among

animal health workers and livestock keepers in Arusha and Tanga, Tanzania. Tanzan J

Health Res. 12 (4): 280-286.



Zool. 44 (2): 393-398.

Torgerson P, Torgerson D. 2008. Does risk to humans justify high cost of fighting bovine TB?

Nature. 455 (7216): 1029-1029.

WHO 2015. Global Tuberculosis Report.

http://www.who.int/tb/publications/global_report/gtbr2015_executive_summary.pdf.

WHO http://www.emro.who.int/pak/programmes/stop-tuberculosis.html.

Winthrop KL, Scott J, Brown D, Jay MT, Rios R, Mase S, Richardson D, Edmonson A,

MacLean M, Flood J. 2005. Investigation of human contacts: a Mycobacterium bovis

outbreak among cattle at a California dairy. Int J Tuberc Lung Dis. 9 (7): 809-813.

http://www.who.int/tb/publications/global_report/gtbr2015_executive_summary.pdf

http://www.emro.who.int/pak/programmes/stop-tuberculosis.html

Experiment -3

127

Zumla A, Squire SB, Chintu C, Grange JM. 1999. The tuberculosis pandemic: implications for

health in the tropics. Trans R Soc Trop Med Hyg. 93 (2): 113-117.

128

CHAPTER 6

EXPERIMENT -4

Epidemiological study of Zoonotic Tuberculosis in Peshawar, Pakistan

Abstract

This study aims to determine the proportion of human M. bovis disease in overall adult

tuberculosis (TB) patients and prevalence of M. bovis disease in school children, drug resistance

of M. bovis isolates and Knowledge, Attitude and Practices (KAP) about TB. For this purpose a

total of 300 adult TB patients positive for acid fast bacilli on smear microscopy and 100 school

children with chronic cough were included in the study. Sputum samples were processed by

Polymerase Chain Reaction (PCR) for the presence of Mycobacterium tuberculosis and M. bovis.

Sputum samples from all these TB patients were cultured for M. bovis isolation that were then

subjected to drug susceptibility testing. Data on knowledge, attitude and practices were obtained

from TB patients by administering pre-tested questionnaire. PCR based identification indicate

that 4% (12/300) of TB patients were infected with M. bovis. Interestingly, none of the school

child was declared positive for M. bovis. Residence, occupation, presence of animals at home

and sleeping in shed at night was found significantly associated with occurrence of zoonotic TB.

Low level of knowledge and practices were observed. Except one, all M. bovis isolates were

resistant to Pyrazinamide. Furthermore, among other drugs the resistance to streptomycin and

isoniazid was high. Altogether, our report highlights the high burden of M. bovis infection in

human TB patients in Peshawar Pakistan and identified its links with livestock.

Key words: M. bovis, zoonosis, Tuberculosis, Drug resistance, KAP

Experiment -4

129

Introduction

In 2013, an estimated 9.0 million people developed tuberculosis (TB) and 1.5 million died from

the disease, 360000 of whom were HIV-positive (WHO 2014). Around 95% of TB cases occur

in people in developing countries. In Pakistan TB incidence was 0.274% and prevalence was

0.342% during 2013 (WHO 2014). Mycobacterium bovis is a part of Mycobacterium

tuberculosis complex and can cause TB infection in a wide range of mammalian hosts (LoBue et

al. 2010). Of note, TB caused by M. bovis is radiographically, clinically and pathologically

indistinguishable from TB disease caused by M. tuberculosis (Grange 2001) that has been

associated with increased mortality (Rodwell et al. 2008). Furthermore, the emergence of the

HIV/AIDS pandemic has opened new discussion on the impact of immunosuppression on M.

bovis transmission to and between human beings. The occurrence of human M. bovis infection is

low in countries with bTB control programs (Pavlik et al. 2004; Hlavsa et al. 2008; Rodriguez et

al. 2009) and higher in countries where bTB programs are not being implemented due to

insufficient resources (Ayele et al. 2004; Borna et al. 2013; Malama et al. 2013). Human-to-

human transmission of M. bovis events has also been reported (Evans et al. 2007; Sunder et al.

2009). Considering the increasing incidence of TB globally, epidemiological data on the

incidence and impact of human M. bovis disease is crucial. Unfortunately, constant vigilance

programs and surveys have been constantly ignored, particularly in the developing countries

largely due to limited resources(Grange 2001; Laniado-Laborin et al. 2014). In Pakistan bovine

TB is widely spread in animals (Khan and Khan 2007; Javed et al. 2012) but human M. bovis

disease is not well studied and its share in overall human TB patients is unknown.

For effective prevention and control of TB it is necessary to properly address the primary

barriers for the prevention of the disease. Therefore it is important to understand the perceptions

Experiment -4

130

and practices about TB.This study was designed to determine the proportion of human M. bovis

disease out of overall adult TB patients and prevalence of M. bovis disease in school children,

drug resistance of M. bovis isolates and knowledge, attitude and practices about TB.

Material and Methods

Study Design and sample size

Sputum samples were obtained from a total of 300 adult pulmonary TB patients who attended

TB DOTS center Hashtnagri and Hayatabad Medical Complex during January 2015 to July 2015

and were diagnosed positive for Acid Fast Bacillus (AFB) by smear microscopy. Additionally

sputum samples from 100 school children who had chronic cough were obtained. The sputum

samples were obtained in sputum cups, properly labeled and transported to Provincial

Tuberculosis Reference Laboratory (Biosafety level III), Peshawar in ice-Packed cool box. All

interview participants were briefed about the aims of the study and written consent was obtained

before starting the interview. A pretested questionnaire was administered to the TB patients for

obtaining data regarding their demography, socioeconomic status, knowledge about clinical signs

and symptoms, transmission and social impact of TB. Each sputum sample was divided into two

parts. One part was subjected directly to DNA extraction and Polymerase Chain Reaction (PCR)

for detection of Mycobacterium tuberculosis (M. tuberculosis) and M. bovis and the other part

was processed and cultured simultaneously on Lowenstein Jensen (LJ) and stone brink media for

growth of M. tuberculosis and M. bovis, respectively.

Detection of M. tuberculosis and M. bovis in sputum samples using PCR

The DNA was isolated from sputum with the help of Genolyse ® DNA kit as advised by the

manufacturer. Two sets of primers in separate reactions were used for each sample in PCR. One

Experiment -4

131

set of primer was specific for M. tuberculosis and the other one was for M. bovis as described

earlier (Nawaz et al. 2012). The primer sequences for M. tuberculosis were Forward: pncATB-

1.2 pncA gene ATGCGGGCGTTGATCATCGTC and Reverse: pncAMT-2 pncA gene

CGGTGTGCCGGAGAAGCGG, while for M. bovis were Forward: JB21

TCGTCCGCTGATGCAAGTGC and Reverse: JB22: CGTCCGCTGACCTCAAGAAAG.

Detection of M. tuberculosis was carried out by amplification of 185 bp PCR product while M.

bovis by 500 bp PCR product. For PCR analysis, a 25 µl volume reaction for each sample was

prepared which contained 1.75 µl of distilled water, 0.25 µl of AmpliTaq DNA polymerase, 1.5

µl of forward primer, 1.5 µl of reverse primer, 10 µl of red dye PCR Master Mix (Merck

Millipore) and 10 µl of DNA sample. PCR reaction mixture tubes were transferred to a thermal

cycler and amplified products over 35 cycles were obtained by using the conditions: 94oC for 4

minutes, 93oC for 30 seconds, 50oC for 30 seconds, 72oC for 45 seconds and final extension step

of 5 minutes at 72oC. PCR product was anlysed by agrose gel electrophoresis.. The gel was

stained with ethidium bromide solution having concentration of 10 mg/ml for 20 minutes. The

gel was observed under UV trans-illuminator, and photographed using smart phone camera. The

500 bp amplified PCR product of M. bovis positive samples were sequenced in First BASE

Laboratories, Malaysia and phylogenetic tree was prepared using mega 6.0 software.

Phylogenetic tree was constructed employing Neighbor-joining method with 1,000 bootstrap

value.

Culture and Drug susceptibility of Mycobacterial isolates

To prepare sputum samples for culture on LJ and stone brink media, the N-acetyl-L-cysteine–

sodium citrate–NaOH (NALC-NaOH) digestion–decontamination procedure was followed as

described by (Morcillo et al. 2008). Briefly 1 ml of sputum sample and equal volume of NALC-

Experiment -4

132

NAOH solution were mixed in 50 ml falcon tube and incubated for 20 minutes at room

temperature. After that 48 ml of phosphate buffer was added and centrifuged at 3000g for 15

minutes. The supernatant was then discarded carefully and for sediment resuspension, 0.5 ml of

phosphate buffer was added. This final suspension of each sample was inoculated on one slant of

LJ and one slant of stone brink media simultaneously. Both slants were incubated for 8 weeks at

37 oC and observed weekly for growth. The culture of M. bovis positive samples were subjected

to Drug susceptibility Testing (DST). The DST was performed for 5 first line anti TB drugs i.e.,

Streptomycin (STR), Isoniazid (INH), Rifampicin (RMP), Ethambutol (EMB) and Pyrazinamide

(PZA) and for 3 second line drugs i.e., Amikacin (AMK), Capreomycin (CPM) and Ofloxacin

(OFX). Mycobacterium bovis inoculum for DST was prepared from solid media following

manufacturer’s instructions and DST was performed in BACTEC MGIT 960 instrument as

described earlier by (Tortoli et al. 2002) Final drug concentrations used in DST were 1.0 μg/ml

for STR, 0.1 μg/ml for INH, 1.0 μg/ml for RMP, 5.0 μg/ml for EMB, 100 μg/ml for PZA, 1

μg/ml for AMK, 2.5 μg/ml for CPM and 2.0 μg/ml for OFX.

Results

Detection through PCR

Our data analysis using PCR indicate that all the 100 sputum samples from school children were

PCR-negative for M. bovis. Furthermore, our results show that out of 300 sputum samples that

were collected from Human TB patients and were processed by PCR for M. tuberculosis and M.

bovis identification, 288 samples (96%) were positive for M. tuberculosis and 12 samples (4%)

were positive for M. bovis. This showed that the burden of M. bovis disease was 4.0% (CI 2.08-

6.88) among human TB patients (Figure 1).

Experiment -4

133

Figure 6.1 Molecular detection, sequence and Phylogenetic analysis of Mycobacterium bovis

isolates

Experiment -4

134

Sequence and Phylogenetic analsysis of 500 bp fragement of M. bovis

The 500bp amplified product obtained by using M. bovis specific primers was sequenced.

Multiple sequence alignments indicate high degree of homology among all isolates, however,

there were slight differences of a single base at random position among these isolates (Figure 1).

It would be interesting to know whether these insertion mutation lead to frame shift and whether

that reveals a silent or obvious mutation in the translated protein. Furthermore, based on this

alignment all these sequences were basically clustered into two major groups, which contain

further sub clusters. Overall, a total of six clusters were observed, in which one of them

contained maximum of six isolates. All these information indicate that perhaps very little

heterogeneity exists between the isolated strains based on the sequence of this conserved 500 bp

region.

Isolation and identification by in vitro culture on solid media

Interestingly, out of total 300 samples, 274 (91.3%) showed mycobacterial growth on LJ media

only, 13 (4.3%) samples showed growth on Stone brink media while 5 (1.7%) samples grew on

both LJ and Stone brink media. Seven samples (2.3%) were contaminated and 2 (0.7%) samples

didn’t show any growth (Table 6.1).

Table 6.1 Growth and isolation of Mycobacterium tuberculosis and Mycobacterium bovis on

solid media

Culture Result Number of samples Percent

Growth observed only on LJ media 274 91.3

Growth observed only on Stone brink media 13 4.3

Growth observed on both LJ and stone brink

media

5 1.7

No growth observed 2 0.7

Contaminated samples 7 2.3

Total 300

Experiment -4

135

In vitro Drug susceptibility

Out of 12 isolates, 11 were resistant to PZA., while remaining 1 isolate was found sensitive to it.

Resistance to STR, INH, RMP, OFX and AMK was shown by 8 (66.7%), 8 (66.7%), 7 (58.3%),

2 (16.7%) and 1 (8.3%) isolate, respectively. Remarkably, none of the samples showed resistance

to CPM (Table 6.2).

Table 6.2 Drug Susceptibility Testing of Mycobacterium bovis isolates from human active

pulmonary tuberculosis patients

Name STR INH RMP EMB PZA AMK CPM OFX

Asma R R R R R S S R

Burhanuddin R R R R R S S S

Gul Pana S S S S R S S S

Ilahia R R R S R S S S

Nisar S S S S R S S S

Mumtaz Begum R R S R R R S S

Noor Aman R R R S R S S S

Zia S S S S R S S S

Rasheeda R R R R S S S S

Said Shafiq R R R R R S S R

Sidra R R R R R S S S

Lal Nawaz S S S S R S S S

Total Resistant

isolates

8/12 8/12 7/12 6/12 11/12 1/12 0/12 2/12

STR ‐Streptomycin, INH ‐Isoniazid, RMP ‐Rifampicin, EMB ‐ Ethambutol, PZA‐Pyrazinamide,

AMK‐Amikacin, CPM‐Capreomycin, OFX ‐ Ofloxacin

Experiment -4

136

Risk Factors of Zoonotic TB and Socio-demographic Condition of TB Patients

In this study we investigated a total of 300 human TB patients. Among these, Pakistani nationals

were 96% (288/300) and Afghan nationals were 4% (12/300). Age distribution and socio-

demographic conditions are presented in Table 6.3.

Table 6.3 Bivariate frequency analysis of various parameters in M. tuberculosis and M.

bovis infected patients

Characteristics Total no. Of

Patients

Zoonotic TB Patients,

n (%)

P value

Nationality

Pakistani 288 12 (4.2) 0.607

Afghani 12 0 (0.0)

Age

<20 Years 21 0 (0.0) 0.658

20-30 Years 46 3 (6.5)

31-40 Years 64 2 (3.1)

41-50 Years 72 4 (5.6)

50 Years 97 3 (3.1)

Education Level

Illiterate 35 1 (2.8) 0.713

Middle 87 2 (2.3)

Secondary 106 5 (4.7)

Graduate or above 72 4 (5.6)

Residence

Urban 216 3 (1.4) 0.001

Rural 84 9 (10.7)

Socio-economic

Status

Very High 3 0 (0.0) 0.060

High 44 0 (0.0)

Medium 150 8 (5.3)

Low 77 1 (1.3)

Very Low 26 3 (11.5)

Marital Status

Experiment -4

137

Single 38 1 (2.6) 0.902

Married 238 10 (4.2)

Divorced 6 0 (0.0)

Widow 18 1 (5.5)

Occupation

Livestock Farmer 48 6 (12.5) 0.005

Abattoir worker/

butcher/ Veterinarian

2 0 (0.0)

Other 250 6 (2.4)

Animals at home

Cattle/ buffalo 77 10 (13.0) 0.000

Other 12 0 (0.0)

None 211 2 (9.5)

Sleep in animal

Shed

Yes 7 4 (57.1) 0.000

No 293 8 (2.7)

Data analysis of our report indicates that associated risk factors of M. bovis disease in human

were occupation (0.005), residence (p 0.001), presence of animal at home (0.000) and sleeping in

animal shed (p 0.000). Importantly, burden of M. bovis disease was higher in livestock farmers

as compare to other professions. Similarly the burden was also higher in people living in rural

areas, those who had cattle and buffaloes at home or sleeping in animal shed.

Knowledge, Attitude and practices of TB patients regarding TB

Our data indicate that about half of the respondents (51.3%) considered micro-organisms/germs

as causative agents of TB disease while 11.7% stated that TB is a hereditary disease. All of these

participants had cough for more than 2 weeks along with blood or sputum at some stage. Other

self-reported signs and symptoms of TB by the respondents were weight loss (95.3%), night

Experiment -4

138

sweeting (89.7%), Fever (88.3%), chest pain (80.7%), weakness or fatigue (77.0%), no appetite

(71.7%) and chills (71.0%)(Table 6.4).

Table 6.4 Self-reported clinical signs and symptoms in TB patients

Signs and symptoms n (%)

Chronic cough lasts for more than 3 weeks 300 (100.0)

Pain in the chest 242 (80.7)

Coughing up blood or sputum 300 (100.0)

Weakness or fatigue 231 (77.0)

Weight loss 286 (95.3)

No appetite 215 (71.7)

Chills 213 (71.0)

Fever 265 (88.3)

Sweating at night 269 (89.7)

TB was considered a communicable disease by 82.7% study participants. The perceived mode

of TB transmission mentioned by majority of the respondents (86%) was living with TB patients

(Table 6.5). Significant number (78.7%) of patients correctly indicated that TB transmission

from animal to human can take place through consuming raw meat (78.7%). Un-boiled milk and

aerosol route were mentioned by the 60.3% and 30.3% patients respectively as transmission

pathway of M. bovis infection from animal to human. Notable some (31.7%) patietns incorrectly

stated contact with feaces, riding, consumption of cooked meat and boiled milk as route of TB

transmission.

Experiment -4

139

Table 6.5 Participants knowledge about transmission of TB

Yes No Don’t Know


Is TB a communicable disease? 248 (82.7) 36 (12.0) 16.0 (5.3)

TB transmitted through

Cough or sneeze 162 (54.0) 90 (30.0) 48 (16.0)

Hand shake 35 (11.7) 211 (70.3) 54 (18.0)

Sexual relations 13 (4.3) 184 (61.3) 103 (34.3)

Sharing food 95 (31.7) 153 (51.0) 52 (17.3)

Living with patient Tb 258 (86.0) 7 (2.3) 35 (11.7)

Excess work 57 (19.0) 215 (71.7) 28 (9.3)

TB transmitted from animals to human

through

Consumption of un-boiled milk 181 (60.3) 112 (37.3) 7 (2.3)

Consumption of raw meat 236 (78.7) 59 (19.7) 5 (1.7)

Though aerosol 91 (30.3) 206 (68.7) 3 (1.0)

Other (Boiled milk, Cooked meat, Riding, Contact

with feaces)

95 (31.7)

Majority of the patients (96.3%) were hopeful that TB is treatable and most trusted method of

cure was treatment provided by physician (90.3%) and Herbal Cures/ consulting Hakeem

(33.7%). Majority (78.3%) of the patients mentioned that TB would be preventable and the most

Experiment -4

140

frequently mentioned methods of TB prevention were good nutrition (52.3%) and covering

mouth when sneezing or coughing (50.3%) (Table 6.6).

Table 6.6 Participants knowledge about prevention and treatment of TB

Yes No Don’t Know


Can TB be prevented? 235 (78.3) 41 (13.7) 24 (8.0)

Preventive methods of TB

Good nutrition 157 (52.3) 90 (30.0) 53 (17.7)

Closing windows 45 (15.0) 82 (27.3) 173 (57.7)

Covering your mouth when sneezing or coughing 151 (50.3) 94 (31.3) 55 (18.3)

Not sharing food 89 (29.7) 169 (56.3) 42 (14.0)

Avoiding use of utensils used by Patient TB 74 (24.7) 163 (54.3) 63 (21.0)

Is TB treatable? 289 (96.3) 3 (1.0) 8 (2.7)

Treatment method of TB

Adhering to treatment provided by physician 271 (90.3) 16 (5.3) 13 (4.3)

Herbal Cures/ Consulting Hakeem 101 (33.7) 176 (58.7) 23 (7.7)

Resting but not taking medications 53 (17.7) 233 (77.7) 14 (4.7)

Prayers/ Eating well/ Others 96 (32.0) 190 (63.3) 14 (4.7)

Our results show that more than half (59.7%) of the patients considered TB as a very serious

disease. When we asked that “What feelings they had when were informed as TB-postive?” the

responses were fear (29.0%), sadness/ hopelessness (28.3%), surprise (26.7%), shame, hurt and

Experiment -4

141

others. When we asked TB patients that ‘how a person with TB gets-on by the community’,

17.3% responded that people don’t want TB patient to let them play with their children, 14.3%

stated that community considers TB patients as uncleaned, 12.7% responded that people keep

distance from TB patients. When asked about sharing of TB diagnostic information, all patients

responded that they would be willing to share diagnostic information related to TB with

physicians, while, 70.7% mentioned with partners and finally 65.3% mentioned with their

parents..

Our data indicate that majority (94.0%) of the participants always used boiled milk, 5.3%

occasionally un-boiled milk while 0.7% regularly used raw milk. Thirty five participants

(11.7%) had TB infected person at home and 25 (8.3%) had been in close contact with TB

patients. With respect to sources of information about TB, most frequently mentioned sources of

information were television (60.3%) and health workers (25.3%). Other sources mentioned were

Pamphlets/ posters/ other printed materials (22.7%), newspapers (19.3%) and family member,

friend or neighbor (17.0%). Most of the patients (72.7%) were aware that TB treatment is

provided free of cost in Public sector hospitals.

Discussion

Studies focusing on the M. bovis infection in human and its risk factors in Pakistan are limited.

The current study reported the burden of human M. bovis infection and its associated risk factors.

Furthermore the drug susceptibility of M. bovis isolates was determined.

In the current study Mycobacterium bovis DNA was detected in 4% of the adult human TB

patients’ sputum samples. This reported burden of human M. bovis infection in Pakistan was

high as compared to 2% in France (Sunder et al. 2009), 1.9% in Spain (Rodriguez et al. 2009),

Experiment -4

142

1–2% in Unites States (Hlavsa et al. 2008), 0.8% in Mali (Traore et al. 2012), 1.6% in Brazil

(Silva et al. 2013), 1.2% in Burkina Faso (Sanou et al. 2014), 0.4% in Argentina, 3% in Ireland,

1.4% in Netherlands but similar to previous study conducted in Pakistan that reported 4% share

of human M. bovis disease (Jabbar et al. 2015). However, a slight higher (6.67%) burden of

human M. bovis infection has been reported in Bangladesh (Rahman et al. 2015). This high

burden of zoonotic TB in Pakistan is linked to higher prevalence of bovine TB in Pakistan and

absence of prevention and control strategies of TB in cattle and buffalo.

The livestock farmers and those rearing cattle and buffalo at home were found more infected by

M. bovis as compared to the people of other professions and those with no domestic animals.

Similar findings have been reported in other parts of the word such as in Mexico 11.8% of the

sputum samples from farm workers were positive for M. bovis (Milian-Suazo et al. 2010), 6% of

the M. bovis infected human patients were in contact with animals (Portillo-Gomez and Sosa-

Iglesias 2011), 65% of the M. bovis infected patients in Argentina were occupationally exposed

(Cordova et al. 2012) and two sputum samples were found positive for M. bovis in

occupationally exposed peoples in Mexico (Torres-Gonzalez et al. 2013). In Bangladesh “rearing

of livestock in household” was identified risk factor of zoonotic TB (Rahman et al. 2015). In

Tanzania and Uganda also livestock keeping were found associated with occurrence of TB

(Mfinanga et al. 2003; Hlavsa et al. 2008). In our study rural residence was found significantly

associated with occurrence of zoonotic TB. Cordova et al. (2012) has reported that 31% of the

zoonotic TB patients in Buenos Aires, Argentina were living in rural areas. Rural residents more

often keep livestock and more often shared dwelling with animals than urban dwellers (Kilale et

al. 2015) and was therefore seem to be the reason of high burden of zoonotic TB in rural

residents. Pulmonary form of zoonotic TB occur as a result of aerosol transmission of the bacilli

Experiment -4

143

from animals to human. Sleeping in animal shed increases the chances of transmission from

infected animals to human due to prolonged exposure and close interaction with animals.

In current study, 66.7% (8/12) M. bovis isolates were found resistant to Isoniazid and

Riphampicin. In Maxico, 16.1% and 9.5% M. bovis isolates were resistant to Isoniazid and

Riphampicin, respectively (Bobadilla-Del Valle et al. 2015). In agreement with our study, in

Ireland, 28.5% of the M. bovis cases were found resistant to both Pyrazinamide and Isoniazid

(McLaughlin et al. 2012). Similarly, in New York and San Diego, 9% and 7% of M. bovis

isolates, respectively were resistant to isoniazid and pyrazinamide (LoBue et al. 2003; CDC

2005). Rifampicin and multidrug resistance were observed in 2 out of 39 M. bovis isolates in

Argentina (Cordova et al. 2012).

About half (51.3%) of the participants stated that microorginsm/ bacteria is the cause of TB.

Studies conducted in Shinile town and South Western Ethiopia have reported that 22.9% and

3.3% individuals respectively were aware that micro-orginsm/ bacteria was the causative agent

of TB (Bati et al. 2013; Tolossa et al. 2014) while in Bangladesh, 42.8% knew that bacteria is

responsible for causing TB (Rana et al. 2015).

TB was considered a communicable disease by 82.7% study participants. Similar results have

been reported in Ethiopia where 80% of the participants considered TB as a communicable

disease (Tolossa et al. 2014) While the results differed from studies conducted in India and

Bangladesh where 61% and 51.5% people respectively perceived TB a communicable disease

(Kulkarni et al. 2014; Rana et al. 2015).

Experiment -4

144

Conclusion

The current study showed evidences of M. bovis infections in Human TB patients in Peshawar

district, Pakistan. This strongly suggest that further studies should be conducted to assess the

burden of M. bovis infection in human in other parts of the country including a national survey in

current settings of National TB Control Program. Such kind of survey and study is expected to

determine overall M. bovis infection burden in human that would ultimately help policy makers

and educationist for devising strategies for the control of M. bovis disease.

Experiment -4

145

References



Bati J, Legesse M, Medhin G. 2013. Community's knowledge, attitudes and practices about

tuberculosis in Itang Special District, Gambella Region, South Western Ethiopia. BMC

Public Health. 13 734.

Bobadilla-Del Valle M, Torres-Gonzalez P, Cervera-Hernandez ME, Martinez-Gamboa A,

Crabtree-Ramirez B, Chavez-Mazari B, Ortiz-Conchi N, Rodriguez-Cruz L, Cervantes-

Sanchez A, Gudino-Enriquez T, Cinta-Severo C, Sifuentes-Osornio J, et al. 2015. Trends

of Mycobacterium bovis Isolation and First-Line Anti-tuberculosis Drug Susceptibility

Profile: A Fifteen-Year Laboratory-Based Surveillance. PLoS Negl Trop Dis. 9 (9):

e0004124.


Zoonotic Mycobacterium bovis induced Tuberculosis in Humans. Emerging Infectious

Disease journal. 19 (6): 899.

CDC CfDCaP 2005. Human tuberculosis caused by Mycobacterium bovis—New York City,

2001–2004. MMWR Morb Mortal Wkly Rep. 54 605-608.

Cordova E, Gonzalo X, Boschi A, Lossa M, Robles M, Poggi S, Ambroggi M. 2012. Human

Mycobacterium bovis infection in Buenos Aires: epidemiology, microbiology and

clinical presentation. Int J Tuberc Lung Dis. 16 (3): 415-417.

Evans JT, Smith EG, Banerjee A, Smith RM, Dale J, Innes JA, Hunt D, Tweddell A, Wood A,

Anderson C, Hewinson RG, Smith NH, et al. 2007. Cluster of human tuberculosis caused

by Mycobacterium bovis: evidence for person-to-person transmission in the UK. Lancet.

369 (9569): 1270-1276.

Experiment -4

146

Grange JM 2001. Mycobacterium bovis infection in human beings. Tuberculosis (Edinb). 81 (1-

2): 71-77.



1995-2005. Clin Infect Dis. 47 (2): 168-175.

Jabbar A, Khan J, Ullah A, Rehman H, Ali I. 2015. Detection of Mycobacterium tuberculosis

and Mycobacterium bovis from human sputum samples through multiplex PCR. Pak J

Pharm Sci. 28 (4): 1275-1280.

Javed MT, Ahmad L, Feliziani F, Pasquali P, Akhtar M, Usman M, Irfan M, Severi G, Cagiola

M. 2012. Analysis of some of the epidemiological risk factors affecting the prevalence of

tuberculosis in buffalo at seven livestock farms in Punjab Pakistan. Asian Biomed. 6 (1):

35–42.

Khan IA, Khan A. 2007. Prevalence and risk factors of bovine tuberculosis in Nili Ravi buffaloes

in the Punjab, Pakistan. Ital J Anim Sci. 6 (Suppl. 2): 817-820.

Kilale AM, Ngadaya E, Kagaruki GB, Lema YL, Muhumuza J, Ngowi BJ, Mfinanga SG,

Hinderaker SG. 2015. Experienced and Perceived Risks of Mycobacterial Diseases: A

Cross Sectional Study among Agropastoral Communities in Northern Tanzania. PLoS

One. 10 (6): e0130180.

Kulkarni P, Kudale A, Arasu K, Lab M, Darby W, Rangan S. 2014. Tuberculosis knowledge and

awareness in tribal-dominant districts of Jharkhand, India: implications for ACSM.

Public Health Action. 4 (3): 189-194.

Experiment -4

147

Laniado-Laborin R, Muniz-Salazar R, Garcia-Ortiz RA, Vargas-Ojeda AC, Villa-Rosas C,

Oceguera-Palao L. 2014. Molecular characterization of Mycobacterium bovis isolates

from patients with tuberculosis in Baja California, Mexico. Infect Genet Evol. 27 1-5.

LoBue PA, Betacourt W, Peter C, Moser KS. 2003. Epidemiology of Mycobacterium bovis

disease in San Diego County, 1994-2000. Int J Tuberc Lung Dis. 7 (2): 180-185.

LoBue PA, Enarson DA, Thoen CO. 2010. Tuberculosis in humans and animals: an overview.


Malama S, Muma JB, Godfroid J. 2013. A review of tuberculosis at the wildlife-livestock-human

interface in Zambia. Infect Dis Poverty. 2 13-13.

McLaughlin AM, Gibbons N, Fitzgibbon M, Power JT, Foley SC, Hayes JP, Rogers T, Keane J.

2012. Primary Isoniazid Resistance in Mycobacterium bovis Disease: A Prospect of

Concern. Am J Respir Crit Care Med. 186 (1): 110-111.

Mfinanga SG, Morkve O, Kazwala RR, Cleaveland S, Sharp JM, Shirima G, Nilsen R. 2003.

Tribal differences in perception of tuberculosis: a possible role in tuberculosis control in

Arusha, Tanzania. Int J Tuberc Lung Dis. 7 (10): 933-941.

Milian-Suazo F, Perez-Guerrero L, Arriaga-Diaz C, Escartin-Chavez M. 2010. Molecular

epidemiology of human cases of tuberculosis by Mycobacterium bovis in Mexico. Prev

Vet Med. 97 (1): 37-44.

Morcillo N, Imperiale B, Palomino JC. 2008. New simple decontamination method improves

microscopic detection and culture of mycobacteria in clinical practice. Infection and drug

resistance. 1 21-26.

Experiment -4

148

Nawaz A, Chaudhry ZI, Shahid M, Gul S, Khan FA, Hussain M. 2012. Detection of

Mycobacterium tuberculosis and Mycobacterium bovis in sputum and blood samples of

human. J Anim Plant Sci. 22 (2 suppl). 117- 120.

Pavlik I, Ayele WY, Havelkova M, Svejnochova M, Jankovic VK, Dovc MZ. 2004.

Mycobacterium bovis infection in human population in four Central European countries

during 1990–1999. Vet Med. 48 90–98.

Portillo-Gomez L, Sosa-Iglesias EG. 2011. Molecular identification of Mycobacterium bovis and

the importance of zoonotic tuberculosis in Mexican patients. Int J Tuberc Lung Dis. 15

(10): 1409-1414.

Rahman MM, Noor M, Islam KM, Uddin MB, Hossain FMA, Zinnah MA, Mamun MA, Islam

MR, Eo SK, Ashour HM. 2015. Molecular diagnosis of bovine tuberculosis in bovine and

human samples: implications for zoonosis. Future Microbiol. 10 (4): 527-535.

Rana M, Sayem A, Karim R, Islam N, Islam R, Zaman TK, Hossain G. 2015. Assessment of

knowledge regarding tuberculosis among non-medical university students in Bangladesh:

a cross-sectional study. BMC Public Health. 15 716.

Rodriguez E, Sanchez LP, Perez S, Herrera L, Jimenez MS, Samper S, Iglesias MJ. 2009.

Human tuberculosis due to Mycobacterium bovis and M. caprae in Spain, 2004-2007. Int

J Tuberc Lung Dis. 13 (12): 1536-1541.

Rodwell TC, Moore M, Moser KS, Brodine SK, Strathdee SA. 2008. Tuberculosis from

Mycobacterium bovis in Binational Communities, United States. Emerg Infect Dis. 14

(6): 909-916.

Sanou A, Tarnagda Z, Kanyala E, Zingué D, Nouctara M, Ganamé Z, Combary A, Hien H,

Dembele M, Kabore A, Meda N, Van de Perre P, et al. 2014. Mycobacterium bovis in

Experiment -4

149

Burkina Faso: Epidemiologic and Genetic Links between Human and Cattle Isolates.

PLoS Negl Trop Dis. 8 (10): e3142.

Silva MR, Rocha Ada S, da Costa RR, de Alencar AP, de Oliveira VM, Fonseca Junior AA,

Sales ML, Issa Mde A, Filho PM, Pereira OT, dos Santos EC, Mendes RS, et al. 2013.

Tuberculosis patients co-infected with Mycobacterium bovis and Mycobacterium

tuberculosis in an urban area of Brazil. Mem Inst Oswaldo Cruz. 108 (3).

Sunder S, Lanotte P, Godreuil S, Martin C, Boschiroli ML, Besnier JM. 2009. Human-to-human

transmission of tuberculosis caused by Mycobacterium bovis in immunocompetent

patients. J Clin Microbiol. 47 (4): 1249-1251.




Torres-Gonzalez P, Soberanis-Ramos O, Martinez-Gamboa A, Chavez-Mazari B, Barrios-

Herrera MT, Torres-Rojas M, Cruz-Hervert LP, Garcia-Garcia L, Singh M, Gonzalez-

Aguirre A, Ponce de Leon-Garduno A, Sifuentes-Osornio J, et al. 2013. Prevalence of

latent and active tuberculosis among dairy farm workers exposed to cattle infected by

Mycobacterium bovis. PLoS Negl Trop Dis. 7 (4): e2177.

Tortoli E, Benedetti M, Fontanelli A, Simonetti MT. 2002. Evaluation of Automated BACTEC

MGIT 960 System for Testing Susceptibility of Mycobacterium tuberculosis to Four

Major Antituberculous Drugs: Comparison with the Radiometric BACTEC 460TB

Method and the Agar Plate Method of Proportion. J Clin Microbiol. 40 (2): 607-610.

Traore B, Diarra B, Dembele BP, Somboro AM, Hammond AS, Siddiqui S, Maiga M, Kone B,

Sarro YS, Washington J, Parta M, Coulibaly N, et al. 2012. Molecular strain typing of

Experiment -4

150

Mycobacterium tuberculosis complex in Bamako, Mali. Int J Tuberc Lung Dis. 16 (7):

911-916.


151

CHAPTER 7

SUMMARY

A cross-sectional study was carried out to determine the prevalence of bovine tuberculosis (bTB)

and associated risk factors in cattle and buffalo in Peshawar, Pakistan. Cattle and buffalo,

randomly selected from all four towns of District Peshawar were screened for bovine

tuberculosis using comparative cervical intradermal tuberculin test (CCIT). For obtaining data on

risk factors, socio-demographic condition, animal characteristics and management, interviewer

administered pretested questionnaire to animal owners. Multivariable logistic regression models

were used to measure association between risk factors and comparative cervical intradermal

tuberculin reactors. A total of 556 cattle and buffalo were screened for bovine tuberculosis. Out

of 556 animals screened, 5.75% (3.9-8.0%) were found positive. The prevalence was higher in

old animals (P= 0.001) as compared to younger animals. Prevalence also varied with source of

animal (either raised on farm or purchased), stay of animals at night (indoor or outdoor) and herd

size. Farmer’s knowledge about transmission of TB from animals to human as well as signs and

symptoms of TB was extremely low. Only 3.6% farmers correctly stated the combination of

three major symptoms of TB. Results of the study call for immediate intervention to control bTB

in animals as well as its transmission to human population. Furthermore, it is suggested to

emphasize on local epidemiology of bTB and husbandry practices of cattle and buffalo during

the control program.

To assess the presence of Mycobacterium bovis (M. bovis) in milk sold at retail shops and find

the knowledge, attitude and practice (KAP) about tuberculosis (TB) in the high risk M. bovis

contaminated milk consumers, milk samples were obtained from 92 milk shops and analysed for

presence of M. bovis. Data on socio-demographic characteristics and KAP about TB was

Summary

152

obtained from 800 M. bovis contaminated milk consumers. Mycobacterium bovis was detected in

8.7% (8/92) milk samples. Although 97.4% of the participants had heard of TB but only 39.6%

knew that cough lasts for more than 3 weeks was one symptom. Only 79.2% have awareness that

TB can be prevented and the most frequently stated (48.4%) method of TB prevention was good

nutrition. Participants believed that TB can be cured by prayers/ eating well (41.8%) and also by

herbal cures/ consulting Hakeem (35.7%). Mean knowledge score for the participants was 12.1±

2.47 out of maximum 22. Mean knowledge score varied significantly with ethnicity, level of

education and residential status (Urban vs rural). Overall knowledge about TB was low.

Therefore community’s health education focused on increasing knowledge of TB must be

initiated.

This part of study was conducted to determine the occurrence of active pulmonary tuberculosis

due to M. bovis in abattoir workers, butchers, livestock farmers and veterinarians and to

document the Knowledge and practices of these professional regarding bTB. The cross sectional

study included 141 abattoir workers, 317 butchers, 50 livestock farmers, 5 veterinary doctors and

3 veterinary assistants. Sputum samples were collected from those respondents who had chronic

cough that last for more than 2 weeks. Four out of 16 suspected abattoir workers and 1 out of 50

livestock farmers were found positive for M. bovis by Polymerase chain reaction analysis.

Duration of work as abattoir worker was found significantly associated (p<0.05) with occurrence

of zoonotic TB. The knowledge of abattoir workers, butchers, livestock farmers and veterinary

assistants regarding transmission of bTB from animal to human and symptoms of TB in human

was very low. Most of these professional did not use protective material/ techniques and are

considered at high risk of acquiring zoonotic tuberculosis. This study declares zoonotic

tuberculosis a critical public health issue especially for professionally exposed groups in

Summary

153

Peshawar, Pakistan and warrant immediate intervention for control of bovine and zoonotic

tuberculosis.

The last part of study aims to determine the proportion of zoonotic TB cases out of overall

human TB patients and school children, drug resistance of M. bovis isolates and knowledge,

attitude and practices about TB. Total 300 human TB patients and 100 school children were

included in the study. Sputum samples were processed by PCR for presence of Mycobacterium

tuberculosis and M. bovis. Sputum samples from TB patients were cultured and M. bovis isolates

were subjected to drug susceptibility testing. Data on knowledge, attitude and practices were

obtained from TB patients by administering pre-tested questionnaire. Among TB patietns 4%

(12/300) were infected with M. bovis. None of the school children was positive for M. bovis.

Residence, occupation, presence of animals at home and sleeping in shed at night was found

significantly associated with occurrence of zoonotic TB. Except one all M. bovis isolates were

resistant to Pyrazinamide. Among other drugs resistance to streptomycin and isoniazid was high.

Low level of knowledge and practices were observed. The study concluded that considering

zoonotic aspect of TB during diagnosis and treatment of TB is necessary and recommends

national survey for true estimation of burden of zoonotic TB in Pakistan.

EPIDEMIOLOGY OF BOVINE TUBERCULOSIS AND...

Documents

Transcript of EPIDEMIOLOGY OF BOVINE TUBERCULOSIS AND...