Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells...

18
Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes’ Ability to Infect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International Society for Microbial Ecology

Transcript of Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells...

Page 1: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes’ Ability to

Infect Host Cells

Sarah Layoun Dr. Walt Ream Laboratory

Source: International Society for Microbial Ecology

Page 2: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Only known prokaryote which can integrate segments of its DNA into eukaryotic DNA

Soil bacteria known to infect a variety of plants

About Agrobacterium

Source: ag.ndsu.edu

Crown Galls Disease

Source: forestryimages.org

Hairy Root Disease

Page 3: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Type IV Secretion System H. pylori, L. pneumophila, B. pertussis, N.

gonorrhoeae1

Frequently used as a vector for creating GMOs4

5.34 billion pounds of crop increase3

46.6 million pounds of pesticide reduction3

About Agrobacterium

Page 4: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Method of Tumor Induction

Page 5: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Understanding the necessity of virE3 in T-DNA insertion and integration into host nucleus

Comparing wild-type A. rhizogenes to virE3 mutants in ability to induce tumors

Project Overview

Page 6: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

VirE3

Galls

1.2. VirE3

VirE3

Suicide Plasmid

3.

Page 7: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

10,oo0 bp6,000

bp4,000 bp

3,000 bp

2,000 bp1,500 bp

1,000 bp

VirE3

pRi1724

1,350 bpEco

RISal

Galls

VirE3

Page 8: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

HindIII

VirE3

Klenow Fragment

dNTPs

VirE3 VirE3

Mutated version of virE3

Creating the Mutated Form of VirE3

Page 9: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project DescriptionCreating the Mutated Form of

VirE3

Suicide plasmid containing wild-type VirE3

HindIII

AGCTTAGCTTCTCGATGACGTTCGA

AGCTACTGCAAGCT AGCTTAGCTTTCGATGACGTTCGA TCGAATCGAA

Klenow FragmentdNTPs

AGCTACTGCAAGCTAGCTTAGCTTTCGATGACGTTCGATCGAATCGAA

AGCTACTGCA ATCGAA

G

Blunt End Ligation

HindIII digestion

Page 10: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description Continued

VirE3

KanamycinR

AmpicillinR

VirE3

KanamycinR

AmpicillinR

E. coli

Page 11: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

Transformed E.coli

Page 12: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

VirE3

E. coli

VirE3

A.Rhizogenes

Electroporation

SacB

GentamicinR

Page 13: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description Electroporation

Source: pnas.org

Low voltage pulse induces membrane pore formation

Page 14: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

VirE3

A. rhizogenes

HomologousRecombination

A. rhizogenes

Page 15: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Project Description

Arabidopsis thaliana source: nature.com

• Infect several plant species, including potatoes, carrots, and A. thaliana

Page 16: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Means of preventing plant diseases

Improvement of GMO synthesis

Possible insight into Type IV Secretion Systems

Significance of Findings

Page 17: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

Ernest and Pauline Jaworski Howard Hughes Medical Institute Dr. Kevin Ahern Dr. Walt Ream Larry Hodges

Acknowledgements

Page 18: Elucidating the Role of the Protein VirE3 in Agrobacterium rhizogenes Ability toInfect Host Cells Sarah Layoun Dr. Walt Ream Laboratory Source: International.

References

1.  Fronzes, Rémi; Christie, Peter J.; Waksman, Gabriel. The Structural Biology of type IV secretion systems. Nature Reviews Microbiology, Oct2009, Vol. 7 Issue 10, p703-714.

2. The FDA list of Completed Consultations of Bioengineered Foods. http://www.accessdata.fda.gov/scripts/fcn/fcnNavigation.cfm?rpt=bioListing. Updated on April 30, 2011.

3. Tonouchi, Naoto. Merits and the Global Status of Genetically Modified (GM) Crops. Foods Food Ingredients J. Jpn., Vol. 210, No.7, 2005

4. Vaidya, M., Li, J., Krichevsky, A.,Citovsky, V. Uncoupling of the Functions of the Arabidopsis VIP1 Protein in Transient and Stable Plant Genetic Transformation by Agrobacterium. Proc Natl Acad Sci USA. April 2005, 102 (16) pg. 5733-8.