Enhanced Platinum (II) Drug Delivery for Anti-cancer Therapy

City University of New York (CUNY) City University of New York (CUNY)

CUNY Academic Works CUNY Academic Works

Dissertations, Theses, and Capstone Projects CUNY Graduate Center

9-2021

Enhanced Platinum (II) Drug Delivery for Anti-cancer Therapy Enhanced Platinum (II) Drug Delivery for Anti-cancer Therapy

Marek T. Wlodarczyk The Graduate Center, City University of New York

How does access to this work benefit you? Let us know!

More information about this work at: https://academicworks.cuny.edu/gc_etds/4622

Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected]

https://academicworks.cuny.edu/

https://academicworks.cuny.edu/gc_etds

https://academicworks.cuny.edu/gc

http://ols.cuny.edu/academicworks/?ref=https://academicworks.cuny.edu/gc_etds/4622

https://academicworks.cuny.edu/gc_etds/4622

https://academicworks.cuny.edu/?

mailto:[email protected]

Enhanced Platinum (II) drug delivery for anti-cancer therapy

by

Marek T. Wlodarczyk

A dissertation submitted to the Graduate Faculty in Chemistry in partial fulfillment

of the requirements for the degree of Doctor of Philosophy, The City University of

New York 2021

ii

© 2021

Marek T. Wlodarczyk

All Rights Reserved

iii


by

Marek T. Wlodarczyk

This manuscript has been read and accepted for the Graduate Faculty in Chemistry

in satisfaction of the dissertation requirement for the degree of

Doctor of Philosophy.

_______________ ______________________________

Date Aneta Mieszawska

Chair of Examining Committee

_______________ ______________________________

Date Yolanda Small

Executive Officer

Supervisory Committee:

Maria Contel

John A Martignetti

Rein V. Ulijn

THE CITY UNIVERSITY OF NEW YORK

iv


by

Marek T. Wlodarczyk

Advisor: Professor Aneta Mieszawska

Abstract

Over the years, anti-cancer therapies have improved the overall survival rate of patients.

Nevertheless, the traditional free drug therapies still suffer from side effects and systemic toxicity,

resulting in low drug dosages in the clinic. This often leads to suboptimal drug concentrations

reaching cancer cells, contributing to treatment failure and drug resistance. Among available anti-

cancer therapies, metallodrugs are of great interest. Platinum (II)-based agents are highly potent

and are used to treat many cancers, including ovarian cancer (OC). Cisplatin (cis-

diaminedichloroplatinum (II)) is the first Food and Drug Administration (FDA)-approved

metallodrug for treatment of solid tumors, and its mechanism of action is based on inhibition of

cancer cell replication via binding to nuclear DNA. However, circulating cisplatin binds to

glutathione and other proteins in the blood compartment, diminishing the concentration of the free

drug available for therapy. Also, highly potent cisplatin is associated with severe side effects,

limiting the dosage of Pt(II) that can be administered in the clinic. The next generation Pt(II) drugs

aim at sustaining the same effectiveness while improving systemic toxicity. Carboplatin is a

second-generation Pt-based agent approved by the Food and Drug Administration (FDA). Slower

hydrolysis times for carboxylate ligands in carboplatin, compared to rather fast times for chlorine

ligands in cisplatin, lead to longer blood circulation times and lesser side effects. The therapeutic

effect of carboplatin is comparable with cisplatin in some tumors, but it requires higher drug

dosages, and the survival rate did not improve.

v

The problems above associated with free Pt(II)-based therapy created a need for the

development of more efficient drug delivery systems. These include targeted drug delivery such

as an antibody or protein conjugates or nanoparticle (NP)-mediated drug delivery, e.g., by using

liposomes, polymeric or oil-based NPs, among other approaches. This dissertation presents two

alternative drug delivery systems for Pt(II)-based agents: peptide conjugate and a NP. These

systems are tested in OC models, where Pt (II) therapy is a golden standard.

Chapter II focuses on a peptide-drug conjugate of nuclear localization sequence (NLS)

peptide-carboplatin-like complex. Nuclear localization sequence peptides target nuclear transport

protein, delivering the therapeutic payload into a cancer cell's nucleus. NLS-Pt(II) conjugate

demonstrated enhanced therapeutic effect in vitro in OC cell lines when compared to carboplatin.

Conjugation of carboplatin-like complexes with NLS peptide also drastically increased the

solubility of Pt(II) drug in an aqueous media.

Chapter III focuses on targeted and pH-sensitive polymeric NP to deliver Pt(II). Poly lactic-

co-glycolic acid (PLGA)-based NPs are explored, as the PLGA is biodegradable, biocompatible,

and, most importantly, approved by the FDA. The NP's corona contains phospholipids and custom-

synthesized pH-sensitive polyethylene glycol (PEG)-phospholipid coating. A DNA-aptamer

against mucin 1 (MUC1), which is overexpressed in OC cells, is added as an active targeting

ligand. The NP design takes advantage of a slightly acidic environment around cancer cells

(pH~6.8) to disintegrate PEG-based NP's coating and to expose the aptamer targeting ligands

facilitating a fast NP uptake through receptor-mediated endocytosis. Slow intracellular

degradation of the NP leads to sustained release of Pt(II). The NPs showed higher cytotoxicity in

vitro when compared to free carboplatin, and the NPs effectively accumulated in the tumor tissue

in vivo. Importantly, the NP platform can be easily modified. The ease of functionalization of

vi

PLGA with other drugs, as well as the choice of different targeting aptamers, can extend the

applications of the proposed NP platform to other disease types.

vii

DEDICATION

To my beloved wife, Jola Zajworoniuk-Wlodarczyk, for believing in me.

viii

ACKNOWLEDGMENTS

I would like to show my gratitude to Dr. Aneta Mieszawska for giving me an opportunity

to be a part of this exciting research project. Her continuous support made it all possible.

I would also like to express my sincere thanks to my dissertation committee members,

Dr. Maria Contel, Dr. John A Martignetti, and Dr. Rein Ulijn, for their support and patience.

My warm thoughts follow to our Research Group members:

Dr. Sylwia Dragulska, for being a good friend and for tireless help with all aspects of our

research projects.

Mina Poursharifi for all help with in vitro and imaging experiments.

I would also like to give special thanks to Brooklyn College's former and present

graduate students. Especially Dr. Gan Zhang for countless tips on the use of HPLC and LCMS.

I would also like to give special thanks to the Brooklyn College Faculty and Staff for

giving me so much-needed support and making me feel at home.

Additionally, I would like to thank our Research Collaborators who shared with us their

knowledge, resources, and time.

Professor John A Martignetti’s group from Icahn School of Medicine at Mount Sinai:

Olga Camacho-Vanegas, PhD.; Sandra Catalina Camacho, MD; Ying Cheng, MD, PhD

Professor Andrzej Jarzecki for help with DFT study.

Professor Oleg Gang’s group from Columbia University and Brookhaven National Laboratory

Suchetan Pal PhD.

No research could be done without generous funding support from various organizations.

ix

This work was supported by the National Cancer Institute under Grant SC2CA206194. J.A.M.

and P.D. received funding from the Varadi Ovarian Initiative in Cancer Education (VOICE), the

Ruttenberg families, the Gordon family, and Wendy and Matthew Siegel, which funded in part,

these studies.

x

TABLE OF CONTENTS

Page

1. LIST OF FIGURES x

2. LIST OF TABLES xii

3. LIST OF ABBREVIATIONS xiii

4. CHAPTER I. DRUG DELIVERY SYSTEMS. 1

4.1. Background and significance 1

4.2. Nanoparticles in drug delivery 5

4.2.1. Liposomes 5

4.2.2. Micelles 6

4.2.3. Inorganic nanoparticles 6

4.2.4. Polymeric nanoparticles 7

4.3. Aptamers as targeting ligands 8

4.4. Formulation of polymeric nanoparticles 9

5. CHAPTER II. NUCLEAR LOCALIZATION SEQUENCE PEPTIDE AS A

PLATINUM (II) DRUG CARRIER 12

5.1. Introduction 12

5.2. Synthetic strategy 14

5.3. DFT analysis and product characterization 17

5.4. Rationale and biological evaluation 21

5.5. Conclusions 26

5.6. Experimental section 27

xi

5.6.1. General experimental procedures and FTIR, 1HNMR and 13CNMR spectra and

HPLC analysis 27

5.7. Appendix. Determination of IC 50 of the Carboplatin and Pt-NLS complexes 52

6. CHAPTER III. A pH-SENSITIVE NANOPARTICLE SYSTEM FOR TARGETED

DELIVERY OF PT (II) THERAPY TO OVARIAN CANCER. 58

6.1. Introduction 58

6.2. Synthetic Strategy and Rationale 61

6.3. Biological evaluation and discussion 66

6.4. Conclusion 73

6.5. Experimental Section 74

6.5.1 General experimental procedures for in vitro study 74

6.5.2 General experimental procedures for cellular uptake, drug release, nanoparticle

characterization and synthesis, pH-sensitive bond cleavage, in vivo biodistribution

(by AAS analysis of organs) and half-life studies, ELISA test for MUC1. 75

6.6 Appendix 82

7. SUMMARY 86

8. BIBLIOGRAPHY 88

xii

1. LIST OF FIGURES

Page

Figure 1. Metallodrugs used in the clinic and examples of metallodrug candidates 4

Figure 2. Schematic representation of NP-based delivery carriers. 5

Figure 3. Schematic of a DNA aptamer and its binding to target protein expressed on the

cell’s surface 8

Figure 4. Schematic representation of the NP synthesis methods. 11

Figure 5. Chemical structure of platinum (II) complexes Pt(II)-N3, and Pt(II)-CCH,

and the structure of the Pt-NLS conjugate. 16

Figure 6. The new approach to Pt-NLS synthesis. 17

Figure 7. Experimental and calculated IR spectra of Pt (II) complexes. 18

Figure 8. HRMS of Pt-NLS hybrid, Pt(II)-N3 complex, Pt(II)-CCH complex. 20

Figure 9 and 10. Confocal images of CP70 cells incubated with NLS peptide. 22

Figure 11. Viability of platinum-sensitive and resistant cells after 72 h of incubation with

Pt-NLS hybrid and controls. 24

Figure 12. ELISA test results for mucin 1 presence in OC cell lines. 62

Figure 13. A schematic of an active targeting module and the proposed Apt-PLGA-Pt NP

platform. 63

Figure 14. TEM image of negatively stained Apt-PLGA-Pt NPs; stability of

Apt-PLGA-Pt NPs in 10% FBS; in vitro Pt (II) release from

Apt-PLGA-Pt NPs in PBS at 37°C. 64

xiii

Page

Figure 15. The measurement of the hydrazone bond cleavage on the Apt-PLGA NPs via

fluorescamine test. Incubation of Apt-PLGA NPs at different pH and incubation

of Apt-PLGA NPs at pH 6.8. 66

Figure 16. Confocal images of cells incubated with PLGA NPs without the Apt and

Apt-PLGA NPs. 67

Figure 17. Confocal images of Apt-PLGA-Pt NPs localized inside different OC Cell lines. 68

Figure 18. Cellular viability of different ovarian cancer cell lines after 72 h incubation with

Apt-PLGA-Pt NPs and controls. 70

Figure 19. The images of NPs biodistribution in vivo in an ovarian cancer mouse model and

excised tumors from an NP-injected mouse and a control mouse. 73

Figure 20. Schematic of the synthetic approach to pH-sensitive PEG2000-hydrazone-

phospholipid coating of nanoparticles. 82

Figure 21. Biodistribution study ex-vivo, nanoparticle treated, control untreated organs. 83

Figure 22 AAS analysis of biodistribution of a platinum drug in organs after 4 days. 83

Figure 23. 1H-NMR spectrum of: A phospholipid hydrazine, B PEG-2000 aldehyde and C

phospholipid hydrazone-PEG2000 conjugate. 84

Figure 24. Monitoring of hydrazone bond formation via 1H-NMR. 85

Figure 25. A slide from the movie with Live imaging of nanoparticle uptake on

CP70 OC cell line. 85

Figures S 1-30. 1H and 13C NMR spectra, HRMS, HPLC analysis and FTIR spectra

of Pt-NLS precursors and products. 31-57

xiv

2. LIST OF TABLES

Page

Table 1. Viability of platinum-sensitive and resistant cells after 72 h of incubation with

Pt-NLS hybrid and controls. 24

Table 2. Cellular viability of different ovarian cancer cell lines after 72 h incubation with

Apt-PLGA-Pt NPs and controls. 71

xv

3. LIST OF ABBREVIATIONS

13C NMR Carbon nuclear magnetic resonance

1H-NMR Proton nuclear magnetic resonance

AAS Atomic absorption spectroscopy

ACN Acetonitrile

amu Atomic mass unit

Apt Aptamer

Arg, R Arginine

Boc tert-butyloxycarbonyl

bp Base pairs

C=O Carbonyl

Carbpt Carboplatin

Cplx-Pt NLS Complex with diamineplatinum

Cplx-Pt-Alkyne Alkyne terminated complex with diamineplatinum

Cplx-Pt-Azide Azide terminated complex with diamineplatinum

d Doublet

Da Daltons

DAPI 4′,6-diamidino-2-phenylindol

DCM Dichloromethane

DFT Density functional theory

DIPEA Diisopropylethylamine

DLS Dynamic light scattering

DMEM Dulbecco's Modified Eagle's Medium

DMF Dimethylformamide

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

DPPE 1,2-Dipalmitoyl-sn-glycero-3-phosphorylethanolamine

DSPC 1,2-distearoyl-sn-glycero-3-phosphocholine

xvi

DSPE 1,2-distearoyl-sn-glycero-3-phosphoethanolamine

EDC 1-ethyl-3-(-3-dimethylaminopropyl) carbodiimide hydrochloride

ELISA Enzyme-linked immunosorbent assay

EPR Enhanced permeability and retention effect

ESI Electrospray ionization

FBS Fetal bovine serum

FDA Food and drug administration

FITC Fluorescein

Fmoc Fluorenylmethyloxycarbonyl

FOLFOX Folic acid, fluorouracil and oxaliplatin regimen

FOV Field of view

FTIR Fourier transform infrared spectroscopy

g Gram

G-G Guanidine-Guanidine crosslink

Gly, G Glycine

HCl Hydrochloric acid

HPLC High performance liquid chromatography

HRMS High resolution mass spectrometry

IC 50 Half maximal inhibitory concentration

IPA Isopropyl alcohol

Lys, K Lysine

m Multiplet

m2 Square meter

meq Milliequivalent

min Minute

ml Milliliter

mM Millimolar

mmol Millimole

xvii

MPS Mononuclear phagocyte system

MUC1 Mucin 1 protein

MW Molecular weight

N3, N=N=N Azide

NER Nucleotide excision repair

NHS N-hydroxysuccinimide

NIR Near-infrared

NLS Nuclear localization sequence

nm Nanometer

NP Nanoparticle

OC Ovarian cancer

PBS Phosphate buffer

PEG Polyethylene glycol

PEG2000 Polyethylene glycol with approximately 2000 amu molecular weight

PLGA Poly lactic-co-glycolic acid

Pro, P Proline

Pt Platinum

Pt-NLS hybrid NLS complex with diamineplatinum

rpm Revolutions per minute

s Singlet

siRNA Small interfering ribonucleic acid

SPPS Solid peptide synthesis

SV40 Simian Vacuolating Virus 40

t Triplet

TBTU 2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetramethylaminium tetrafluoroborate

TEM Transmission electron microscopy

TFA Trifluoracetic acid

THF Tetrahydrofuran

xviii

TIPS Triisopropylsilane

TLC Thin layer chromatography

Uranine Fluorescein

Val, V Valine

WGA Wheat Germ Agglutinin

μM Micromolar

1

4. CHAPTER I. DRUG DELIVERY SYSTEMS

4.1 Background and significance

Cancer is the second most common cause of death in the United States, surpassed only by

cardiovascular disease, accounting for nearly one in every four deaths. The number of new cancer

cases per year is expected to rise to 23.6 million by 20301. In 2021, an estimated 1,898,160 new

cancer cases were diagnosed in the United States, and 608,570 people will die from the disease

(International Agency for research of cancer)2. Ovarian cancer (OC) is one of the leading causes

of death among women, mainly due to the late-stage detection of the disease3. The standard OC

therapy includes surgical removal followed by treatment with Pt (II)-based drugs or Pt (II)

combination therapy with other antineoplastic agents, e.g., paclitaxel4.

The nanoparticle (NP)-mediated delivery systems have been extensively studied to aid

cancer therapy. It is well documented that NPs can encapsulate toxic or hydrophobic drug

molecules, thus minimizing systemic toxicity and achieve targeting5. The accumulation of NPs in

the tumor's interstitium is caused by the tumor's leaky vasculature and so-called enhanced

permeability and retention (EPR) effect, where the NPs extravasate through a defective vascular

system into the tumor’s interstitium6. The accumulation of NPs in the tumor via EPR, also known

as passive targeting, depends strongly on the NP's size, and a suitable diameter of the NP to

facilitate tumor’s targeting via EPR is ~100 nm. Although very promising, the NP-mediated drug

delivery via EPR results only in about 0.7% of the drug retained in the tumor7. To increase the

NPs uptake by cancer cells ensuring that most tumor accumulated NPs enter cancer cells for

maximum efficacy, active targeting strategies can be incorporated into NP designs8. Active

targeting is based on the addition of ligands to the NPs’ surface that recognize complementary

cellular receptors, usually a surface protein overexpressed on cancer cells.

2

There are several different types of NP carriers suitable for drug delivery. Most common

include micelles, liposomes, dendrimers, antibody conjugates, carbon nanotubes, metallic NPs,

protein conjugates, and most importantly, polymeric NPs8. Initially, polymeric NPs were

synthesized with non-biodegradable polymers such as polystyrene and polyethylene glycol

(PEG)9-10. Currently, biocompatible polymers are being explored, including polylactic-co glycolic

acid (PLGA)11. PLGA is biocompatible, biodegradable, and, most importantly, FDA approved12.

Therefore, it is readily used for various medical applications, including biodegradable bone

implants, grafts, sutures, or surgical sealants13. These properties also make PLGA a suitable

material for NP formulations and drug applications.

Cisplatin (cis-diaminedichloroplatinum (II)), the first-generation Pt (II)-based agent, was

approved by the FDA in 1978 for cancer therapy14. Cisplatin is a cytotoxic agent that activates

within the cell to form [Pt(NH3)2]2+ species upon hydrolysis of chlorine ligands. Cisplatin binds to

N-7 of guanine or adenine and forms a 1,2 or 1,3 intrastrand crosslink within DNA, inhibiting

DNA replication15. The major shortcoming of cisplatin is premature activation in the bloodstream,

which induces severe side effects and systemic toxicity, limiting the maximum dosage that can be

used in the clinic16. Besides, binding of Pt (II) to plasma proteins further diminishes the

concentration of Pt (II) capable of entering cancer cells. This often leads to insufficient DNA

damage, followed by cellular DNA repair, and acquired Pt (II) resistance by cancer cells17. The

ultimate recurrence of cancer contributes to low overall survival rates among patients18.

To overcome the negative effect of early activation of cisplatin, second-generation Pt (II)

analogs have been developed. The goal was to diminish the side effects of Pt (II) while increasing

the dosage. These include carboplatin, oxaliplatin, heptaplatin, nedaplatin, and lobaplatin19. All

second-generation Pt (II) drugs possess lower toxicity profiles compared to cisplatin, which is

3

attributed to slower hydrolysis of carboxylate chelates compared to chlorides. However, the dose

escalation is minimal, and the crucial problem of Pt (II) resistance remains, thus the effectiveness

of therapy with second-generation Pt(II) agents remains unchanged20.

Currently, additional Pt (II) analogs undergo clinical trials, such as Lipoplatin and Lipoxal,

as well as liposomal cisplatin and oxaliplatin21-22. Also, combination therapies with drugs targeting

different metabolic pathways or different mechanisms of action are being explored. The

cumulative effect of combination therapies is often a better patient survival profile23.

Another example of an innovative approach to Pt-based therapy is exploring Pt (IV)

complexes, e.g., satraplatin, that rely on Pt (IV) reduction to Pt (II) within the bloodstream.

Satraplatin, currently in clinical trials in the US, can be administered orally instead of

intravenously, which is more convenient to patients and more cost-effective24. Although Pt-based

drugs are still leading therapies of choice, some new promising metalorganic molecules are

emerging. These include ruthenium, gold25, gallium, and also arsenic analogs. Among the most

promising are NAMI-A, KP1019, BOLD-100, AP-002, and Darinaparsin26-27. AP-002 currently

undergoes Phase 2 clinical trial for treatment of solid tumors, such as recurrent breast cancer, non-

small cell lung cancer and prostate cancer28. BOLD-100 is in Phase 1 clinical trial for the treatment

of colorectal, pancreatic, and gastric cancers as well as in combination with FOLFOX29 for

cholangiocarcinoma therapy. Most of the modern metallodrugs are organometallic compounds and

have limited solubility in water (Figure 1). Attempts to incorporate them into more sophisticated

drug delivery systems are being investigated. The anti-cancer applications of organometallic drugs,

although very promising, are still in their early stages. The development of new classes of

organometallic compounds is on the rise30. Figure 1. shows the respective structures of the

metallodrugs.

4

Figure 1. Metallodrugs used in the clinic (top) and examples of metallodrug candidates (bottom).

BOLD-100

Auranofin

AP-002

5

4.2 Nanoparticle drug delivery systems.

NP-based drug delivery systems are of particular interest as they can aid the current search

for more effective cancer therapies. Over the years, several different platforms have been

developed, and the main groups include liposomes, micelles, nanoemulsions, inorganic NPs, and

polymeric NPs30, which are schematically shown in Figure 2.

4.2.1 Liposomes: the Liposome is the first-generation NP system, where a phospholipid bilayer

surrounds an aqueous core31. Liposomes encapsulate hydrophilic molecules in the aqueous

core and hydrophobic molecules within the bilayer. Different liposomal formulations are

currently undergoing clinical trials or are FDA approved and used in the clinic. Among the

latter, Doxil32 is a liposomal formulation of doxorubicin used to treat various solid tumors.

Marqibo is liposomal vincristine used in leukemia, lymphoma, or melanoma33. Also, a

liposomal irinotecan with a brand name Onivyde MM-398 is used in the therapy of

Figure 2. Schematic representation of NP-based delivery carriers.

6

metastatic pancreatic cancer34. However, the disadvantages of liposomes include fast drug

release (burst release) as well as inducing an immune response35.

4.2.2 Micelles: Micelles are simple NPs assembled from amphiphilic molecules. The

hydrophobic side of the amphiphilic molecule comprises the core, while the hydrophilic

side is exposed to the aqueous media. The combination therapies with micellar

formulations of paclitaxel and doxorubicin are in pre-clinical trials in therapies of breast

and colorectal cancers. Similar to liposomes, micelles have characteristic burst drug release

and often premature release resulting from fast structural disintegration in an aqueous

environment35.

4.2.3 Inorganic NPs: Inorganic NPs are most commonly used as contrast agents. Inorganic iron

oxide and hafnium oxide NPs are also being used in current anti-cancer thermal/radio

therapy36. More elaborate designs consist of inorganic NPs embedded in a polymer or

inorganic mesoporous material and active drug with or without the targeting ligand. For

example, iron oxide NPs, loaded with camptothecin and coated with silica gel, propyl-

methyl phosphonate, and folic acid were used in the pancreatic cancer cell model37.

Peptide-coated gold NPs were successfully used to inhibit or activate a blood vessel

formation38. Also, platinum NPs coated with H-Lys-Pro-Gly-Lys-NH2 exhibited superior

selectivity and toxicity to hepatic cancer cells (HepG2) when compared to cisplatin39. The

major drawback of using metallic NPs as drug carriers arises from their lack of

biocompatibility and premature drug release. There is also a question of inorganic NPs

long-term systemic toxicity and accumulation in the body40.

7

4.2.4 Polymeric NPs: Another large group of NPs used in drug delivery comprises polymeric

NPs41. The examples include polystyrene, chitosan, or PLGA NPs, among others.

Polystyrene NPs are stable, can be synthesized in various sizes with low polydispersity,

and are easy to functionalize. However, they are not biodegradable, which limits their

potential clinical use10. Still, they are readily used in model studies of the NP interactions

with cells, proteins, and other biological components42.

PLGA NPs are second-generation NPs capable of fine-tuning drug release that can

sharply increase the efficacy of therapy. Currently, PLGA conjugated microspheres, such

as Trelstar43 and Lupron Depot44, are clinically used to treat prostate cancer. PLGA is a

polyester composed of lactic and glycolic acid subunits and is fully biodegradable and

biocompatible. PLGA is highly hydrophobic, thus, suitable for incorporating hydrophobic

drug molecules. PLGA NPs encapsulating anti-cancer drugs e.g., cisplatin, doxorubicin,

paclitaxel, as well as contrast agents e.g. fluorophores or gold nanocrystals have been

proposed45-46.

PLGA NPs are usually stabilized with surfactants, such as polysaccharides

phospholipids, polyethylene glycol (PEG), or PEGylated phospholipids45. Among these,

PEG is the most widely used in NP formulations creating a stable coating around the NP

in aqueous media due to its hygroscopic properties. As a result, PEGylated NPs are hidden

from the mononuclear phagocyte system (MPS) in the blood compartment, allowing long

NP circulation times47. On the contrary, steric hindrance caused by PEG leads to

suppressed cellular uptake of PEGylated NPs and their endosomal escape. This

phenomenon is known as the "PEG dilemma" and often complicates NP-mediated drug

delivery to cancer cells48.

8

4.3 Aptamers as targeting ligands:

Commonly used active targeting ligands include antibodies, short peptides, foliates,

glycosides, and recently DNA aptamers49. DNA aptamers are short oligonucleotides, usually 15-

70 bp, which gained much attention due to their superior target recognition characteristics that

rival even those of antibodies50. Aptamers bind to their corresponding ligands via noncovalent

interactions, such as hydrophobic forces and electrostatic interactions. The shape of the aptamer

plays a crucial role in molecular recognition. Typical targets for aptamers include proteins,

molecules, nucleic acids, and cells. They are non-immunogenic, biocompatible, and

biodegradable. Unlike antibodies, aptamers are much smaller in size and can be synthesized to

order51. The whole selection process can be completed within three days. It is scalable and more

cost-efficient when compared to antibodies52. Figure 3 shows the schematic structure of an aptamer

and its binding to the cellular target52.

Figure 3. Schematic of a DNA aptamer and its binding to target protein expressed on the cell’s

surface.

9

However, the major drawback of aptamers is their short half-life in vivo caused by

enzymatic degradation, limiting their biological applications53. Aptamers are easy to modify and

functionalize with other molecules like phospholipids or PEG and, importantly, can be

incorporated into the NP's corona. The latter can initiate the receptor-mediated endocytosis of the

NPs and dramatically increase the NP internalization by cancer cells, thus heighten the NP's

retention in the tumor50.

The aim of this project is to address the shortcomings of a free Pt (II) therapy, using a

second-generation PLGA NP platform to encapsulate carboplatin like Pt (II) complex. The NP

design includes active targeting ligand – an aptamer against Mucin 1, which is a protein

overexpressed in OC cells. The active targeting approach in the NP is used with a pH-sensitive

surface shielding technology based on phospholipid-PEG synthesized with an acid-labile linker.

PEG chains shield the aptamer ligands on the NP's surface at physiological pH, and disintegrate at

lower pH exposing the ligands. This can enhance the NP uptake by cancer cells via receptor-

mediated endocytosis and increase the NP retention in the tumor, eventually leading to improved

therapeutic outcomes.

4.4 Formulation of PLGA NPs.

Emulsification-Evaporation method: It is the most commonly used method for PLGA

NP synthesis. In this method, the active ingredient is usually dissolved in a volatile organic solvent

and added to a surfactant-containing aqueous solution while stirring. Once completed, the organic

solvent is evaporated, and emulsion forms. The emulsion can be used as is, or the process can be

repeated several times to achieve double or multiple emulsions. However, the concentration of the

polymer has to be strictly controlled. The size of NPs depends on the polymer concentration in the

evaporation step54-55.

10

Salting out method: In this method, both PLGA polymer and a drug are dissolved in an

organic solvent miscible with water. An organic solution is added to an aqueous solution

containing salt and surfactant. The NPs form while organic solvent dissolves in aqueous media.

This method is very convenient if components are temperature sensitive, as it can be performed at

room temperature. However, it requires extensive purification steps to remove residual

surfactants54-55.

Microfluidics-assisted method: Microfluidic method allows for the continuous synthesis

of NPs. Organic solutions containing PLGA polymer and drug, as well as an aqueous solution

containing surfactants, are transferred via micro channels into a mixing chamber where NPs

synthesis occurs. The NPs synthesized by this method have a more narrow size range, compact

morphology, and a high level of reproducibility. This is attributed to strictly controlled solvent

flow rate, temperature, and reaction time56-57. The schematic approach to each nanoparticle method

is shown in Figure 4.

Nanoprecipitation method: It is a single-step procedure where polymer and drug

dissolved in an organic solvent are added dropwise into an aqueous solution containing

surfactant/s. Phospholipids and PEGylated phospholipids may serve as stabilizing agents. This

method is easily scalable. The NP size depends on polymer-surfactant ratio, PLGA molecular

weight, the chemical nature of the solvent as well as the stirring rate. Afterward, the product is

washed several times to remove residual surfactants. This method's simplicity allows for easy

surface modification and purification of the synthesized NPs54-55. The nanoprecipitation method

was used in this work to synthesize pH-sensitive PLGA NPs for Pt(II) delivery.

11

Figure 4. Schematic representation of the NP synthesis method58-60.

12

5. CHAPTER II. NUCLEAR LOCALIZATION SEQUENCE PEPTIDE AS A

PLATINUM(II) DRUG CARRIER

5.1 Introduction

Nuclear localization sequence (NLS) peptides target nuclear transport. Importins α and β

facilitate the transport of proteins or DNA into the nucleus. Proteins containing NLS sequence

bind to importin α active sites and then to the importin β. Interaction of importin β with nuclear

pore complex enables nuclear transport of importin α complex into the nucleus and release of its

cargo protein. The first the NLS peptide, with PKKKRKV sequence, was discovered in SV40

Large T-Antigen. This peptide has demonstrated an excellent ability to transfer SV40 Large T-

antigen into the nucleus and has been used as a model study for NLSs. The PKKKRKV sequence

is of viral origin and belongs to the monopartite family of NLSs, indicating only one continuous

peptide sequence. Other bipartite NLSs possess two separate peptide sequences separated by a

short spacer sequence. Bipartite NLS peptides are predominant localization sequences found in

cellular nuclear proteins.

Since their discovery, the platinum (II) based drugs (Figure 1) are leading compounds of

choice in many cancer therapies. Cisplatin, cis-diamminedichloroplatinum(II), is the first platinum

(II) medication approved by the FDA for anticancer treatment15, 19, 61. Other FDA-approved

platinum (II) drugs include carboplatin and oxaliplatin. There are also additional platinum drugs

that are awaiting FDA approval or are already in use outside the US19. The overall survival rates

of patients treated with any Pt-based complex are comparable. Cisplatin, carboplatin, and

oxaliplatin share a structural feature, where amine ligands are coordinated to the central platinum

atom. However, the remaining two ligands are varied in the complexes. In cisplatin, there are two

chlorides coordinated to platinum, while carboplatin and oxaliplatin have carboxylate ligands. In

13

both cases, the drug must possess a cis configuration to present high efficacy. Transplatin, with

trans configuration, is much less potent compared to cisplatin.

The mechanism of action of platinum compounds involves an initial hydrolysis of either

chlorine or carboxylate ligand, leading to the formation of active [Pt(NH3)2L(H2O)]+ species that

enter the nucleus via electrostatic interactions to negatively charged DNA. Activated cisplatin

forms covalent DNA adducts between intrastrand 1,2d (GpG) and 1,3d (GpXpG), as well as

interstrand G-G cross-links. The platinum-induced changes lead to DNA shape distortion, resulting

in inhibition of the cellular replication and transcription processes. Once the damage to DNA is

beyond repair, the cell induces apoptosis62-64.

However, although highly potent, the Pt-based therapy also results in systemic toxicity,

which varies for different complexes and is dependent on the ligands coordinated to the Pt (II)

center. Cisplatin induces higher systemic toxicity compared to carboplatin and oxaliplatin due to

its high aquation rates and formation of active Pt(II) species in the circulation, which can affect

healthy cells65. Therefore, lower drug concentrations have to be used therapeutically. In addition,

the activated cisplatin in circulation forms irreversible complexes with molecules containing free

thiol –SH, and reversible complexes with -SCH3, affecting glutathione, metallothionein, and

methionine. Sulfur coordinated platinum complexes are unable to interact with DNA due to

increased stability of S-Pt bond, diminishing their effectiveness. In addition the Pt complexes bind

to plasma proteins. Those interactions inhibit the therapeutic activity of cisplatin, decreasing its

efficacy. As a result, subtherapeutic concentrations of cisplatin may reach the cancer cell nucleus,

causing lower DNA damage and activation of DNA repair pathways, contributing to the

development of subsequent drug chemoresistance66-67.

14

Oxaliplatin and carboplatin have lower aquation rates, as carboxylate ligands coordinated

to platinum are more resistant to hydrolysis as compared to chlorides in cisplatin64, 68-70. Therefore,

these complexes are characterized by lower systemic toxicity. Also, the shelf life of aqueous

solutions of carboplatin is longer when compared to cisplatin. Only about 3% of carboplatin

decomposed after 150 days of storage in aqueous media70. Ideally, the activation of the Pt-based

complexes should occur in the cytoplasm, then [Pt(NH3)2L(H2O)]+ complex should enter the

nucleus and interact with the DNA. One drawback of Pt (II) complexes with carboxylate ligands

is slow hydrolysis in the cytoplasm, which delays the formation of active Pt (II) species and slows

down the nuclear entry, eventually lowering the efficacy of the drug. To address this problem,

thousands of platinum complexes have been reported for over forty years, but only a few have

entered clinical trials. Thus, the need for developing a new class of platinum compounds is of high

importance. The lower systemic toxicity, higher drug efficacy, and better solubility under

physiological conditions are the key factors that need to be improved in Pt-based therapy71-72.

5.2 Synthetic strategy

Short peptides are increasingly explored for therapeutic applications, and currently, over a

hundred peptide-based therapies are undergoing clinical trials. Short peptides are among the large

group of targeting ligands employed in the fight against cancer. Other systems include Pt (II)

conjugates with folate receptors73, angiogenic receptors74, liver and estrogen receptors75-76.

Glucose conjugates have also been explored to target the high nutritional demand of cancer cells77.

Previously reported peptide conjugates with platinum employed mainly Pt (IV) prodrugs and a

limited number of Pt (II) conjugates. PEG-Pt-NLS conjugates were also reported with moderate

therapeutic efficacy78-84.

15

Our approach focuses on the formation of PKKKRKV peptide hybrid with Pt (II)

complexes. NLS peptides usually possess a high concentration of hydrophilic amino acids in their

sequence. A high presence of arginine and lysine amino acids in PKKKRKV makes the NLS

peptide highly water-soluble. It also gives it a positive charge under physiological conditions,

required for successful interaction with integrin α and nuclear membrane transport85-86. The goal

is to conjugate carboplatin-like complexes with NLS peptide to solve two significant problems

associated with the use of carboplatin. Firstly, we aim to provide the ability for targeted transfer

of unchanged Pt (II) complex into the nucleus. Secondly, we focus on a significant increase in the

solubility of the drug.

The original approach to form the Pt(II)-NLS hybrid employed the synthesis of new

carboplatin-like complexes that have linkers available for chemical reactions. To this end, azide

Pt(II)-N3 (C10H21N5O4Pt) and an alkyne Pt(II)-CCH (C10H18N2O4Pt) complexes were synthesized

in a multistep organic synthesis, which is explained in Experimental Section. The goal was to

conjugate our new complexes functionalized with alkyne or azide to NLS peptide via a click

reaction, as presented in Figure 5.

16

Figure 5. Chemical structure of platinum (II) complexes Pt(II)-N3 (A), and Pt(II)-CCH (B), and

the structure of the Pt-NLS conjugate (C).

However, the Pt-azide and Pt-alkyne complexes do not dissolve in water and, although the

complexes are promising for organic solvent-based approaches, the conjugation to NLS peptides

was difficult. Therefore, we employed the new synthetic pathway, which is shown in Figure 6, to

form the Pt-NLS hybrid. In the first step, the NLS peptide was conjugated with dicarboxylate

ligand via copper-catalyzed click reaction during solid-phase peptide synthesis. In the second step,

the dicarboxylate-NLS ligand was purified and conjugated with diamine platinum. This strategy,

which involved the formation of the Pt (II) complex directly on the peptide, was successful and

resulted in a stable, highly soluble Pt-NLS hybrid that was further explored for therapeutic

purposes. The full description of the synthetic strategy is included in the Experimental Section.

A B

C

17

Figure 6. The new approach to Pt-NLS synthesis. Peptide 1 reacts with activated

diaminediaquaplatinum (II) to form peptide 2 (Pt-NLS).

5.3 Density Functional Theory (DFT) analysis and characterization of the products.

Azide and alkyne complexes, as well as Pt-NLS hybrid, were analyzed by the FT-IR.

Experimental spectra were compared to the density functional theory (DFT) calculated spectra87.

Vibrations, characteristic for several functional groups present in all complexes, were detected,

and azide and alkyne functionalities present in Pt(II)-N3 and Pt(II)-CCH were identified. An

overlay for the computed and experimental spectra is presented in Figure 7. The N═N═N and the

C≡C stretching vibrations are observed as an intense signal at 2095 cm–1 (frame A) and weak

signal at 2111 cm–1 (frame B), respectively. The IR bands around 1320 and 1600 cm–1 are assigned

to the C=O stretching. The experimental spectra for the complexes are in good agreement with

DFT predicted data.

18

Figure 7. Experimental and calculated IR spectra of Pt (II) complexes; Pt(II)-N3 complex (section

A), Pt(II)-CCH complex (section B), and Pt-NLS hybrid (section C).

The IR spectrum of Pt-NLS conjugate (frame C) shows characteristic amide I, II, III bands

at 1642 cm–1, 1542, and 1338 cm–1, respectively, and they are also in agreement with those

obtained by the DFT study. DFT spectra overemphasized the intensities of C═O stretching at

around 1600 and 1450 cm–1, most likely due to the C═O proximity and coordination to Pt (II) that

enhances electron polarizability in an analyzed model, thus over stimulating computed intensities.

Characteristic deformations for the Pt (II) complex are found at lower frequencies of 900–700 cm–

1. Those frequencies are specific to a six-member ring present in all characterized complexes and

Pt-NLS conjugate. DFT calculations were performed by Dr. Andrzej Jarzecki from Brooklyn

College.

19

The complexes and the hybrid were also analyzed by High Resolution Mass Spectrometry

(HRMS), and the results are presented in Experimental Section (Figure 8). The data clearly

demonstrate that isotopic distributions are in agreement with the theoretical values. The exact

masses of the complexes are as follows: Pt(II)-N3 complex is 470.1241 au, and of the Pt(II)-CCH

complex is 425.0914 au; the Pt-NLS hybrid is 1447.7865 au. As mentioned before, the solubility

in aqueous media of the alkyne and azide complexes was very low. However, the new synthesis

strategy that was based on forming the complexes directly on the NLS peptide resulted in highly

enhanced solubility of Pt (II) via conjugation to the peptide. The solubility of Pt-NLS was found

to be over 50 mg/ml or 35 mM. Importantly, enhanced solubility of Pt (II) through NLS peptide

addresses one of the major concerns associated with the bioavailability of platinum-based therapy.

20

Figure 8. HRMS of Pt-NLS hybrid (section A),Pt(II)-N3 complex (section B), Pt(II)-CCH complex

(section C).

21

5.4 Rationale and biological evaluation of new Pt(II)-NLS hybrid.

As mentioned before, NLS peptides have a unique ability to penetrate cellular and nuclear

membranes. DNA or small proteins can be carried into the cytoplasm and then to the nucleus with

the assistance of the NLS peptides. PKKKRKV peptide belongs to the well-known group of short

peptides with the ability to carry DNA or small proteins into the cytoplasm and nucleus88-89. To

confirm the penetrating properties of the PKKKRKV peptide, we tested the fluorescein (FITC)

labeled NLS (FITC-NLS) in selected ovarian cancer cell line CP70, which is platinum-resistant.

The CP70 cells were incubated with FITC-NLS peptide for 72h, and the cells were examined under

a confocal microscope. The results are presented in Figure 9. Figure 9A represents the phase-

contrast confocal image of CP70 cells, and Figure 9B shows the FITC-NLS (green) penetration

into the CP70 cells., Figure 9C shows the nucleus stained with DAPI (blue), and Figure 9D is the

overlay of B and C images. Figure 10 shows a zoom-out picture of the CP70 cell line. All cells

were successfully penetrated by FITC-NLS conjugate (Figure 10B). Based on these studies, it is

evident that the FITC-NLS peptide successfully penetrated the nuclear and cellular membrane.

These encouraging results confirm the utility of NLS-based as a drug delivery platform.

22

Figure 9. Confocal images of CP70 cells incubated with NLS peptide: (A) phase-contrast

image, (B) fluorescence image of the same cells with FITC-NLS peptide, (C) nuclei of the cells

with DAPI, (D) overlay of B and C.

Figure 10. Confocal images of a large area of CP70 cells incubated with NLS peptide: (A) phase-

contrast image, (B) fluorescence of cells with FITC-NLS peptide, (C) nuclei of the cells stained

with DAPI, (D) overlay of A, B and C.

A B

C D 50 μm

23

Platinum-based drugs are used in treatments of several human malignancies, including

ovarian cancer (OC). In order to evaluate the cytotoxic properties of Pt-NLS, we tested the hybrid

in selected six OC cell lines that differ in histotypes, genomic features, and resistance to platinum64,

90-92. All results were compared to carboplatin, a structurally similar type of platinum complex

currently used in the clinic, as well as to the NLS peptide without platinum and to NLS-free

complexes. The results are presented in Figure 11. The IC50 values of Pt-NLS hybrid and

carboplatin were determined for each cell line and are presented in Experimental Section (Figures

S19-S30). Pt-NLS hybrid demonstrated higher cytotoxicity as compared to carboplatin in all cell

lines tested. The most pronounced cytotoxic effect of Pt-NLS was observed in A2780, a platinum-

sensitive cell line, where a 60% decrease in viability was observed for Pt-NLS, as compared to

only 25% for carboplatin. In CP70 cell line, which is platinum-resistant and isogenic to the A2780

cell line, showed a 40% decrease in viability for Pt-NLS and 30% for carboplatin. Other Pt-

sensitive cell lines tested included TOV21G and ES2. The Pt-NLS reduced the viability by 50%

in TOV21G and 30% in ES2, as compared to 40% and 20% for carboplatin, respectively. For other

platinum-resistant cell lines, SKOV3 and OV90, the viability decreased by 50% and 45%, while

for carboplatin by 40% and 35%, respectively. Free azide and alkyne complexes demonstrated the

superior cytotoxic effect in all tested cell lines. The fragmentation profile from HRMS suggests

faster carboxylate ligand exchange with water and quicker release of the activated cisplatin.

However, a poor aqueous solubility of the complexes hampers their biological applications. As a

result, suspensions of both complexes had to be used in all in vitro experiments. On the other hand,

the superior solubility of the Pt-NLS hybrid over 50 mg/ml, compared to cisplatin (1 mg/ml) and

carboplatin (10 mg/ml), makes it much more desirable drug candidate.

24

Figure 11. Viability of platinum-sensitive (left) and resistant (right) cells after 72 h incubation

with Pt-NLS hybrid and controls. The purity of the Pt-NLS hybrid was 87%. Each column

represents the mean and standard deviation of N = 3 and p < 0.005. The concentrations are

constant in each cell line and are as follows: 24.6 μM (A2780), 52.8 μM (CP70), 56.6 μM (TOV-

21G), 56.6 μM (SKOV3), 18.4 μM (ES-2), 59.0 μM (OV-90). Abbreviations: Carboplatin

(Carbpt), Complex-Pt (Cplx-Pt). Concentrations of Pt-NLS for each cell line were chosen based

on the results from IC50 studies.

25

Table 1. Viability of Pt-sensitive and Pt-resistant cells after incubation with Pt-NLS hybrid for 72

h. Cells witout any treatment (blank), incubation with NLS peptide, and carboplatin were used as

controls.

As a proof of concept, we investigated if the Pt-NLS hybrid indeed leads to the formation

of Pt-DNA adducts in the nucleus. To this end, we determined the Pt (II) content in the isolated

DNA. We used two cell lines A2780 and CP70, that were treated with Pt-NLS for 72 hours. The

DNA was extracted from the cells, and its concentration was determined using the nanodrop, while

the platinum concentration was established with atomic absorption spectroscopy (AAS). The ratio

of platinum to DNA base pairs was found to be about 1:244 in A2780 cells and 1:114 in CP70

cells. Assuming that there are approximately ten base pairs per turn in the DNA helix, it was

estimated that the platinum complex was bound every 20th turn in the A2780 cell line and every

10th in CP70 cells. However, since the above test was performed on whole cellular DNA, including

mitochondrial, the true Pt:DNA ratio might even be higher. The above test directly confirms that

Pt-NLS effectively shuttles Pt(II) into the nucleus.

Cell line A2780 CP70 TOV21G SKOV3 ES2 OV90

Concentration [μM] 24.6 52.8 56.6 56.6 18.4 59.0

% V

iab

ilit

y

Blank 100.0 100.0 100.0 100.0 100.0 100.0

NLS 99.0 80.0 82.0 82.0 99.0 100.0

Carboplatin 75.0 70.0 60.0 60.0 80.0 65.0

Pt-NLS hybrid 40.0 60.0 50.0 50.0 70.0 55.0

Cplx-Pt-Alkyne 20.0 28.0 33.0 24.0 40.0 40.0

Cplx-Pt- Azide 10.0 16.0 34.0 19.0 20.0 36.0

26

5.5 Conclusions.

In summary, we report the synthesis and biological evaluation of carboplatin-like

complexes bearing azide and alkyne functionalities. We also report the synthesis and

characterization of the Pt-NLS hybrid. The hybrid successfully penetrates the cellular, and nuclear

membranes, thus, delivering platinum complexes into the nucleus. In addition, Pt-NLS showed

higher cytotoxicity than clinically relevant carboplatin while tested using platinum-sensitive and

platinum-resistant OC cell lines. The combination of high solubility and biological activity of the

Pt-NLS hybrid, as well as excellent transport properties of the NLS peptide, suggest a high

therapeutic potential of the Pt-NLS platform. Moreover, the Pt-complexes with alkyne and azide

ligands might find use in other transport systems, such as nanoparticles, or solid supports, which

extends their applications. Such conjugates could form the basis for other Pt (II) delivery methods.

Future studies may include in-vivo evaluation of Pt-NLS hybrid. A half-life experiment will

provide important information about drug stability under physiological conditions, while the

therapy study will provide the biodistribution and cytotoxic profile of the Pt-NLS system. Since

an enzymatic degradation of the peptide might be an issue, modified NLS peptides could be used

as targeting ligands. Furthermore, the therapeutic applications of Pt-NLS. Can be extended to

cancer models other than ovarian. Since Pt-NLS hybrid has an amphiphilic character with a

hydrophobic platinum complex and hydrophilic NLS peptide, examining the self-assembly

properties of Pt-NLS towards micelle formation might allow the development of a new targeted

nanoparticle-based delivery system. Finally, radioactive trackers could be used to visualize the

cellular translocation of Pt-NLS hybrid, providing insights into organellar distribution of the

therapy.

27

5.6 Experimental section:

5.6.1 General experimental procedures

Chemicals were purchased from Acros Organics: potassium carbonate 99%, sodium

hydride 60% in mineral oil, diethyl methylmalonate 99%, silver nitrate, cis-

dichlorodiamineplatinum (II) 99%, 5-hexynoic acid 97%, copper (I) iodine 99.995%; Alfa Aesar:

propargyl bromide 97%, (80% in toluene), 6-chloro-1-hexyne 98%, 1,6-dibromohexane 97%,

ninhydrin 99%; Fisher Scientific: uranine powder 40%, sodium azide, L-ascorbic acid, phenol,

sodium hydroxide; Chem-Impex INT’L INC.: 6-bromohexanoic acid 99.2%,

Chemicals for solid-phase peptide synthesis (SPPS) were purchased from Chem-Impex

INT'L INC.: Fmoc-L-Pro 99.44%, Fmoc-L-Val 4-alkoxybenzyl alcohol resin (0.332 meq/g) and

Nα-Fmoc-Nω-Pbf-L-Arg 99.1%, triisopropylsilane (TIPS); Acros Organics: Nα-Fmoc-Nε-Boc-L-

Lys, ANASPEC INC.: 2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetramethyluronium tetrafluoroborate

(TBTU); Alfa Aesar: piperidine 99%, trifluoroacetic acid 99% (TFA) and Oakwood Chemical:

N,N-diisopropylethylamine (DIPEA).

All solvents were bought and used without further purification. Fischer Scientific (ACS

grade): chloroform, ethyl acetate, methylene chloride, anhydrous ethyl ether, 2-propanol (IPA),

N,N-dimethylformamide (DMF), methanol, hexanes; Acros Organic: acetonitrile HPLC grade;

Alfa Aesar: anhydrous tetrahydrofuran (THF) and Koptec: ethyl alcohol 190 proof.

NMR spectra of all the synthetic samples were recorded on Bruker 400 MHz Ultra Shield

instrument.

LC/MS: Ultra High Performance Liquid Chromatography System Agilent Technologies 1200

series Accurate-Mass TOF LC/MS 6220.

IR: Nicolet iS10 FT-IR Spectrophotometer Thermo Scientific

AAS: Atomic Absorption Spectrophotometer AAnalyst 800 Perkin Elmer

28

HPLC: High-Performance Liquid Chromatography Agilent Technologies 1260 Infinity

Cell culture methods.

Human cancer-derived cell line A2780 and its isogenic clone CP70 were generously donated by

Professor J. A. Martignetti from Department of Genetics and Genomic Sciences, Icahn School of

Medicine at Mount Sinai, 1425 Madison Avenue, New York, NY 10029, and SKOV-3, OV-90,

TOV-21G, ES-2 were purchased from ATCC. The cell lines were cultured in Dulbecco's Modified

Eagle Medium (Sigma Aldrich) supplemented with 10% (A2780, CP70, SKOV-3,

ES-2) or with 15% (TOV-21G, OV-90) fetal bovine serum (HyClone) with L-Glutamine

(HyClone) and penicillin/streptomycin (HyClone). All cells were grown in a 5% CO2, water-

saturated atmosphere at 37°C. For in vitro experiments, 3x105 cells were seeded in each 96-well

plate and pre-cultured overnight. All stock solutions of standards and drugs were prepared in water.

Figures S20 to S25 describe the determination of IC50 carboplatin for each cell line. Figures S26

to S31 describe the determination of IC50 Pt-NLS for each cell line. The concentration of all

substrates was adjusted to match the molar concentration of carboplatin. The volume of substrates

in the solution was adjusted to not exceed 10% of the media volume. After 72 hours of incubation,

media was removed, and the cell viability/cytotoxicity was evaluated using TACS MTT Cell

Proliferation assay (Trevigen) according to the manufacturer instructions and analyzed by a plate

reader (SpectraMax M3 by Molecular devices).

29

Isolation of DNA.

Cell lines type A2780 and CP70 were seeded onto a petri dish at the density of 3x105 cells/petri

dish and incubated for 72h according to the procedure described above. Media was removed, and

each dish was washed three times with PBS. Cells were treated with trypsin for approximately two

minutes then media was added. After centrifugation at 1250 rpm for 10 min, cells were washed

with PBS three times and centrifuged again. The whole cellular DNA was isolated using QIAamp

® DSP DNA Mini Kit (QIAGEN) according to the manufacturer's instructions. The concentration

of DNA was measured using NanoDrop 2000C Spectrophotometer (Thermo Scientific).

Confocal images.

Cell line type CP70 was seeded onto a 35mm MatTek confocal dish at the density of 3x105 cells

per dish and pre-cultured overnight and incubated with FITC modified NLS peptide in media for

72h. After incubation, media was removed, and the cells were washed three times with PBS

(Dulbecco's phosphate-buffered saline, Corning). Glutaraldehyde (Alfa Aesar) was added, and

after 2 hours' cells were washed three times with PBS again. DAPI was used to stain the nucleus.

The distribution of the drug was visualized by confocal microscopy (Fluoview FV10i

OLYMPUS).

30

Synthesis of compound 1

All glassware was flame dried and cooled under an argon atmosphere.

All steps were carried under an argon atmosphere.

Diethyl methylmalonate 10.00g [58.5mmol] in 20ml of dry THF was

added dropwise into sodium hydride 3.51g [87.8mmol] suspension in 20ml of dry THF at 0oC.

Hydrogen gas evolution was observed. The reaction mixture was allowed to warm up to room

temperature and stirred for 30min. The reaction mixture was transferred via a cannula into a

solution of 1,6-dibromohexane 16.73ml [87.8mmol] in 30ml of dry THF. The color of the reaction

mixture changed to yellow/brown with stirring. Progress of the reaction was monitored by TLC

[hexane/ethyl acetate 9:1]. Upon completion (about 17 hours), the reaction was quenched with 5ml

of saturated ammonium chloride solution, diluted with 20 ml of water, and extracted with diethyl

ether [3x50ml]. The organic layer was dried with anhydrous sodium sulfate. The crude product

was purified by flash chromatography using solvent gradient starting with 1:0 to 9:1 hexane to

ether ratio. Afforded 11g of pure product [56% yield]. 1H NMR (CDCl3) 4.166 (q, 4H), 3.391

(t, 2H) 1.860 (m, 4H), 1.458 (m, 2H), 1.419 (s, 3 H), 1.351 (m, 2H), 1.241 (t, m overlap,

8 H). 13C NMR (CDCl3) 172.42, 61.11, 53.61, 35.37, 33.77, 32.66, 28.98, 27.89, 24.07, 19.84,

14.06 (Figure S1.). HRMS-ESI: m/z [M + H]+ calc. for C14H25BrO4 : 337.1014; found: 337.0992.

31

Figure S 1. 1H and 13C NMR spectra of compound 1.

32


All glassware was flame dried and cooled under an argon atmosphere.

All steps were carried under an argon atmosphere.

To a solution of sodium iodide 3.71g [24.7mmol] in 15ml of acetone,

6-chloro-1-hexyne was added 1.00ml [8.25mmol] and stirred under reflux overnight. Progress of

the reaction was monitored by NMR. Upon completion, acetone was removed under vacuum. The

remaining solid was diluted with 20 ml of water and extracted with diethyl ether [3x30 ml]. The

organic fraction was washed with brine [20 ml] then dried with anhydrous magnesium sulfate.

Afforded 1.52g of product [88.9% yield]. 1H NMR (CDCl3) 3.209 (t, 2 H), 2.226 (dt, 2H, J =

2.4 Hz) 1.960 (m, 3H), 1.647 (m, 2H). 13C NMR (CDCl3) 172.34, 84.11, 68.36, 61.13, 53.57,

34.91, 28.60, 23.33, 19.79, 18.13, 14.04.

Diethyl methylmalonate 1.00g [5.85mmol] in 20ml of dry THF was added dropwise into sodium

hydride 0.35g [87.8mmol] suspension in 20ml of dry THF at 0oC. Hydrogen gas evolution was

observed. The reaction mixture was allowed to warm up to room temperature and stirred for 30min.

6-iodo-1-hexyne 1.15g [7.28mmol] was added in one portion. The brown color of the solution was

observed. Progress of the reaction was monitored by TLC [hexane:ethyl acetate 9:1]. Upon

completion (about 17 hours), the reaction was quenched with 3 ml of saturated ammonium chloride

solution, diluted with 10 ml of water, and extracted with diethyl ether [3x20ml]. The organic layer

was dried with anhydrous sodium sulfate. The crude product was purified by flash chromatography

using solvent gradient starting with 1:0 to 9:1 hexane to ether ratio. Afforded 1.48g of pure product

[99.3% yield]. 1H NMR (CDCl3) 4.165 (q, 4 H), 2.195 (dt, 2H, J = 2.8 Hz) 1.917 (t, 1H),

1.887-1.835 (m, 2H), 1.539 (m, 2H), 1.401 (s, 3H), 1.351 (m, 2H), 1.241 (t, 6H).

33

13C NMR (CDCl3) 172.34, 84.11, 68.36, 61.13, 53.57, 34.91, 28.60, 23.33, 19.79, 18.13, 14.04

(Figure S2.). HRMS-ESI: m/z [M + H]+ calc. for C14H22O4: 255.1596; found: 255.1560.


34


To a solution of bromide 8.11g [24.1 mmol], 1 in 75ml of DMF,

sodium azide 4.69g [72.1mmol] was added. Not all azide dissolved.

The reaction mixture was allowed to stir over the weekend. Progress

of the reaction was monitored by NMR. Upon completion, DMF was removed under vacuum at

45oC. Afforded colorless oil 7.20g, quantitative yield. 1H NMR (CDCl3) 4.173 (q, 4H), 3.239

(t, 2H), 1.831 (m, 2H), 1.574 (m, 2H), 1.406-1.245 (s,m,t, 15H). 13C NMR (CDCl3) 172.39,

61.07, 53.57,51.36, 35.33, 29.33, 28.70, 26.41, 24.07, 19.81, 14.02 (Figure S3.). HRMS-ESI: m/z

[M + H]+ calc. for C14H25N3O4 300.1926; found: 300.2019.

35


36

Synthesis of compounds 4, 5

To a solution of azide 3 3.78g [12.6mmol] in 15ml of methanol,

sodium hydroxide 3.03g [75.8mmol] was added. A pale yellow

solution was observed. Progress of the reaction was monitored by

TLC [hexane:ethyl acetate 4:1]. Methanol was removed under vacuum. Water was added 20ml,

and an aqueous fraction was extracted with ether [3x20ml]. The organic phase was discarded. The

aqueous phase was acidified with 10% HCl and extracted with ethyl acetate [3x35ml]. The organic

phase was dried over anhydrous sodium sulfate. Afforded white solid 2.78g [90% yield]. 1H NMR

(DMSO) 12.566 (bs, 2H), 3.305 (t, 2 H), 1.700 (m, 2H), 1.512 (m, 2H), 1.301-1.159

(m,s,m, 9H). 13C NMR (DMSO) 173.63, 52.69, 50.56, 35.04, 28.86, 28.14, 25.93, 23.77, 19.64

Figure S5. HRMS-ESI: m/z [M + Na]+ calc. for C10H17N3O4 266.1117; found: 266.1136. IR

spectrum Figure S4.

Figure S 4. FTIR spectra of compound 4.

37


38

Product 5 was synthesized by the same procedure from substrate 2.

Afforded white solid with [94% yield]

1H NMR (DMSO) 12.610 (bs, 2 H), 2.730 (s, 1 H), 2.154 (dt, 2H

J=2.4Hz), 1.699 (m, 2H), 1.427 (m, 2H), 1.281-1.243 (m,s, 5H).

13C NMR (DMSO) 173.63, 52.69, 50.56, 35.04, 28.86, 28.14, 25.93, 23.77, 19.64 Figure S7.

HRMS-ESI: m/z [M + Na]+ calc. for C10H14O4 221.0790; found 221.0798. IR spectrum Figure S6.

Figure S6. FTIR spectra of compound 5.

39


40

Synthesis of Pt-N3 (6) and Pt-CCH (7) complexes

To a suspension of cisplatin 101.6mg [0.338mmol] in 190 proof

ethanol 10ml, silver nitrate was added 112.2mg [0.660mmol]. A

white precipitate formed upon silver nitrate addition. The reaction

was stirred in the dark at 40-50oC until the test for silver +1 with

10% HCl was negative. Usually 1 to 2 hours. Most of the white

precipitate was removed by centrifugation. The remaining solid

was removed via syringe filter 0.2µm. The filtrate was tested for

the presence of platinum with tin (II) chloride.

To dicarboxylic acid 4 80.3mg [0.330mmol] solution in 2ml of ethanol, sodium hydroxide 26.4mg

[0.660mmol] in 2 ml of ethanol was added. After 5 minutes of stirring, filtrate containing activated

platinum from the first step was added dropwise. Some white precipitation was observed. Stirred

at room temperature over 2 hours. Progress of the reaction was monitored by HRMS due to poor

solubility of substrate in DMSO and methanol. Solid was removed by centrifugation and washed

twice with methanol 5ml and once with ether 20 ml Afforded white powder 66.7mg [43%yield].

Product Pt-N3 complexes: No NMR due to poor solubility. HRMS-

ESI: m/z [M + H]+ calc. for C10H21N5O4Pt 471.1320; found

471.1313, Figure S10. IR spectrum, Figure S8.

Product Pt-CCH complexes: Afforded off white powder 32.0mg

[39.4%yield]. No NMR due poor solubility. HRMS-ESI: m/z [M + H]+ calc. for C10H18N2O4Pt

426.0993; found 426.0973, Figure S13. IR spectrum, Figure S9.

41

Figure S 8. FTIR spectra of Pt-N3 complex 6.

Figure S9. FTIR spectra of Pt-CCH complex 7.

42

Figure S10. HRMS of Pt-N3 complex 6.

Figure S11. HRMS of Pt-CCH complex 7.

43

General procedure for synthesis of precursor for Pt-NLS hybrid (peptide 1), Pt-NLS hybrid

(peptide 2) and NLS-FITC (peptide 3).

Peptide sequence PKKKRKV

Precursor for Pt-NLS hybrid (peptide 1)

The standard SPPS method has been employed to synthesize PKKKRKV peptide. Briefly,

5g of Fmoc-L-Val 4-alkoxybenzyl alcohol resin (0.332 meq/g) were soaked in DMF 25ml for 1-

hour prior to use. Deprotection of Fmoc protecting amine group was carried with 20%

piperidine/DMF solution 5 min followed by 20 min cycle. Upon completion, the resin was washed

for 1min with each solvent as follows: DMF, IPA, DMF, IPA, DMF, IPA, DMF, DMF. Kaiser test

was performed, and if positive, coupling was performed overnight. Standard coupling conditions:

Wang resin 1.65mmol, Fmoc amino acid 3.3mmol, TBTU 3.3mmol, DIPEA 6.6mmol. DMF 10ml.

The amino acid was dissolved together with TBTU in DMF then DIPEA was added. The resulting

44

solution was transferred to a reaction vessel and shaken overnight. The next day resin was washed

for 1 min with DMF, IPA, DMF, and IPA. Then Kaiser test was performed again. If negative,

another deprotection cycle started, followed by coupling of subsequent amino acid. If the Kaiser

test was positive coupling procedure was repeated.

The N-terminal amino acid was derivatized with either 6-azido-hexanoic acid1 or 5-

hexynoic acid by the same coupling procedure. Peptide 1 was synthesized via click reaction.

Briefly, to 0.315mmol of derivatized peptide, 0.631mmol of solid copper iodide was added,

followed by 0.631mmol of 4 and ascorbic acid 0.631mmol in 5 ml of deoxygenated 20%

piperidine/DMF solution. Brown solution formed while shaking. Any exposure to air caused a

color change to green. Therefore, all solvents were degassed by passing argon gas through the

solvent for at least 30 min. Speed of reaction, when exposed to air, decreases drastically, probably

due to oxidation of Cu1+ to Cu2+. Progress of the reaction was monitored by HRMS. Upon

completion, the resin was washed for 1 min with 5ml of DMF, IPA, DMF, Methanol,

Dichloromethane, Methanol, and diethyl ether. Cleavage of peptide 1 from the resin was achieved

with a solution of TFA/TIPS/H2O ratio 95/2.5/2.5 over 3 hours. The crude peptide was precipitated

out in cold diethyl ether, washed 3 times with cold ether then dried under vacuum. The crude

product was lyophilized then purified by HPLC. For analytical purposes, Agilent XDB-C18 5µm

4.6-150mm column was used. For purification purposes, Agilent Zorbax RX-C8 5µm, 4.6-250mm

was used. 1-35% solvent gradient over 25min of water/acetonitrile/TFA (95/5/0.01%) and

acetonitrile/water/TFA (95/5/0.01%). Fractions containing pure product were collected and used

in the synthesis of Peptide 2. HRMS-ESI: m/z [M + H]+ calc. for C56H102N17O13 1220.7843; found

1220.7867, Figure S13. IR spectrum, Figure S12, and HPLC analysis, Figure S14.

45

Figure S 2. FTIR spectra of precursor for Pt-NLS hybrid (peptide 1).

Figure S 13. HRMS of precursor for Pt-NLS hybrid (peptide 1).

46

Figure S 14. HPLC analysis of precursor for Pt-NLS hybrid (peptide 1).

47

Pt-NLS hybrid (peptide 2)

Cisplatin 12.3mg (0.041mmol) was suspended in 0.5ml of water, 13.2mg (0.079mmol) of

silver nitrate in 0.5ml of water as added. The reaction mixture was stirred in the dark at 40-50oC

until the test for silver +1 with 10% HCl was negative. Usually 1 to 2 hours. Most of the white

precipitate was centrifuged off, and the remaining solid was removed via syringe filter 0.2µm. The

aqueous filtrate was tested for the presence of platinum with tin (II) chloride.

Peptide 1 23.8mg (0.0194mmol) was dissolved in 1 ml of water. Aqueous sodium

hydroxide was added 1.56mg in 0.5 ml of water. The filtrate containing activated platinum was

added dropwise to the sodium salt of peptide 1. The reaction was allowed to stir at room

temperature over 2 days. Progress of the reaction was monitored by HRMS. The crude product

was purified by HPLC following the same protocol as Peptide 1. The pure product was tested in

vitro. HRMS-ESI: m/z [M + H]+ calc. for C56H108N19O13Pt 1448.7943; found 1448.7873, Figure

S16. IR spectrum, Figure S15, and HPLC analysis, Figure S17.

48

Figure S 15. FTIR spectra of Pt-NLS hybrid (peptide 2)

Figure S 16. HRMS of Pt-NLS hybrid (peptide 2).

49

Figure S 27. HPLC analysis of f Pt-NLS hybrid (peptide 2).

50

NLS-FITC (peptide 3)

6-azido-hexanoic acid derivative of the NLS peptide obtained from synthesis of peptide 1 was

coupled via click reaction with propargyl fluorescein93. Briefly, to 0.043mmol of resin with

modified NLS, 0.017mmol of solid copper (I) iodide was added, followed by 0.172mmol of

propargyl fluorescein and ascorbic acid 0.0.017mmol in 3 ml of deoxygenated 20%

piperidine/DMF solution. Brown solution formed with shaking. Any exposure to oxygen caused a

color change to green. Progress of the reaction was monitored by HRMS. Upon completion, the

resin was washed for 1 min with 5ml of DMF, IPA, DMF, Methanol, Dichloromethane, Methanol,

and diethyl ether. Cleavage of NLS-FITC from the resin was achieved with a solution of

TFA/TIPS/H2O ratio 95/2.5/2.5 over 3 hours. The crude peptide was precipitated out in cold

diethyl ether, washed 3 times with cold ether then dried under vacuum. After desalting and

lyophilization product was used directly for the confocal imaging study. Peptide 3. HRMS-ESI:

m/z [M + H]+ calc. for C69H102N17O14 1392.7792; found 1392.7780, Figure S19.

51

Figure S 18. HRMS of NLS-FITC (Peptide 3).

52

5.7 Appendix

Determination of IC 50 of the Carboplatin and Pt-NLS complexes.

The cell culture method was previously described (see page 28).

Figure S 19. Determination of IC50 of carboplatin for CP70 cell line.

Figure S 20. Determination of IC50 of carboplatin for A2780 cell line.

0

20

40

60

80

100

120

Blank 6.15E-06 1.23E-05 1.85E-05 2.46E-05 3.69E-05

% V

iab

ility

Concentration [M]

A2780

Concentration [μM] 0 17.6 52.8 88 106 123 158 176 194

% Viability 100 90.5 70.8 66.4 61.6 53.1 48.3 38.4 28.3

Concentration [μM] 0 6.15 12.3 18.5 24.6 36.9 158

% Viability 100 95.5 89.1 66.4 75.4 68.6 62.5

53

Figure S 21. Determination of IC50 of carboplatin for OV-90 cell line.

Figure S 22. Determination of IC50 of carboplatin for ES-2 cell line.

0

20

40

60

80

100

120

Blank 2.46E-05 4.92E-05 7.38E-05 9.84E-05 1.48E-04 1.97E-04

% V

iab

ility

Concentration [M]

OV-90

0

20

40

60

80

100

120

Blank 1.72E-05 1.97E-05 2.71E-05 2.95E-05 3.44E-05 3.69E-05 4.18E-05

% V

iab

ility

Concentration [M]

ES-2

Concentration [μM] 0 24.6 49.2 7.38 98.4 148 197

% Viability 100 87.3 65.8 59.2 50.8 40.8 37.0

Concentration [μM] 0 17.2 19.7 27.1 29.5 34.4 36.9 41.8

% Viability 100 78.5 70.0 63.1 60.2 51.5 48.2 41.3

54

Figure S 23. Determination of IC50 of carboplatin for TOV-21G cell line.

Figure S 24. Determination of IC50 of carboplatin for SKOV-3 cell line.

0

20

40

60

80

100

120

Blank 2.95E-05 3.94E-05 4.92E-05 5.41E-05 5.90E-05 6.40E-05

% V

iab

ility

Concentration [M]

TOV-21G

0

20

40

60

80

100

120

Blank 1.23E-05 2.46E-05 4.92E-05 7.38E-05 8.61E-05 1.11E-04

% V

iab

ility

Concentration [M]

SKOV3

Concentration [μM] 0 29.5 39.4 49.2 54.1 59.0 64.0

% Viability 100 91.4 80.6 67.3 56.8 48.6 42.1


% Viability 100 100.0 77.2 72.2 55.8 50.0 46.0

55

Figure S 25. Determination of IC50 of Pt-NLS for CP-70 cell line.

Figure S 26. Determination of IC50 of Pt-NLS for A2780 cell line.

0

20

40

60

80

100

120

Blank 1.46E-05 4.08E-05 4.67E-05 5.25E-05 6.42E-05 8.17E-05

% V

iab

ility

Concentration [M]

CP-70

0

20

40

60

80

100

120

Blank 1.02E-05 1.22E-05 1.43E-05 1.63E-05 2.24E-05

% V

iab

ility

Concentration [M]

A2780


% Viability 100 85.8 70.2 61.6 59.4 54.5 45.6

Concentration [μM] 0 10.2 12.2 14.3 16.3 22.4

% Viability 100 72.3 68.1 61.0 54.1 44.1

56

Figure S 27. Determination of IC50 of Pt-NLS for OV-90 cell line.

Figure S 28. Determination of IC50 of Pt-NLS for ES-2 cell line.

0

20

40

60

80

100

120

Blank 8.15E-06 2.45E-05 4.08E-05 4.89E-05 5.71E-05

% V

iab

ility

Concentration [M]

OV-90

0

20

40

60

80

100

120

Blank 8.15E-06 1.22E-05 1.43E-05 1.83E-05 2.04E-05 2.65E-05

% V

iab

ility

Concentration [M]

ES-2


% Viability 100 95.1 65.8 57.5 53.8 48.6


% Viability 100 99.1 87.2 80.2 73.2 66.3 56.7

57

Figure S 29. Determination of IC50 of Pt-NLS for TOV-21G cell line.

Figure S 30. Determination of IC50 of Pt-NLS for SKOV3 cell line.

0

20

40

60

80

100

120

Blank 2.21E-05 2.95E-05 4.18E-05 4.92E-05 5.66E-05

% V

iab

ility

Concentration [M]

TOV-21G

0

20

40

60

80

100

120

Blank 2.21E-05 2.95E-05 3.69E-05 4.18E-05 4.92E-05 5.66E-05

% V

iab

ility

Concentration [M]

SKOV3


% Viability 100 88.2 79.3 76.1 62.0 51.8


% Viability 100 82.1 69.5 62.6 61.4 53.6 45.6

58

6. CHAPTER III. A pH-SENSITIVE NANOPARTICLE SYSTEM FOR TARGETED

DELIVERY OF Pt (II) THERAPY TO OVARIAN CANCER.

6.1 Introduction.

The importance of platinum (II) based therapy has been previously described in chapter I

and II. Briefly: platinum (II) therapy, e.g., cisplatin, carboplatin, and oxaliplatin, is broadly used

to treat many malignancies, including testicular, bladder, or ovarian cancer64. Ovarian cancer is

usually diagnosed at a late disease stage and is the leading cause of gynecologic cancer death94-95.

Gold standard treatment consists of debulking surgery combined with platinum/taxane

combination therapy. Although initial response rates are ~70-80%, recurrence rates resulting from

platinum resistance are high, leading to overall reduced survival rates94, 96. Pt (II) complexes bind

to nuclear DNA, interfering with DNA duplication and transcription, which eventually induces

cancer cell apoptosis15, 65. Although Pt (II) complexes are among the most potent anti-cancer agents

used in the clinic, severe side effects compromise the benefit of platinum therapy67. Therefore, low

clinical dosages of Pt (II) are used, often leading to subtherapeutic intracellular concentrations of

the drug. The insufficient DNA damage and activation of DNA repair mechanisms, such as

nucleotide excision repair (NER) pathway responsible for platinum-DNA adduct removal, is

considered the primary mediator of platinum resistance66, 97.

Nanoparticles (NPs) offer unique shielding effects and sustained release that can

potentially diminish severe side effects of highly toxic agents98. NPs accumulate in the tumor's

interstitium due to impaired tumor vasculature, the phenomenon known as enhanced permeability

and retention (EPR) effect99, also referred to as passive targeting. Passive targeting can be

enhanced with an active targeting approach, where ligands are implemented onto the NP's surface,

enhancing the NPs uptake by cancer cells via receptor-mediated endocytosis100. NP-based delivery

59

of platinum agents has been previously explored101, including liposome102-107, polymeric108-109, or

chitosan-based110 NPs. Also, biological111 or inorganic carriers112-113 have been reported. However,

limitations to these systems exist, including low cellular uptake, uncontrollable drug release, or

inadequate efficacy, hampering the translational advancement of the NPs to the clinic114-115.

Recent developments in NP design seek stimuli-responsive "smart" building blocks sensitive

to a tumor's microenvironment, such as altered redox potential, enzyme upregulation, hypoxia, or

acidic pH, to enhance the NP's functions116-117. Some examples include pH-induced disruption of

NPs for "on-demand" drug release118-121, or pH-promoted charge conversion to enhance the NPs

uptake122-124. Also, chemical mediators such as glutathione125, as well as enzymes such as

metalloproteinases126-128, hyaluronidase129, or cathepsin B130, have been proposed to trigger the

disintegration of NPs and drug release.

Aptamers also referred to as chemical antibodies, are short single-stranded nucleic acid

sequences that fold into secondary or tertiary shapes and offer exceptional molecular

recognition131-134. The target binding characteristics of aptamers prompted their use in place of

conventional antibodies, primarily due to their small size, ease of chemical synthesis, the flexibility

of chemical modification, and long-term storage stability. Still, bare oligonucleotides are prone to

natural degradation by nuclease enzymes present in the circulation and often exhibit short in vivo

half-lives. Chemical modifications of the nucleobases have partially addressed these limitations,

but these changes can distort the aptamers' tertiary shapes and affect their target recognition

characteristics132.

One of the most common surfactants used to prolong the stability of the NPs in serum is

polyethylene glycol (PEG), as PEG-coated nanocarriers can evade the mononuclear phagocyte

system (MPS) in the circulation 47, 135. PEG is a non-ionic hydrophilic polymer with repeating

60

ethylene ether units and provides a so-called "stealth" coating that diminishes the charge-based

interactions of PEGylated nanostructures with plasma proteins47. However, studies have shown

that the cellular uptake and endosomal escape of PEGylated NPs are suppressed due to the steric

hindrance conferred by PEG136-138. Thus, PEGylated systems convertible in the tumor's

microenvironment are of great interest. The nanoemulsions with metalloproteinase-sensitive PEG

coating139, or pH-responsive micelles of PEG-siRNA140 and PEG-acrylamide, PEG-

phosphatidylethanolamine conjugates141-143 have been proposed thus far to improve the NP's

translocation into the cell.

Herein, we report a pH-responsive PEGylated NP system with PLGA-Pt (II) core for aptamer

(Apt)-based targeting of OC. The proposed Apt-PLGA-Pt NP belongs to the second generation

slow-releasing NPs, which are based on biocompatible and biodegradable PLGA polymer144.

PLGA exhibits a wide range of erosion times, has tunable mechanical properties, and, importantly,

is an FDA-approved polymer145. PLGA has been extensively studied for the delivery of small

molecules, proteins, and other macromolecules in commercial use and in research146. At present

many PLGA-based formulations are at the pre-clinical stage146-147. Importantly, and to the best of

our knowledge, a pH-responsive targeting mechanism in a PLGA/PEG NP system proposed herein

to deliver Pt (II) therapy has not been previously reported.

61

6.2 Synthetic strategy and rationale.

Characterization of phospholipid-hydrazone-PEG, phospholipid-Apt conjugates, and

PLGA-Pt (II) hybrid. The Apt-PLGA-Pt NP is presented in Figure 13. The active targeting

module is shown in Figure 13 (top). The pH-sensitive phospholipid-hydrazone-PEG conjugate was

formed from PEG2000-aldehyde and DSPE-phospholipid-hydrazine precursors, and the reaction

was monitored by 1H and spectroscopy (Appendix Figure 21). The synthesis of phospholipid-

hydrazone-PEG is described in Figure 20 (Appendix). The NMR spectra demonstrate the

disappearance of the CHO signal from the aldehyde at 9.8 ppm, suggesting the formation of the

hydrazone bond between the PEG-aldehyde and the phospholipid-hydrazine (Appendix Figure

24).

The synthesis of phospholipid-Apt conjugate followed a standard EDC coupling chemistry

between an amine-terminated Apt and a carboxylate-terminated DPPE phospholipid. We used the

DNA Apt against Mucin1 (MUC1)132, a glycoprotein present on the surface of normal epithelial

cells but overexpressed by at least 10-fold in OC cells148. The final DNA content in the

phospholipid-Apt conjugate was quantified and determined to be 46.7% by mass, corresponding

to an ~ 1:31 molar ratio of DNA Apt to the DPPE phospholipid. In order to validate the targeting

strategy, we evaluated Mucin 1 expression in OC cells. MUC1 was quantified using the ELISA

test, and the results were compared to immortalized ovarian surface epithelial (IOSE) cells. The

results are presented in Figure 12. Mucin 1 expression in TOV21G, OV90, SKOV3, CP70, and

OVCAR3 is 10, 1.85, 5.34, 4.61, and 1.32 times higher in these cells when compared to Mucin 1

62

content in IOSE cells. Two cell lines had a lower concentration of Mucin 1, and these included

A2780 (0.56×) and ES2 (0.07×) cells.

Figure 12. ELISA test results for mucin 1 presence in OC cell lines.

The PLGA-Pt (II) hybrid was formed by the method developed previously by our group for Pt

(II)-lipophilic carboxylates (see Chapter II 5.6)149. The coordination of PLGA-carboxylates to Pt

(II) center resembles a configuration of carboplatin and is expected to follow the exact mechanism

of action. Activation of the Pt(II) complex involves acid hydrolysis with a successive displacement

of two monodentate carboxylates, initiated with a ring-opening step, followed by a complete loss

of ligand150-151. This process is pH sensitive, and at high acidity, the first step is ten times faster

than the second, while at low acidity, this difference is four-fold152. The final active species is cis-

[Pt(NH3)2(H2O)2]2+ that is capable of entering the nucleus via electrostatic interactions with

negatively charged DNA64. The formation of PLGA-Pt (II) hybrid was characterized with AAS

and revealed the Pt (II) concentration of 3.62 % by mass corresponding to 1:1.7 molar ratio of Pt

(II) to PLGA in the PLGA-Pt (II) hybrid), which was calculated assuming the average molecular

weight of PLGA to be 3000 Da. This ratio suggests the coordination of two PLGA monomers to

one Pt (II) center.

63

Characterization of the physicochemical parameters of Apt-PLGA-Pt NPs.

The Apt-PLGA-Pt NPs were characterized with respect to their size, surface charge, stability,

and in vitro Pt (II) release. The size of Apt-PLGA-Pt NPs was examined by dynamic light

spectroscopy (DLS) and transmission electron microscopy (TEM). The hydrodynamic diameter of

the NPs studied by DLS was found to be 110 nm with a low polydispersity of 0.199. The Zeta

potential of the NPs was determined to be – 29 mV indicating good colloidal stability of Apt-

PLGA-Pt NPs and a negative surface charge. The negative surface charge is attributed to PEG

coating and is expected to prevent the non-specific NP-protein adsorption in vivo that might lead

to cytotoxicity117. The TEM image of Apt-PLGA-Pt NPs is shown in Figure 14A and reveals that

the NPs have a spherical morphology with a core diameter of 97 ± 27nm. This size range of Apt-

PLGA-Pt NPs is suitable for in vivo applications , and permeation of tumors through EPR.

Figure 13. A schematic of an active targeting module (top) and the proposed Apt-PLGA-Pt NP

platform (bottom).

O

O

O

O

OP

O

HN S H

O H

O

O

H 2NNH

N

O O

O

O

O

O

O

OP

O

HN S

O H

O

O

N H 2H N

N O

O

O

(O C H 2 C H 2 )n O C H 3

HN

HO

O

O

O

O

O

OP

O

HN S

O H

O

O

NHN

N O

O

O(O C H 2 C H 2 )n O C H 3

HN

O

Phospholipid–hydrazone–PEGconjugate

MUC1aptamer

N–CTTCCTCTCTCCTTCTCTCTTCCTCTCTCCTTCTCTCTTCCTTCCCTTGGTCTAGGT

GCAG ATCCTT

CC

A

TT

G

H

N–CTTCCTCTCTCCTTCTCTCTTCCTCTCTCCTTCTCTCTTCCTTCCCTTGGTCTAGGT

GCAG ATCCTT

CC

A

TT

G

H

Phospholipid–Muc1aptamerconjugate

Spacer

ProposedApt-PLGA-PtNPplatform

phospholipid-pHsensitivePEG

phospholipid

phospholipid-aptamer

PLGA

Pt(II)

ActivetargetingmodulewithpHsensitivecoating

PLGA-Pt(II)hybrid

O O

OO

OH x

y

O

OO

O

OO

OO

O

Hx

y

O

O

P t

O

O

N H 3

N H 3

Hydrazonebond

64

Figure 14. TEM image of negatively stained Apt-PLGA-Pt NPs (A); stability of Apt-PLGA-Pt

NPs in 10% FBS (B); in vitro Pt (II) release from Apt-PLGA-Pt NPs in PBS at 37°C (C). TEM

images were taken together with Dr. Sylwia Dragulska.

Next, we evaluated the stability of Apt-PLGA-Pt NPs in fetal bovine serum (FBS) to determine

if PEG coating prevents the opsonization of the NPs with plasma proteins and if it protects the

DNA aptamer from enzymatic degradation. FBS is a blood product that contains a variety of active

proteins and nucleases153-154, most importantly DNase I, that can lead to the digestion of nucleic

acid-containing nanostructures155. In the experiment, the Apt-PLGA-Pt NPs were mixed with 10

% FBS solution at a final NPs concentration of 600 µg/ml and incubated at 37ºC for 48 h. The size

of the NPs was measured by DLS at different time points, and the results are shown in Figure 14B.

The diameter of the Apt-PLGA-Pt NPs remained stable during the testing period. This result

indicates the absence of any NP-protein aggregates, which would include the nucleases. It suggests

200nm

0

50

100

150

0 3 6 20 44

Size[nm]

Time[h]

0

10

20

30

40

50

60

70

80

0 5 10

%Ptreleased

Time[h]

pH5.5 pH6.8 pH7.2

A B

C

pH7.4

65

that the acid-sensitive PEG coating is capable of shielding the Apt ligand in the NP's corona, and

therefore the NPs are expected to be stable in the systemic circulation.

The in vitro Pt (II) release from the Apt-PLGA-Pt NPs was studied at three different pH values:

7.4 (physiological), 6.8 (tumor's interstitium), and 5.5 (endosomal). The degradation rate of the

PLGA polymer is pH-dependent156, which might influence the Pt (II) release from the NPs. The

initial Pt (II) payload in the Apt-PLGA-Pt NPs was determined by AAS and was found to be 1.62

wt. %. The NP solutions at the concentration of 600 µg/ml were placed in mini dialysis tubes and

incubated at 37ºC in PBS for 12 h. The solutions were collected from the dialysis tubes at pre-

defined time intervals and quantified for Pt (II) content using AAS. The percent of Pt (II) released,

with respect to the initial Pt (II) concentration, is presented in Figure 14C. After 3 h, only 2.5 %

of Pt (II) was released at pH 7.4, 9 % at pH 6.8, and 45 % at pH 5.5. The Pt (II) release from the

NPs after 12h at pH 7.4 was lower by 14 % when compared to pH 6.8 and by 30 % versus pH 5.5,

showing a consistent trend with the earlier time point. This result suggests low Pt (II) release in

the circulation after the intravenous administration of the NPs, and heightened Pt (II) release once

the NPs translocate into the tumor space as well as into intracellular compartments. Based on these

experiments, the Apt-PLGA-Pt NP follows the characteristics of a slow-releasing system, as

expected for PLGA-based NPs, which is of high importance in the drug delivery field144.

The direct measurement of the hydrazone-PEG bond cleavage on the Apt-PLGA-Pt NP was

monitored using a fluorescamine test. The hydrolysis of the hydrazone bond yields a free amine,

and the non-fluorescent fluorescamine in the presence of free amine produces a highly fluorescent

product. To this end, the phospholipid-hydrazone-PEG2000 conjugate solutions were incubated

with fluorescamine for 15 min at pH 7.4, 6.8, and 5.5 in 96 black well plates. The result of the test

is presented in Figure 15A. It can be clearly seen that the fluorescence is higher at pH 6.8 and

66

versus pH 7.4 and the highest at pH 5.5, indicating faster hydrazone bond hydrolysis with

decreasing the pH. We also monitored the fluorescence change over time (60 min) at tumoral pH

of 6.8 during the phospholipid-hydrazone-PEG2000 conjugate incubation with fluorescamine

(Figure 15B). The fluorescence increases with longer incubation times, confirming the continuous

hydrazone-PEG bond cleavage and formation of free amines in a low acidity environment.

Figure 15. The measurement of the hydrazone bond cleavage on the Apt-PLGA NPs via

fluorescamine test. Incubation of phospholipid-hydrazone-PEG2000 conjugate at different pH (A)

and incubation of phospholipid-hydrazone-PEG2000 conjugate at pH 6.8 (B).

6.3 Biological evaluation and discussion

Cellular uptake and in vitro biological activity of the NPs. The interaction of the Apt-PLGA-

Pt NPs with OC cell lines and active cellular uptake of the NPs was investigated using

fluorescence, confocal microscopy.

First, as a proof-of-concept, we compared the internalization of the Apt-modified NPs versus

non-modified NPs, to corroborate if the presence of targeting ligands leads to the enhanced

accumulation of the NPs into cells. The experiment was performed using the CP70 cell line. To

this end, we used Apt-PLGA NPs (without platinum) coated with a short version of PEG

(phospholipid-PEG350) to expose the Apt ligand onto the NP's surface. The PLGA NPs without

the Apt ligand was used as a control. The fluorescein-labeled phospholipid was added at 5 mol %

0

100

200

300

400

500

600

700

800

pH5.5 pH6.8 pH7.4

Fluorescence[a.u.]

530

540

550

560

570

580

590

600

610

1 15 60

Fluorescen

ce[a.u.]

Time[min]

HydrolysisofDSPE-PEG2000pH-sensitivenanoparticles[Time15min]

HydrolysisofDSPE-PEG2000pH-sensitivenanoparticlesatpH6.8

A B

67

to the NPs' coating to facilitate the optical studies. The cells were incubated with the NPs at a

concentration of 600 µg/ml for 25 min, washed with PBS, fixed, and imaged using a confocal

microscope. The images are shown in Figure 16. While control PLGA NPs (green; without the

Apt) were detected within the cells (frame A), the Apt-PLGA NPs were internalized into cells to

a much higher extent (frame B). These results suggest that the MUC1 Apt ligand accelerates the

NPs internalization into cells via receptor-mediated endocytosis.

Figure 16. Confocal images of cells incubated with PLGA NPs without the Apt (A) and Apt-PLGA

NPs (B).

Cellular uptake of Apt-PLGA-Pt NPs labeled with Cy5.5 in real-time at pH 6.8 was

investigated with a confocal microscope. The experiment was performed using A2780 cells

cultured in confocal microscope-ready Petri dishes. The cellular membrane was stained with

Wheat Germ Agglutinin Alexa Fluor 594 Conjugate (WGA 594 (red)). The 27-second movie of

the first 12 min after the addition of the NPs to the cells is presented in the appendix. Cellular

uptake of the NPs was apparent (green fluorescence) and consistently increased over time. After

12 min of incubation, the NPs appear to be localized within the cells and distributed throughout

the cytoplasm.

200nm 200nm

A B

C D

68

Next, we analyzed the uptake of Apt-PLGA-Pt NPs by OC cells. The results for A2780, CP70,

SKOV3, OV90, ES2, TOV21G, and OVCAR3 cell lines are presented in Figure 17.

Figure 17. Confocal images of Apt-PLGA-Pt NPs (red) localized inside different OC Cell lines,

nucleus staining in blue. The scale bars are 5 m. Images were taken with Mina Poursharifi.

Results confirm that the Apt-PLGA-Pt NPs undergo fast endocytosis and can be used as an

efficient nanocarrier for the intracellular delivery of Pt (II) therapy.

69

The in vitro NP cytotoxic effect on the cells was assessed via Alamar Blue assay. Cell lines

were seeded in 96 well plates and incubated with Apt-PLGA-Pt NPs for 72 h at a Pt (II)

concentration corresponding to IC50 values obtained for the NPs. Cell viabilities were compared

to controls of Apt-PLGA NPs without Pt, single-agent carboplatin, and no treatment (blank)

(Figure 18). Treatment with plain Apt-PLGA NPs had no significant cytotoxic effects in any of

the cell lines tested. By contrast, the Pt-loaded NPs demonstrated significant cytotoxicity in all cell

lines. The Pt-sensitive cell lines, A2780, ES-2, and TOV-21G, demonstrated the decreased

viability by 61.0, 55.5, and 34.2%, respectively. In comparison, free carboplatin at the same

concentration decreased the viability by 49.1, 43.5, and 31.0% in the same cells. The viability of

Pt-resistant cells was decreased by 59.7, 50.4, 31.8, and 61.5% in CP70, OV90, SKOV3, and

OVACR3 cells after the incubation with Apt-PLGA-Pt NPs. Carboplatin only at the same

concentration decreased the viability by 42.7, 32.0, 12.2, and 39.3%, respectively. All Apt-PLGA-

Pt NPs treated cell lines exhibited lower viability compared to carboplatin only. The difference in

viability is: 11.9% (A2780 cells), 12.0% (ES2 cells), and 3.2% (TOV21G cells), 17.0% (CP70

cells), 18.4% (OV90 cells), 19.6% (SKOV3 cells), and 22.2% (OVCAR3 cells). This difference is

more evident in platinum-resistant cell lines with the range of 17.0-22.2%, while about 12% in

platinum-sensitive cells. The exception is the TOV21G cell line with only a 3.2% difference in

viability. The above findings suggest higher efficacy of nanoparticle platinum (II) platform when

compared to carboplatin only.

70

Figure 18. Cellular viability of different ovarian cancer cell lines after 72 h incubation with Apt-

PLGA-Pt NPs and controls. Each column represents the mean and standard deviation of N=3 and

p<0.01 all cell lines, p<0.2 in TOV-21G. The concentrations are constant in each cell line, and are

as follows: SKOV3 3.44 x 10-5M, CP70 5.28 x 10-5M, OV-90 2.95 x 10-5M, TOV-21G 2.95 x 10-

5M, A2780 3.08 x 10-5M, OVCAR3 3.08 x 10-5M, ES-2 3.44 x 10-5M.

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

✻

Control1PLGANPswithpHsensitivePEG(withoutApt)Control2Apt-PLGANPswithpHsensitivePEG(withoutPt)NPsApt-PLGA-PtNPswithpHsensitivePEG

71

Table 2. Cellular viability of different ovarian cancer cell lines after 72 h incubation with Apt-

PLGA-Pt NPs and controls. Control 1: PLGA Nanoparticles with pH-sensitive PEG (without

aptamer), Control 2: PLGA Nanoparticles with pH-sensitive PEG (with aptamer), Nanoparticles:

Nanoparticles with pH-sensitive PEG and aptamer and PLGA-Pt.

Characterization of Apt-PLGA-Pt NPs half-life and biodistribution in vivo. All in vivo

study was performed with assistance of Dr. Ying Chen from Icahn School of Medicine at Mount

Sinai. To examine the pharmacokinetic properties of the Apt-PLGA-Pt NPs, we used fluorescence

and AAS to measure the NPs concentration in blood samples collected at various time points

following the NPs administration. Lipids labeled with a near-infrared (NIR) Cy7 fluorophore were

added to the NP's coating at 5 mol.% to facilitate biological imaging. The Apt-PLGA-Pt NPs were

administered intravenously to nude mice at 0.314 mg Pt (II). The dose given to mice corresponds

to a bioequivalent cisplatin dose for patients (75 mg/m2)157. Blood samples were drawn at 5, 20,

45, and 120 min. The two-hour range of the sampling was chosen arbitrarily based on the drug

release study (Figure 14C). At physiological pH, the drug release is below 10% within the 2-hour

range. Based on these studies, the in vivo half-life of the Apt-PLGA-Pt NPs was found to be 45

min.

Cell line A2780 CP70 TOV21G SKOV3 ES2 OV90 OVCAR3

Concentration [μM] 30.8 52.8 29.5 34.4 34.4 29.5 30.8

% V

iab

ilit

y

Blank 100.0 100.0 100.0 100.0 100.0 100.0 100.0

Control 1 88.0 90.0 92.0 94.0 100.0 104.0 92.0

Control 2 102.0 95.0 99.0 94.0 106.0 88.0 104.0

Carboplatin 50.9 57.3 69.0 87.8 56.5 68.0 60.7

Nanoparticles 39.0 40.3 65.8 68.2 44.5 49.6 38.5

72

Next, we evaluated the potential of Apt-PLGA-Pt NPs to target solid tumors in a pre-clinical

model of ovarian cancer. All mice were prepared according to the protocol described under

experimental section (see page 81). The Apt-PLGA-Pt NPs, at the same Pt (II) dose as in half-life

studies, were intravenously injected via tail vein into OVCAR-3 tumor-bearing nude mice. The

NPs biodistribution studies in vivo were performed using Cy7-labeled NPs and an IVIS small

animal imaging system. Untreated mice were used as a control. Twenty-four hours post-injection,

no fluorescence signal was detected in the control mouse, and a strong NIR signal was observed

at the tumor site in the Cy7-Apt-PLGA-Pt NPs injected mouse (Figure 19 top left). In addition,

after four days, the NIR signal in the tumor was still high, indicating prolonged retention of the

NPs in the tumor (Figure 19 top right).

After four days, the tumors and organs were excised and examined ex vivo by fluorescence and

AAS. Figure 21 (bottom) demonstrates fluorescence in the excised tumor as measured by regions

of interest (ROIs). The AAS measurements of Pt (II) concentration reveal the presence of 0.011

µg of Pt in the extracted tumor with the NPs, and a negligible Pt amount in control. Collectively,

these results strongly indicate that the NPs effectively translocate into tumors and are retained in

the tumor's interstitium for several days. Moreover, the Apt-PLGA-Pt NPs deliver Pt (II) therapy

directly to cancer cells in vivo.

The background biodistribution of the NPs into organs was also assessed, and the NIR images

of the organs, as well as AAS quantification of Pt (II), are presented in Figure 21 and 22. The NPs

were detected in the liver, spleen, and kidneys and in much lesser amounts in the heart and in the

lungs. No signal was detected in the brain, indicating that the Apt-PLGA-Pt NPs do not cross the

blood-brain barrier.

73

Our results contrast with the biodistribution of the carboplatin in a cervical tumor mouse

model. 18F-labeled carboplatin-like free-drug complex undergoes 95% renal clearance in just 1

hour, with a half-life of 16 min. The biodistribution study indicates the highest concentration of

the 18F labeled drug in kidneys, liver, skin, and lungs. However, the concentration decreases

significantly over 90 min. The tumor sample indicates over 60% loss of the radiolabel signal over

90 min.158

Figure 19. The images of NPs biodistribution in vivo (top) in an ovarian cancer mouse model and

excised tumors (bottom) from an NP-injected mouse (left) and a control mouse (right).

6.4 Conclusions.

In summary, a novel pH-sensitive NP-based system for active targeting and effective Pt

(II) delivery to tumors was synthesized and characterized. The Apt-PLGA-Pt NPs demonstrated

cellular uptake across various OC cell lines, resulting in efficacy in vitro, especially in Pt-resistant

cells. Also, the in vivo studies confirmed the suitability of the platform for tumor targeting and

drug delivery. These findings indicate that the Apt-PLGA-Pt NP platform can potentially be used

for Pt (II) therapy. Most importantly, the modular design of the NP allows for quick modifications,

8.0 6.0 4.0 x107

24 h post-injection 4 days post-injection

0.0110 µg Pt 0.000824 µg Pt

74

and the platform could easily be extended to other polymeric or lipophilic NP-based systems for

treatments of other cancers.

Future studies may focus on understanding the mechanism of action of the NP system. For

example, determining the organelle that is the final delivery point where the active drug is released

from the NP, the degradation profile of the NP or a long-term cytotoxicity of the platform. It would

also be interesting to determine if other anticancer drugs could be incorporated into the NP or if

the synergetic effect is observed in the combination therapy with other anticancer drugs, both NP-

based and free drugs. In addition, Pt-NLS-hybrids could be included in the NP formulation to

investigate its influence on platinum loading and efficacy of the platform. Lastly, the role of MUC-

1 in NP uptake could be investigated on the ovarian cancer model with silenced genes responsible

for MUC-1 expression.

6.5 Experimental section.

6.5.1 General experimental procedure for in vitro study.

In vitro viability assay. Human cancer-derived cell line A2780 and its isogenic clone CP70,

as well as OVCAR3 cells, were generously donated by Professor J. A. Martignetti from the

Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, 1425

Madison Avenue, New York, NY 10029. SKOV-3, OV-90, TOV-21G, ES-2 were purchased from

ATCC. The cell lines were cultured in Dulbecco's Modified Eagle Medium (Sigma Aldrich)

supplemented with 10% (A2780, CP70, SKOV-3, ES-2) or with 15% (TOV-21G, OV-90) fetal

bovine serum (FBS, HyClone) with L-Glutamine (HyClone) and penicillin/streptomycin

(HyClone). All cells were grown in a water-saturated atmosphere at 37°C and 5 % CO2. The cells

were seeded at a density of 3x105 per well in a 96-well plate and pre-cultured overnight. The Apt-

PLGA-Pt NPs were added at the concentrations corresponding to IC50 for each cell line and

75

incubated for 72 hours. After 72 hours, media was aspirated, and cells were washed with PBS.

Next, Alamar Blue solution (10 %) of in PBS was added to each well, and the cells were incubated

for an additional 30 to 45 min. The metabolic activity of the cells was determined by measuring

fluorescence at 590 nm (plate reader Spectra Max M3 by Molecular Devices).

76

6.5.2 General experimental procedures

The synthesis of precursor 1. First, beta-alanine 5.0 g (56.1 mmol) was dissolved in glacial

acetic acid (50 ml), and maleic acid anhydride 6.6 g (67.3 mmol) was added portion-wise. Next,

the solution was stirred until the formation of a white precipitate and the reaction mixture was

refluxed overnight. After that, the acetic acid was removed under reduced pressure at 40oC. The

remaining solid was suspended in chloroform (100 ml) and filtered through a silica gel pad,

followed by two additional washes with chloroform (2x100 ml). The filtrate was then condensed

and dried under vacuum, affording 5.6 g (49% yield) of a white solid. 1HNMR (DMSO-d6)

12.35 (s,br,1H), 7.01(s,2H), 3.61 (t,2H), 2.51 (t,2H), 13CNMR (CDCl3) 172.06, 170.75,

134.61, 33.31, 32.41. HRMS-ESI: m/z [M+H]+ calc. for C7H7NO4: 170.0375; found: 170.0449.

The synthesis of precursor 2. 0.2000g (1.18 mmol) of precursor 1 and t-butyl-carbazide

0.2032 g (1.54 mmol) was dissolved in 15 ml of DCM and was chilled to 0oC. The initial step was

followed by the addition of 0.3172 g of DCC (1.54 mmol) in 5 ml of dichloromethane (DCM) to

the reaction mixture. The reaction was allowed to warm up to room temperature. The progress of

the reaction was monitored by TLC using a chloroform/methanol 4:1 solvent system. Upon

completion (usually 1 to 2 hours), the reaction mixture was chilled at -20oC. The white precipitate

was removed by filtration, and the filtrate was diluted with 30 ml of DCM and washed with 10%

HCL solution (3x20 ml) and brine (20 ml). The organic phase was dried over anhydrous sodium

sulfate and filtered. The crude product was purified by flash chromatography using hexane/ethyl

acetate gradient, starting with 4:1 to 0:1 solvent ratio. The product was a colorless oil, 0.3829 g

(87% yield). 1HNMR (CDCl3) 7.82(s,br,1H), 6.70(t,2H), 6.62(s,br,1H) 3.86(t,2H), 2.59

(t,2H), 1.44(s,9H), 13CNMR (CDCl3) 172.43, 169.31, 155.34, 81.95, 33.81, 32.29, 28.08.

77

The synthesis of precursor 3. 0.2828g (1.35 mmol) of 2 was dissolved in 10 ml of 20%

solution of TFA in DCM and stored overnight. Next, the reaction mixture was condensed under

reduced pressure and diluted with 3 ml of DCM until the white product precipitated out. The

product was chilled in the freezer at -20oC for ~ 2 hours and centrifuged at 4000 rpm for 5 min at

4oC. The white solid was washed with cold DCM (2x1.5 ml) and then dried under the vacuum.

The product was a white solid, 0.1839 g (74.3% yield). 1H NMR (D2O) 6.87(s,2H), 3.84(t,2H),

2.65 (t,2H), 13C NMR (D2O) 172.56,171.38, 33.54, 31.98. HRMS-ESI: m/z [M+H]+ calc. for

C7H9N3O3: 184.0644; found: 184.0719.

The synthesis of precursor 4. 0.0196 g (2.34 µmol) of DSPE-thiol was dissolved in 5 ml of

dry chloroform. Next, 0.0069g (2.34 µmol) of 3 was added, followed by 0.100 ml of triethylamine.

The reaction mixture was allowed to stir at room temperature for 4 hours. The progress of the

reaction was monitored by NMR. Upon completion, the solvent and triethylamine were removed

under reduced pressure. The crude product was dissolved in a minimum amount of chloroform and

precipitated out with cold methanol. The product, 0.0180 g (75% yield), was a white solid. Figure

23A HRMS-ESI: m/z [M+H]+ calc. for C51H95N4O12PS: 1019.6405; found: 1019.6465.

The synthesis of lipid-hydrazone-PEG2000 (5). 0.0150 g (1.47 µmol) of 4 was combined

with 0.0294 g (1.47 µmol) of O-[2-(6-Oxocaproylamino)ethyl]-O′-methylpolyethylene glycol

2000 and stirred in 3 ml of chloroform. The progress of the reaction was monitored by NMR

Figure 24. Upon completion, the solvent was removed under the vacuum. The product (5) was a

white solid at 0.0350 g (78% yield). Figure 23C.

The synthesis of the phospholipid-Apt conjugate. The MUC-1 aptamer-1,2-dipalmitoyl sn-

glycero-3-phosphoethanolamine-N (DPPE)-Glutaryl conjugate was synthesized by standard EDC

protocol. Briefly, MUC-1 5'amine-modified aptamer was dissolved in 0.1 M PBS buffer at pH 6.8.

78

Next, at least 10X excess of DPPE-Glutaryl was added, followed by the addition of EDC at the

concentration of 0.2 M. The reaction was stirred overnight, then desalted using a QIAquick

nucleotide removal kit. The final product (6) was stored at -20oC in a 20% ethanol/water solution.

The final DNA concentration in the construct was analyzed by Nanodrop.

Synthesis of PLGA-Pt (II) conjugate (7). Cisplatin 0.0652 g (217 µmol) was suspended in 5

ml of the nanopure water. Next, silver nitrate 0.0720 g (423 µmol) in 1 ml of water was added,

and the reaction mixture was heated to 60oC and stirred in the dark for 1 hour. The white

precipitate was filtered off, and the filtrate was added dropwise to 0.3000 g of PLGA (MW 1000-

5000) dissolved in 15 ml of THF. The reaction was stirred at room temperature overnight. Next,

the solvent was removed under reduced pressure, and the remaining solid was dissolved in

acetonitrile. After centrifugation, the supernatant was condensed and added dropwise to cold

methanol. The pale brown precipitate (7) was collected and dried under vacuum, producing 0.3020

g. The Pt (II) content was quantified by AAS.

Nanoparticle synthesis. The Apt-PLGA-Pt NPs were synthesized via a nanoprecipitation

method159-160. First, 5 mg of 7 was dissolved in 2.5 ml of acetonitrile to achieve the concentration

of 2 mg/ml. Next, the PLGA-Pt (II) solution was added dropwise to the mixture of the following

lipids: MUC-1 aptamer-lipid (0.02 molar ratio to total lipids), 1 mg of DSPC/lipid-hydrazone-PEG

(5) in (7:3 molar ratio), in 5 ml of 4% ethanol at 60-70oC. The Apt-PLGA-Pt NPs were allowed to

stir for at least 2 hours, and then the NP solution was washed three times with water using vivaspin

filters (100.000 MW). The NP sample was condensed to achieve the volume ~ 1 ml and

characterized by TEM and DLS. The Pt (II) content was analyzed by AAS.

79

Synthesis of PLGA- Cy5.5 conjugate. 101mg (0.00363 mmol) of PLGA-NH2 (MW 28000)

(PolySciTech) was dissolved in 2.5 ml of dry DMF and mixed with 2.6mg (0.00363 mmol) of

Cy5.5-NHS ester (Lumiprobe) in 0.5 ml DMF. Next, 10µl triethylamine was added, and the

reaction mixture was stirred overnight. After that, DMF was removed under reduced pressure, and

the crude reaction mixture was dissolved in 1 ml of acetonitrile. The product was precipitated out

with cold methanol and stored in the fridge, giving 49.7 mg (47% yield) of blue solid.

Nanoparticle synthesis for proof-of-concept studies (with Apt and short PEG 350).

Briefly, 5 mg of PLGA-Cy5.5 was dissolved in 2.5 ml of acetonitrile to achieve a 2 mg/ml

concentration. Next, the PLGA-Cy5.5 solution was added dropwise to the mixture of the following

phospholipids: MUC-1 Apt-phospholipid (0.02 molar ratio to total lipids), 1 mg of DSPC/DSPE-

PEG350 in (7:3 molar ratio), in 5 ml of 4% ethanol at 60-70oC. The Apt-PLGA NPs labeled with

Cy5.5 were allowed to stir for at least 2 hours, and then the NP solution was washed three times

with water in vivaspin 20 (100.000 MW), concentrated, and used directly for confocal imaging

studies.

Synthesis of and DSPE-Cy7 conjugate. 13.7mg (0.0183 mmol) of DSPE (Avanti Lipids) was

dissolved in 1 ml of dry DMF. Next, 12.5 mg (0.0183 mmol) of Cy7-NHS ester (Lumiprobe) in

0.5 ml of DMF was added to the solution, followed by 10 µl of triethylamine. After overnight

stirring of the reaction mixture, DMF was removed under reduced pressure. The product was

washed 3 times with cold acetonitrile and then dissolved in ethanol, giving 18 mg (77% yield) of

blue solid.

Nanoparticle characterization. The nanoparticles' size and zeta potential were analyzed by

dynamic light scattering (DLS) using ZetaPals (Brookhaven Instrument Corporation). The

concentrated NP solution was diluted in distilled water to obtain a concentration of 0.500 mg

80

PLGA/ml. The obtained solution was measured for the hydrodynamic mean diameter and size

distribution. Each measurement was done in triplicate. The shape, surface morphology, and size

of the NPs were analyzed by transmission electron microscopy (TECNAI 200 kV TEM Fei,

Electron Optics). A droplet of the NPs was placed on a carbon-coated copper grid, forming a thin

liquid film. The samples were negatively stained with 2 % (w/V) solution of phosphotungstic acid.

In vitro drug release. The in vitro Pt (II) release studies from Apt-PLGA-Pt NPs were carried

out using the dialysis bag diffusion method148. Shortly, 500 µl of Apt -PLGA-Pt NPs was

dispensed into mini dialysis tubes (Slide-A-Lyser MINI dialysis units, Thermo Scientific), and the

tubes were placed in three separate beakers containing 600 ml of pH 7.4, 6.8, and 5.5 phosphate

buffer, respectively, with gentle stirring. The temperature of the buffers was maintained at

37 ± 1 °C throughout the experiment. Samples (three tubes) were withdrawn at definite time

intervals and analyzed for Pt (II) concentration with AAS. Drug release = Dt/D0 x 100. From the

above formulae, Dt and D0 indicate the amount of drug released from the NPs at certain intervals

and the total amount of drug in the NPs solution, respectively.

Fluorescamine test. phospholipid-hydrazone-PEG2000 were diluted with three solutions of

PBS at pH 7.4, 6.8, and 5.5, respectively, to achieve a final concentration of 1.6 mg NPs/ml. 10µl

of fluorescamine solution in DMSO (3 mg/ml) was added for each 150 µl of phospholipid-

hydrazone-PEG2000 solution. Each solution was then transferred into black flat bottom 96 well

plate and analyzed using a plate reader (Spectra Max M3 by Molecular devices). PBS solutions at

pH 7.4, 6.8, and 5.5, as well as PBS at pH7.4, 6.8, and 5.5 with Apt-PLGA NPs without

fluorescamine, were used as controls.

81

Cellular uptake of NPs. The PLGA-FITC NPs without Pt (II) was used in all imaging

experiments. For the proof-of-concept studies, CP70 cells were cultured in Dulbecco's Modified

Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), with L-Glutamine

(HyClone), and penicillin/streptomycin (HyClone). The cells were incubated with 600μg/mL plain

PLGA NPs, and Apt-PLGA-FITC NPs added to cell culture media for 15 min, washed with cold

PBS three times, and fixed by 2% paraformaldehyde for 20 min. The chambers were mounted onto

the confocal laser scanning microscope (Olympus Fluoview FV10i, Tokyo, Japan) with a red

channel excited at 684 nm.

For real-time uptake experiments, CP70 cells were plated in a four-well round chamber

(Greiner Bio-one) at a density of 5 × 104 cells/well. After 24 h, wheat germ agglutinin (WGA)

Alexa FluorTM488 conjugate (Invitrogen) was added to the media at a concentration of 5 μg/ml.

Next, the Apt-PLGA-Cy5.5 NPs were added to the cells. The pH of the media was 6.8. Imaging

started 5 minutes after the addition of the NPs and continued for 10 minutes. Imaging was

performed using an LSM880 inverted confocal microscope with Airyscan and FAST.

For imaging of Apt-PLGA NP distribution within the cells, the cells were plated in 8 well

chambers (Thermo Scientific™ Nunc™ Lab-Tek™ II Chambered Coverglass) at the density of

1.9×104 cells/well. After 24h, Next, the media was removed, and NucBlueTM live cell stain ready

probe TM (Invitrogen) in fresh media was added to the cells and incubated at room temperature for

30 minutes following the manufacturer's protocol. Then, cells were washed once with PBS 1X

(Corning Cellgro) and incubated with Apt-PLGA NPs in media at a pH of 6.8 for 1 h at 37°C.

Imaging was performed by LSM880 inverted live cell imaging confocal microscope with Airyscan

and FAST model.

82

In vivo mouse model studies. All in vivo experiments were approved by the Institutional

Animal Care and Use Committee (IACUC) of the Icahn School of Medicine at Mount Sinai. Five-

week-old female Nude mice (Charles River, MA), weighing 18-20g and maintained in specific

pathogen-free conditions, were used to generate the ovarian cancer tumor model and to determine

the in vivo half-life of the NPs.

In vivo OC model. 1×107 OVCAR3 cells were inoculated subcutaneously into the right hind

limbs of Nude mice (n=3). When resultant tumors reached approximately 500 mm3, as measured

using external calipers, mice were injected with Apt-PLGA-Pt-Cy7 NPs via tail vein at the

concentration of 0.314 mg of Pt (II). 24 h after the injection, in vivo fluorescence imaging, was

performed as described below. Mice were then euthanized, and subcutaneous tumors and organs

(brain, lung, liver, kidney, spleen, and heart) were collected for ex vivo fluorescence imaging and

AAS analysis.

In vivo fluorescence imaging. In vivo and ex vivo, NIRF imaging experiments were performed

using the IVIS-200 System (Xenogen, CA). To enable detection of the Cy7 labeled NPs, a 745 nm

excitation filter and 800nm emission filter were used. A field of view (FOV) of 17.6 and an

excitation time of 4 s were chosen.

AAS analysis of Pt (II) in organs. Excised organs were frozen, lyophilized, and dissolved in

aqua regia for 48 h. Next, the samples were sonicated for 24 h in a water-bath sonicator and dried

under vacuum. After that, 200 μL of water was added to each sample, all samples were centrifuged,

and the supernatants were directly analyzed by AAS (Figures 19).

ELISA test for Mucin 1 presence in OC cells. MUC1 test was purchased from Thermo

Scientific (EHMUC1). 1×107 cells of each type were harvested and washed 3x with PBS. Next,

the cells were suspended in 400 µl of a lysis buffer made of 50 mM Tris buffer, 100mM NaCl, and

83

x1 of protease inhibitor cocktail (Thermo-Scientific cat.#7448). Protein extraction was performed

by sonication using the QSONICA Q500 sonicator. Six 5 second sonications were followed by 30

second cooldown time. Sonication was performed on ice. Protein extract was centrifuged at 15000

rpm for 30 min at 4oC. The supernatant was collected and stored on ice. Protein content was tested

using the Bradford protocol. Elisa test was performed according to manufacturer guidelines.

(Figure 12)

6.6 Appendix

Figure 20. Schematic of the synthetic approach to pH-sensitive PEG2000-hydrazone-phospholipid

coating of nanoparticles. (a) glacial acetic acid, maleic anhydride, (b) t-butyl carbazide, DCC,

DCM, (c) 20%TFA in DCM, (d) CHCl3, Et3N, (e) CHCl3

84

Figure 21. Biodistribution study ex-vivo, nanoparticle treated (left), control untreated organs (right)

Figure 22 AAS analysis of biodistribution of a platinum drug in organs after 4 days.

85

Figure 23. 1H-NMR spectrum of: A phospholipid hydrazine, B PEG-2000 aldehyde and C

phospholipid hydrazone-PEG2000 conjugate.

A

C

B

86

Figure 24. Monitoring of hydrazone bond formation via 1H-NMR. Disappearance aldehyde proton

(top) vs. no signal in the final product (bottom).

Figure 25. A frame from the movie with Live imaging of nanoparticle uptake on CP70 OC cell

line. Membrane staining in green and nanoparticles in red. Images were taken with Mina

Poursharifi.

87

7 SUMMARY

In summary, in chapter II we reported the synthesis of carboplatin like Pt (II) complexes

with functional groups suitable for click chemistry and the hybrid construct of Pt (II) complex with

an NLS peptide (Pt-NLS) designed to heighten Pt (II) transport into the cancer cell’s nucleus. Pt-

NLS exhibited superior biological activity in vitro in the OC cell culture compared to free

carboplatin in platinum-resistant and platinum-sensitive cell lines. In addition, the formation of Pt-

NLS hybrid markedly increased the solubility of Pt (II) complex in an aqueous media, which

presents a significant improvement with respect to clinical applications of Pt (II)-based therapy.

Moreover, the natural propensity of NLS peptide to penetrate cellular and nuclear membranes

resulted in an increased accumulation of the Pt-NLS complex into the nucleus compared to free Pt

(II), confirming successful drug delivery using the hybrid construct. Increased in vitro activity of

Pt-NLS complexes implies that incorporation of the Pt-NLS motive would be beneficial in more

complex drug delivery systems. Future applications might include the incorporation of Pt-NLS

and Pt-alkyne and azide complexes into even more complex delivery platforms that are

additionally modified with tumor-targeting ligands. One can also envision further NLS peptide

modifications that would allow peptide self-assembly into Pt-loaded NPs, such as micelles.

In Chapter III, we presented a new NP-based delivery system composed of biodegradable

polymer PLGA-Pt (II) conjugate and an aptamer-based active targeting in combination with pH-

responsive phospholipid-PEG coating. The PEG coating on the NP’s surface shields aptamer

ligands in physiological pH and is removed upon pH drop around the tumor site exposing aptamers.

The pH-active coating is designed to prevent the enzymatic degradation of the aptamer ligands

while the NP is in the systemic circulation, thus extending its effective half-life and preserving the

integrity of the targeting module. The in vitro viability studies of Pt-resistant and Pt-sensitive OC

88

cell lines show the superior activity of the NPs compared to the free drug. Furthermore, live

imaging studies confirm quick cellular uptake of the NPs. Preliminary in vivo studies show NPs

accumulation in the tumor. The proposed delivery platform is highly versatile and scalable. The

polymeric core can be easily modified with other anticancer drugs while changing the aptamer

ligand to target different cellular receptors can modify targeting properties of the NP, thus allowing

applications of the NP to different cancer types. The pH-responsive coating is also adaptable and

can easily be modified to accommodate smaller or larger targeting ligands. In summary, we have

developed a flexible NP-based drug delivery platform with possible wide future applications in

anticancer therapy.

89

8 BIBLIOGRAPHY

1. https://www.cancer.gov/about-cancer/understanding/statistics.

2. American Cancer Society. Cancer Facts & Figures 2021. Atlanta: American Cancer Society;

2021. https://www.cancer.org/content/dam/cancer-org/research/cancer-facts-and-

statistics/annual-cancer-facts-and-figures/2021/cancer-facts-and-figures-2021.pdf.

3. Torre, L. A.; Trabert, B.; DeSantis, C. E.; Miller, K. D.; Samimi, G.; Runowicz, C. D.;

Gaudet, M. M.; Jemal, A.; Siegel, R. L., Ovarian cancer statistics, 2018. CA Cancer J Clin

2018, 68 (4), 284-296.

4. Chandra, A.; Pius, C.; Nabeel, M.; Nair, M.; Vishwanatha, J. K.; Ahmad, S.; Basha, R.,

Ovarian cancer: Current status and strategies for improving therapeutic outcomes. Cancer

Med 2019, 8 (16), 7018-7031.

5. Egusquiaguirre, S. P.; Igartua, M.; Hernández, R. M.; Pedraz, J. L., Nanoparticle delivery

systems for cancer therapy: advances in clinical and preclinical research. Clin Transl Oncol

2012, 14 (2), 83-93.

6. Tee, J. K.; Yip, L. X.; Tan, E. S.; Santitewagun, S.; Prasath, A.; Ke, P. C.; Ho, H. K.; Leong,

D. T., Nanoparticles' interactions with vasculature in diseases. Chem Soc Rev 2019, 48 (21),

5381-5407.

7. Wilhelm, S.; Tavares, A. J.; Dai, Q.; Ohta, S.; Audet, J.; Dvorak, H. F.; Chan, W. C. W.,

Analysis of nanoparticle delivery to tumours. Nat. Rev. Mater. 2016, 1 (5), 16014.

8. Nag, O. K.; Delehanty, J. B., Active Cellular and Subcellular Targeting of Nanoparticles

for Drug Delivery. Pharmaceutics 2019, 11 (10).

https://www.cancer.gov/about-cancer/understanding/statistics

90

9. Loos, C.; Syrovets, T.; Musyanovych, A.; Mailänder, V.; Landfester, K.; Nienhaus, G. U.;

Simmet, T., Functionalized polystyrene nanoparticles as a platform for studying bio-nano

interactions. Beilstein J Nanotechnol 2014, 5, 2403-12.

10. Khan, J.; Alexander, A.; Ajazuddin; Saraf, S.; Saraf, S., Exploring the role of polymeric

conjugates toward anti-cancer drug delivery: Current trends and future projections. Int J

Pharm 2018, 548 (1), 500-514.

11. Swider, E.; Koshkina, O.; Tel, J.; Cruz, L. J.; de Vries, I. J. M.; Srinivas, M., Customizing

poly(lactic-co-glycolic acid) particles for biomedical applications. Acta Biomater 2018, 73,

38-51.

12. Lü, J. M.; Wang, X.; Marin-Muller, C.; Wang, H.; Lin, P. H.; Yao, Q.; Chen, C., Current

advances in research and clinical applications of PLGA-based nanotechnology. Expert Rev

Mol Diagn 2009, 9 (4), 325-41.

13. Pavot, V.; Berthet, M.; Rességuier, J.; Legaz, S.; Handké, N.; Gilbert, S. C.; Paul, S.;

Verrier, B., Poly(lactic acid) and poly(lactic-co-glycolic acid) particles as versatile carrier

platforms for vaccine delivery. Nanomedicine (Lond) 2014, 9 (17), 2703-18.

14. Chabner, B. A., Barnett Rosenberg: In Memoriam (1924–2009). Cancer Res. 2010, 70 (1),

428.

15. Dasari, S.; Tchounwou, P. B., Cisplatin in cancer therapy: molecular mechanisms of action.

Eur J Pharmacol 2014, 740, 364-78.

16. Oun, R.; Moussa, Y. E.; Wheate, N. J., The side effects of platinum-based chemotherapy

drugs: a review for chemists. Dalton Trans 2018, 47 (19), 6645-6653.

17. Chen, S. H.; Chang, J. Y., New Insights into Mechanisms of Cisplatin Resistance: From

Tumor Cell to Microenvironment. Int J Mol Sci 2019, 20 (17).

91

18. Chien, J.; Kuang, R.; Landen, C.; Shridhar, V., Platinum-sensitive recurrence in ovarian

cancer: the role of tumor microenvironment. Front Oncol 2013, 3, 251.

19. Wheate, N. J.; Walker, S.; Craig, G. E.; Oun, R., The status of platinum anticancer drugs in

the clinic and in clinical trials. Dalton Trans 2010, 39 (35), 8113-27.

20. Binju, M.; Padilla, M. A.; Singomat, T.; Kaur, P.; Suryo Rahmanto, Y.; Cohen, P. A.; Yu,

Y., Mechanisms underlying acquired platinum resistance in high grade serous ovarian

cancer - a mini review. Biochim Biophys Acta Gen Subj 2019, 1863 (2), 371-378.

21. Liu, D.; He, C.; Wang, A. Z.; Lin, W., Application of liposomal technologies for delivery

of platinum analogs in oncology. Int J Nanomedicine 2013, 8, 3309-19.

22. Boulikas, T., Clinical overview on Lipoplatin: a successful liposomal formulation of

cisplatin. Expert Opin Investig Drugs 2009, 18 (8), 1197-218.

23. Bayat Mokhtari, R.; Homayouni, T. S.; Baluch, N.; Morgatskaya, E.; Kumar, S.; Das, B.;

Yeger, H., Combination therapy in combating cancer. Oncotarget 2017, 8 (23), 38022-

38043.

24. Bhargava, A.; Vaishampayan, U. N., Satraplatin: leading the new generation of oral

platinum agents. Expert Opin Investig Drugs 2009, 18 (11), 1787-97.

25. ClinicalTrials.gov [Internet]. Bethesda (MD): National Library of Medicine (US), 2012 Nov

22, Identifier NCT01737502, Sirolimus and Auranofin in Treating Patients With Advanced

or Recurrent Non-Small Cell Lung Cancer or Small Cell Lung Cancer, Available from

https://clinicaltrials.gov/ct2/show/NCT01737502.

26. Alessio, E.; Messori, L., NAMI-A and KP1019/1339, Two Iconic Ruthenium Anticancer

Drug Candidates Face-to-Face: A Case Story in Medicinal Inorganic Chemistry. Molecules

2019, 24 (10).

https://clinicaltrials.gov/ct2/show/NCT01737502

92

27. Hosein, P. J.; Craig, M. D.; Tallman, M. S.; Boccia, R. V.; Hamilton, B. L.; Lewis, J. J.;

Lossos, I. S., A multicenter phase II study of darinaparsin in relapsed or refractory

Hodgkin's and non-Hodgkin's lymphoma. Am J Hematol 2012, 87 (1), 111-4.

28. ClinicalTrials.gov [Internet]. Bethesda (MD): National Library of Medicine (US), 2019

Sept 27, Identifier NCT04143789, Evaluation of AP-002 in Patients With Solid Tumors

Available from:https://clinicaltrials.gov/ct2/show/NCT04143789.

29. ClinicalTrials.gov [Internet]. Bethesda (MD): National Library of Medicine (US), 2020 Aug

28, Identifier NCT04421820, BOLD-100 in Combination With FOLFOX for the Treatment

of Advanced Solid TumoursAvailable from

https://clinicaltrials.gov/ct2/show/NCT04421820.

30. Poursharifi, M.; Wlodarczyk, M. T.; Mieszawska, A. J., Nano-Based Systems and

Biomacromolecules as Carriers for Metallodrugs in Anticancer Therapy. Inorganics 2019,

7 (1).

31. Yingchoncharoen, P.; Kalinowski, D. S.; Richardson, D. R., Lipid-Based Drug Delivery

Systems in Cancer Therapy: What Is Available and What Is Yet to Come. Pharmacol Rev

2016, 68 (3), 701-87.

32. Barenholz, Y., Doxil®--the first FDA-approved nano-drug: lessons learned. J Control

Release 2012, 160 (2), 117-34.

33. Leung, A. W. Y.; Amador, C.; Wang, L. C.; Mody, U. V.; Bally, M. B., What Drives

Innovation: The Canadian Touch on Liposomal Therapeutics. Pharmaceutics 2019, 11 (3).

34. Zhang, H., Onivyde for the therapy of multiple solid tumors. Onco Targets Ther 2016, 9,

3001-7.



93

35. Wen, H.; Jung, H.; Li, X., Drug Delivery Approaches in Addressing Clinical Pharmacology-

Related Issues: Opportunities and Challenges. Aaps j 2015, 17 (6), 1327-40.

36. Anselmo, A. C.; Mitragotri, S., A Review of Clinical Translation of Inorganic

Nanoparticles. Aaps j 2015, 17 (5), 1041-54.

37. Narayan, R.; Nayak, U. Y.; Raichur, A. M.; Garg, S., Mesoporous Silica Nanoparticles: A

Comprehensive Review on Synthesis and Recent Advances. Pharmaceutics 2018, 10 (3).

38. Roma-Rodrigues, C.; Heuer-Jungemann, A.; Fernandes, A. R.; Kanaras, A. G.; Baptista, P.

V., Peptide-coated gold nanoparticles for modulation of angiogenesis in vivo. Int J

Nanomedicine 2016, 11, 2633-9.

39. Shoshan, M. S.; Vonderach, T.; Hattendorf, B.; Wennemers, H., Peptide-Coated Platinum

Nanoparticles with Selective Toxicity against Liver Cancer Cells. Angew Chem Int Ed Engl

2019, 58 (15), 4901-4905.

40. Henriksen-Lacey, M.; Carregal-Romero, S.; Liz-Marzán, L. M., Current Challenges toward

In Vitro Cellular Validation of Inorganic Nanoparticles. Bioconjug Chem 2017, 28 (1), 212-

221.

41. Kim, D.; Shin, K.; Kwon, S. G.; Hyeon, T., Synthesis and Biomedical Applications of

Multifunctional Nanoparticles. Adv Mater 2018, 30 (49), e1802309.

42. Bolhassani, A.; Javanzad, S.; Saleh, T.; Hashemi, M.; Aghasadeghi, M. R.; Sadat, S. M.,

Polymeric nanoparticles: potent vectors for vaccine delivery targeting cancer and infectious

diseases. Hum Vaccin Immunother 2014, 10 (2), 321-32.

43. Garner, J.; Skidmore, S.; Park, H.; Park, K.; Choi, S.; Wang, Y., A protocol for assay of

poly(lactide-co-glycolide) in clinical products. Int J Pharm 2015, 495 (1), 87-92.

94

44. Sartor, O., Eligard: leuprolide acetate in a novel sustained-release delivery system. Urology

2003, 61 (2 Suppl 1), 25-31.

45. Rezvantalab, S.; Drude, N. I.; Moraveji, M. K.; Güvener, N.; Koons, E. K.; Shi, Y.;

Lammers, T.; Kiessling, F., PLGA-Based Nanoparticles in Cancer Treatment. Front

Pharmacol 2018, 9, 1260.

46. Mieszawska, A. J.; Kim, Y.; Gianella, A.; van Rooy, I.; Priem, B.; Labarre, M. P.; Ozcan,

C.; Cormode, D. P.; Petrov, A.; Langer, R.; Farokhzad, O. C.; Fayad, Z. A.; Mulder, W. J.,

Synthesis of polymer-lipid nanoparticles for image-guided delivery of dual modality

therapy. Bioconjug Chem 2013, 24 (9), 1429-34.

47. Suk, J. S.; Xu, Q.; Kim, N.; Hanes, J.; Ensign, L. M., PEGylation as a strategy for improving

nanoparticle-based drug and gene delivery. Adv Drug Deliv Rev 2016, 99 (Pt A), 28-51.

48. Chen, Y.; Zhang, M.; Jin, H.; Tang, Y.; Wang, H.; Xu, Q.; Li, Y.; Li, F.; Huang, Y., Intein-

mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG

dilemma into prodrug-like feature. Biomaterials 2017, 116, 57-68.

49. Yoo, J.; Park, C.; Yi, G.; Lee, D.; Koo, H., Active Targeting Strategies Using Biological

Ligands for Nanoparticle Drug Delivery Systems. Cancers (Basel) 2019, 11 (5).

50. Zhu, Q.; Liu, G.; Kai, M., DNA Aptamers in the Diagnosis and Treatment of Human

Diseases. Molecules 2015, 20 (12), 20979-97.

51. Maimaitiyiming, Y.; Hong, F.; Yang, C.; Naranmandura, H., Novel insights into the role of

aptamers in the fight against cancer. J Cancer Res Clin Oncol 2019, 145 (4), 797-810.

52. Mallikaratchy, P., Evolution of Complex Target SELEX to Identify Aptamers against

Mammalian Cell-Surface Antigens. Molecules 2017, 22 (2).

https://www.idtdna.com/pages/education/decoded/article/planning-to-work-with-aptamers

95

53. Autour, A.; Westhof, E.; Ryckelynck, M., iSpinach: a fluorogenic RNA aptamer optimized

for in vitro applications. Nucleic Acids Res 2016, 44 (6), 2491-500.

54. Vauthier, C.; Bouchemal, K., Methods for the preparation and manufacture of polymeric

nanoparticles. Pharm Res 2009, 26 (5), 1025-58.

55. Krishnamoorthy, K.; Mahalingam, M., Selection of a suitable method for the preparation of

polymeric nanoparticles: multi-criteria decision making approach. Adv Pharm Bull 2015, 5

(1), 57-67.

56. Rezvantalab, S.; Keshavarz Moraveji, M., Microfluidic assisted synthesis of PLGA drug

delivery systems. RSC Advances 2019, 9 (4), 2055-2072.

57. Streck, S.; Neumann, H.; Nielsen, H. M.; Rades, T.; McDowell, A., Comparison of bulk

and microfluidics methods for the formulation of poly-lactic-co-glycolic acid (PLGA)

nanoparticles modified with cell-penetrating peptides of different architectures. Int J Pharm

X 2019, 1, 100030.

58. Wang, Y.; Li, P.; Truong-Dinh Tran, T.; Zhang, J.; Kong, L., Manufacturing Techniques

and Surface Engineering of Polymer Based Nanoparticles for Targeted Drug Delivery to

Cancer. Nanomaterials (Basel) 2016, 6 (2).

59. Paswan, S. K.; Saini, T. R., Purification of Drug Loaded PLGA Nanoparticles Prepared by

Emulsification Solvent Evaporation Using Stirred Cell Ultrafiltration Technique. Pharm

Res 2017, 34 (12), 2779-2786.

60. Amoyav, B.; Benny, O., Controlled and tunable polymer particles’ production using a single

microfluidic device. Appl. Nanosci. 2018, 8 (4), 905-914.

96

61. Galanski, M.; Jakupec, M. A.; Keppler, B. K., Update of the preclinical situation of

anticancer platinum complexes: novel design strategies and innovative analytical

approaches. Curr Med Chem 2005, 12 (18), 2075-94.

62. Fichtinger-Schepman, A. M.; van Oosterom, A. T.; Lohman, P. H.; Berends, F., cis-

Diamminedichloroplatinum(II)-induced DNA adducts in peripheral leukocytes from seven

cancer patients: quantitative immunochemical detection of the adduct induction and

removal after a single dose of cis-diamminedichloroplatinum(II). Cancer Res 1987, 47 (11),

3000-4.

63. Reishus, J. W.; Martin, D. S., cis-Dichlorodiammineplatinum(II). Acid Hydrolysis and

Isotopic Exchange of the Chloride Ligands1. J. Am. Chem. Soc. 1961, 83 (11), 2457-2462.

64. Dilruba, S.; Kalayda, G. V., Platinum-based drugs: past, present and future. Cancer

Chemother Pharmacol 2016, 77 (6), 1103-24.

65. Englander, E. W., DNA damage response in peripheral nervous system: coping with cancer

therapy-induced DNA lesions. DNA Repair (Amst) 2013, 12 (8), 685-90.

66. Galluzzi, L.; Senovilla, L.; Vitale, I.; Michels, J.; Martins, I.; Kepp, O.; Castedo, M.;

Kroemer, G., Molecular mechanisms of cisplatin resistance. Oncogene 2012, 31 (15), 1869-

83.

67. Boeckman, H. J.; Trego, K. S.; Turchi, J. J., Cisplatin sensitizes cancer cells to ionizing

radiation via inhibition of nonhomologous end joining. Mol Cancer Res 2005, 3 (5), 277-

85.

68. Jerremalm, E.; Videhult, P.; Alvelius, G.; Griffiths, W. J.; Bergman, T.; Eksborg, S.;

Ehrsson, H., Alkaline hydrolysis of oxaliplatin--isolation and identification of the oxalato

monodentate intermediate. J Pharm Sci 2002, 91 (10), 2116-21.

97

69. Di Pasqua, A. J.; Goodisman, J.; Kerwood, D. J.; Toms, B. B.; Dubowy, R. L.; Dabrowiak,

J. C., Activation of carboplatin by carbonate. Chem Res Toxicol 2006, 19 (1), 139-49.

70. Di Pasqua, A. J.; Kerwood, D. J.; Shi, Y.; Goodisman, J.; Dabrowiak, J. C., Stability of

carboplatin and oxaliplatin in their infusion solutions is due to self-association. Dalton

Trans 2011, 40 (18), 4821-5.

71. Johnstone, T. C.; Suntharalingam, K.; Lippard, S. J., The Next Generation of Platinum

Drugs: Targeted Pt(II) Agents, Nanoparticle Delivery, and Pt(IV) Prodrugs. Chem Rev

2016, 116 (5), 3436-86.

72. Basu, U.; Banik, B.; Wen, R.; Pathak, R. K.; Dhar, S., The Platin-X series: activation,

targeting, and delivery. Dalton Trans 2016, 45 (33), 12992-3004.

73. Aronov, O.; Horowitz, A. T.; Gabizon, A.; Gibson, D., Folate-targeted PEG as a potential

carrier for carboplatin analogs. Synthesis and in vitro studies. Bioconjug Chem 2003, 14 (3),

563-74.

74. Abu-Lila, A.; Suzuki, T.; Doi, Y.; Ishida, T.; Kiwada, H., Oxaliplatin targeting to

angiogenic vessels by PEGylated cationic liposomes suppresses the angiogenesis in a dorsal

air sac mouse model. J Control Release 2009, 134 (1), 18-25.

75. Descôteaux, C.; Provencher-Mandeville, J.; Mathieu, I.; Perron, V.; Mandal, S. K.; Asselin,

E.; Bérubé, G., Synthesis of 17beta-estradiol platinum(II) complexes: biological evaluation

on breast cancer cell lines. Bioorg Med Chem Lett 2003, 13 (22), 3927-31.

76. Larena, M. G.; Martinez-Diez, M. C.; Macias, R. I.; Dominguez, M. F.; Serrano, M. A.;

Marin, J. J., Relationship between tumor cell load and sensitivity to the cytostatic effect of

two novel platinum-bile acid complexes, Bamet-D3 and Bamet-UD2. J Drug Target 2002,

10 (5), 397-404.

98

77. Mikata, Y.; Shinohara, Y.; Yoneda, K.; Nakamura, Y.; Brudziñska, I.; Tanase, T.;

Kitayama, T.; Takagi, R.; Okamoto, T.; Kinoshita, I.; Doe, M.; Orvig, C.; Yano, S.,

Unprecedented sugar-dependent in vivo antitumor activity of carbohydrate-pendant cis-

diamminedichloroplatinum(II) complexes. Bioorg Med Chem Lett 2001, 11 (23), 3045-7.

78. Ndinguri, M. W.; Solipuram, R.; Gambrell, R. P.; Aggarwal, S.; Hammer, R. P., Peptide

targeting of platinum anti-cancer drugs. Bioconjug Chem 2009, 20 (10), 1869-78.

79. Cheetham, A. G.; Keith, D.; Zhang, P.; Lin, R.; Su, H.; Cui, H., Targeting Tumors with

Small Molecule Peptides. Curr Cancer Drug Targets 2016, 16 (6), 489-508.

80. Wisnovsky, S. P.; Wilson, J. J.; Radford, R. J.; Pereira, M. P.; Chan, M. R.; Laposa, R. R.;

Lippard, S. J.; Kelley, S. O., Targeting mitochondrial DNA with a platinum-based

anticancer agent. Chem Biol 2013, 20 (11), 1323-8.

81. Gandioso, A.; Shaili, E.; Massaguer, A.; Artigas, G.; González-Cantó, A.; Woods, J. A.;

Sadler, P. J.; Marchán, V., An integrin-targeted photoactivatable Pt(IV) complex as a

selective anticancer pro-drug: synthesis and photoactivation studies. Chem Commun

(Camb) 2015, 51 (44), 9169-72.

82. Massaguer, A.; González-Cantó, A.; Escribano, E.; Barrabés, S.; Artigas, G.; Moreno, V.;

Marchán, V., Integrin-targeted delivery into cancer cells of a Pt(IV) pro-drug through

conjugation to RGD-containing peptides. Dalton Trans 2015, 44 (1), 202-12.

83. Abramkin, S.; Valiahdi, S. M.; Jakupec, M. A.; Galanski, M.; Metzler-Nolte, N.; Keppler,

B. K., Solid-phase synthesis of oxaliplatin-TAT peptide bioconjugates. Dalton Trans 2012,

41 (10), 3001-5.

99

84. Aronov, O.; Horowitz, A. T.; Gabizon, A.; Fuertes, M. A.; Pérez, J. M.; Gibson, D., Nuclear

localization signal-targeted poly(ethylene glycol) conjugates as potential carriers and

nuclear localizing agents for carboplatin analogues. Bioconjug Chem 2004, 15 (4), 814-23.

85. Cartier, R.; Reszka, R., Utilization of synthetic peptides containing nuclear localization

signals for nonviral gene transfer systems. Gene Ther 2002, 9 (3), 157-67.

86. Zanta, M. A.; Belguise-Valladier, P.; Behr, J. P., Gene delivery: a single nuclear localization

signal peptide is sufficient to carry DNA to the cell nucleus. Proc Natl Acad Sci U S A 1999,

96 (1), 91-6.

87. Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.; Cheeseman, J.

R.; Scalmani, G.; Barone, V.; Petersson, G. A.; Nakatsuji, H.; Li, X.; Caricato, M.;

Marenich, A. V.; Bloino, J.; Janesko, B. G.; Gomperts, R.; Mennucci, B.; Hratchian, H. P.;

Ortiz, J. V.; Izmaylov, A. F.; Sonnenberg, J. L.; Williams; Ding, F.; Lipparini, F.; Egidi, F.;

Goings, J.; Peng, B.; Petrone, A.; Henderson, T.; Ranasinghe, D.; Zakrzewski, V. G.; Gao,

J.; Rega, N.; Zheng, G.; Liang, W.; Hada, M.; Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa,

J.; Ishida, M.; Nakajima, T.; Honda, Y.; Kitao, O.; Nakai, H.; Vreven, T.; Throssell, K.;

Montgomery Jr., J. A.; Peralta, J. E.; Ogliaro, F.; Bearpark, M. J.; Heyd, J. J.; Brothers, E.

N.; Kudin, K. N.; Staroverov, V. N.; Keith, T. A.; Kobayashi, R.; Normand, J.;

Raghavachari, K.; Rendell, A. P.; Burant, J. C.; Iyengar, S. S.; Tomasi, J.; Cossi, M.;

Millam, J. M.; Klene, M.; Adamo, C.; Cammi, R.; Ochterski, J. W.; Martin, R. L.;

Morokuma, K.; Farkas, O.; Foresman, J. B.; Fox, D. J. Gaussian 16 Rev. B.01, Wallingford,

CT, 2016.

100

88. Costantini, D. L.; Hu, M.; Reilly, R. M., Peptide motifs for insertion of radiolabeled

biomolecules into cells and routing to the nucleus for cancer imaging or radiotherapeutic

applications. Cancer Biother Radiopharm 2008, 23 (1), 3-24.

89. Ragin, A. D.; Morgan, R. A.; Chmielewski, J., Cellular import mediated by nuclear

localization signal Peptide sequences. Chem Biol 2002, 9 (8), 943-8.

90. Parker, R. J.; Eastman, A.; Bostick-Bruton, F.; Reed, E., Acquired cisplatin resistance in

human ovarian cancer cells is associated with enhanced repair of cisplatin-DNA lesions and

reduced drug accumulation. J Clin Invest 1991, 87 (3), 772-7.

91. Chen, Y.; Camacho, S. C.; Silvers, T. R.; Razak, A. R.; Gabrail, N. Y.; Gerecitano, J. F.;

Kalir, E.; Pereira, E.; Evans, B. R.; Ramus, S. J.; Huang, F.; Priedigkeit, N.; Rodriguez, E.;

Donovan, M.; Khan, F.; Kalir, T.; Sebra, R.; Uzilov, A.; Chen, R.; Sinha, R.; Halpert, R.;

Billaud, J. N.; Shacham, S.; McCauley, D.; Landesman, Y.; Rashal, T.; Kauffman, M.;

Mirza, M. R.; Mau-Sørensen, M.; Dottino, P.; Martignetti, J. A., Inhibition of the Nuclear

Export Receptor XPO1 as a Therapeutic Target for Platinum-Resistant Ovarian Cancer. Clin

Cancer Res 2017, 23 (6), 1552-1563.

92. Domcke, S.; Sinha, R.; Levine, D. A.; Sander, C.; Schultz, N., Evaluating cell lines as

tumour models by comparison of genomic profiles. Nat Commun 2013, 4, 2126.

93. Boiteau, J.-G., Single step functionalization and cross-linking of hyaluronic acid, Patent

WO

2015/0444455 A1,. 2015.

94. Ahmed-Lecheheb, D.; Joly, F., Ovarian cancer survivors' quality of life: a systematic

review. J Cancer Surviv 2016, 10 (5), 789-801.

101

95. Cristea, M.; Han, E.; Salmon, L.; Morgan, R. J., Practical considerations in ovarian cancer

chemotherapy. Ther Adv Med Oncol 2010, 2 (3), 175-87.

96. Herzog, T. J.; Pothuri, B., Ovarian cancer: a focus on management of recurrent disease. Nat

Clin Pract Oncol 2006, 3 (11), 604-11.

97. Amable, L., Cisplatin resistance and opportunities for precision medicine. Pharmacol Res

2016, 106, 27-36.

98. Wang, E. C.; Wang, A. Z., Nanoparticles and their applications in cell and molecular

biology. Integr Biol (Camb) 2014, 6 (1), 9-26.

99. Iyer, A. K.; Khaled, G.; Fang, J.; Maeda, H., Exploiting the enhanced permeability and

retention effect for tumor targeting. Drug Discov Today 2006, 11 (17-18), 812-8.

100. Elkhodiry, M. A.; Momah, C. C.; Suwaidi, S. R.; Gadalla, D.; Martins, A. M.; Vitor, R. F.;

Husseini, G. A., Synergistic Nanomedicine: Passive, Active, and Ultrasound-Triggered

Drug Delivery in Cancer Treatment. J Nanosci Nanotechnol 2016, 16 (1), 1-18.

101. Browning, R. J.; Reardon, P. J. T.; Parhizkar, M.; Pedley, R. B.; Edirisinghe, M.; Knowles,

J. C.; Stride, E., Drug Delivery Strategies for Platinum-Based Chemotherapy. ACS Nano

2017, 11 (9), 8560-8578.

102. Kim, E. S.; Lu, C.; Khuri, F. R.; Tonda, M.; Glisson, B. S.; Liu, D.; Jung, M.; Hong, W. K.;

Herbst, R. S., A phase II study of STEALTH cisplatin (SPI-77) in patients with advanced

non-small cell lung cancer. Lung Cancer 2001, 34 (3), 427-32.

103. Harrington, K. J.; Lewanski, C. R.; Northcote, A. D.; Whittaker, J.; Wellbank, H.; Vile, R.

G.; Peters, A. M.; Stewart, J. S., Phase I-II study of pegylated liposomal cisplatin (SPI-077)

in patients with inoperable head and neck cancer. Ann Oncol 2001, 12 (4), 493-6.

102

104. Newman, M. S.; Colbern, G. T.; Working, P. K.; Engbers, C.; Amantea, M. A., Comparative

pharmacokinetics, tissue distribution, and therapeutic effectiveness of cisplatin

encapsulated in long-circulating, pegylated liposomes (SPI-077) in tumor-bearing mice.

Cancer Chemother Pharmacol 1999, 43 (1), 1-7.

105. Farhat, F. S.; Temraz, S.; Kattan, J.; Ibrahim, K.; Bitar, N.; Haddad, N.; Jalloul, R.; Hatoum,

H. A.; Nsouli, G.; Shamseddine, A. I., A phase II study of lipoplatin (liposomal

cisplatin)/vinorelbine combination in HER-2/neu-negative metastatic breast cancer. Clin

Breast Cancer 2011, 11 (6), 384-9.

106. Stathopoulos, G. P.; Antoniou, D.; Dimitroulis, J.; Stathopoulos, J.; Marosis, K.;

Michalopoulou, P., Comparison of liposomal cisplatin versus cisplatin in non-squamous cell

non-small-cell lung cancer. Cancer Chemother Pharmacol 2011, 68 (4), 945-50.

107. Stathopoulos, G. P.; Boulikas, T., Lipoplatin formulation review article. J Drug Deliv 2012,

2012, 581363.

108. Dhar, S.; Gu, F. X.; Langer, R.; Farokhzad, O. C.; Lippard, S. J., Targeted delivery of

cisplatin to prostate cancer cells by aptamer functionalized Pt(IV) prodrug-PLGA-PEG

nanoparticles. Proc Natl Acad Sci U S A 2008, 105 (45), 17356-61.

109. Xiong, Y.; Jiang, W.; Shen, Y.; Li, H.; Sun, C.; Ouahab, A.; Tu, J., A poly(γ, L-glutamic

acid)-citric acid based nanoconjugate for cisplatin delivery. Biomaterials 2012, 33 (29),

7182-93.

110. Babu, A.; Wang, Q.; Muralidharan, R.; Shanker, M.; Munshi, A.; Ramesh, R., Chitosan

coated polylactic acid nanoparticle-mediated combinatorial delivery of cisplatin and

siRNA/Plasmid DNA chemosensitizes cisplatin-resistant human ovarian cancer cells. Mol

Pharm 2014, 11 (8), 2720-33.

103

111. Eriksson, M.; Hassan, S.; Larsson, R.; Linder, S.; Ramqvist, T.; Lövborg, H.; Vikinge, T.;

Figgemeier, E.; Müller, J.; Stetefeld, J.; Dalianis, T.; Ozbek, S., Utilization of a right-handed

coiled-coil protein from archaebacterium Staphylothermus marinus as a carrier for cisplatin.

Anticancer Res 2009, 29 (1), 11-8.

112. Kumar, A.; Huo, S.; Zhang, X.; Liu, J.; Tan, A.; Li, S.; Jin, S.; Xue, X.; Zhao, Y.; Ji, T.;

Han, L.; Liu, H.; Zhang, X.; Zhang, J.; Zou, G.; Wang, T.; Tang, S.; Liang, X. J., Neuropilin-

1-targeted gold nanoparticles enhance therapeutic efficacy of platinum(IV) drug for prostate

cancer treatment. ACS Nano 2014, 8 (5), 4205-20.

113. Dhar, S.; Liu, Z.; Thomale, J.; Dai, H.; Lippard, S. J., Targeted single-wall carbon nanotube-

mediated Pt(IV) prodrug delivery using folate as a homing device. J Am Chem Soc 2008,

130 (34), 11467-76.

114. Anselmo, A. C.; Mitragotri, S., Nanoparticles in the clinic. Bioeng Transl Med 2016, 1 (1),

10-29.

115. Jeevanandam, J.; Chan, Y. S.; Danquah, M. K., Nano-formulations of drugs: Recent

developments, impact and challenges. Biochimie 2016, 128-129, 99-112.

116. Upreti, M.; Jyoti, A.; Sethi, P., Tumor microenvironment and nanotherapeutics. Transl

Cancer Res 2013, 2 (4), 309-319.

117. Blanco, E.; Shen, H.; Ferrari, M., Principles of nanoparticle design for overcoming

biological barriers to drug delivery. Nat Biotechnol 2015, 33 (9), 941-51.

118. Jeong, Y. H.; Shin, H. W.; Kwon, J. Y.; Lee, S. M., Cisplatin-Encapsulated Polymeric

Nanoparticles with Molecular Geometry-Regulated Colloidal Properties and Controlled

Drug Release. ACS Appl Mater Interfaces 2018, 10 (28), 23617-23629.

104

119. Xu, H. L.; Fan, Z. L.; ZhuGe, D. L.; Tong, M. Q.; Shen, B. X.; Lin, M. T.; Zhu, Q. Y.; Jin,

B. H.; Sohawon, Y.; Yao, Q.; Zhao, Y. Z., Ratiometric delivery of two therapeutic

candidates with inherently dissimilar physicochemical property through pH-sensitive core-

shell nanoparticles targeting the heterogeneous tumor cells of glioma. Drug Deliv 2018, 25

(1), 1302-1318.

120. Li, X. X.; Chen, J.; Shen, J. M.; Zhuang, R.; Zhang, S. Q.; Zhu, Z. Y.; Ma, J. B., pH-

Sensitive nanoparticles as smart carriers for selective intracellular drug delivery to tumor.

Int J Pharm 2018, 545 (1-2), 274-285.

121. Pan, C.; Liu, Y.; Zhou, M.; Wang, W.; Shi, M.; Xing, M.; Liao, W., Theranostic pH-

sensitive nanoparticles for highly efficient targeted delivery of doxorubicin for breast tumor

treatment. Int J Nanomedicine 2018, 13, 1119-1137.

122. Tang, B.; Zaro, J. L.; Shen, Y.; Chen, Q.; Yu, Y.; Sun, P.; Wang, Y.; Shen, W. C.; Tu, J.;

Sun, C., Acid-sensitive hybrid polymeric micelles containing a reversibly activatable cell-

penetrating peptide for tumor-specific cytoplasm targeting. J Control Release 2018, 279,

147-156.

123. Tang, S.; Meng, Q.; Sun, H.; Su, J.; Yin, Q.; Zhang, Z.; Yu, H.; Chen, L.; Gu, W.; Li, Y.,

Dual pH-sensitive micelles with charge-switch for controlling cellular uptake and drug

release to treat metastatic breast cancer. Biomaterials 2017, 114, 44-53.

124. Li, Y.; Zhi, X.; Lin, J.; You, X.; Yuan, J., Preparation and characterization of DOX loaded

keratin nanoparticles for pH/GSH dual responsive release. Mater Sci Eng C Mater Biol Appl

2017, 73, 189-197.

105

125. Miao, Y.; Qiu, Y.; Yang, W.; Guo, Y.; Hou, H.; Liu, Z.; Zhao, X., Charge reversible and

biodegradable nanocarriers showing dual pH-/reduction-sensitive disintegration for rapid

site-specific drug delivery. Colloids Surf B Biointerfaces 2018, 169, 313-320.

126. Zhang, X.; Wang, X.; Zhong, W.; Ren, X.; Sha, X.; Fang, X., Matrix metalloproteinases-

2/9-sensitive peptide-conjugated polymer micelles for site-specific release of drugs and

enhancing tumor accumulation: preparation and in vitro and in vivo evaluation. Int J

Nanomedicine 2016, 11, 1643-61.

127. Huang, C.; Sun, Y.; Shen, M.; Zhang, X.; Gao, P.; Duan, Y., Altered Cell Cycle Arrest by

Multifunctional Drug-Loaded Enzymatically-Triggered Nanoparticles. ACS Appl Mater

Interfaces 2016, 8 (2), 1360-70.

128. Nazli, C.; Demirer, G. S.; Yar, Y.; Acar, H. Y.; Kizilel, S., Targeted delivery of doxorubicin

into tumor cells via MMP-sensitive PEG hydrogel-coated magnetic iron oxide nanoparticles

(MIONPs). Colloids Surf B Biointerfaces 2014, 122, 674-683.

129. Hu, Q.; Sun, W.; Lu, Y.; Bomba, H. N.; Ye, Y.; Jiang, T.; Isaacson, A. J.; Gu, Z., Tumor

Microenvironment-Mediated Construction and Deconstruction of Extracellular Drug-

Delivery Depots. Nano Lett 2016, 16 (2), 1118-26.

130. Zhang, X.; Tang, K.; Wang, H.; Liu, Y.; Bao, B.; Fang, Y.; Zhang, X.; Lu, W., Design,

Synthesis, and Biological Evaluation of New Cathepsin B-Sensitive Camptothecin

Nanoparticles Equipped with a Novel Multifuctional Linker. Bioconjug Chem 2016, 27 (5),

1267-75.

131. Farokhzad, O. C.; Karp, J. M.; Langer, R., Nanoparticle-aptamer bioconjugates for cancer

targeting. Expert Opin Drug Deliv 2006, 3 (3), 311-24.

106

132. Morita, Y.; Leslie, M.; Kameyama, H.; Volk, D. E.; Tanaka, T., Aptamer Therapeutics in

Cancer: Current and Future. Cancers (Basel) 2018, 10 (3).

133. Musumeci, D.; Platella, C.; Riccardi, C.; Moccia, F.; Montesarchio, D., Fluorescence

Sensing Using DNA Aptamers in Cancer Research and Clinical Diagnostics. Cancers

(Basel) 2017, 9 (12).

134. Röthlisberger, P.; Gasse, C.; Hollenstein, M., Nucleic Acid Aptamers: Emerging

Applications in Medical Imaging, Nanotechnology, Neurosciences, and Drug Delivery. Int

J Mol Sci 2017, 18 (11).

135. D'Souza A, A.; Shegokar, R., Polyethylene glycol (PEG): a versatile polymer for

pharmaceutical applications. Expert Opin Drug Deliv 2016, 13 (9), 1257-75.

136. Li, Y.; Kröger, M.; Liu, W. K., Endocytosis of PEGylated nanoparticles accompanied by

structural and free energy changes of the grafted polyethylene glycol. Biomaterials 2014,

35 (30), 8467-78.

137. Hatakeyama, H.; Akita, H.; Harashima, H., The polyethyleneglycol dilemma: advantage

and disadvantage of PEGylation of liposomes for systemic genes and nucleic acids delivery

to tumors. Biol Pharm Bull 2013, 36 (6), 892-9.

138. Cho, E. C.; Zhang, Q.; Xia, Y., The effect of sedimentation and diffusion on cellular uptake

of gold nanoparticles. Nat Nanotechnol 2011, 6 (6), 385-91.

139. Gianella, A.; Mieszawska, A. J.; Hoeben, F. J.; Janssen, H. M.; Jarzyna, P. A.; Cormode, D.

P.; Costa, K. D.; Rao, S.; Farokhzad, O. C.; Langer, R.; Fayad, Z. A.; Mulder, W. J.,

Synthesis and in vitro evaluation of a multifunctional and surface-switchable nanoemulsion

platform. Chem Commun (Camb) 2013, 49 (82), 9392-4.

107

140. Oishi, M.; Nagasaki, Y.; Itaka, K.; Nishiyama, N.; Kataoka, K., Lactosylated poly(ethylene

glycol)-siRNA conjugate through acid-labile beta-thiopropionate linkage to construct pH-

sensitive polyion complex micelles achieving enhanced gene silencing in hepatoma cells. J

Am Chem Soc 2005, 127 (6), 1624-5.

141. Quan, C. Y.; Chen, J. X.; Wang, H. Y.; Li, C.; Chang, C.; Zhang, X. Z.; Zhuo, R. X., Core-

shell nanosized assemblies mediated by the alpha-beta cyclodextrin dimer with a tumor-

triggered targeting property. ACS Nano 2010, 4 (7), 4211-9.

142. Sawant, R. M.; Hurley, J. P.; Salmaso, S.; Kale, A.; Tolcheva, E.; Levchenko, T. S.;

Torchilin, V. P., "SMART" drug delivery systems: double-targeted pH-responsive

pharmaceutical nanocarriers. Bioconjug Chem 2006, 17 (4), 943-9.

143. Peer, D.; Karp, J. M.; Hong, S.; Farokhzad, O. C.; Margalit, R.; Langer, R., Nanocarriers as

an emerging platform for cancer therapy. Nat Nanotechnol 2007, 2 (12), 751-60.

144. Zhang, L.; Chan, J. M.; Gu, F. X.; Rhee, J. W.; Wang, A. Z.; Radovic-Moreno, A. F.; Alexis,

F.; Langer, R.; Farokhzad, O. C., Self-assembled lipid--polymer hybrid nanoparticles: a

robust drug delivery platform. ACS Nano 2008, 2 (8), 1696-702.

145. Jagur-Grodzinski, J., Biomedical application of functional polymers. Reactive and

Functional Polymers 1999, 39 (2), 99-138.

146. Cryan, S. A., Carrier-based strategies for targeting protein and peptide drugs to the lungs.

Aaps j 2005, 7 (1), E20-41.

147. Danhier, F.; Ansorena, E.; Silva, J. M.; Coco, R.; Le Breton, A.; Préat, V., PLGA-based

nanoparticles: an overview of biomedical applications. J Control Release 2012, 161 (2),

505-22.

108

148. Engelstaedter, V.; Heublein, S.; Schumacher, A. L.; Lenhard, M.; Engelstaedter, H.;

Andergassen, U.; Guenthner-Biller, M.; Kuhn, C.; Rack, B.; Kupka, M.; Mayr, D.; Jeschke,

U., Mucin-1 and its relation to grade, stage and survival in ovarian carcinoma patients. BMC

Cancer 2012, 12, 600.

149. Dragulska, S. A.; Chen, Y.; Wlodarczyk, M. T.; Poursharifi, M.; Dottino, P.; Ulijn, R. V.;

Martignetti, J. A.; Mieszawska, A. J., Tripeptide-Stabilized Oil-in-Water Nanoemulsion of

an Oleic Acids-Platinum(II) Conjugate as an Anticancer Nanomedicine. Bioconjug Chem

2018, 29 (8), 2514-2519.

150. Mabey, W.; Mill, T., Critical review of hydrolysis of organic compounds in water under

environmental conditions. Journal of Physical and Chemical Reference Data 1978, 7 (2),

383-415.

151. Canovese, L.; Cattalini, L.; Chessa, G.; Tobe, M. L., Kinetics of the displacement of

cyclobutane-1,1-dicarboxylate from diammine(cyclobutane-1,1-dicarboxylato)platinum(II)

in aqueous solution. Journal of the Chemical Society, Dalton Transactions 1988, (8), 2135-

2140.

152. Hay, R. W.; Miller, S., Reactions of platinum(II) anticancer drugs. Kinetics of acid

hydrolysis of cis-diammine(cyclobutane-1,1-dicarboxylato)platinum(II) “Carboplatin”.

Polyhedron 1998, 17 (13), 2337-2343.

153. Miyauchi, K.; Ogawa, M.; Shibata, T.; Matsuda, K.; Mori, T.; Ito, K.; Minamiura, N.;

Yamamoto, T., Development of a radioimmunoassay for human deoxyribonuclease I. Clin

Chim Acta 1986, 154 (2), 115-23.

154. Koizumi, T., Deoxyribonuclease II (DNase II) activity in mouse tissues and body fluids.

Exp Anim 1995, 44 (2), 169-71.

109

155. Hahn, J.; Wickham, S. F.; Shih, W. M.; Perrault, S. D., Addressing the instability of DNA

nanostructures in tissue culture. ACS Nano 2014, 8 (9), 8765-75.

156. Li, S., Hydrolytic degradation characteristics of aliphatic polyesters derived from lactic and

glycolic acids. J Biomed Mater Res 1999, 48 (3), 342-53.

157. Reagan-Shaw, S.; Nihal, M.; Ahmad, N., Dose translation from animal to human studies

revisited. Faseb j 2008, 22 (3), 659-61.

158. Lamichhane, N.; Dewkar, G. K.; Sundaresan, G.; Wang, L.; Jose, P.; Otabashi, M.; Morelle,

J.-L.; Farrell, N.; Zweit, J., 18F-Labeled Carboplatin Derivative for PET Imaging of

Platinum Drug Distribution. J. Nucl. Med. 2017, 58 (12), 1997.

159. Kuo, Y. C.; Chung, J. F., Physicochemical properties of nevirapine-loaded solid lipid

nanoparticles and nanostructured lipid carriers. Colloids Surf B Biointerfaces 2011, 83 (2),

299-306.

160. Martínez Rivas, C. J.; Tarhini, M.; Badri, W.; Miladi, K.; Greige-Gerges, H.; Nazari, Q. A.;

Galindo Rodríguez, S. A.; Román, R.; Fessi, H.; Elaissari, A., Nanoprecipitation process:

From encapsulation to drug delivery. Int J Pharm 2017, 532 (1), 66-81.

Enhanced Platinum (II) Drug Delivery for Anti-cancer Therapy

Documents

Transcript of Enhanced Platinum (II) Drug Delivery for Anti-cancer Therapy