DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN...
Transcript of DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN...
![Page 1: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/1.jpg)
This document is downloaded from DR‑NTU (https://dr.ntu.edu.sg)Nanyang Technological University, Singapore.
Dynamics of BCL‑2 family of proteins in earlypancreatic progenitors and β‑cells
Loo, Larry Sai Weng
2020
https://hdl.handle.net/10356/142359
https://doi.org/10.32657/10356/142359
This work is licensed under a Creative Commons Attribution‑NonCommercial 4.0International License (CC BY‑NC 4.0).
Downloaded on 22 Mar 2021 15:04:22 SGT
![Page 2: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/2.jpg)
DYNAMICS OF BCL-2 FAMILY OF PROTEINS
IN EARLY PANCREATIC PROGENITORS
AND β-CELLS
LARRY LOO SAI WENG
SCHOOL OF BIOLOGICAL SCIENCES
2019
![Page 3: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/3.jpg)
DYNAMICS OF BCL-2 FAMILY OF PROTEINS
IN EARLY PANCREATIC PROGENITORS
AND β-CELLS
LARRY LOO SAI WENG
SCHOOL OF BIOLOGICAL SCIENCES
A thesis submitted to the Nanyang Technological University in partial
fulfilment of the requirement for the degree of Doctor of Philosophy
2019
![Page 4: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/4.jpg)
i
STATEMENT OF ORIGINALITY
I hereby certify that the work embodied in this thesis is the result of original research
done by me except where otherwise stated in this thesis. The thesis work has not been
submitted for a degree or professional qualification to any other university or
institution. I declare that this thesis is written by myself and is free of plagiarism and
of sufficient grammatical clarity to be examined. I confirm that the investigations were
conducted in accord with the ethics policies and integrity standards of Nanyang
Technological University and that the research data are presented honestly and without
prejudice.
21st Aug 2019
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Date Larry Loo Sai Weng
![Page 5: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/5.jpg)
ii
SUPERVISOR DECLARATION STATEMENT
I have reviewed the content and presentation style of this thesis and declare it of
sufficient grammatical clarity to be examined. To the best of my knowledge, the thesis
is free of plagiarism and the research and writing are those of the candidate’s except as
acknowledged in the Author Attribution Statement. I confirm that the investigations
were conducted in accord with the ethics policies and integrity standards of Nanyang
Technological University and that the research data are presented honestly and without
prejudice.
.
21st Aug 2019
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Date Adrian Kee Keong Teo, Ph.D.
![Page 6: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/6.jpg)
iii
AUTHORSHIP ATTRIBUTION STATEMENT
This thesis contains material from 1 paper published in the following peer-reviewed
review paper in which I am listed as first author.
Figure 1 is published as Loo et al., An arduous journey from human pluripotent stem
cells to functional pancreatic β-cells. Diabetes Obes Metab. 2018 Jan;20(1):3-13
The contributions of the co-authors are as follows:
L. S. W. L., H. H. L., J. B. J. and C. S. L. wrote and edited the manuscript. A. K. K. T.
conceptualized the contents, and wrote, edited and approved the manuscript.
Figure 2 is published as Giménez-Cassina A et al., Regulation of mitochondrial
nutrient and energy metabolism by BCL-2 family proteins. Trends Endocrinol
Metab. 2015 Apr;26(4):165-75.
Figure 4 is published as Ronit Sionov et al., Regulation of Bim in health and disease.
Oncotarget. 2015 Sep; 6(27): 23058–23134.
21st Aug 2019
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Date Larry Loo Sai Weng
![Page 7: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/7.jpg)
iv
ACKNOWLEDGEMENTS
The herculean effort expended in the completion of this thesis is not mine alone. I
would like to thank the many people behind this.
To Dr Adrian Teo, thank you for the wonderful opportunity to be one of the pioneer
members in your laboratory in IMCB. You are an excellent mentor with an undying
enthusiasm for science. You have given me much freedom for this project but despite
this, you were always there whenever I needed assistance in terms of experimental
troubleshooting and writing. I am very honoured to be the first PhD student to
graduate from AT Lab and I definitely look forward to the many generations of PhD
students successfully graduating from AT lab in the years to come. I firmly believe
that the Stem Cell and Diabetes Laboratory will be one of the leading laboratories
focusing on diabetes research in Singapore.
To Dr Xavier Roca, thank you for the time and effort in co-supervising me. I owe it to
you for the constant discussion on this project.
To Dr Su I-Hsin and Dr Yusuf Ali, thank you both for taking the time out to
participate in my qualifying exam and being part of my thesis advisory committee.
You have been most helpful in advising me during the entire PhD journey.
To Dr Shawn Hoon, Dr Choi Hyun Won, Dr Vidhya and Soumita, thank you all for
performing the RNA-Seq and bioinformatics analysis data presented in Figure 12A,
12B, 13A, 13B, 16A, 19A.
To members of the AT Lab, Hwee Hui/Shirley/Chek Mei for the logistics support.
Thanks to Alvin for performing the FACS experiments presented in Figure 14A. Also,
![Page 8: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/8.jpg)
v
thanks to Natasha and Linh for critical evaluation of the manuscript. Also, thanks to
the rest of the lab members, Shabrina, Blaise and the numerous FYP students for
sharing their experiences and troubleshooting skills that made this thesis possible. And
finally, thanks to Joanita, Chang Siang and Hwee Hui for the effort to publish the
review paper (Loo et al., 2017).
To A*STAR Graduate Academy, thank you for awarding me the prestigious A*STAR
Graduate Scholarship which made it possible for me to pursue a PhD at A*STAR
Institute of Molecular and Cell Biology. I am very grateful for this. I look forward to
contributing to A*STAR in future.
To May Chong of Nanyang Technological University, School of Biological Sciences,
thank you for the amazing administrative support which you have given to the
graduate students.
![Page 9: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/9.jpg)
vi
TABLE OF CONTENTS
Content page
Statement of Originality i
Supervisor Declaration Statement ii
Authorship Attribution Statement iii
Acknowledgements iv
Table of contents vi
Summary xiii
List of figures xvi
List of tables xx
List of abbreviations xxi
1 Introduction 1
1.1 Recapitulating pancreatic β-cells differentiation using human pluripotent
stem cells 1
1.1.1 Different hPSC lines used in pancreatic differentiation protocols 6
1.1.2 Variability between current protocols used to generate pancreatic
β-like cells 9
1.2 BCL-2 family 11
1.2.1 BCL-2 family proteins 11
1.2.2 Direct activation model 13
1.2.3 Displacement model 13
1.2.4 Embedded together model 14
1.2.5 Unified model 14
1.3 BCL-xL 16
![Page 10: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/10.jpg)
vii
1.4 BIM (BCL2L11) 17
1.5 Role of splicing in BCL-2 family proteins 19
1.6 Role of members of the BCL-2 family in pancreatic development 21
1.7 Role of BCL-2 family in other cell lineages 24
1.8 The unfolded protein response and apoptotic pathways in mediating
pancreatic β-cell failure in diabetes 26
1.9 Hypothesis 30
1.10 Specific aims 30
2. Materials and Methods 32
2.1 Materials 32
2.1.1 Cell lines 32
2.1.2 Antibodies 32
2.1.3 Chemicals, peptides, media, reagents, assays and buffers 34
2.1.4 Softwares, instruments and algorithms 37
2.2 Mammalian cell cultures and differentiation 36
2.2.1 Mouse embryonic fibroblasts 38
2.2.2 hPSC and iAGb 38
2.2.3 17 Day differentiation protocol 38
2.2.4 35 Day differentiation protocol 39
2.2.5 HEK293FT cell culture 39
2.2.6 MIN6 cell culture 40
2.2.7 Human islets 40
2.3 Molecular biology techniques 40
2.3.1 RNA extraction and RT-PCR 40
2.3.2 Real-time Quantitative PCR (RT-QPCR) 41
![Page 11: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/11.jpg)
viii
2.3.3 Protein BCA assay 42
2.3.4 SDS-PAGE and Western blot 42
2.3.5 Immunostaining 43
2.3.6 Fluorescence-activated cell sorting (FACS) 44
2.3.7 Subcloning of plasmids 45
2.3.8 Transfection/ Overexpression rescue studies 45
2.4 ER stressors, cytokines and inhibitor assays 46
2.4.1 ER stressors and cytokines 46
2.4.2 Chemical inhibitor 46
2.5 Lentiviral-mediated knockdown using shRNAs 46
2.6 Lentiviral-mediated overexpression of BIM isoforms 47
2.7 Seahorse metabolic flux assay 48
2.8 RNA-Seq and differential expression analysis 48
2.9 Quantification and statistical analysis 49
2.10 Data and software availability 49
3 Results 58
3.1 Differentiation of human pluripotent stem cells into pancreatic cells as a
model of human pancreatic development in vitro 58
3.1.1 Morphology and transcriptional profile of pancreatic genes during
17D differentiation 58
3.2 Decrease in apoptosis from D5 to D7 during 17D differentiation 61
3.3 Changes in BCL-2 family of transcripts during 17D differentiation 61
3.3.1 Transcriptional profile of BCL-2 family of genes during 17D8
differentiation 61
3.3.2 Protein profile of BCL-2 family of genes during 17D differentiation 63
![Page 12: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/12.jpg)
ix
3.4 BCL-xL protects against apoptosis of pancreatic progenitor 66
3.4.1 Inhibition of BCL-xL at D7 using WEHI-539 decreases BCL-xL
expression and induces apoptosis in pancreatic progenitors 66
3.5 High-throughput RNA-Seq analysis identifies other possibles roles
of BCL-xL 70
3.5.1 Inhibition of BCL-xL decreases pancreatic progenitor transcripts 71
3.5.2 Inhibition of BCL-xL decreases pancreatic progenitor protein
expression 74
3.5.3 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited
phenotype in pancreatic progenitors 76
3.6 Metabolic genes were perturbed in pancreatic progenitors upon BCL-xL
inhibition 77
3.6.1 Inhibition of BCL-xL using WEHI-539 on D7 decreases glycolytic
capacity and glycolytic reserve in pancreatic progenitors 78
3.6.2 Inhibition of BCL-xL using WEHI-539 on D7 decreases oxidative
phosphorylation in pancreatic progenitors 80
3.7 Role of Wnt and Secreted Frizzled Receptor Proteins (SFRPs) in pancreatic
lineage specification 83
3.7.1 Heatmap of Wnt and SFRPs showing differential gene expression after
BCL-xL inhibition 83
3.7.2 SFRP5 transcript expression is decreased upon WEHI-539
treatment on D7 84
3.7.3 Knockdown of SFRP5 does not decrease the expression of pancreatic
progenitor transcripts 86
3.8 Role of BCL-xL during pancreatic β-like cell differentiation 87
![Page 13: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/13.jpg)
x
3.8.1 Dynamics of BCL-xL transcript in pancreatic β-like cell 87
3.8.2 Impact of BCL-xL inhibition on pancreatic β-like cell 89
4 Effects of ER stressors, Tunicamycin and Thapsigargin on MIN6 cells 91
4.1 Tunicamycin upregulates ER stress transcripts and selected Bcl-2 family
of transcripts in MIN6 cells 91
4.2 Thapsigargin upregulates ER stress transcripts and selected Bcl-2 family of
transcripts in MIN6 cells 93
4.3 Overexpression of BIM isoform transcripts in MIN6 cells 94
4.3.1 Overexpression of BIM isoform transcripts in the presence of
Tunicamycin/Thapsigargin treatment did not perturb ER stress
and Bcl-2 family of transcripts in MIN6 cells 94
4.4 Overexpression of BIM isoform transcripts in human islets 97
4.4.1 Overexpression of BIM isoform transcripts did not perturb ER
stress and BCL-2 family of transcripts in human islets 97
4.5 BIM isoforms can be overexpressed at the protein level in HEK293FT cells 98
4.6 BIML and BIMEL proteins are unable to be overexpressed at the protein level
in MIN6 cells 99
4.6.1 Overexpression of the BIM isoform proteins in MIN6 cells 99
4.6.2 Time-course overexpression of BIML, BIMEL and BIMγ in MIN6
cells 100
4.7 Overexpression of BIMγ was successful in Tunicamycin/Thapsigargin-treated
MIN6 cells 102
4.8 Overexpression of BIMγ was successful in MIN6 cells treated with cytokines 102
4.9 Overexpression of BIMγ in the presence of ER stressors or cytokines did not
confer protection against apoptosis in MIN6 cells 103
![Page 14: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/14.jpg)
xi
4.9.1 Overexpression of BIMγ in the presence of ER stressors did not
perturb other repertoire of BCL-2 proteins except for BCL-xL 103
4.9.2 Overexpression of BIMγ in the presence of cytokines did not perturb
other repertoire of BCL-2 proteins except for BCL-xL 105
4.10 Cleaved caspase 3 was present in MIN6 cells overexpressed with BIMγ and
treated with ER stressors 107
4.11 Cleaved caspase 3 was present in MIN6 cells overexpressed with BIMγ and
treated with cytokines 108
5 Discussion (Part 1) 109
5.1 Decrease in apoptosis during differentiation of hPSC to
pancreatic progenitors 109
5.2 Changes in BCL-2 family of transcript expression levels during
differentiation of hPSC into pancreatic progenitors 110
5.3 BCL-xL and BAK play important roles in pancreatic specification 110
5.4 BCL-xL is critical for the survival of pancreatic progenitors 111
5.5 BCL-xL plays an indirect role in pancreatic specification 112
5.6 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited
phenotype in pancreatic progenitors 114
5.7 BCL-xL is involved in maintaining the metabolic state of pancreatic
progenitors 115
5.8 Inhibition of BCL-xL perturbs Wnt signaling pathway in pancreatic
progenitors 117
5.9 A decrease in SFRP5 transcript expression is insufficient to decrease
pancreatic gene expression in vitro 118
5.10 Inhibition of BCL-xL indirectly leads to a loss of pancreatic β-like cell
![Page 15: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/15.jpg)
xii
identity 120
6 Discussion (Part 2) 121
6.1 Tunicamycin and Thapsigargin induce ER stress and perturb the
expression of Bcl-2 family of transcripts in MIN6 cells 121
6.2 Overexpression of BIM isoforms did not perturb ER stress and BCL-2
family of transcripts in MIN6 cells and human islets 122
6.3 Inhibitory mechanisms prevent BIM protein from being overexpressed
in MIN6 cells 123
6.4 Overexpression of BIMγ induced upregulation of BCL-xL but did not protect
against apoptosis induced by ER stressors/cytokines 124
7 Conclusion 125
8 Future work 127
8.1 Future work for Chapter 3 127
8.2 Future work for Chapter 4 128
9 References 129
10 Author’s publications 149
11 Posters, awards, invited talk 150
12 Appendix – Western blot films 151
![Page 16: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/16.jpg)
xiii
SUMMARY
Part 1: Role of BCL-xL in pancreatic specification (Chapter 3)
BCL-2 family proteins play an important role in the regulation of cell survival and
death. However, there are also certain members that exhibit tissue- and developmental
stage-specific expression and function. Here, I report a unique reciprocal relationship
between BCL-xL (not BCL2) and BAK during early human pancreatic differentiation.
The association of BCL-xL but not BCL2 with BAK has also been reported to keep
apoptosis in check, albeit not specifically during pancreatic development. This is
consistent with our findings that the compensatory increase in BCL2 protein
expression upon BCL-xL inhibition with WEHI-539 is insufficient to curb the BAK-
mediated increase in cleaved caspase 3 and the triggering of the caspase cascade.
I also found that the downregulation of BCL2L1/BCL-xL expression and function
resulted in a decrease in early pancreatic gene and protein expression. However, BCL-
xL is known to be dispensable during rodent beta cell development but rather is
important for protection against apoptotic stimuli in mature beta cells (Carrington et
al., 2009). Therefore, I propose that BCL-xL might be indirectly involved in human
pancreatic specification that is ultimately crucial for proper beta cell function.
Upon inhibition of BCL-xL function in D7 pancreatic progenitors, I found
perturbations in Wnt signalling molecules and a distinct downregulation of SFRP5
protein. Given the known role of Wnt signalling in pancreas development and the
importance of Sfrp5 in pancreatic organogenesis in both the Xenopus and zebrafish I
suggest that this could partly contribute to the effects of loss of BCL-xL/BCL2L1 gene
and protein function on the downregulation of pancreatic marker gene expression.
![Page 17: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/17.jpg)
xiv
Interestingly, the inhibition of BCL-xL function affected metabolic processes during
early pancreatic specification. Since cellular metabolism can affect differentiation and
development, I posit that this perturbation at the mitochondrial level also partly
contributes to the mechanistic link between BCL-xL function and pancreatic
development. BCL-xL has been reported to be directly involved in mitochondrial
energetic capacity that is necessary for cell survival. Therefore, the loss of BCL-xL
function could indirectly result in a decrease in pancreatic differentiation fidelity as I
have observed.
Together, I report a previously unappreciated role for BCL-xL/BCL2L1 in possibly
suppressing BAK during human pancreatic development. Modulation of these BCL-2
family of proteins during human pancreatic specification from hPSC could possibly be
a means to improve differentiation efficiency.
Part 2: Role of BIM in MIN6 mouse β-cell and human islets (Chapter 4)
In this project, I evaluate the role of BIM in MIN6 (mouse β-cell line) and human
islets. I hypothesize that the increased BIM exon 3 to exon 4 ratio will decrease the
apoptosis of pancreatic β-cells. Hence, I overexpress the various BIM isoforms in
mouse β-cell and human islets treated with tunicamycin and thapsigargin;
BIML/BIMEL (promote apoptosis) and BIMγ (postulated to protect against apoptosis
based on increased BIM exon 3 to exon 4 ratio).
I reported that the BIM isoforms overexpression at the transcript level was insufficient
to perturb both ER stress and Bcl-2 family of transcripts in MIN6 cells and human
islets. Interestingly, although all three BIM isoforms, BIML, BIMEL and BIMγ were
successfully overexpressed in HEK293FT, only BIMγ was successfully overexpressed
![Page 18: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/18.jpg)
xv
in MIN6 cells. This suggests a tight translational/posttranslational control of BIML
and BMEL proteins in MIN6 cells. I also report that the increased BIM exon 3 to exon
4 ratio through overexpression of BIMγ was able to indirectly upregulate BCL-xL
protein expression. However, this was insufficient to protect mouse β-cells against
apoptosis. Together, I report that the non-apoptotic form of BIMγ can regulate the
expression of BCL-xL in MIN6 cells.
![Page 19: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/19.jpg)
xvi
List of figures
Figure 1 Diagram showing the stepwise differentiation from human pluripotent stem
cells to pancreatic β-like cells
Figure 2 Different classes of BCL-2 family of genes
Figure 3 Diagram showing the different activation models of BCL-2 family
Figure 4 The various isoforms of BIM
Figure 5 The three BIM isoforms used in this study
Figure 6 Pancreatic β-cells undergoing ER stress upregulate the BCL-2 family of
proteins
Figure 7 Morphology and characterisation of hPSC differentiating into pancreatic
progenitors using 17D differentiation protocol
Figure 8 Decrease in apoptosis from D5 to D7
Figure 9 Changes in BCL-2 family of transcripts during differentiation into
pancreatic progenitor using 17D differentiation protocol
Figure 10 Anti-apoptotic BCL-XL/BCL2L1 and pro-apoptotic BAK proteins exhibit
opposite trends during pancreatic specification from human pluripotent stem
cells
Figure 11 Effects of WEHI-539 treatment on D7 pancreatic progenitors
Figure 12 Inhibition of BCL-xL induces apoptosis in pancreatic progenitors.
Figure 13 RNA-Seq analysis showing groups of differentially expressed genes upon
WEHI-539 treatment
Figure 14 RNA-Seq analysis reveal that the inhibition of BCL-xL function decreases
the expression of pancreatic genes
Figure 15 Effects of BCL-xL knockdown on D7 pancreatic progenitors.
Figure 16 Inhibition of BCL-xL decreases pancreatic progenitor protein expression.
![Page 20: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/20.jpg)
xvii
Figure 17 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited
phenotype in pancreatic progenitors
Figure 18 Inhibition of BCL-xL perturbs metabolic genes in pancreatic progenitors
Figure 19 Inhibition of BCL-xL function decreases glycolytic functions in pancreatic
progenitors
Figure 20 Inhibition of BCL-xL function decreases the mitochondrial functions in
pancreatic progenitors
Figure 21 Inhibition of BCL-xL perturbs the expression of Wnt-associated genes
Figure 22 SFRP5 is involved in pancreatic specification
Figure 23 Effects of SFRP5 knockdown on pancreatic progenitor transcript
Figure 24 Dynamics of mature β-like cell markers and BCL-xL transcript during 35D
differentiation
Figure 25 Morphology and transcriptional profile of DMSO vs WEHI-539 treated cells
during differentiation into β-like cells
Figure 26 Effects of tunicamycin dose treatment on MIN6 cells
Figure 27 Effects of thapsigargin dose treatment on MIN6 cells
Figure 28 Transcripts of Bcl-2 family genes in BIM isoforms-overexpressing MIN6
cells under ER stress.
Figure 29 Overexpression of BIM isoforms in human islets
Figure 30 Overexpression of BIM isoforms at the protein level in HEK293FT cells
Figure 31 Overexpression of BIM isoforms at the protein level in MIN6 cells
Figure 32 Overexpression of the various BIM isoforms, BIML, BIMEL and BIMγ in
MIN6 cells
Figure 33 Overexpression of BIMγ was successful in MIN6 cells treated with
Tunicamycin/Thapsigargin
![Page 21: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/21.jpg)
xviii
Figure 34 Overexpression of BIMγ was successful in MIN6 cells treated with
cytokines
Figure 35 Western blot analysis of BCL-2 family of proteins upon BIMγ
overexpression in MIN6 cells treated with ER stressors
Figure 36 Western blot analysis of BCL-2 family of proteins upon BIMγ
overexpression in MIN6 cells treated with cytokines
Figure 37 Cleaved caspase 3 was present in BIMγ overexpression in the presence of
ER stressors
Figure 38 Cleaved caspase 3 was present in BIMγ overexpression in the presence of
cytokines.
Figure 39 Full western blot films corresponding to Figure 10A.
Figure 40 Full western blot films corresponding to Figure 10A.
Figure 41 Full western blot films corresponding to Figure 10A.
Figure 42 Full western blot films corresponding to Figure 12A and 12B.
Figure 43 Full western blot films corresponding to Figure 12A and 12B.
Figure 44 Full western blot films corresponding to Figure 30.
Figure 45 Full western blot films corresponding to Figure 31A.
Figure 46 Full western blot films corresponding to Figure 32A & 32B.
Figure 47 Full western blot films corresponding to Figure 33A.
Figure 48 Full western blot films corresponding to Figure 34A.
Figure 49 Full western blot films corresponding to Figure 35A, 35B and 35C.
![Page 22: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/22.jpg)
xix
Figure 50 Full western blot films corresponding to Figure 36A, 36B and 36C
Figure 51 Full western blot films corresponding to Figure 37A.
Figure 52 Full western blot films corresponding to Figure 38A.
![Page 23: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/23.jpg)
xx
List of Tables
Table 1 Types of hPSC used in the various pancreatic differentiation protocols
Table 2 List of antibodies used
Table 3 Chemicals, peptides, media, reagents, assays and buffers
Table 4 Softwares, instruments and algorithms
Table 5 List of human primers used for RT-QPCR
Table 6 List of human primers used for short hairpin (shRNA) cloning
Table 7 List of human primers used for cloning and overexpression
Table 8 List of mouse primers used for RT-QPCR
Table 9 Generation of pancreatic progenitors (17D protocol)
Table 10 Generation of pancreatic β-like cells (35D protocol)
Table 11 Molecular weight of BIM isoforms
![Page 24: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/24.jpg)
xxi
List of Abbreviations
A1 B-cell lymphoma 2-related protein A1
ACT A Activin A
ADCY Adenylate Cyclase
ALDOC Aldolase C, fructose-biphosphate
ALK5ii TGF-β RI Kinase Inhibitor I
AMY Amylase
APAF1 Apoptotic protease activating factor 1
APC Adenomatous polyposis coli
ATF4 Activating transcription factor 4
ATF6 Activating transcription factor 6
ATP Adenosine Triphosphate
Axl Axl receptor tyrosine kinase
BAD BCL-2associated death promoter
BAX BCL-2-associated X protein
BAK BCL2 Antagonist/Killer 1
BBC3 BCL2 Binding Component 3
B cell B Lymphocyte
BCL2 B Cell Lymphoma 2
BCL-xL B Cell Lymphoma-Extra large
BCL-xS B Cell Lymphoma-Extra short
BCA Bicinchoninic acid assay
BCL-W BCL-2-like protein 2
BH3 BCL-2 Homology Domain 3
BH3-A BCL-2 Homology Domain 3 Activator
BH3-S BCL-2 Homology Domain 3 Sensitizer
BID BH3 interacting-domain death agonist
BIM BCL-2 Interacting Mediator of Death
BIML BCL-2 Interacting Mediator of Death Long
BIMEL BCL-2 Interacting Mediator of Death Extra Long
BIMS BCL-2 Interacting Mediator of Death Short
BIMγ BCL-2 Interacting Mediator Gamma
BIO 6-bromoin-dirubin-3-oxime
BLAST Basic Local Alignment Search Tool
BMF BCL-2 Modifying Factor
BMP4 Bone Morphogenetic Protein 4
BOK BCL-2 related ovarian killer
BOO BCL-2 Like 10
bp Basepair
Ca2+ Calcium
cDNA Complementary Deoxyribonucleic Acid
CD4 Cluster of Differentiation 4
CD8 Cluster of Differentiation 8
CED-9 Cell death abnormality gene 9
CHIR CHIR-99021
CHOP10 DNA damage-inducible transcript 3
![Page 25: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/25.jpg)
xxii
CK19 Cytokeratin-19
CML Chronic Myeloid Leukemia
CMRL Connaught Medical Research Laboratories
CMV Cytomegalovirus
CO2 Carbon Dioxide
C/EBP CCAAT-enhancer-binding proteins
DAPI 4′,6-diamidino-2-phenylindole
DAPT Gamma-secretase inhibitor
DAVID Database for Annotation, Visualization and Integrated Discovery
DEX Dexamethasone
DMEM Dulbecco Modified Eagle Medium
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic Acid
dNTP deoxynucleotide triphosphate
DPAGT1 Dolichyl-Phosphate N-Acetylglucosaminephosphotransferase 1
DPBS Dulbecco's Phosphate Buffered Saline
dUTP Deoxyuridine-5'-triphosphate
ECAR Extracellular Acidification Rate
EGFR-
NSCLC
Epidermal Growth Factor-Receptor-Mutated Non-Small-Cell Lung
Cancer
EGL-1 EGg Laying defective
eIF2a Eukaryotic translation initiation factor 2A
ELISA Enzyme-Linked Immunosorbent Assay
ENO2 Enolase 2
ER Endoplasmic Reticulum
FACS Florescence-activated Cell Sorting
FAF-BSA Fatty Acid Free- Bovine Serum Albumin
FBS Foetal Bovine Serum
FDR False Discovery Rate
FGF2 Fibroblast Growth Factor 2
FGF7 Fibroblast Growth Factor 7
FGF10 Fibroblast Growth Factor 10
FW Forward
FZD1 Frizzled Class Receptor 1
FZD2 Frizzled Class Receptor 2
FZD3 Frizzled Class Receptor 3
FZD4 Frizzled Class Receptor 4
FZD5 Frizzled Class Receptor 5
FZD6 Frizzled Class Receptor 6
FZD7 Frizzled Class Receptor 7
FZD8 Frizzled Class Receptor 8
FZD10 Frizzled Class Receptor 10
FOXA1 Forkhead box protein A1
FOXA2 Forkhead box protein A2
GATA4 GATA binding protein 4
GATA6 GATA-binding factor 6
GCG Glucagon
![Page 26: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/26.jpg)
xxiii
GDNA Genomic Deoxyribonucleic Acid
GEO Gene Expression Omnibus
GFP Green Fluorescence Protein
GHRL Ghrelin
GLIS1 Glis Family Zinc Finger 1
GLP-1 Glucagon-Like Peptide 1
GLUT2 Glucose Transporter 2
GSIS Glucose-stimulated insulin secretion
GSK3 Glycogen synthase kinase 3
G1 Gap 1 phase
HDAC Histone Deacetylases
HEK293FT Human Embryonic Kidney 293 Cells
hESCs Human Embryonic Stem Cells
HGF Hepatocyte Growth Factor
HH Hedgehog
HHEX Hematopoietically-expressed homeobox protein
HK2 Hexokinase 2
hIPSCs Human Induced Pluripotent Stem Cells
HLXB9 Homeobox HB9
HNF1A Hepatocyte nuclear factor 1 homeobox A
HNF1B Hepatocyte nuclear factor 1 homeobox B
HNF4A Hepatocyte nuclear factor 4 alpha
hPSC Human Pluripotent Stem Cells
HRK Harakiri
HRP Horse Radish Peroxidase
IAPP Islet Amyloid Polypeptide
IGF Insulin-Like Growth Factor
IFN-γ Interferon Gamma
IL-1β Interleukin 1 beta
INS Insulin
iPSCs Induced Pluripotent Stem Cells
IRE1-α Inositol-Requiring Enzyme 1 α
ITS-X Insulin-Transferrin-Selenium-Ethanolamine
JNK1 c-Jun N-Terminal Protein Kinase 1
KGF Keratinocyte growth factor
KLF4 Kruppel-like Factor 4
KOSR KnockOut™ serum replacement
LDN LDN193189
MAFA MAF bZIP transcription factor
MAPK/ERK mitogen-activated protein kinase
MCL-1 Myeloid cell Leukemia 1
MCL-1S Myeloid cell Leukemia 1 Short
MCL-1ES Myeloid cell Leukemia 1 Extra Short
MCL-1L Myeloid cell Leukemia 1 Long
MCS Multiple Cloning Site
MEF Mouse Embryonic Fibroblast
MET Mesenchymal-epithelial transition
MOI Multiplicity of Infection
![Page 27: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/27.jpg)
xxiv
MOMP Mitochondrial Outer Membrane Permeabilization
MPER Mammalian Protein Extraction Reagent
mRNA Messenger RNA
MTD Matador
NaHCO3 Sodium bicarbonate
NANOG Nanog Homeobox
N-Bak Neuronal BCL2 Antagonist/Killer 1
NCBI National Center for Biotechnology Information
N-Cys N-acetylcysteine
NEAA Non-essential amino acid
NF-kB Nuclear Factor kappa-light-chain-enhancer of activated B cells
NGN3 Neurogenin-3
Nic Nicotinamide
NO Nitrous Oxide
NKX6.1 NKX6 Homeobox 1
NOXA Phorbol-12-myristate-13-acetate-induced protein 1
NRG-mice NOD/RAG1/2−/−IL2Rγ−/− mice
OCR Oxygen Consumption Rate
OCT4 Octamer-Binding Transcription Factor 4
OE Overexpression
PAX6 Paired Box Protein Pax-6
PARS Poly (ADP-Ribose) Synthetase
PBS Phosphate Buffer Saline
PBST Phosphate Buffer Saline Tween-20
PCA Principal Component Analysis
PDBu Phorbol 12,13-dibutyrate
PDX1 Pancreatic and duodenal homeobox 1
PERK Protein kinase R (PKR)-like endoplasmic reticulum kinase
PI3K Phosphoinositide 3-kinase
PKC Protein Kinase C
PTF1a Pancreas Associated Transcription Factor 1a
PTPN2 Protein Tyrosine Phosphatase Non-Receptor Type 2
PUMA p53 upregulated modulator of apoptosis
PYY Peptide YY
RA Retinoic Acid
RFX6 Regulatory factor X, 6
RNA Ribonucleic Acid
RNA-Seq Ribonucleic Acid Sequencing
ROCK Rho-Associated Protein Kinase
RPM Rounds Per Minute
RPMI-1640 Roswell Park Memorial Institute 1640 Medium
RT-QPCR Real-time Quantitative Polymerase Chain Reaction
RV Reverse
SANT1 Sonic Hedgehog Inhibitor.
SD Standard Deviation
SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis
SERCA Sarco/Endoplasmic Reticulum Ca2+-ATPase
SFRP1 Secreted Frizzled-Related Protein 1
![Page 28: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/28.jpg)
xxv
SFRP2 Secreted Frizzled-Related Protein 2
SFRP4 Secreted Frizzled-Related Protein 3
SFRP5 Secreted Frizzled-Related Protein 5
shRNA Short Hairpin Ribonucleic Acid
siRNA Short Interfering Ribonucleic Acid
SOX2 Sex Determining Region Y-box 2
SOX9 Sex-Determining Region Y-box 9
SOX17 SRY-Box Transcription Factor 17
SST Somatostatin
sXBP1 Spliced X-box Binding Protein 1
TA Annealing Temperature
tBID Truncated BH3 interacting-domain death agonist
TBS Tris Buffer Saline
TBST Tris Buffer Saline Tween-20
Tm Melting Temperature
TNF-α Tumor Necrosis Factor Alpha
Treg Regulatory T cells
T1D Type 1 Diabetes
T2D Type 2 Diabetes
T3 Triiodothyronine
UPR Unfolded Protein Response
VDAC1 Voltage-dependent anion-selective channel 1
VEGF Vascular Endothelial Growth Factor
Vit C Vitamin C
WEHI-539 Walter and Eliza Hall Institute-539
Wg Wingless
WNT Wingless-related integration site
WNT2B Wingless-related integration site 2B
WNT5A Wingless-related integration site 5A
WNT5B Wingless-related integration site 5B
WNT7B Wingless-related integration site 7B
WNT8B Wingless-related integration site 8B
XBP1 X-box Binding Protein 1
XXi Gamma-Secretase Inhibitor
Y-27632 Rock Inhibitor
![Page 29: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/29.jpg)
1
1 Introduction
1.1 Recapitulating pancreatic β-cell differentiation using human pluripotent
stem cells
Pluripotent “human embryonic stem cells” (hESCs) were initially discovered over two
decades ago (Thomson et al., 1998). hESCs possess the capability to undergo self-
renewal as well as the ability to differentiate into majority of human cell types. Using
hPSC as a model, many studies have been able to obtain pancreatic β-like cells from
hPSC (D'Amour et al., 2006, Kroon et al., 2008, Rezania et al., 2012, Pagliuca et al.,
2014). Discovered in 2006, induced pluripotent stem cells (iPSCs) can be produced
via reprogramming of somatic cells by expressing the pluripotency factors c-MYC,
OCT4, SOX2 and KLF4 (Takahashi and Yamanaka, 2006). Human iPSCs (hiPSCs)
can also be used to screen thousands of drugs in a high through-put manner on the
differentiated human cells (Takahashi and Yamanaka, 2013).
Many protocols have been established to produce pancreatic β-like cells in culture
(Loo et al., 2018). Novel breakthroughs in this field have facilitated the production of
β-like cells that possess the ability to secrete insulin in response to glucose challenge.
These protocols represent an avenue of cure for diabetes patients in terms of cell
replacement therapy. Using these protocols, scientists would be able to generate
pancreatic β-like cells and possibly utilize them for drug-screening libraries which
may prove to be valuable in enhancing secretion of insulin and regeneration of these
pancreatic β-like cells (Teo et al., 2015a, Teo et al., 2013).
Research on pancreatic ontogenesis in several animal models such as chicken, frog,
mouse and zebrafish (Zorn and Wells, 2007, Santosa et al., 2015) has identified many
signaling pathways that direct differentiation towards the pancreatic lineage. Many
![Page 30: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/30.jpg)
2
growth factors and chemicals have been used to achieve this purpose and have been
summarized in Fig 1. To drive hPSC towards the pancreatic lineage, Activin A is used
during the first 2-4 days of differentiation to differentiate hPSC into definitive
endoderm (DE) (D'Amour et al., 2006, Jiang et al., 2007a, Basford et al., 2012,
Pagliuca et al., 2014, Nostro et al., 2011, D'Amour et al., 2005). To further induce DE
formation, BMP4 (Phillips et al., 2007, Xu et al., 2011, Teo et al., 2012), sodium
butyrate (Jiang et al., 2007a), WNT3A, BIO or CHIR99021 are utilized in conjunction
with Activin A (D'Amour et al., 2006, Teo et al., 2014). PI3K inhibitors such as
LY294002 (McLean et al., 2007) and Wortmannin (Zhang et al., 2009) are used as
PI3K signalling inhibits differentiation of DE. To characterize DE, high expression
levels of FOXA2, SOX17, CXCR4 are needed.
As DE progresses to pancreatic foregut, the morphology of the cells changes from a
2D to an epithelium layer that is largely cuboidal in structure. In the human embryonic
pancreatic mesenchyme, FGF such as FGF7 and FGF10 are highly expressed in order
to ensure proliferation of pancreatic epithelial cell (Ye et al., 2005) and FGF10 has
been shown to promote PDX1+ pancreatic progenitor proliferation (Hart et al., 2003).
FGF2 has also been shown in many studies to promote pancreatic progenitor
formation (Jiang et al., 2007a, Jiang et al., 2007b, Zhang et al., 2009, Teo et al., 2012,
Teo et al., 2014, Teo et al., 2015b). Vertebrate pancreatic development also requires
the aid of RA signaling. In vivo, the splanchnic lateral plate mesoderm produces RA
which induces Pdx1 expression in the dorsal foregut endoderm (Martin et al., 2005,
Molotkov et al., 2005). Thus, RA has been extensively utilized in pancreatic
development studies at an increasing concentration from 2 μM (D'Amour et al., 2006,
Zhang et al., 2009, Basford et al., 2012, Nostro et al., 2011) to 3 μM (Teo et al., 2012,
Teo et al., 2014, Teo et al., 2015b) and 10 μM (Jiang et al., 2007b, Shim et al., 2007).
![Page 31: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/31.jpg)
3
In the ventral endoderm, BMP signaling is involved in liver lineage specification over
pancreas (Wandzioch and Zaret, 2009). Thus, to encourage pancreatic specification,
Noggin, a BMP antagonist is often used at doses of 50 ng/ml (Zhang et al., 2009,
Basford et al., 2012, Nostro et al., 2011), 100 ng/ml (Jiang et al., 2007a) and up to 150
ng/ml (Cho et al., 2012). Compounds such as LDN-193189 (Rezania et al., 2014,
Pagliuca et al., 2014) and dorsomorphin (Takeuchi et al., 2014) has also been shown to
inhibit BMP receptor. A disadvantage of adding BMP inhibitors during pancreatic
development ultimately results in premature endocrine differentiation (Pagliuca et al.,
2014, Rezania et al., 2013). The end-result of the insulin-producing cells are mostly
poly-hormonal. Since TGF-β signaling blocks specification of pancreatic
development, TGF-β receptor antagonist, SB431542 or ALK5 inhibitor II (ALK5ii)
has been utilized with Noggin, RA and FGF10 to initiate pancreatic specification and
at the same time inhibiting liver and gut expression markers (Cho et al., 2012, Inman
et al., 2002, Rezania et al., 2011).
The suppression of hedgehog signaling is necessary in pancreatic lineage specification
(D'Amour et al., 2006, Hebrok et al., 1998). Prior to Pdx1 expression, shh signaling is
impeded by notochord-derived signals in the foregut endoderm (Hebrok, 2003).
During pancreatic specification, DE cells are treated with 0.25 µM SANT1 (Rezania et
al., 2014, Pagliuca et al., 2014) and 0.25 µM cyclopamine (D'Amour et al., 2006,
Basford et al., 2012, Russ et al., 2015, Nostro et al., 2011, Mfopou et al., 2010) to
suppress hedgehog signaling and this serves to boost the generation of PDX1+ cells.
To further enhance pancreatic endocrine differentiation, additional components such
as Indolactam V and protein kinase C (PKC) agonists have been used (Chen et al.,
2009). Several studies have shown that PKC activators, TPB or PDBu, enhance
![Page 32: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/32.jpg)
4
transcription factor expression such as NEUROD1, NGN3, NKX6.1 and PTF1A
(Rezania et al., 2014, Pagliuca et al., 2014).
To promote NGN3 expression and generation of various endocrine cell types,
suppression of NOTCH signaling is required (Jensen, 2004). Using γ-secretase
inhibitor DAPT that suppresses NOTCH signaling, it has been shown to enhance
generation of NGN3-expression cells (D'Amour et al., 2006). An alternative of γ-
secretase inhibitor XXI has also been used to augment the formation of
NKX6.1+INS+GLUC- cells from 25-50 % (Rezania et al., 2014).
In order to obtain mature pancreatic endocrine cells, nicotinamide, a poly (ADP-
ribose) synthetase inhibitor which enhances β-cell mass in human fetal pancreatic cells
in culture is also used (Otonkoski et al., 1993). In multiple studies, various
concentrations of Nicotinamide from 10 µM - 10 mM has been extensively utilized
(Segev et al., 2004, Jiang et al., 2007a, Zhang et al., 2009). Many years ago, the
generation of pancreatic β-like cells was only possible after maturation for three to six
months in vivo (Shim et al., 2007, Kroon et al., 2008, Rezania et al., 2012). However,
breakthroughs have been made in the past two years showing that functional
pancreatic β-like cells have been generated in vitro (Rezania et al., 2014, Pagliuca et
al., 2014, Russ et al., 2015). Despite the promising results of showing glycaemic
correction in animal diabetes models using these cells (Rezania et al., 2014, Vegas et
al., 2016, Bruin et al., 2015b), these immature cells are incomparable to mature human
β-cells. This is because they lack many important markers that are indicative of mature
β-cells. These β-like cells are incapable of responding in real-time to glucose challenge
and show incorrect insulin secretory kinetics and calcium dynamics (Bruin et al.,
2015a). Hence, there represents an ever-urgent demand to optimize the in vitro
protocols which will allow the generation of true mature human pancreatic β-cells.
![Page 33: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/33.jpg)
5
Having discussed the numerous cellular signalling pathways being activated/repressed
upon pancreatic β-like cell differentiation, I also seek to identify new proteins that can
influence differentiation towards the pancreatic lineage. In this thesis, I am focused on
the BCL-2 family of proteins which have a canonical function in prosurvival and
death. But yet, they also have little-known functions in regulating cell lineage
differentiation.
Figure 1. Diagram showing the stepwise differentiation from human pluripotent stem cells to
pancreatic β-like cells. The various critical signaling pathways involved are listed in this diagram.
Green box indicates activation of the respective signalling pathways whereas red box indicates
inhibition of the respective signalling pathways. Blue box indicates small molecules or chemicals
used. Yellow box indicates the types of assays used to characterise the cells. Light blue box
indicates the RNA/Protein markers used to characterise the cells at each respective stage.
Taken from (Loo et al., 2018). An arduous journey from human pluripotent stem cells to functional
pancreatic β-cells. Diabetes Obes Metab. 20(1):3-13 (2018).
![Page 34: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/34.jpg)
6
1.1.1 Different hPSC lines used in pancreatic differentiation protocols
Different hPSC lines can be differentiated into the three germ layers (Osafune et al.,
2008). Hence, different groups have tried using hPSC lines in order to assess if
differentiation protocols can be reproduced with minimal changes on the results (Table
1).
Most notably, H1(Rezania et al., 2012, Rezania et al., 2014) or H9 hESCs (WiCell) are
often the cell line of choice among the many research groups. The next most
frequently used cell lines are HES lines (ESI BIO) or the HUES lines from HSCI
(Harvard Stem Cell Institute). Pagliuca et al (Pagliuca et al., 2014) used HUES8 hESC
which is supposedly the best line for pancreatic differentiation (Osafune et al., 2008)
and also two hiPSC lines for their protocol (Pagliuca et al., 2014).
As shown in Table 1, many groups have experimented with different hPSC lines for
pancreatic differentiation and each of the line tends to exhibit differences in
differentiation potential (Pagliuca et al., 2014). As a result, it becomes difficult to
compare the reliability of each different protocols.
Despite the general consensus that pancreatic β-like cells can be reliably generated
with a wide variety of hPSC lines, optimization of each hPSC line may have to be
performed to achieve maximum differentiation potential to obtain pancreatic β-like
cells.
![Page 35: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/35.jpg)
7
hESC line hiPSC
line
Summary Reference
H9 - Spontaneous differentiation of hESC into INS+ cells
in vitro.
(Assady et al., 2001)
H1, H9 - Spontaneous differentiation of hESC into mixed
population of INS+, GCG+, SST+, PYY+, IAPP+,
PDX1+, FOXA2+ and SOX17+ cells in vitro.
(Xu et al., 2006)
H9.2, H13, I6 - Growth factor-induced directed differentiation of
hESC into mixed population of INS+, GCG+, IAPP+,
PDX1+, NKX6.1+ and GLUT2+ cells in vitro.
(Segev et al., 2004)
SA002, AS034,
SA121, SA181
- Spontaneous differentiation of hESC into PDX1+,
FOXA2+ cells in vitro; followed by in vivo
maturation into mixed population of INS+, GCG+,
AMY+ and C-peptide+ cells.
(Brolen et al., 2005)
CyT203, CyT25,
CyT49, BG01,
BG02, BG03
- Growth factor-induced directed differentiation of
hESC into mixed populations of INS+, GCG+,
GHRL+, SST+, PPY+, C-peptide+, PDX1+, FOXA2+
and NKX6.1+ cells in vitro.
(D'Amour et al.,
2006)
HES1, HES2,
HES3, HES4,
HUES7, HUES9
- Growth factor-induced directed differentiation of
hESC into mixed populations of INS+, GCG+, SST+,
C-peptide+, PDX1+, NKX6.1+, GLUT2+ and CK19+
cells.
(Phillips et al., 2007)
H1, H7, H9 - Growth factor-induced directed differentiation of
hESC into mixed population of INS+, GCG+, AMY+,
C-peptide+, PDX1+, FOXA2+, NKX6.1+, GLUT2+
and PTF1a+ cells in vitro.
(Jiang et al., 2007a)
H1, H9 - Growth factor-induced directed differentiation of
hESC into mixed population of INS+, GCG+, AMY+,
SST+, C-peptide+, PDX1+, SOX17+ and GLUT2+
cells in vitro.
(Jiang et al., 2007b)
Miz-hES4, Miz-
hES6
- Growth factor-induced differentiation of hESC into
INS+, GCG+, C-peptide+, PDX1+, FOXA2+ and
SOX17+ co-expressing cells in vitro.
(Shim et al., 2007)
CyT49, CyT203 - Growth factor-induced differentiation of hESC into
PDX1+, NKX6.1+, FOXA2+ cells in vitro; followed
by in vivo maturation into INS+, GCG+, SST+, IAPP+,
GHR+ and MAFA+ cells.
(Kroon et al., 2008)
SNUhES3 - Growth factor-induced differentiation of hESC into
mixed population of GCG+, C-peptide+, PDX1+,
FOXA2+ and SOX17+ cells in vitro.
(Cho et al., 2008)
H9, H1 C1, C2,
C5
Growth factor-induced directed differentiation of
hESC and hiPSC into mixed population of INS+,
AMY+, SST+, C-peptide+, PDX1+, FOXA2+, SOX17+
and NKX6.1+ cells.
(Zhang et al., 2009)
HUES4, HUES8,
HUES9
- Chemically-induced directed differentiation of hESC
into PDX1+, FOXA2+ and SOX17+ cells.
(Borowiak et al.,
2009)
HUES2, HUES4, - Chemically and growth factor induction of hESC into (Chen et al., 2009)
Table 1: Different hPSC lines used in pancreatic differentiation protocols
Different hPSC/ hiPSC lines have been used in many different differentiation protocols over the
years and they are all listed in the table above.
Taken from (Loo et al., 2018). An arduous journey from human pluripotent stem cells to functional
pancreatic β-cells. Diabetes Obes Metab. 20(1):3-13 (2018).
![Page 36: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/36.jpg)
8
HUES9 PDX1+ cells and further differentiation using growth
factors into mixed population of INS+, AMY+ and C-
peptide+ cells in vitro.
CyT49 - Reported the inconsistency in the results using
differentiation protocol described in Kroon et al.,
2008.
(Matveyenko et al.,
2010)
H1, H9, UC06 - Growth factor-induced differentiation of hESC into
INS+, AMY+, C-peptide+, PDX1+, NKX6.1+ and
FOXA2+ cells in vitro.
(Cai et al., 2010)
WA01, WA09 - Growth factor-induced differentiation of hESC into
INS+, GCG+, PDX1+, FOXA2+, SOX17+ and
NKX6.1+ cells in vitro.
(Xu et al., 2011)
H1, H9, HES3 38-2
from
GM013
90
Growth factor-induced differentiation of hESC and
hiPSC into INS+, C-peptide+, PDX1+ and FOXA2+
cells in vitro.
(Nostro et al., 2011)
INSGFP/w, HES2 - Growth factor-induced differentiation of hESC into
mixed population of INS+, GCG+, SST+ and GLUT2+
cells in vitro.
(Basford et al., 2012)
CyT49 - Growth factor-induced differentiation of hESC into
PDX1+, FOXA2+, NKX6.1+ and SOX17+ cells in
vitro; further maturation of progenitor cells into INS+,
GCG+ and SST+ cells in vivo.
(Schulz et al., 2012)
H1, ESI-
49
- Growth factor-induced differentiation of hESC into
INS+, GCG+, PDX1+, NKX6.1+ cells in vitro; further
maturation of progenitor cells into INS+, GCG+,
SST+, PPY+, PDX1+ and NKX6.1+ cells in vivo.
(Rezania et al., 2012)
VUB07 - Growth factor-induced differentiation of hESC into
PDX1+, FOXA2+, SOX9+ and CK19+ cells in vitro;
further maturation of progenitor cells into INS+ and
NKX6.1+ cells in vivo.
(Sui et al., 2013)
H1 - Growth factor-induced differentiation of hESC into
mixed population of INS+, GCG+ and NKX6.1+ cells
in vitro; further maturation of progenitor cells into
INS+, GCG+, SST+, C-peptide+, PDX1+ and NKX6.1+
in vivo.
(Bruin et al., 2013)
KhES-3 hiPSC
253G1
Growth factor-induced differentiation of hESC and
hiPSC into mixed population of INS+, GCG+, SST+,
C-peptide+, PDX1+, FOXA2+, NKX6.1+ and SOX17+
in vitro.
(Takeuchi et al.,
2014)
H1 hiPSC
#A189
45
Growth factor-induced differentiation of hESC and
hiPSC into mixed population of INS+, GCG+, PDX1+
and NKX6.1+ in vitro; further maturation of cells into
SST+ and C-peptide+ cells in vivo.
(Rezania et al., 2014)
HUES8 hiPSC1
,
hiPSC2
Growth factor-induced differentiation of hESC and
hiPSC into mixed population of INS+, GCG+, C-
peptide+, PDX1+ and NKX6.1+ cells in vitro.
(Pagliuca et al.,
2014)
H1 - Growth factor-induced differentiation of hESC into
mixed population of INS+, GCG+ and NKX6.1+ cells
in vitro; further maturation of progenitor cells into
INS+, GCG+, SST+, C-peptide+, PDX1+ and NKX6.1+
in vivo.
(Bruin et al., 2015b)
MEL1 - Growth factor-induced differentiation of hESC into
mixed population of INS+, GCG+, C-peptide+, PDX1+
and NKX6.1+ in vitro.
(Russ et al., 2015)
- ND1,
ND2,
hiPSCs
Growth factor-induced differentiation of hESC and
hiPSC into mixed population of INS+, GCG+, C-
peptide+, PDX1+ and NKX6.1+ cells in vitro.
(Millman et al.,
2016)
![Page 37: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/37.jpg)
9
1.1.2 Variability between current protocols used to generate pancreatic β-like
cells.
2007 to present: maturation in vivo
In order to achieve insulin-producing cells, scientists have been transplanting
pancreatic progenitors into diabetic mice for in vivo maturation. PDX1+ pancreatic
endoderm cells were able to differentiate into insulin- and glucagon-producing cells
(Shim et al., 2007). As a result of this novel finding, more groups began to incorporate
in vivo maturation into their work (Basford et al., 2012, Kroon et al., 2008,
Matveyenko et al., 2010, Schulz et al., 2012).
Scientists from ViaCyte were able to generate pancreatic endoderm cell aggregates
and mature them in vivo for 3 to 6 months into glucose-responsive pancreatic
endocrine cells (Kroon et al., 2008). Interestingly, the C-peptide and insulin levels
secreted by the stem cell-derived beta-like cells were comparable to those secreted by
human islets. Next, the question of whether the site of transplantation would affect the
maturation efficiency began to surface. (Sui et al., 2013) reported that pancreatic
progenitors transplanted at the subcutaneous site were PDX1+ where barely any cells
remained post-transplantation in the fat pad. However, (Kroon et al., 2008) reported
transplantation of cells into the fat pad and these in vivo matured cells were capable of
restoring normoglycemia in streptozotocin-treated diabetic mice. This suggests that the
survival of transplanted pancreatic progenitors are strongly influenced by the in-vivo
microenvironment.
![Page 38: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/38.jpg)
10
2014 to present: functional beta cells in vitro in a scalable system
Since 2014, scientists have been trying to generate functional beta-like cells in vitro in
a scalable system. To achieve a higher efficiency in generating beta-like cells, Insulin+
cells were generated from many different hPSC lines by culturing spheroids in media
containing nicotinamide, dexamethasone, and ALK5 inhibitor II (Takeuchi et al.,
2014).
A 7-stage protocol to differentiate hPSC into stage 7 (S7) cells was developed by
(Rezania et al., 2014) and the insulin secretion content of these S7 cells was
comparable to the amount secreted by human islets. Using this protocol, Rezania et al.
were able to reverse diabetes in mice in as short as 40 days compared to the normal 3
to 6 months.
In a breakthrough, (Pagliuca et al., 2014) came up with a protocol which could
generate billions of beta-like cells (SC-beta-cells) from hPSC in vitro. These cells
were able to reverse worsening hyperglycaemia in NRG-Akita mice. This essentially
solved the difficult problem of obtaining a sufficient amount of mature beta-like cells
from patient-specific hiPSCs. Furthermore, this protocol also provides a high-
throughput platform which can generate billions of patient-derived cells for drug-
screening purposes.
Using the same protocol, the SC beta-cells were encapsulated with alginate derivatives
which can maintain normal blood glucose levels without the need for
immunosuppressants for up to 174 days (Vegas et al., 2016).
![Page 39: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/39.jpg)
11
1.2 BCL-2 family
1.2.1 BCL-2 family proteins
BCL-2 proteins control the activity of caspases and downstream cellular apoptosis.
(Adams and Cory, 1998, Gross et al., 1999). The proportion of anti-apoptotic to pro-
apoptotic BCL-2 proteins represents a critical effector of apoptosis. Anti-apoptotic
proteins are crucial in promoting cell survival. These proteins include A1, Bcl-2, Bcl-
xL, Bcl-w, Boo, Mcl-1 and C. elegans protein CED-9. The anti-apoptotic factors
contain three or four BH domains (BH1-4). In contrast, the pro-apoptotic factors are
classified into two major groups. The first group contains two or three BH domains
(Bax, Bak and Bok/Mtd) whereas the second group contains only the BH3 domain
(Bad, Bid, Bim/Bod, Bmf, Noxa, Puma/Bbc-3 and C. elegans Egl-1) (Huang and
Strasser, 2000) (Fig 2). These BH1-4 domains consist of short amino acid sequences
that play a part in categorizing these BCL-2 proteins into anti- and pro-apoptotic
proteins as well as defining them as multi-domain or BH3-only proteins.
BH3-only proteins are critical for initiating cellular apoptosis in mice (Bouillet et al.,
1999). In mammalian systems, there are at least eight BH3-only protein such as Bid,
Bim and Puma (Huang and Strasser, 2000). Each of the different BH3-only proteins
acts differently to avoid functional redundancy. The BH3 domain is comprised of an
amphipathic α-helix that is around 26 residues long that is capable of binding the
hydrophobic groove present in the anti-apoptotic BCL-2 proteins (Sattler et al., 1997).
In order to induce apoptosis, the BH3 domains of the pro-apoptotic proteins can
heterodimerize with the hydrophobic pockets formed by the BH1-3 domains of the
anti-apoptotic factors. The various BH3-only proteins are able to bind to many anti-
![Page 40: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/40.jpg)
12
apoptotic proteins with a varying degree of binding affinity (Opferman et al., 2003,
Chen et al., 2005b, Kuwana et al., 2005b, Certo et al., 2006, Ku et al., 2011).
Apoptosis controlled by BCL-2 proteins is known as intrinsic apoptosis. BH3-only
proteins, including BIM, BID and PUMA, can bind BAX and BAK, permitting their
activation. This then facilitates their oligomerization which allows them to become
embedded into the mitochondrial membrane, resulting in “mitochondrial outer
membrane permeabilization” (MOMP). Once MOMP has taken place, cytochrome C
is released through the pores and interacts with apoptotic protease-activating factor 1
(APAF-1) to form the apoptosome. The cascade of events activate the initiator caspase
9 which then proceed to cleave and activate the various downstream executioner
caspases 3, 6 and 7, contributing to intrinsic apoptosis (Desagher et al., 1999, Kim et
al., 2006, Wei et al., 2000, Wei et al., 2001).
Figure 2. Different classes of BCL-2 family of genes. (1) Anti-apoptotic multidomain (BH1-4)
proteins, (2) Pro-apoptotic multidomain proteins (BH1-3) (3) BH3-only (BH3) domain proteins.
Adapted from Giménez-Cassina A et al. Regulation of mitochondrial nutrient and energy
metabolism by BCL-2 family proteins. Trends Endocrinol Metab. 2015 Apr;26(4):165-75.
![Page 41: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/41.jpg)
13
Thus, I have presented several models here which show the behaviours of the various
BCL-2 proteins (Fig 3).
1.2.2 Direct activation model
In the “direct activation model”, pro-apoptotic BAX and BAK are bound by BH3
proteins and directly activated (Figure 3A). BH3 proteins can be subdivided into
“activators” and “sensitizers” depend upon their interaction affinities for BCL-2
proteins (Letai et al., 2002). Activator proteins, including BIM, tBID and PUMA, can
bind anti- and pro-apoptotic BCL-2 proteins (Kim et al., 2006). Sensitizers including
BAD and NOXA can bind anti-apoptotic proteins, resulting in liberation of activator
proteins, promoting MOMP (Letai et al., 2002, Kuwana et al., 2005a, Certo et al.,
2006). Anti-apoptotic proteins can interact with both activator and sensitizer proteins,
but cannot form a complex with BAX and BAK (Kim et al., 2006). Hence, to avoid
apoptosis, BH3 proteins must be sequestered by the anti-apoptotic factors to inhibit the
activity of BAX/BAK.
1.2.3 Displacement model
In the “displacement model”, BAX and BAK are proposed to be constitutively active,
with their inhibition requiring binding of anti-apoptotic proteins (Figure 3B). For
apoptosis to initiate, BAX and BAK must be released from their interaction with pro-
survival factors. In certain cells that express numerous anti-apoptotic BCL-2 proteins,
a combination of selectively binding BH3 proteins is needed to initiate apoptosis by
counteracting the protective ability of the anti-apoptotic members (Chen et al., 2005a).
For example, BAK heterodimerizing with BCL-xL and MCL-1 is commonly found in
proliferating cells. Introduction of NOXA can displace BAK-MCL-1 heterodimers.
![Page 42: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/42.jpg)
14
This ultimately releases BAK, allowing the formation of NOXA-MCL complexes to
be formed. Hence, both BAD and NOXA are essential for antagonizing the influence
of BCL-xL and MCL-1 to successfully stimulate apoptosis (Willis et al., 2005).
1.2.4 Embedded together model
The “embedded together model” is a combination of the two previously discussed
models. It proposes that BAX and BAK bind to the cell membrane, inducing an
alteration to BCL-2 protein conformation (Figure 3C). This ultimately affects their
binding affinity for their respective partners (Garcia-Saez et al., 2009, Leber et al.,
2007). The sensitizer BH3 proteins can neutralize the activity of anti-apoptotic
proteins via displacement of both BAX and BAK from the membrane-embedded
complexes of anti-apoptotic factors (Billen et al., 2008, Lovell et al., 2008). As a
result, BAX and BAK bind membrane-embedded anti-apoptotic proteins and are then
released by sensitizer proteins to form oligomers and permeabilize membranes.
The activator proteins also play double role in which they can interact with pro-
survival factors and directly activate pro-apoptotic proteins. However, the interaction
between BH3 proteins and the anti-apoptotic/pro-apoptotic BCL-2 proteins is unstable.
This model of interaction has been shown in living cells (Aranovich et al., 2012).
1.2.5 Unified model
The “unified model” represents an expansion of the embedded together model, and
postulates that there are two modes via which BCL-2 proteins are able to block
MOMP (Llambi et al., 2011) (Figure 3D). In mode 1, activator BH3 proteins are
sequestered by the pro-survival BCL-2 proteins; whereas in mode 2, the effectors
![Page 43: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/43.jpg)
15
themselves, active BAX and BAK, are bound and sequestered by anti-apoptotic BCL-
2 proteins. In this model, mode 1 is deemed inefficient as BH3 sensitizers can easily
overcome it, hence promoting MOMP. This model is also consistent with the known
roles of BAX and BAK in the division and fusion of mitochondria without initiating
MOMP. The unified model thus serves to link the regulation of MOMP and
mitochondrial dynamics.
Understanding the various models of BCL-2 protein interactions allows us to have a
structured summary of how BCL-2 proteins are known to act in concert to promote
MOMP. This is especially important in establishing the identity of various BCL-2
proteins during cellular development which I will explore next.
![Page 44: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/44.jpg)
16
1.3 BCL-xL
Being a member of the BCL-2 gene family, BCL-xL maps to chromosome 20q11.21
(Boise et al., 1993). BCL-xL is able to undergo isoform splicing, leading to 2 different
proteins translated, the anti-apoptotic BCL-xL (233 residues) and the smaller residue
BCL-xS (170 residues) (Boise et al., 1993). BCL-xL consists of BH1-4 domains which
Figure 3. Diagram showing the different activation models of BCL-2 family. (A) Direct activation
model – BH3-Activators (BH3-A) bind to BAX/BAK. The BH3-Sensitisers (BH3-S) actively binds to the
anti-apoptotic proteins. BH3-A initiate activation BAK/BAX to induce mitochondrial outer membrane
permeabilization (MOMP). (B) Displacement model – BAX/BAK are constitutively expressed and they
promote MOMP by oligomerization. In this model, BAX/BAK are restrained by the anti-apoptotic
proteins. To induce MOMP through the freeing of BAX/BAK, the correct combination of BH3 proteins
must be bounded to the various anti-apoptotic proteins. (C) Embedded together model – The reversible
binding interactions between the BCL-2 proteins are regulated by local affinities and protein
concentrations. The membrane lipid bilayer plays a major role in this model. At different intracellular
membranes, the different concentrations of subsets of BCL-2 proteins change the binding dynamics to the
membrane bilayer and binding equilibria between the members. Both BH3-A and BH3-S can sequester
anti-apoptotic proteins and the anti-apoptotic proteins can sequester BH3 proteins and BAX/BAK at the
membrane or by preventing them to bind at the membrane level. (D). Unified model – In this model, anti-
apoptotic proteins has dual functions; sequester BH3-A (mode 1) and BAX/BAK (mode 2). However,
inhibition through mode 1 is considered less efficient.
![Page 45: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/45.jpg)
17
are four distinct BCL-2 homology (BH) domains. An additional transmembrane region
allows it to localize to several cell compartments such as endoplasmic reticulum, outer
membrane and nuclear envelope. (Boise et al., 1993, Ng et al., 1997, Schmitt et al.,
2007). However, BCL-xS lacks the BH1 and BH2 domains (Boise et al., 1993, Fang et
al., 1994) and is mostly implicated in developmental apoptosis and pharmacological
cell death (Heermeier et al., 1996, Willimott et al., 2011).
Together with BCL-2, BCL-xL was originally involved in the capability to mediate
antioxidant effects (Hockenbery et al., 1993, Kane et al., 1993). However, the current
model favors both of them suppressing apoptosis by sequestering the pro-apoptotic
BAX and BAK in inhibitory interactions (Oltvai et al., 1993, Yang et al., 1995).
Hence, the rheostat model proposed in 1993 showed that apoptosis is largely
determined by the intrinsic equilibrium between anti- and pro-apoptotic BCL-2
proteins (Korsmeyer et al., 1993). An example of how BCL-xL exerts its pro-apoptotic
influence is seen when BCL-xL is able to inhibit the formation of pro-apoptotic
cystolic Ca2+ waves, ultimately decreasing the limit of ER Ca2+ stores. However, this
effect can be negated by BAK (Distelhorst and Bootman, 2011, Oakes et al., 2005,
Rong and Distelhorst, 2008). BCL-xL also regulates mitochondrial permeability
transition-dependent apoptosis by governing VDAC1 (Shimizu et al., 1995, Vander
Heiden et al., 2001, Vander Heiden et al., 1999).
1.4 BIM (BCL2L11)
Bim was first discovered in 1998 when researchers screened a bacteriophage lamda
cDNA expression library with recombinant Bcl-2 as a bait (O'Connor et al., 1998). In
lymphoid cells, BIM is highly expressed (O'Reilly et al., 2000). Bim-knockout mice
exhibit lymphoid hyperplasia which indicates that BIM is critical for the killing of
![Page 46: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/46.jpg)
18
autoreactive thymocytes (Bouillet and Strasser, 2002) and B cells (Enders et al., 2003).
Also, these knockout mice exhibit a high titer of antibodies which eventually leads to
autoimmune kidney disease (Bouillet et al., 1999). Bim-knockout in hematopoietic cell
types showed resistance to cytotoxic conditions such as deprivation of cytokines and
exposure to glucocorticoids and taxol-induced killing (Bouillet et al., 1999). In a study
on patients with chronic myeloid leukemia, a deletion polymorphism in BIM was
observed and this changes the alternative splicing of the mRNA. This deletion
polymorphism with a 12.3 % minor allele frequency in East Asian individuals has
been shown to protect against apoptosis (King Pan Ng et al., 2012).
BIM can undergo differential splicing, resulting in three major isoforms (BIML,
BIMEL and BIMS). Among the three isoforms, BIMS is the most potent isoform and
is difficult to detect in vivo (O'Connor et al., 1998). Apart from these three isoforms,
other minor isoforms have also been cloned and characterized. In 2005, Adachi et al.
proposed a name standardization to the minor isoforms of BIM (Adachi et al., 2005).
As of current, there are 16 isoforms of BIM which are summarized in Figure 2 above.
BH3 domain is present in exon 8 (E8). In BIM intron 2, a 2903 bp deletion
polymorphism was found to favour splicing to exon 3 and this results in the
impairment of BIM’s role in apoptosis (Juan et al., 2014).
![Page 47: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/47.jpg)
19
Figure 4. The various isoforms of BIM. Most common forms of BIM isoforms are BIML, BIMEL
and BIMS.
Adapted from Ronit Sionov et al. Regulation of Bim in health and disease. Oncotarget. 2015 Sep;
6(27): 23058–23134.
1.5 Role of splicing in BCL-2 family proteins
Several BCL-2 family members can undergo alternative splicing and hence, have their
activity modulated by post-transcriptional modifications. The anti-apoptotic BCL-2
can undergo alternative splicing to become BCL-2α and BCL-2β. BCL-2α is highly
expressed in B-cell lymphoma with t(14:18) translocation and this confers high level
of stress-resistance on the cells, improving their survival (Tsujimoto, 1989). BCL-2β
has a lower expression in healthy cells as compared to BCL-2α. However, it was
reported that there is an increased ratio of BCL-2β expression in both blood and bone
marrow of CML patients (Llambi et al., 2016). The anti-apoptotic BCL-xS is the pro-
apoptotic isoform of BCL-xL and its role mainly lies in inhibiting BCL-2, preventing
![Page 48: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/48.jpg)
20
cell survival. It is generally expressing in cells with high turnover rate (Boise et al.,
1993) and can also sensitise cells to chemotherapy agents (Sumantran et al., 1995).
There are 3 isoforms of MCL-1; MCL-1L (MCL-1 Long), MCL-1S (MCL-1 Short)
and MCL-1ES (MCL-1 Extra Short). MCL-1L expression is increased when cells are
exposed to tumorigenic compounds, inducing cell survival (Belka and Budach, 2002,
Kozopas et al., 1993). MCL-1S is a pro-apoptotic isoform of MCL-1 which is encoded
by splicing out exon II in MCL-1 (Bae et al., 2000). The shortest isoform of MCL-1 is
known as the pro-apoptotic MCL-1ES and it interacts with MCL-1L to induce
mitochondrial cell death (Kim et al., 2009). Both pro-apoptotic MCL-1S and MCL-
1ES are lowly expressed in oral cancer tissues as compared to MCL-1 (Czabotar et al.,
2007).
As for the pro-apoptotic BCL-2 family members, there are multiple spliced variants in
Bax gene (Akgul et al., 2004, Oltvai et al., 1993). The inactive form of Baxα is
localised in the cytosol or embedded on the outer mitochondrial membranes in healthy
cells (Nechushtan et al., 1999). Upon stimuli by other pro-apoptotic members such as
Bim and tBid (Cartron et al., 2004, Marani et al., 2002), the N- and C-terminal region
of Baxα unfolds. This results in Baxα translocating from the cytosol to mitochondria,
ultimately leading to permeabilization of the outer mitochondrial membrane (Eskes et
al., 2000, Annis et al., 2005). The other isoform of Bax, Baxβ, exists in a constitutively
active conformation and is able to trigger cytochrome c release from the mitochondria.
Knockdown of Baxβ using shRNA desensitises Bax-dependent apoptosis signalling in
HCT116-Bax+/- cells. Taken together, therapeutic strategies could be designed by
targeting the spliced isoforms of Bax.
![Page 49: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/49.jpg)
21
Another pro-apoptotic gene, Bak has a spliced variant N-Bak (Neuronal Bak) which is
only present in the neurons (Sun et al., 2001, Wong et al., 2005).
However, not much work is done on assessing the roles of the various members of
BCL-2 alternatively spliced isoforms on pancreatic progenitors and pancreatic β-cells.
In this project, I have cloned in the spliced isoforms BIMEL, BIML and BIMγ into the
pCDH-MSCV-MCS-EF1α-GFP vector. The expressed genes are already in their
spliced variants, hence, these isoforms will not be further spliced.
1.6 Role of members of the BCL-2 family in pancreatic development
Among the many members of the BCL-2 family of proteins, I am focusing on BCL-xL
and BIM. Understanding the functions of BCL-xL and BIM in pancreatic development
and β-cells would give us further insights into how BCL-2 family of proteins is used to
enhance generation of pancreatic progenitors and β-cells. There have been very limited
BCL-xL-related studies on pancreatic development of β-cells. One group has shown
that high expression of BCL-xL in β-cells is able to prevent cell death but ultimately,
the β-cells exhibit impairment of mitochondrial signal for insulin secretion (Zhou et
al., 2000). Mouse islets β-cells that lack BCL-xL develop normally and they are
especially hypersensitive to apoptotic stimuli (Carrington et al., 2009). Elevated
expression of BCL-xL, but not BCL-2, were also discovered in human islets post-
isolation, strongly highlighting the function of BCL-xL in regulating prosurvival in
human islets (Campbell et al., 2012). Both BCL-xL and BCL-2 have also been found
to repress glucose signaling in pancreatic β-cells (Luciani et al., 2013). To our
knowledge, there have been no reports on the roles of BCL-xL in pancreatic
development. This represents a huge research gap that I hope to fill through exploring
the role of BCL-xL using hPSC as a model to generate pancreatic progenitors. In
![Page 50: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/50.jpg)
22
doing so, I seek to identify the non-canonical roles of BCL-xL in pancreatic
specification.
For BIM, I focused on BIML, BIMEL and BIMγ. The three BIM isoforms are depicted
in Fig 5. The BIML and BIMEL isoforms contain exon 8 in which reference (Ng et al.,
2012) refers to as exon 4. Therefore, exon 8 will be referred to as exon 4 from this
point onwards. The BH3 domain lies in the exon 4. However, exon 4 is absent in the
BIMγ isoform. In many studies, the BH3 domain has been shown to bind to anti-
apoptotic members and induce apoptosis (Huang and Strasser, 2000, Chen et al.,
2005a, Certo et al., 2006, Ku et al., 2011).
BIM transcript was shown to be upregulated in isolated human islets (Campbell et al.,
2012) and there have been very limited studies involving the modulation of BIM
expression in apoptosis in various cellular systems such as mouse and human
pancreatic β-cells (Nogueira et al., 2013, Santin et al., 2011, Colli et al., 2011a, Miani
et al., 2013b). BIML and BIMEL are expressed at an elevated level in the endocrine
cells as compared to the acinar cells (O'Reilly et al., 2000).
The modulation of BIM expression has also been observed to initiate apoptosis in
various cellular models, including mouse and human pancreatic β-cells. The
knockdown of GLIS1, a susceptibility gene for Type I diabetes (T1D) and Type II
diabetes (T2D), is able to activate apoptosis via modulation of BIM, favoring the
expression of BIMS which is the most potent splice variant of BIM (Nogueira et al.,
2013). PTPN2 upon inhibition was found to modulate pancreatic β-cell apoptosis
through JNK1-induced phosphorylation of BIM at Ser65. The phosphorylation at BIM
Ser65 in combination with exposure to IFN-γ leads to β-cells death (Santin et al.,
2011).
![Page 51: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/51.jpg)
23
The inhibition of BIM by siRNAs in β-cells also prevented the activation of the
caspase cascade and cell death, when infected with the diabetogenic virus CVB5. This
implicates BIM in playing a role in apoptosis following viral invasion of β-cells (Colli
et al., 2011b). When β-cells were incubated with cyclopiazonic acid (CPA) + IL-1β, it
was found that the apoptotic rate was decreased when BIM was silenced. They
concluded that crosstalk between ER stress and IL-1β sensitizes β-cells to apoptosis
through an imbalance of anti-apoptotic A1 and pro-apoptotic BIM (Miani et al.,
2013a). These evidence suggest BIM has a critical function in governing β-cells death.
Other BCL-2 family of proteins are also implicated in pancreatic development.
Various cell death signals can induce high expression of Bax protein and is widely
considered a critical event in β-cell apoptosis (Grunnet et al., 2009, Tonnesen et al.,
2009). Using cytokines, Bax protein expression was also upregulated, resulting in a
high Bax/Bcl-2 ratio, favoring a cytokine-induced apoptotic fate for primary rat islets
(Mehmeti et al., 2011). Bax expression was also highly increased during islet isolation
procedure, suggesting that the physical stress of islet isolation also led to an apoptotic
fate in human islets (Thomas et al., 2002). Bax, rather than Bak, has been shown to
play a key role in pancreatic β-cell death upon Pdx-1 knockdown (Sun et al., 2016).
This suggests that Bax is important in regulating pancreatic β-cell apoptosis. Using a
high glucose concentrations as a long-term model of metabolic stress on β-cells, Bim,
Puma and Bax are upregulated and contributed to apoptosis in β-cells (McKenzie et
al., 2010).
Upon exposure to cytokines, Bcl-2, an anti-apoptotic factor, is decreased in mouse and
human pancreatic β-cells (Piro et al., 2001, Trincavelli et al., 2002, Van de Casteele et
al., 2002). Bcl-2 was also overexpressed in pancreatic β-cells and this led to protection
against cytokine-mediated apoptosis in these cells (Barbu et al., 2002, Rabinovitch et
![Page 52: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/52.jpg)
24
al., 1999). Forced Bcl-2 expression also protects mouse islet against apoptosis but was
unable to inhibit autoimmune-induced apoptosis (Allison et al., 2000).
In response to cytokine-induced toxicity, Mcl-1 was implicated in protecting human
and rodent pancreatic β-cells against apoptosis (Meyerovich et al., 2017). However,
the ablation of Mcl-1 does not affect the development and functions of islets in mice.
A combination of cytokines, palmitate and ER stressors also decreased Mcl-1
expression in β-cells, resulting in apoptosis (Allagnat et al., 2011). This evidence
strongly highlights Mcl-1 as a possible drug target in diabetes treatment.
In order for BCL-2 family proteins to become activated for β-cell survival or
apoptosis, I looked at the ER which is crucial for folding and modification of proteins.
1.7 Role of BCL-2 family in other cell lineages
In the hepatocyte lineage, pro-apoptotic members such as Bak, Bad and Bax exhibit an
early decline in transcript levels during liver regeneration induced by partial
hepatectomy. On the other hand, Bcl-xl transcripts were increased, peaking at 12, 24
Figure 5. The three BIM isoforms used in this study. The gene structure of BIM-γ, BIML and
BIMEL containing different exons. BIM-γ is hypothesized to be the non-apoptotic version whereas
BIML and BIMEL are hypothesized to be the pro-apoptotic version as they contain the exon 8
domain. Exon 8 will therefore be referred to as Exon 4 in this thesis.
![Page 53: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/53.jpg)
25
and 48 to 72 h, suggesting its role as a delayed early response gene during liver
regeneration (Tzung et al., 1997). Knockout of Bcl-w and Bfl-1/A1 in mice resulted in
the absence of liver (Hamasaki et al., 1998, Print et al., 1998, Rosse et al., 1998).
In the kidney cell lineage, mice which lacks Bcl-2 exhibit polycystic kidney disease
and eventually die around 4-16 weeks of age (Veis et al., 1993, Nakayama et al.,
1994). Bcl-2 knockout mice are born with normal hair colour but it rapidly turns to
grey coat colour (Veis et al., 1993, Nakayama et al., 1994, Kamada et al., 1995). This
gradual transit in colour change is attributed to the loss of melanocytes that produced
melanin (Yamamura et al., 1996). At the end of 5-6 weeks of the hair follicle cycle,
the melanin level in Bcl-2 knockout mice is comparable to that of albino mice
(Yamamura et al., 1996).
In the hematopoietic system, MCL-1 is shown to be critical for the survival of
common lymphocyte progenitor which gives rise to both B and T lymphocytes
(Opferman et al., 2005). Many other lymphocytes such as pro-B, pro-T cells, naïve,
effector, T-regulatory, memory B and T cells also require MCL-1 for survival
(Opferman et al., 2003, Dzhagalov et al., 2008, Vikstrom et al., 2010, Tripathi et al.,
2013, Pierson et al., 2013). Loss of anti-apoptotic BCL-xL in immature CD4+CD8+
thymocytes results in apoptosis and inhibits proper development of single-positive
thymocytes in chimeric animals (Ma et al., 1995). In Bcl-2 knockout mice, mature
lymphocytes undergo apoptosis due to the triggering of pro-apoptotic stimuli that
results in the expression of BIM (Bouillet et al., 2001). These studies point to the
importance of anti-apoptotic Bcl-2 family proteins in the survival of lymphocytes.
![Page 54: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/54.jpg)
26
1.8 The unfolded protein response and apoptotic pathways in mediating
pancreatic β-cell failure in diabetes
The endoplasmic reticulum (ER) is a special cellular organelle involved in synthesis of
proteins and lipids. Proteins that are made in the ER may not be correctly folded,
forming aberrant structures. The accumulation of these incorrectly folded proteins may
result in aggregation in the ER lumen, resulting in ER stress and ultimately, UPR
activation (Pirot et al., 2007, Marciniak and Ron, 2006, Zhang and Kaufman, 2006).
The ER stress are able to induce UPR and this has been implicated in β-cell loss in
diabetes (type I and II) (Cnop et al., 2005). The three UPR pathways, PERK, IRE1α
and ATF6 gave crucial roles in the biosynthesis of proteins, and act to increase ER
capacity to buffer the stress load during increased protein synthesis (Elouil et al., 2007,
Lipson et al., 2006). However, prolonged stimulation of these pathways eventually
causes an impairment of β-cell function and apoptosis. Downstream of ER stress
pathways, CHOP (DNA-Damage-Inducible Transcript 3) belongs to the C/EBP
(CCAAT-enhancer-binding proteins) family (Oyadomari and Mori, 2004, Cao et al.,
1991) and its expression is increased under stress conditions.
There are several chemical inducers that can be used to bring about UPR. Examples
include tunicamycin and thapsigargin. Tunicamycin is commonly used in biological
studies to inhibit N-linked glycosylation, inducing UPR and arrest in G1 cell cycle
phase (Heifetz et al., 1979). Thapsigargin,is able to inhibit sarcoplasmic/endoplasmic
reticulum Ca2+-ATPase (SERCA) and it is also able to induce UPR and apoptosis in
β-cells (Cardozo et al., 2005, Zhou et al., 1998). The depletion of Ca2+ reduces the
quality of ER protein folding, leading to apoptosis via CHOP-10 upregulation
(Oyadomari et al., 2001).
![Page 55: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/55.jpg)
27
As T1D is an autoimmune disease, the autoreactive T cells also play a key role in
mediating the destruction of beta cells in the body. In the asymptomatic phase of T1D,
T cell responses to autoantigens and autoantibody can be detected in suspected
patients (Ziegler et al., 2013). About 50-60% of genetic risk for T1D is derived from
HLA allele which encodes molecules which are implicated in the presentation of
antigen peptides to T cells (Noble et al., 2010). In T1D patients, autoreactive T cells
exhibit proinflammatory cytokine profiles (Chujo et al., 2013, van Lummel et al.,
2014). T1D patients also show dysregulation in peripheral tolerance including
impaired Treg function (Buckner, 2010, Ferraro et al., 2011) and effector T cell
resistance to Treg suppression (Schneider et al., 2008). Furthermore, the progression
of T1D can also be delayed by using immunosuppressive drugs which are targeted to
T cells (Bougneres et al., 1988).
Infiltrating immune cells release cytokines which are critical regulators of β-cell
apoptosis in T1D. The combination of TNF-α and/or IL-1β in combination with IFN-γ
induce production of nitrous oxide (NO) which in turn causes severe dysfunction and
death of β-cells (Eizirik and Mandrup-Poulsen, 2001, Southern et al., 1990, Welsh et
al., 1991, Eizirik et al., 1992). Apoptosis induced by the various cytokines is
modulated by several transcriptional cascades including genes such as NF-kB and
STAT-1 (Cardozo et al., 2001a, Cardozo et al., 2001b, Kutlu et al., 2003, Gysemans et
al., 2005, Eldor et al., 2006, Callewaert et al., 2007, Cnop et al., 2005). IL-1β and IFN-
γ are able to reduce SERCA expression in primary β cells and rat INS-1E cells,
thereby diminishing calcium ion stores in the ER (Cardozo et al., 2005). Certain
cytokines, including IL-1β and IFN-γ, can induce ER stress response by activating
IRE1α and eIF2a/ATF4/CHOP-10/BIM (Pirot et al., 2007, Cardozo et al., 2001b,
Kutlu et al., 2003, Cardozo et al., 2005). IFN-γ is able to decrease sXBP1 (spliced
![Page 56: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/56.jpg)
28
XBP1) mRNA expression while augmenting CHOP-10 and ATF4 expression (Pirot et
al., 2006, Rasschaert et al., 2003). This results in a decrease of β-cell defense against
ER stress, favoring pro-apoptotic cues such as the expression of CHOP-10 and other
ATF4-dependent factors.
The BCL-2 family proteins are critical in downstream of ER stress pathways. Under
ER stress response, their expression increases rapidly and activates several
downstream genes; BIM, PUMA, NOXA and BCL-2. Several of them have been
observed to promote the demise of β-cells during ER stress (Reimertz et al., 2003,
Morishima et al., 2004, Mathai et al., 2005, Li et al., 2006). In the mitochondria, BAX
and BAK regulate outer mitochondria membrane permeability by undergoing
oligomerization when the cell is committed to apoptosis (Hsu et al., 1997, Gross et al.,
1998, Desagher et al., 1999, Griffiths et al., 1999, Wei et al., 2000, Makin et al., 2001).
Once the outer membrane is breached, cytochrome C is released and becomes bound
to procaspase 9 and APAF1, forming an apoptosome complex (Chinnaiyan, 1999, Hill
et al., 2004). This eventually activates the main activator, caspase 9 then further trigger
the activation of caspases 3 and 7 and through a series of downstream processes,
coordinate the destruction of the cell (also known as apoptosis) (Slee et al., 1999).
![Page 57: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/57.jpg)
29
Figure 6. Pancreatic β-cells undergoing ER stress upregulate the BCL-2 family of proteins.
The 3 arms of the UPR (PERK, IRE1α, ATF6) are located in the ER membrane. They initiate
signaling events which serve to either increase or reduce protein load on the ER. PERK is able to
phosphorylate eIF2α which functions in shutting down global protein translation and increase
ATF4 expression. ATF4 induces transcription of selected genes whose function involves restoring
proteostasis. This creates a feedback mechanism leading to eIF2α dephosphorylation, reinitiating
protein translation. Activated cytosolic domains of IRE1α excise a 252bp intron from XBP1,
resulting in sXBP1. sXBP1 is able to upregulate UPR stress genes by binding directly to stress
promoters in the nucleus. ATF6 is exported to the golgi which is cleaved by protease to form
(ATF6 p50). ATF6 p50 acts as a transcription factor, inducing transcription of genes involved in
the UPR.
![Page 58: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/58.jpg)
30
1.9 Hypotheses
I hypothesize that there are changes in the transcript and protein expression level of
the BCL-2 family of genes during differentiation of human embryonic stem cells into
the pancreatic lineage. The perturbation of certain members of BCL-xL through
chemical inhibition/ lentiviral-mediated knockdown will lead to a change in cell
lineage specification. I also hypothesize that modulation of BIM isoforms would
provide protective effects against apoptosis in mouse pancreatic β-cells and human
islets.
1.10 Specific aims
Aim 1: To determine the expression profile of BCL-2 family members during
pancreatic lineage differentiation and ascertain their role and function
Methodology 1: Differentiate human pluripotent stem cells (hPSC) into pancreatic
lineage and perform RT-QPCR/ western blot to assess the BCL-2 transcript and
protein levels at 8 different timepoints.
Aim 2: To perturb the expression level of BCL-xL during pancreatic differentiation to
study its role and function
Methodology 2: Inhibit BCL-xL using chemical inhibitors/ lentiviral-mediated
knockdown and perform RT-QPCR and western blot to assess specific pancreatic
markers level.
![Page 59: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/59.jpg)
31
Aim 3: To understand the role of various BIM isoforms in pancreatic beta cells
Methodology 3: Overexpress various BIM isoforms in mouse pancreatic beta cells
and human islets and perform RT-QPCR and western blot to assess the protective
effects against apoptosis.
![Page 60: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/60.jpg)
32
2 Materials and Methods
2.1 Materials
2.1.1 Cell lines
The cell samples were periodically sent for mycoplasma contamination checks.
H9 and iAGb were confirmed to have normal karyotype.
MIN6 cells were confirmed to be glucose-responsive by a fellow lab colleague, Miss
Shabrina.
Cell Lines Source Cat. No.
Mouse: CF-1 mouse
embryonic fibroblasts
MTI-GlobalStem GSC-6001G
Human ESC W09 (Female) WiCell Research Institute,
Inc
15-W0038
Human iPSCs iAGb (Male) Reprogrammed from
fibroblast AG16102,
Coriell Institute
N/A
HEK293FT Thermo Fisher Scientific R70007
MIN6 AddexBio C0018008
Human Islets Alberta Islet Distribution P
rogram
NA
2.1.2 Antibodies
All antibodies were from purchased Cell Signaling Technology (Danvers, MA, USA),
Santa Cruz Biotechnology (Santa Cruz, CA, USA), R&D Biosystems (Minneapolis,
MN, USA), Abcam (Cambridge, UK), Sigma-aldrich, Thermo Fisher Scientific
(Waltham, Massachusetts), Millipore (Burlington, MA).
Table 2: List of antibodies used
Antibodies Source Cat. No./ RRID
Anti-β-Actin (Mouse
monoclonal)
Sigma A5441;
RRID:AB_476744
![Page 61: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/61.jpg)
33
Anti-BAX [2D2] Mouse
monoclonal
Abcam Ab77566;
RRID:AB_1565901
Anti-BAX (Rabbit
polyclonal)
Cell Signaling Technology #2772S;
RRID: AB_10695870
Anti BAK [AT8B4] (Mouse
monoclonal)
Abcam Ab104124;
RRID:AB_10712355
Anti-BAK (Rabbit
polyclonal)
Cell Signaling Technology #3814S;
RRID: AB_2290287
Anti -BCL-xL [EPR16642]
(Rabbit monoclonal)
Abcam Ab178844;
RRID: NA
Anti-BCL-xL (Rabbit
polyclonal)
Cell Signaling Technology #2762S;
RRID: AB_10694844
Anti-BCL2 [EPR17509]
(Rabbit monoclonal)
Abcam Ab182858;
RRID: AB_2715467
Anti-BCL2 (Rabbit
polyclonal)
Cell Signaling Technology #2876;
RRID: AB_2064177
Anti-BIM (Rabbit
polyclonal)
Cell Signaling Technology #2819S;
RRID: AB_10692515
Anti-Caspase 3 (Rabbit
monoclonal)
Abcam Ab13847;
RRID:AB_443014
Anti-Caspase 3 (Rabbit
polyclonal)
Cell Signaling Technology #9662S;
RRID: AB_10694681
Anti-GATA4 [6H10] (Mouse
monoclonal)
Thermo Fisher Scientific MA5-15532;
RRID: AB_10989032
Anti-HNF1B (Goat
polyclonal)
Abcam Ab59118;
RRID:AB_945772
Anti- HNF4α (Rabbit
monoclonal)
Cell Signaling Technology #3113S;
RRID:AB_2295208
Anti-MCL1 (Rabbit
polyclonal)
Cell Signaling Technology #4572;
RRID: AB_2281980
Anti-PAX6 [AD1.5] (Mouse
monoclonal)
Millipore Ab570718;
RRID:AB_570718
Anti-PDX1 (Goat
polyclonal)
R&D Systems Af2419;
RRID:AB_355257
Anti-PUMA (Rabbit
polyclonal)
Cell Signaling Technology #4976;
RRID: AB_2064551
Anti-SFRP5 (Rabbit
polyclonal)
Abcam Ab230425;
RRID: NA
Donkey Anti-Mouse IgG
(H+L) Highly Cross-
Adsorbed secondary
antibody, Alexa Fluor Plus
647
Invitrogen Ab32787;
RRID: AB_2762830
Goat Anti-Mouse IgG HRP Santa Cruz sc-2005;
RRID: AB_631736
Donkey Anti-Rabbit IgG
(H+L) Alexa Fluor 488
Invitrogen A21206;
RRID:AB_2535792
Goat Anti-Rabbit IgG HRP Santa Cruz sc-2004;
RRID: AB_631746
![Page 62: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/62.jpg)
34
Donkey Anti-Goat IgG
(H+L) Cross-Adsorbed, Alex
Fluor 488
Thermo Fisher Scientific A11055;
RRID: AB_2534102
Donkey Anti-Mouse (H+L)
Highly Cross-Adsorbed,
Alex Fluor 488
Thermo Fisher Scientific A21202;
RRID: AB_141607
2.1.3 Chemicals, peptides, media, reagents, assays and buffers
Table 3: Chemicals, peptides, media, reagents, assays and buffers
Chemical, peptides, media,
reagents, assays and buffers
Source Cat. No.
Activin A R&D system 338-AC-50
ALK5ill ENZO ALX-270-445-M001
Ascorbic acid Sigma A8960
Betacellulin Cell Signaling 5235SF
B-27™ Serum Minus
Vitamin A
Thermo Fisher Scientific #12587010
β-mercaptoethanol Thermo Fisher Scientific 21985-023
Calcium chloride Sigma C-5670
CHIR9021 Tocris 4423
CMRL 1066 Supplemented Mediatech Inc 99-603-CV
CMRL Medium 1066 Life Technologies 11530-037
Collagenase IV Life Technologies 17104019
Coverslips
18 x 18 mm
Marienfeld 0101030
DAKO mounting medium DAKO S3023
DAPI Sigma D9542
DAPT Abcam Ab120633
Dispase in DMEM/F12 STEMCELL Technologies 07923
D(+)-Glucose WAKO 049-31165
Donkey serum Merck S-30
DMEM F12 media Invitrogen 10565042
DMEM/High Glucose Media Hyclone SH30243.01
DMSO Sigma D2650
FAF-BSA Proliant 68700
FGF2 Miltenyi Biotec 130-093-838
FGF7 Mitenyi Biotec 130037178
Gelatin (Porcine) Sigma G1890
GlutamaxTM Supplement Invitrogen 35050038
HEPES Buffer 1M STEMCELL Technologies 07200
HyClone Phosphate Buffered
Saline solution
GE Healthcare Life
Sciences
SH30256.01
HycloneTM Foetal Bovine Hyclone SV30160.03
![Page 63: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/63.jpg)
35
Serum (South America)
IFN-γ Biolegend 713906
IL-1β Biolegend 579406
ITS-X Life Technologies 51500056
KnockOut™ serum
replacement
Gibco 10828028
LDN193189 Sigma SML0559
L-Glutamine Sigma G8540
![Page 64: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/64.jpg)
36
LipofectamineTM 2000
Transfection Reagent
Invitrogen 11668027
LY294002 LC labs L-7962
MCDB131 Life Technologies 10372019
MEM non-essential amino
acids (100X)
Life Technologies 11140-050
M-PER™ Mammalian
Protein Extraction Reagent
Thermo Fisher Scientific 78501
mTESRTM1 Basal Medium STEMCELL Technologies 85851
NaHCO3 Sigma S5761-500G
NheI New England Biolabs R3131
PDBu Tocris 4153
Penicillin-Streptomycin Thermo Fisher Scientific 15140122
Polybrene Millipore TR-1003-G
Retinoic Acid WAKO 186-01114
RPMI-1640 Gibco 11875093
SANT1 Santa Cruz Sc-203253
SuperFrost Plus™ Adhesion
slides
Thermo Fisher Scientific 10149870
TeSRTM-E8TM Basal Medium STEMCELL Technologies 05990
TeSRTM-E8TM 25X
Supplement
STEMCELL Technologies 05992
Thapsigargin Cayman Chemical 10522-1
Tunicamycin Sigma T7765
TNF-α Biolegend 717904
TrypLE Express Life Technologies 12604021
Trypsin-EDTA (0.25 %) Life Technologies 25200056
T3 Millipore 642511
Vitamin B3 (Nicotinamide) Sigma N0636-100G
Vitamin C (L-Ascorbic acid) WAKO 012-04802
WEHI-539 ApexBio A3935
XhoI New England Biolabs R0146
XXI (Gamma-Secretase
Inhibitor)
Millipore 565790
Y-27632 STEMCELL Technologies 72302
Critical commercial assays Source Cat. No.
High Capacity cDNA
Reverse Transcription Kit
Applied Biosystems 4368813
iTaq™ Universal
SYBR® Green Supermix
Bio-Rad 1725124
Lenti-XTM p24 Rapid Titer
Kit
Clontech 632200
NucleoBondⓇ Xtra Midi Macherey-Nagel 740410.50
NucleospinⓇ Plasmid
EasyPure
Macherey-Nagel 740727.250
Phusion High-Fidelity DNA
Polymerase
Thermo Fisher Scientific F530S
![Page 65: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/65.jpg)
37
PierceTM BCA Protein Assay
Kit
Thermo Fisher Scientific 23227
PureLinkTM Quick PCR
Purification Kit
Invitrogen K310002
RNA isolation NucleospinⓇ
RNA
Macherey-Nagel 740955.250
Seahorse XF Base Medium Agilent 102353-100-100
Seahorse XF Glycolysis
Stress Test Kit
Agilent 103020-100
Seahorse XF Mito Stress Kit Agilent 103015-100
SuperSignalTM West Dura
Extended Duration Substrate
Thermo Fisher Scientific 34076
2.1.4 Softwares, instruments and algorithms
Table 4: Softwares, instruments and algorithms
Softwares, instruments and
algorithms
Source Cat. No.
AxioVision LE Zeiss Version 4.8.2
Bio-Rad CFXTM Manager Bio-Rad Version 3.1
FlowJo 10 FlowJo Version 10
Seahorse XFe96 Analyzer Agilent S7800B
Seahorse Wave Desktop
Software
Agilent Version 2.6.1
Others
CFX384TM Real-Time
System
Bio-Rad 1855485
Coverslips
18 x 18 mm
Marienfeld 0101030
NanoDrop 1000
spectrophotometer
Thermo Fisher Scientific V 3.8
Nikon Eclipse Inverted Nikon TS-100
Olympus Fluoview 1000
Inverted Confocal
Olympus FV1000
Optima L-100 XP
Ultracentrifuge
Beckman Coulter L-100 XP
SuperFrost Plus™ Adhesion
slides
Thermo Fisher Scientific
10149870
SW28 Ti Swinging-Bucket
Aluminium Rotor
Beckman Coulter 342207
Ultra-Clear tubes Beckman Coulter 344058
![Page 66: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/66.jpg)
38
2.2 Mammalian cell cultures and differentiation
2.2.1 Mouse embryonic fibroblasts
Mouse embryonic fibroblasts were cultured in DMEM high glucose with GlutaMAX
supplement, 10 % foetal bovine serum (FBS) and 1 % Non-essential amino acid
(NEAA).
2.2.2 hPSC and iAGb
H9, a human embryonic stem cell line (WiCell Research Institute, Inc) and iAGb, a
human induced pluripotent stem cell line (Coriell Institute) were cultured in feeder-
free condition using TeSR™-E8™ basal medium and TeSR™-E8™ 25X Supplement
(STEMCELL Technologies). Media were changed daily and cells were passaged once
a week when confluent.
2.2.3 17 Day differentiation protocol
Undifferentiated human pluripotent stem cells (hPSC) were maintained in DMEM/F-
12 with 15 mM HEPES (STEMCELL Technologies), 20 % KnockOut™ serum
replacement (KOSR), L-Glutamine, NEAA (Life Technologies) and supplemented
with 10 ng/ml FGF2 (Miltenyi Biotec) in 5 % CO2 and 100 % humidity. hPSC media
were replaced every 24 h. hPSC were manually split and seeded on irradiated CF-1
mouse embryonic fibroblasts once a week. At D-2, the cells were washed with PBS
and incubated with Dispase (STEMCELL Technologies) and Collagenase IV (Life
Technologies) for 5 min. The cells were then washed with sterile PBS, scored and
passed through 70 μM cell strainer. For each 10 cm plate, 6 ml hPSC medium was
used to flush the plate and cell suspension collected. The cell suspension was then
dispensed into a 6 well plate and left to incubate for 48 h at 5 % CO2 and 100 %
![Page 67: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/67.jpg)
39
humidity. Cells were differentiated 2 days later in RPMI-1640/2 % B-27 (no vitamin
A; serum-free chemically defined medium (Gibco) supplemented with 1 % GlutaMAX
Supplement (Invitrogen), 1 % MEM non-essential amino acids NEAA (Invitrogen),
0.1 % β-mercaptoethanol (Gibco). The cells were differentiated using the 17D
differentiation protocol listed in Table 8. At the end of the 17D differentiation
protocol, the cells were then harvested at each respective time-point for RNA and
protein analysis. The protocol has been used to generate early pancreatic progenitors
and is based on the following papers as described in (Teo et al., 2016, Teo et al.,
2015b, Teo et al., 2014).
2.2.4 35 Day differentiation protocol
At D-2, confluent hPSC in 10cm dish were washed with sterile PBS and incubated
with 3 ml of TrypLE (Life Technologies) for 3 min. The cells were then washed with
sterile PBS. 5 ml of DMEM/F12 media were then dispensed into the dish to flush the
cells and the cell solution was filtered through 70 μM filter. The cells were centrifuged
at 1200 rpm for 5 min and seeded at 1 million cells/ml in a non-coated plate and left to
incubate for 48 h at 5 % CO2 and 100 % humidity in a shaker at 80 rpm. The cells
were differentiated using the 35D differentiation protocol listed in Table 9. At the end
of the 35D differentiation protocol, the cells were then harvested at each respective
time-point for RNA analysis. The protocol has been used to generate pancreatic β-like
cells and is based on the following papers as described in (Pagliuca et al., 2014).
2.2.5 HEK293FT cell culture
HEK293FT cells were cultured in DMEM High glucose (Life Technologies)
supplemented with 10 % Foetal bovine serum (South America Hyclone) and 1 % Non-
essential amino acid NEAA (Invitrogen).
![Page 68: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/68.jpg)
40
2.2.6 MIN6 cell culture
Mouse β-cell line MIN6 (P24-P37) was cultured in MIN6 media composed of DMEM
high glucose, 15 % FBS, 1 % sodium pyruvate and 55 µM β-mercaptoethanol.
2.2.7 Human islets
Human islets were obtained from the University of Alberta, Canada and cultured in
Miami media overnight before use. For RT-QPCR study, I used 200 islets for each
condition.
2.3 Molecular biology techniques
2.3.1 RNA extraction and RT-PCR
RNA was extracted from the cells using RNA isolation Nucleospin® RNA (Macherey-
Nagel). 350 μl of RA1 buffer was added to each well of a 12-well plate. Cell
homogenates were transferred to spin columns and processed as according to the
manufacturer’s instructions. Purified RNA was quantified using the NanoDrop 1000
spectrophotometer (Thermo Fisher Scientific). A total of 1 μg of RNA was converted
to cDNA using High capacity cDNA Reverse Transcription Kit (Applied Biosystems).
For 1 reaction, the following were mixed, 2 μl 10X RT buffer, 0.8 μl 25X dNTP mix
(100 mM), 2 μl 10X RT random primers, 1 μl MultiscribeTM reverse transcriptase. The
mixture was topped up with respective amount of nuclease-free water to 20 μl. The
protocol is as follows: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min and 4 °C
forever.
![Page 69: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/69.jpg)
41
2.3.2 Quantitative real-time PCR (RT-QPCR)
RT-QPCR was performed on the CFX384 Touch™ Real-Time PCR Detection System
with iTaq™ Universal SYBR® Green Supermix (Bio-Rad). For one RT-QPCR
reaction, the following reagents were mixed, 5 μl SYBR Green Supermix, 300 nM FW
primer, 300 nM RV primer, 1.9 μl nuclease-free water, 2.5 μl cDNA (2.5 ng/μl) to a
final volume of 10 μl. The samples were loaded in duplicate on a 384-well plate
(Applied Biosystems). The thermal cycling condition was as follows: 95 °C for 3 min,
9 °C for 5 s, 60 °C for 30 s, repeated for 40 cycles and then 65 °C for 30 s, 65 °C for 5
s and 4 °C forever. Fold changes were normalized to β-actin gene expression and are
based on relative expression values calculated using the 2-ΔΔC(T) method. RT-QPCR
primers were designed to span exon-exon junction, wherever possible, using Primer-
BLAST (NCBI). Sequences of primers are listed in Tables 4 and 7.
This is the list of steps to design the primers for RT-QPCR.
1. Obtain accession number for gene of interest from NCBI website
2. US database: http://www.ncbi.nlm.nih.gov/
3. Search for ‘species name’ + ‘gene of interest’
4. Accession number starting with NM, look for those with mRNA
5. Go to Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/)
6. Enter accession number
7. qPCR product size: 100-200 bp (minimum 75 bp; maximum ~300 bp)
Tm: 64 °C (min); 65 °C (opt); 66 °C (max)
[*this is to ensure that the Tm of the 2 primers is not too far apart]
Default Tm difference is 2 °C
TA: ~60 °C for universal RT-QPCR reactions
8. For ‘Exon junction span’, choose ‘Primer must span an exon-exon
junction’.
9. Select intron inclusion.
10. Extension time of 30 s should be insufficient to amplify 1000 bp intronic
sequence
11. If result shows no suitable primers, remove the two criteria from the search
12. Enter the correct species (Depends on type of cells)
Get Primers
![Page 70: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/70.jpg)
42
13. From the result list of the primers, choose 1 pair of primer, take note of the
following:
Product length
14. Exon junction
Check ‘Products on intended target’ to make sure the primers amplify the
gene of interest
15. Ensure that there is NO other different target genes under ‘Products on
potentially unintended templates’
gDNA contains both exons and introns. As for our qPCR experiments, we extracted
the mRNA and converted it to cDNA. Hence, the cDNA only contains the exons
(coding region). No gDNA was detected as gDNA was degraded using on-column
DNAse I.
2.3.3 Protein BCA assay
Cells were washed with PBS and treated with Trypsin for 5 min at 37 °C. Dislodged
cells were neutralized with MEF media and centrifuged at 1500 rpm for 5 min to
obtain the cell pellet. Cell pellet was washed with PBS and centrifuged at 1500 rpm.
The cell pellet was lysed in M-PER mammalian protein extraction reagent (Thermo
Fisher Scientific) in the presence of protease and phosphatase inhibitors (Sigma).
Protein lysates were then quantified using BCA assay kit (Thermo Fisher Scientific).
2.3.4 SDS-PAGE and Western blot
Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was
performed using the Mini-PROTEAN Tetra Cell system (Bio-Rad) at 150 V for 1 h.
40 µg of proteins were then transferred to PVDF membranes (Bio-Rad) at 100 V for 1
h. The blots were then blocked for 1 h in 5 % milk (Anlene non-fat milk) and probed
with the respective primary antibodies and secondary antibodies. Primary antibodies
used in this study: Mouse monoclonal anti-β-actin (1:10000 Sigma, A5541), Rabbit
polyclonal anti-BAX (1:1000, Cell Signaling Technologies, #2772S), Rabbit
![Page 71: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/71.jpg)
43
polyclonal anti-BAK (1:1000, Cell Signaling Technology, #3814S), Rabbit polyclonal
anti-BCL-xL (1:1000, Cell Signaling Technology #2762S), Rabbit polyclonal anti-
BCL2 (1:1000, Cell Signaling Technology #2876), Rabbit polyclonal anti-BIM
(1:1000, Cell Signaling Technology #2819S), Rabbit polyclonal anti-Caspase 3
(1:1000, Cell Signaling Technology, #9662S), Rabbit polyclonal anti-MCL1 (1:1000,
Cell Signaling Technology, #4572), Rabbit polyclonal anti-PUMA (1:1000, Cell
Signaling Technology #4976). Secondary used in this study: Goat anti-rabbit IgG HRP
(1:10000, Santa Cruz, sc-2004), Goat anti-mouse IgG HRP (1:10000, Santa Cruz, sc-
2005). Chemiluminescent signals were detected using Super SignalTM West Dura
Extended Duration substrate (Thermo Fisher Scientific). More information on
antibodies used are in Table 1.
2.3.5 Immunostaining
At the end of each differentiation time-point, cells on coverslips (Marienfeld) were
washed with DPBS and fixed with 4 % paraformaldehyde for 20 min at room
temperature. Cells were blocked with DPBS containing 5 % donkey serum and 0.1 %
Triton X-100 at 4 °C for 1 h before overnight incubation with primary antibodies at 4
°C. Primary antibodies used in this study: Rabbit monoclonal anti-BCL-xL (1:1000,
Abcam, Ab178844), Rabbit monoclonal anti-BCL2 (1:150, Abcam, Ab182858),
Mouse monoclonal anti-BAK (1:1000, Abcam, Ab104124), Mouse monoclonal anti-
GATA4 (1:1000, Thermo Fisher Scientific, MA5-15532), Goat polyclonal anti-
HNF1B (1:100, Abcam, Ab59118), Rabbit monoclonal anti-HNF4α (1:1000, Cell
Signaling Technology #3113), Goat polyclonal anti-PDX1 (1:20, R&D Systems,
Af2419), Rabbit polyclonal anti-Caspase 3 (1:200, Abcam, Ab13847), Cells were
incubated in the dark with secondary antibodies diluted in DPBS containing 0.1 %
Triton X-100 for 1 h at 4 °C before staining with DAPI (Sigma) for 20 min at 4 °C.
![Page 72: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/72.jpg)
44
Secondary antibodies used in this study: Alex Fluor Plus 647 Donkey Anti-Mouse IgG
(H+L) (1:500, Invitrogen, Ab32787), Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)
(1:500, Invitrogen, A21206), Alexa Fluor 488 Donkey Anti-Goat IgG (H+L) (1:500,
Thermo Fisher Scientific, A11055), Alex Fluor 488 Donkey Anti-Mouse (H+L)
(1:500, Thermo Fisher Scientific, A21202). The coverslips were mounted onto
SuperFrost Plus™ Adhesion slides (Thermo Fisher Scientific) using DAKO mounting
medium (DAKO). Confocal images were acquired with the Olympus FV1000 inverted
confocal microscope using the Olympus Fluoview v3.1 software. Brightfield images
were acquired with the Axiovert 200M inverted microscope using the Axiovision LE
software version 4.8.2. More information on antibodies used are in Table 1.
2.3.6 Fluorescence-activated cell sorting (FACS)
Differentiated cells were harvested using a cell scraper and dissociated into single cells
following incubation with Trypsin/EDTA at 37 °C. Single cells were collected by
passing the suspension through a 40 µm cell strainer. Cells were pelleted by
centrifugation at 1200 rpm for 5 minutes. Supernatant was aspirated and cells were
washed with DPBS, followed by fixation with 4 % paraformaldehyde on ice for 1 h.
Fixed cells were washed with DPBS before blocking in FACS buffer (5 % FBS in
DPBS) containing 0.1 % Triton X-100 on ice for 1 h. Cells were incubated with
primary antibodies for 1 h at 4 °C and washed with FACS buffer containing 0.1 %
Triton X-100 prior to addition of secondary antibodies. Cells were incubated with
secondary antibodies in the dark for 1 h at 4 °C. After washing, cells were resuspended
in FACS buffer before analysis using the BDTM LSR II Flow Cytometer. Data analysis
was performed using the FlowJo 7.0 software.
![Page 73: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/73.jpg)
45
2.3.7 Subcloning of plasmids
Plasmids containing the various BIM gene isoforms (BIML, BIMEL and BIMγ) were
kind gifts from our collaborator Dr Ong Sin Tiong at Duke-NUS. Forward and reverse
primers containing NheI (GCTAGC) and XhoI (CTCGAG) restriction sites were
designed. PCR was performed using Phusion High-Fidelity DNA Polymerase. The
relevant bands were excised from the gels and subcloned into pCDH-CMV-MCS-
EF1a lentiviral vector.
For subcloning of BCL-xL and SFRP5, forward and reverse primers containing NheI
(GCTAGC) and XhoI (CTCGAG) restriction sites were designed. BCL-xL and SFRP5
were amplified through PCR using Phusion High-Fidelity DNA Polymerase. BCL-xL
and SFRP5 band were excised from the gel and subcloned into pCDH-CMV-MCS-
EF1a lentiviral vector.
2.3.8 Transfection/ Overexpression rescue studies
HEK293FT/MIN6 cells were seeded onto 6 cm plates and rested overnight. For each
reaction, two tubes were prepared, one tube containing 8 µg of plasmid DNA, 500 μl
of Opti-MEM were mixed together and the other tube containing 20 μl of
Lipofectamine 2000 and 500 μl of Opti-MEM. The reaction was incubated for 20 min
and then added drop-wise onto the cells. The cells were incubated for 48 h and
harvested for protein analysis by SDS-page/Western blot.
hPSC were differentiated to D6 using the 17D protocol and trypsinized into single
cells. The cell solution was neutralized with 5 ml of MEF medium and centrifuged at
1500 rpm for 5 min to obtain the cell pellet. The cell pellet was resuspended in D5
media and 400,000 cells were seeded onto a 12-well plate and incubated overnight. On
![Page 74: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/74.jpg)
46
D7, cells were transduced with shRNA targeting BCL-xL into each well at MOI 200.
The cells were then transfected with 1.6 µg of BCL-xL and incubated for 48 h and
harvested for RT-QPCR analysis.
2.4 ER stressors, cytokines and inhibitor assays
2.4.1 ER stressors and cytokines
All of the human cytokines (IFN-γ, TNF-α, IL-1β) were obtained from
Genomax/Biolegend. They were reconstituted in RNAse-free water and diluted to 1
mg/ml and stored at -80 °C. They were all used at 50 ng/ml in the experiments.
2.4.2 Chemical inhibitor
H9 cells were differentiated using 17D differentiation protocol to D7 and treated with
10 μM of WEHI-539 (ApexBio), inhibitor of BCL-xL. On D8, the cells were
harvested for RT-QPCR, protein analysis and immunostaining.
2.5 Lentiviral-mediated knockdown using shRNAs
shRNAs targeting BCL-xL (Sigma Construct: shRNA TRCN0000033500 and
TRCN0000033501) and SFPR5 (Sigma Construct: shRNA TRCN0000014495 and
TRCN0000429117) were cloned into pLKO.1 vector. Plasmids were extracted using
NucleoBond® Xtra Midi (Macherey-Nagel). The plasmids were packaged into virus
using HEK293FT cells. Media was changed after 24 h after transfection and left to
incubate. Media was collected at 48 and 72 h and pooled. The lentivirus in the
collected media was concentrated using ultra-clear tubes (Beckman Coulter) and
placed in SW28 Ti swinging-bucket aluminium rotor (Beckman Coulter). The SW28
![Page 75: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/75.jpg)
47
swinging-bucket rotor was loaded in Optima L-100 XP ultracentrifuge (Beckman
Coulter) and centrifuged at 23,000 rpm for 1.5 h at 4 °C. 500 µl of DMEM media was
used to resuspend the pellet and the suspension was frozen at -80 °C. hPSC were
differentiated to D6, trypsinized into single cells and re-plated at 400,000 cells per
well in a 12-well plate. On D7, the single cells were transduced with the lentivirus
with a MOI of 200 in 5 μg/ml polybrene (Millipore) for 24 h. The medium were then
changed to normal differentiation media and left to grow for an additional 48 h.
2.6 Lentiviral-mediated overexpression of BIM isoforms
pCDH-CMV-MCS-EF1a vector was obtained from System Biosciences and modified
to include FLAG and V5 tag. The respective BIM isoforms (L, EL, γ) were then
cloned into the vector using NheI and XhoI (New England Biolabs). The constructs
were transfected with viral packing plasmids (pHDM-tat, pRC/CMV-rev, pHDM-
HIVgpm, pHDM-G) into HEK293FT cells using calcium chloride transfection
method.
Media was changed after 24 h after transfection and left to incubate. Media was
collected at 48 and 72 h and pooled. The lentivirus in the collected media was
concentrated using ultra-clear tubes (Beckman Coulter) and placed in SW28 Ti
swinging-bucket aluminium rotor (Beckman Coulter). The SW28 swinging-bucket
rotor was loaded in Optima L-100 XP ultracentrifuge (Beckman Coulter) at
centrifuged at 23,000 rpm for 1.5 h at 4 °C. 500 µl of DMEM media was used to
resuspend the pellet and the suspension was frozen at -80 °C. The lentiviruses were
titer and used at MOI 200 on human islets.
![Page 76: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/76.jpg)
48
2.7 Seahorse metabolic flux assay
hPSC were differentiated to D7 using the 17D differentiation protocol and treated with
DMSO or WEHI-539 (Apexbio) for 24 h. D8 cells were then trypsinized and 150,000
cells plated per well on Seahorse XF96 cell culture microplates (Agilent). Growth
media was changed to Seahorse XF Base Medium (Agilent) supplemented with L-
Glutamine (Sigma) and placed in a non-CO2 incubator 1 h prior to assay. Glycolysis
was measured via the Seahorse XF Glycolysis Stress Test Kit (Agilent) with a
Seahorse XF 96 analyzer (Agilent) following the manufacturer’s protocol. Using the
same setup, oxidative phosphorylation was measured using Seahorse XF Mito Stress
Kit (Agilent).
2.8 RNA-Seq and differential expression analysis
Poly-A mRNA was enriched from 1 µg of total RNA with oligo-dT beads
(Invitrogen). Up to 100 ng of poly-A mRNA recovered was used to construct
multiplexed strand-specific RNA-seq libraries as per manufacturer’s instruction
(NEXTflexTM Rapid Directional RNA-SEQ Kit, dUTP-Based, v2). Individual library
quality was assessed with an Agilent 2100 Bioanalyzer and quantified with a QuBit
2.0 fluorometer before pooling for sequencing on a HiSeq 2000 (1 x 101 bp read). The
pooled libraries were quantified using the KAPA quantification kit (KAPA
Biosystems) prior to cluster formation. Adapter sequences and low quality bases in
Fastq read sequences were trimmed using Trimmomatic (v.0.33) (parameters:
LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). The quality
filtered Fastq sequence reads were then aligned to the human genome (hg19) using
Tophat (v.2.0.14) (parameters: --no-coverage-search --library-type=fr-firststrand) and
annotated with Ensembl gene IDs. The resulting bam files were used to generate
![Page 77: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/77.jpg)
49
feature read counts using the Python package-based htseq-count of HTSeq (v.0.6.1p1)
(parameters: default union-counting mode, --stranded=reverse). The read count matrix
output from HTSeq was used to perform differential expression analysis using the
edgeR package (available in R (v.3.1.3)) in both ‘classic’ and generalized linear model
(glm) modes to contrast patient versus control. Procedures described in edgeR
documentation were followed to calculate P-values, FDR adjusted p-values (q-values)
and fold-changes. A false discovery rate (FDR) cutoff of 0.05 was used to filter
significantly differentially expressed genes. These genes with Ensembl IDs were
mapped to gene symbols. The RNA-Seq and differential expression analysis were
performed in collaborations with Dr Shawn Hoon and Dr Vidhya (IMCB Molecular
Engineering laboratory), Dr Choi Hyun Won, and Soumita (IMCB Computational and
Statistical Systems Biology laboratory).
2.9 Quantification and statistical analysis
All assays were repeated at least twice. Statistical parameters for each experiment,
including values of replicates and statistical significance, can be found in the figure
legends. All statistical analyses were performed using Student’s t-test (2-sided; equal
variance). P values of less than 0.05 were considered significant.
2.10 Data and software availability
The accession number for RNA-Seq data reported in this paper is GEO: GSE136064
![Page 78: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/78.jpg)
50
Primers for cloning, RT-QPCR and knockdown studies
All primers were ordered from IDT Technologies at a concentration of 100 µM.
Table 5: List of human primers used for RT-QPCR
Gene
Usage Accession
Number Sequence
ALDOC RT-
QPCR
NM_005165.2 FW 5’ ACCCGAGCTGTGCTTGTGGC 3’
RV 5’ TTGGCCATGCTGCCTACAGACTC
3’
ATF4 RT-
QPCR
NM_00195.4 FW 5’ CGACCAGTCGGGTTTGGGGG 3’
RV 5’ CGGAGAAGGCATCCTCCTTGCT
3’
ATF6 RT-
QPCR
NM_007348.4 FW 5’
TCTTCAGGGTGCTCTGGAACAGG 3’
RV 5’ CTCCCCTTCTGCGGATGGCT 3’
β-ACTIN RT-
QPCR
NM_001101.5 FW 5’ TTGCCGATCCGCCGCCCGTC 3’
RV 5’
CCCATGCCCACCATCACGCCCTGG 3’
BAD RT-
QPCR
NM_004322.3 FW 5’ CGAGATCGGGCTTGGGGTGAG
3’
RV 5’ CTGGGCCCTCATCTGTCTGCC 3’
BAK RT-
QPCR
NM_001188.4 FW 5’ GATCCCGGCAGGCTGATCCC 3’
RV 5’ TCCTGTTCCTGCTGATGGCGG 3’
BAX RT-
QPCR
NM_00129142
8.1
FW 5’ GCCGGGTTGTCGCCCTTTTC 3’
RV 5’ GCAGCCCCCAACCACCCTG 3’
BCL-xL RT-
QPCR
NM_00131791
9.1
FW 5’ GGAGAACGGCGGCTGGGATA 3’
RV 5’ GGCCACAGTCATGCCCGTCA 3’
BCL2 RT-
QPCR
NM_000633.2 FW 5’ AGGCTGGGATGCCTTTGTGGAA
3’
RV 5’ CAAGCTCCCACCAGGGCCAAA
3’
BID RT-
QPCR
NM_197966.2 FW 5’ GGGTAGTCGACCGTGTCCGC 3’
RV 5’
GCTGGAACCGTTGTTGACCTCAC 3’
BIM RT-
QPCR
NM_138621.5 FW 5’ GCAATGGCTTCCATGAGGCAGG
3’
RV 5’ GTGGGTGGTCTTCGGCTGCT 3’
CHOP10
(DDIT3)
RT-
QPCR
NM_00119505
3.1
FW 5’ AGCACCTCCCAGAGCCCTCA 3’
RV 5’ CATGCGCTGCTTTCCAGCCC 3’
ENO2 RT-
QPCR
NM_001975.3 FW 5’ CATTGCTCAGCTGGCCGGGA 3’
RV 5’ GCTTGCACGCTTGGATGGCTT 3’
FOXA1 RT-
QPCR
NM_004496.4 FW 5’
AGCTACTACGCAGACACGCAGG 3’
![Page 79: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/79.jpg)
51
RV 5’ TGTTGCCGCTCGTAGTCATGGT
3’
GATA4 RT-
QPCR
NM_00130809
3.1
FW 5’
GCAGAGAGTGTGTCAACTGTGGGG 3’
RV 5’ TGGGGACCCCGTGGAGCTT 3’
GATA6 RT-
QPCR
NM_005257.5 FW 5’ GCCCCTCATCAAGCCGCAGA 3’
RV 5’ CAAGTGGTCTGGGCACCCCAT 3’
HHEX RT-
QPCR
NM_002729.5 FW 5’ ACACGCACGCCCTGCTCCGC 3’
RV 5’
TGGCCAGACGCTTCCTCTCGGGC 3’
HK2 RT-
QPCR
NM_000189.4 FW 5’ GGCACCCAGCTGTTTGACCAC 3’
RV 5’ AGCCACAACGTCTCTGCCTTCC
3’
HLXB9 RT-
QPCR
NM_005515.4 FW 5’ GCGTCCACCGCGGGCATGATCC
3’
RV 5’ AAGCGCTTGGGCCGCGACAGG
3’
HNF1A RT-
QPCR
NM_00130617
9.1
FW 5’
CTTCTGCAGGAGGACCCGTGGCGT 3’
RV 5’ GGCGGCCCGCTTCTGCGTCT 3’
HNF1B RT-
QPCR
NM_000458.4 FW 5’ GGGGCCCGCGTCCCAGCAAA 3’
RV 5’ GGCCGTGGGCTTTGGAGGGGG
3’
HNF4A RT-
QPCR
NM_178849.2 FW 5’
GGACGACCAGGTGGCCCTGCTCAGA
3’
RV 5’ GCTCCGGGCAGTGCCGAGGGA
3’
IRE1A RT-
QPCR
NM_001433.5 FW 5’ CCATGCCGCCGAGATGTCCT 3’
RV 5’
GTTGGTGGTTCACGACGAATCTGC 3’
MCL1 RT-
QPCR
NM_021960.5 FW 5’ AGGGCGACTTTTGGCCACCG 3’
RV 5’ TGCCTTGGAAGGCCGTCTCG 3’
NANOG RT-
QPCR
NM_024865.4 FW 5’ GACCTGGTGCACCCAATCCT 3’
RV 5’ TCCAAGGCAGCCTCCAAGTC 3’
NOXA RT-
QPCR
NM_021127.2 FW 5’
CCAGCAGAGCTGGAAGTCGAGTG 3’
RV 5’
TGCAGTCAGGTTCCTGAGCAGAAG 3’
OCT4 RT-
QPCR
NM_002701.6 FW 5’ CCCCGGAGCCCTGCACCGTCA
3’
RV 5’
CCCCCAGGGTGAGCCCCACATCG 3’
PAX6 RT-
QPCR
NM_000280.4 FW 5’ CCCACCACACCGGTTTCCTCC 3’
RV 5’ GGTGGGCAGCATGCAGGAGT 3’
PDX1 RT-
QPCR
NM_000209.4 FW 5’ CCTTCCCGGAGGGAGCCGAGCC
3’
RV 5’ GTAGGCCGTGCGCGTCCGCT 3’
![Page 80: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/80.jpg)
52
PERK RT-
QPCR
NM_004836.6 FW 5’ GACCGCGCGGCAGGTCATTA 3’
RV 5’ TCCCACTGGAAGAGGGCTCCA
3’
PUMA RT-
QPCR
NM_00112724
0.2
FW 5’ CCAGATTTGTGGTCCTCAGCCCT
3’
RV 5’ TTGAGGTCGTCCGCCATCCG 3’
RFX6 RT-
QPCR
NM_173560.4 FW 5’ GCGGCTTGGAACAAGAGGCCA
3’
RV
5‘ACGAGTGAAGCCACCCTCATTCTTT
3’
SFRP1 RT-
QPCR
NM_003012.5 FW 5’ GACCGGCCCATCTACCCGTG 3’
RV 5’ CACACCGTTGTGCCTTGGGG 3’
SFRP2 RT-
QPCR
NM_003013.3 FW 5’ CAGCCACCGAGGAAGCTCCA 3’
RV 5’ TCGGACACACCGTTCAGCTTGT
3’
SFRP4 RT-
QPCR
NM_003014.4 FW 5’ GCCATCGTCACGGACCTCCC 3’
RV 5’ CACCGATCGGGGCTTAGGCG 3’
SFRP5 RT-
QPCR
NM_003015.3 FW 5’
CGCCTCCAGTGACCAAGATCTGC 3’
RV 5’ GTGTCCTTGCGCTTCAGGGGG 3’
SOX2 RT-
QPCR
NM_003106.4 FW 5’ GACGGAGCTGAAGCCGCCGGG
3’
RV 5’ CGCTGCCCGCGGGACCACAC 3’
SOX9 RT-
QPCR
NM_000346.4 FW 5’ ACCAGCCGCGGCGGAGGAAGT
3’
RV 5’ GGGATTGCCCCGAGTGCTCGCC
3’
SOX17 RT-
QPCR
NM_022454.4 FW 5’ GGCGAGGCGCCGGCGAACAG 3’
RV 5’
TCAGCGCCTTCCACGACTTGCCCAG 3’
SXBP1 RT-
QPCR
NM_00107953
9.1
FW 5’
AGTGAGCTGGAACAGCAAGTGGT 3’
RV 5’ TCATTCCCCTTGGCTTCCGCC 3’
WNT2B RT-
QPCR
NM_024494.2 FW 5’ ATGCTGAGACCGGGTGGTGC 3’
RV 5’
AATGTACCACCAGGACGTGTCTACG 3’
WNT5A RT-
QPCR
NM_003392.4 FW 5’ GCTCGCTCGGGTGGCGA 3’
RV 5’
CCTAGCGACCACCAAGAATTGGCT 3’
WNT5B RT-
QPCR
NM_032642.2 FW 5’ CTGGAGCCTGATGGACGGGTG
3’
RV 5’
AGCTAATGACCACCAGGAGTTGGC 3’
WNT7B RT-
QPCR
NM_058238.2 FW 5’ ACGTGAAGCTCGGAGCACTGT
3’
RV 5’ AGCGTCCGAAGCGGAACTGG 3’
![Page 81: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/81.jpg)
53
WNT8B RT-
QPCR
NM_003393.3 FW 5’ GCTTCGCAGTGCCAATCGGG 3’
RV 5’ TTGCCCGTTGCGGGAGTCAT 3’
XBP1 RT-
QPCR
NM_005080.3 FW 5’
AGTGAGCTGGAACAGCAAGTGGT 3’
RV 5’ TCATTCCCCTTGGCTTCCGCC 3’
Table 6: List of human primers used for short hairpin (shRNA) cloning
Gene
Usage Accession
Number Sequence
shBCL-
xL-1
RNAi NA FW 5’
CCGGGTGGAACTCTATGGGAACAAT
CTCGAGATTGTTCCCATAGAGTTCCA
CTTTTTG 3’
RV 5’
AATTCAAAAAGTGGAACTCTATGGG
AACAATCTCGAGATTGTTCCCATAGA
GTTCCAC 3’
shBCL-
xL-2
RNAi NA FW 5’
CCGGGCTCACTCTTCAGTCGGAAATC
TCGAGATTTCCGACTGAAGAGTGAGC
TTTTTG 3’
RV 5’
AATTCAAAAAGCTCACTCTTCAGTCG
GAAATCTCGAGATTTCCGACTGAAGA
GTGAGC 3’
shSFRP5
-1
RNAi NA FW 5’
CCGGCCACTCGGATACGCAGGTCTTC
TCGAGAAGACCTGCGTATCCGAGTG
GTTTTT 3’
RV 5’
AATTAAAAACCACTCGGATACGCAG
GTCTTCTCGAGAAGACCTGCGTATCC
GAGTGG 3’
shSFRP5
-2
RNAi NA FW 5’
CCGGTGCTCCCTCTACTACCCTTTCCT
CGAGGAAAGGGTAGTAGAGGGAGCA
TTTTTTG 3’
RV 5’
AATTCAAAAAATGCTCCCTCTACTAC
CCTTTCCTCGAGGAAAGGGTAGTAGA
GGGAGCA 3’
![Page 82: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/82.jpg)
54
Table 7: List of human primers used for cloning and overexpression
Gene
Usage Accession
Number Sequence
BCL-xL OE NM_138578.3 FW 5’
GCGGCGGCTAGCATGTCTCAGAGCAA
CCGGGAG 3’
RV 5’ CGCCGCCTCGAGTCATT
TCCGACTGAAGAGTGAGCCC 3’
BIML OE NM_006538.5 FW 5’ GCG
GCGGCTAGCATGGCAAAGCAACCTTC
TGATG 3’
RV 5’
CGCCGCCTCGAGTCAATGCATTCTCC
ACACCAGG 3’
BIMEL OE NM_138621.5 FW 5’ GCG
GCGGCTAGCATGGCAAAGCAACCTTC
TGATG 3’
RV 5’ CGC CGCCTC
GAGTCAATGCATTCTCCACACCAGG 3’
BIMγ OE NM_207002.3 FW 5’ GCG
GCGGCTAGCTAGTCATCCTAGAGGAT
ATAGGT 3’
RV 5’
CGCCGCCTCGAGTGAGAAATCCTTGT
GGTTGAGTT 3’
Table 8: List of mouse primers used for RT-QPCR
Gene
Usage Accession
Number Sequence
Bim RT-
QPCR
NM_207680.
2
FW 5’
CAGTGCAATGGCTTCCATACGACAG 3’
RV 5’ GAGGGTGGTCTTCAGCCTCGC 3’
Bax RT-
QPCR
NM_007527.
3
FW 5’ GATCCAAGACCAGGGTGGCTGG
3’
RV 5’ TGAGCGAGGCGGTGAGGACT 3’
Bak RT-
QPCR
NM_007523.
3
FW 5’ CACGGCTGAGCCATCCCACA 3’
RV 5’ TGCTGTTCAGAAGGGGACGGG
3’
Bad RT-
QPCR
NM_007522.
3
FW 5’
ACCAGCAGCCCAGAGTATGTTCCA 3’
RV 5’ GTCCCCGCTGGGTACGAACTG 3’
![Page 83: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/83.jpg)
55
Puma RT-
QPCR
NM_133234.
2
FW 5’ CCCTCCAGAAGGCAACCGCC 3’
RV 5’ TCGCGGGCTAGACCCTCTACG 3’
Noxa RT-
QPCR
NM_021451.
2
FW 5’ CACGTGGAGTGCACCGGACA 3’
RV 5’ CCTTCAAGTCTGCTGGCACCCG
3’
Bid RT-
QPCR
NM_007544.
4
FW 5’ TGGTTGTAGAGCACAGCTGCCA
3’
RV 5’ GGCTCGTGCTGACGATCCCA 3’
Bcl2 RT-
QPCR
NM_009741.
5
FW 5’ TGGGGTGAACTGGGGGAGGAT
3’
RV 5’ GTTCCACAAAGGCATCCCAGCC
3’
Mcl1 RT-
QPCR
NM_008562.
3
FW 5’ AGGCTGGGATGGGTTTGTGGAG
3’
RV 5’
GTCCCCTATTGCACTCACAAGGCT 3’
Bcl-xl RT-
QPCR
NM_001289
716.1
FW 5’ ACGGCGGCTGGGACACTTTT 3’
RV 5’ ATGCCCGTCAGGAACCAGCG 3’
Perk RT-
QPCR
NM_010121.
3
FW 5’ CAGGCAGCGGAAGGAGTCTGAA
3’
RV 5’ CTCCCGTGCCAACTCCCTGTT 3’
Atf4 RT-
QPCR
NM_009716.
3
FW 5’ TCTGCTTGCTGTCTGCCGGTT 3’
RV 5’ CGTGAAGAGCGCCATGGCTTAG
3’
Atf6 RT-
QPCR
NM_001081
304.1
FW 5’
TCTCCAGGGTGCTCTGGAACAGG 3’
RV 5’
ACACTTGCAGCTCACTCCCAGAAT 3’
Ire1a
(Ern1)
RT-
QPCR
NM_023913.
2
FW 5’ GGCCTCCCCATGCCGAAGTT 3’
RV 5’
GGTGATGGTGTATTCTGTCCGTCCA 3’
Chop-
10
(Ddit3)
RT-
QPCR
NM_007837.
4
FW 5’
CCGGAACCTGAGGAGAGAGAACCT 3’
RV 5’
AGGTGCCCCCAATTTCATCTGAGG 3’
sxbp1 RT-
QPCR
NM_005080.
3
FW 5’
AGTGAGCTGGAACAGCAAGTGGT 3’
RV 5’ TCATTCCCCTTGGCTTCCGCC 3’
![Page 84: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/84.jpg)
56
Table 9: Generation of pancreatic progenitors (17D protocol)
D0 Activin A 100 ng/ml + CHIR 3 μM + LY 10 μM
D3 Activin A 50 ng/ml
D5 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM
D7 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM
D10 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM + DAPT 20 μM
D12 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM + DAPT 20 μM
D14 FGF2 50 ng/ml + Nic 10 mM + DAPT 20 μM
D17 Harvest
Table 10: Generation of pancreatic β-like cells (35D protocol)
D-2 Split cells
D0 Activin 100 ng/ml + CHIR 3 μM hPSC
Harvest
D1 Activin 100 ng/ml
D3 FGF7 50 ng/ml DE
D5 FGF7 50 ng/ml
D6 FGF7 50 ng/ml + RA 2 μM + Sant1 0.25 μM + PDBu 500
nM + LDN 200 nM PGT
D7 FGF7 50 ng/ml + RA 2 μM + Sant1 0.25 μM + PDBu 500
nM
D8 FGF7 50 ng/ml + RA 100 nM + Sant1 0.25 μM PP1
D10 FGF7 50 ng/ml + RA 100 nM + Sant1 0.25 μM
D12 FGF7 50 ng/ml + RA 100 nM + Sant1 0.25 μM
D13 RA 100 nM + Sant1 0.25 μM + XXI 1 µM + Alk5iII 10 μM
+ T3 1 μM + Betacellulin 20 ng/ml
PP2
Harvest
![Page 85: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/85.jpg)
57
D15 RA 100 nM + Sant1 0.25 μM + XXI 1 μM + Alk5iII 10 μM
+ T3 1 μM + Betacellulin 20 ng/ml
D17 RA 25 nM + XXI 1 μM + Alk5iII 10 μM + T3 1 μM +
Betacellulin 20 ng/ml
D19 RA 25 nM + XXI 1 μM + Alk5iII 10 μM + T3 1 μM +
Betacellulin 20 ng/ml
D20 Alk5iII 10 μM + T3 1 μM EN
Harvest
D22 Alk5iII 10 μM + T3 1 μM
D24 Alk5iII 10 μM + T3 1 μM
D28 Alk5iII 10 μM + T3 1 μM SC-β
Harvest
D30 Alk5iII 10 μM + T3 1 μM
D32 Alk5iII 10 μM + T3 1 μM
D34 Alk5iII 10 μM + T3 1 μM
D35 SC-β Harvest
Table 11: Molecular weight of BIM isoforms
Name Native isoforms V5 + 3X Flag Overexpressed
isoforms
BIMEL 23 kDa 3 kDa 26 kDa
BIML 15 kDa 3 kDa 18 kDa
BIMγ NA 3 kDa 16 kDa
![Page 86: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/86.jpg)
58
3 Results
3.1 Differentiation of human pluripotent stem cells into pancreatic cells as a
model of human pancreatic development in vitro
In this project, I am investigating the dynamics of pro- and anti-apoptotic proteins
during pancreatic lineage differentiation. I am specifically interested in the Bcl-2
family members which have been shown to be able to contribute to apoptosis in
various cell types (Adams and Cory, 1998, Huang and Strasser, 2000, Gross et al.,
1999, Youle and Strasser, 2008). Through understanding the identity of the BCL-2
members, I hope to make modifications to the in-vitro differentiation protocol which
could possibly lead to higher efficiency of generation of pancreatic progenitors.
3.1.1 Morphology and transcriptional profile of pancreatic genes during 17D
differentiation
I am using a 17 day (17D) protocol that allows us to generate early pancreatic
progenitors from hPSC (Teo et al., 2015b) (Fig 7A). I harvested the cells at different
time-points D0, 3, 5, 7, 10, 12, 14 and 17 and evaluated the different pancreatic
progenitor transcripts by using RT-QPCR. The rationale of this experimental approach
is to give us a deeper insight into the transcript expression dynamics of pancreatic
genes during the differentiation from hPSC to pancreatic progenitors. The spherical
morphology of the hPSC was observed at D0. As differentiation proceeded, the hPSC
started to lose its spherical morphology. As definitive endoderm starts to form, I
observed a monolayer and cobblestone morphology with extensive cell migration out
of the colonies. Towards the end of the differentiation at D17, I observed patches of
cells with pancreatic progenitor morphology at 4X and 125X magnification (Fig 7B).
![Page 87: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/87.jpg)
59
The transcription expression level of OCT4, SOX2 and NANOG were high and sharply
decreased as the differentiation towards pancreatic progenitors began (Fig 7C).
At D0, the expression level of SOX17 and FOXA2 is low but is increased on D3 when
definitive endoderm cells are formed (Fig 7D). At D5, the expression of FOXA2 is
decreased but subsequently increases again from D7 when gut tube derivatives are
being formed. From D10 onwards, SOX17 expression began to decrease until D17.
From D5 to D10, the definitive endoderm differentiates into the posterior foregut and
this is marked by increased expression in several genes such as FOXA1, GATA4,
GATA6 and HNF4A (Fig 7E).
From D10 to D17, the posterior foregut differentiates into early pancreatic progenitors
which are marked by an increased expression of HNF1B, HB9, PAX6, PDX1 and
RFX6 transcripts (Fig 7E). Except for PDX1, all the other transcription factors show a
decrease at D17 due to them having developmental stage-specific expression. Taken
together, these results suggest that I can obtain early pancreatic progenitors in vitro
using this 17D differentiation protocol (Teo et al., 2015b, Teo et al., 2016).
![Page 88: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/88.jpg)
60
A
Figure 7. Morphology and characterisation of hPSC differentiating into pancreatic progenitors
using 17D differentiation protocol. (A) Illustration of the 17D protocol utilising various growth factors
and chemicals to induce hPSC differentiation towards pancreatic progenitor lineage. (B) Morphological
changes of the differentiated cells at each respective time-point. Images were taken at 4X and also
magnified 125X. Scale bar represent 200 µM. (C) Expression profile of pluripotent marker transcripts
during 17D differentiation (D) Expression profile of definitive endoderm transcripts during 17D
differentiation. (E) Expression profile of pancreatic progenitor transcripts during 17D differentiation. A
representative of at least two independent experiments is shown. All error bars indicate SD of three
replicates in an independent experiment.
C D
E
B
![Page 89: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/89.jpg)
61
3.2 Decrease in apoptosis from D5 to D7 during 17D differentiation
As differentiation progresses from D5 to D7, I observed a decrease in the amount of
cell death (Fig 8). This observation was also reported in our subsequent usage of 35D
protocol (Fig 23A) and also in other studies (Wang et al., 2015). However, no further
insights into this decreased cell death were reported. Since the BCL-2 family of genes
are also involved in prosurvival and apoptosis, I hypothesized that the percentage
change in cell death from D5 to D7 is inextricably linked to the BCL-2 family of
genes.
3.3 Changes in BCL-2 family of transcripts during 17D differentiation
3.3.1 Transcriptional profile of BCL-2 family of genes during 17D differentiation
The BCL-2 family is implicated in prosurvival and apoptosis and to our knowledge,
their expression dynamics are relatively unexplored in the field of early pancreas
differentiation. Understanding the expression dynamics of the BCL-2 family allows us
to determine the identity of the various BCL-2 genes which are critical in early
Figure 8. Decrease in apoptosis from D5 to D7. Trypan blue cell count data comparing 8
different timepoints during the 17D differentiation protocol. A representative of at least two
independent experiments is shown. Asterisk (*) indicates P < 0.05 compared to D5 control. All
error bars indicate SD of three replicates in an independent experiment.
![Page 90: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/90.jpg)
62
pancreas differentiation. In doing so, new molecular pathways involving the BCL-2
family could possibly be elucidated, contributing to a deeper understanding of
pancreas development. Hence, I asked the question if there are changes in the BCL-2
family of transcripts during early pancreas differentiation. To determine this, I
differentiated hPSC using the 17D protocol and harvested the cells at each respective
time-point and evaluated several anti-apoptotic and pro-apoptotic transcripts using
RT-QPCR. This gave us an insight into the expression dynamics of the anti-apoptotic
and pro-apoptotic genes during differentiation of hPSC towards the pancreatic lineage.
For pro-apoptotic transcripts, I focused on BAD, BAK, BAX, BID, BIM, NOXA,
PUMA. BAX, BAK, BIM and PUMA showed significant upregulation of at least 2-fold
from D5 to D7 (P < 0.05) (Fig 9A & 9B). Interestingly, anti-apoptotic transcripts BCL-
2, BCL-XL and MCL-1 were also upregulated from D5-D7 (P < 0.05) (Fig 9C). Some
of the transcripts such as BAX and BCL-xL exhibited a decrease between D14 and
D17 whereas BCL2 and BAD did not. This could suggest stage-specific transcript
expression. BID is a BH3 domain only pro-apoptotic member of the BCL2 family. The
active proapoptotic potential of BID is only induced upon its truncation by Casp8 into
tBID. Hence, there might not be any changes in BID transcript expression level.
However, BCL-2 family functions at the protein level, hence, the protein expression
would reflect more accurately on the BCL-2 family members which are involved.
Our results lead us to speculate that the earlier observations of changes in cell death
are linked to the changes in the BCL-2 family of transcripts.
![Page 91: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/91.jpg)
63
3.3.2 Protein profile of BCL-2 family of genes during 17D differentiation
I then evaluated the level of BCL-2 family proteins expression during the 17D
differentiation. I harvested the cells at each respective time-point and examined the
BCL-2 family of protein profile using western blotting.
BIM, MCL-1, PUMA did not show any substantial changes in the protein expression
level during the 17D differentiation (Fig 10A & 10B). BAX is expressed at a low level
Figure 9. Changes in BCL-2 family of transcripts during differentiation into pancreatic
progenitor using 17D differentiation protocol. (A) Expression profile of pro-apoptotic BH3-only
domain BIM and PUMA transcripts during 17D differentiation. (B) Expression profile of
multidomain BAX and BAK transcripts during 17D differentiation. (C) Expression profile of anti-
apoptotic multidomain BCL-xL, BCL2 and MCL1 during 17D differentiation. A representative of at
least three independent experiments is shown. Asterisk (*) indicates P < 0.05 compared to D5
control. All error bars indicate SD of three replicates in an independent experiment.
C A
B
![Page 92: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/92.jpg)
64
on D0 and there is no change in expression level throughout (Fig 10A & 10B).
Interestingly, BCL-xL and BAK showed a highly contrasting trend in terms of protein
expression (Fig 10A & 10B). From D0 to D5, BCL-xL protein is expressed at a low
level. However, as the cells differentiate towards pancreatic progenitors, I detected an
increase in BCL-xL protein expression from D7 onwards to D17. In contrast, BAK
was highly expressed from D0 to D5, but from D7 onwards, BAK protein expression
was downregulated. This contrast in protein expression of BCL-xL and BAK strongly
suggests that they contribute to pancreatic lineage specification.
During apoptosis, BAX and BAK activate and combine into oligomers that result in
MOMP (Korsmeyer et al., 2000, Wei et al., 2000). This allows cytochrome C to
escape into the cytoplasm, instigating the activation of the caspase cascade, ultimately
resulting in cell death (Adams, 2003, Danial and Korsmeyer, 2004, Green and
Kroemer, 2004).
I then evaluated the expression of the final effector cleaved caspase 3. From D5
onwards, the cleaved caspase 3 protein expression was reduced (Fig 10A). This could
be a result of the suppression of BAK by BCL-XL, disabling the BAK apoptotic
mechanism, thereby leading to cell survival. The close association of BAK with BCL-
xL has also been observed in other studies (Willis et al., 2005, Sattler et al., 1997). I
also validated the protein immunoblot data obtained using immunofluorescence
staining. I observed an increased expression of BCL-xL from D3 to D12 whereas
BAK was decreased from D3 to D12 (Fig 10C). Taken together, the evidence propose
that up-regulated BCL-xL and reduced BAK from D7 to D17 may contribute to
reduced cleavage of caspase 3.
![Page 93: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/93.jpg)
65
Figure 10. Anti-apoptotic BCL-XL/BCL2L1 and pro-apoptotic BAK proteins exhibit opposite
trends during pancreatic specification from human pluripotent stem cells. (A) Protein profile of
BCL-2 family of proteins and cleaved caspase 3 during 17D differentiation. (B) Quantification of
the western blot presented in Figure 10A. (C) Immunofluorescence staining showing BCL-xL, BAK
and Cleaved caspase 3 staining on D3 and D12. Scale bars represent 50 μm. A representative of at
least three independent experiments is shown.
B
C
A
![Page 94: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/94.jpg)
66
3.4 BCL-xL protects against apoptosis of pancreatic progenitor
3.4.1 Inhibition of BCL-xL at D7 using WEHI-539 decreases BCL-xL
expression and induces apoptosis in pancreatic progenitors
Next, I asked the question if BCL-xL protects pancreatic progenitors against apoptosis.
To determine if this is the case, I utilized WEHI-539, a highly specific chemical
inhibitor of BCL-xL (Figure 11A). WEHI-539 can inhibit BCL-xL specifically in
many cell types by binding to the hydrophobic groove of BCL-xL (Park et al., 2017,
Pecot et al., 2016, Tan et al., 2018). In this experiment, I differentiated the cells to D7
when the expression of BCL-xL is high and then inhibited BCL-xL using the WEHI-
539 at 10 µM (Fig 11B, 11C).
![Page 95: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/95.jpg)
67
Upon successful inhibition of BCL-xL, I would be able to determine its importance for
pancreatic progenitors’ survival and apoptosis. At the protein level, I observed that
BCL-xL protein was decreased using 1 µM and 10 µM of WEHI-539 (Fig 12A, 12B,
12C, 12D). The decreased BCL-xL protein expression could be an indirect
consequence of WEHI-539 blocking BCL-xL function. I also observed that BCL-2
Figure 11. Effects of WEHI-539 treatment on D7 pancreatic progenitors. (A) Schematics of
experimental layout. For shBCL-xL experiments, please refer to Fig 15B. (B) Morphology of D8
pancreatic progenitors after treatment with 1 μM, 5 μM, 10 μM, 100 μM WEHI-539 for 24 h. Images
were taken at 4X and also magnified 125X. Scale bar represents 200 μm. (C) BCL-2 family of
transcripts expression profile after treatment with WEHI-539 for 24 h.
A
C
B
![Page 96: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/96.jpg)
68
protein expression was increased upon BCL-xL inhibition (Fig 12A & 12B). The
upregulation of BCL-2 suggests that it may be a compensatory mechanism by the cells
to protect against apoptosis. Despite the upregulation of BCL-2 protein, the presence
of cleaved caspase 3 band suggests that BCL-2 protein is unable to protect the cells
against apoptosis (Fig 12A). Hence, our data established that BCL-xL, rather than
BCL-2, plays a more dominant role in maintaining the survival of pancreatic
progenitors.
![Page 97: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/97.jpg)
69
Figure 12. Inhibition of BCL-xL induces apoptosis in pancreatic progenitors. (A) BCL-2 family
of proteins expression profile after treatment with WEHI-539 for 24 h. (B) Repeat of BCL-2 family of
proteins expression profile after treatment with WEHI-539 for 24 h. (C) Quantification of BCL-2
family proteins in Figure 11D. (D) Quantification of second repeat BCL-2 family proteins. A
representative of at least two independent experiments is shown. Asterisk (*) indicates P < 0.05
compared to DMSO control. All error bars indicate SD of three replicates in an independent
experiment.
A
B
C
D
![Page 98: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/98.jpg)
70
3.5 High-throughput RNA-Seq analysis identifies other possible roles
of BCL-xL
Next, I asked the question if there are any molecular phenotype if BCL-xL is inhibited
during pancreatic differentiation. I differentiated the cells to D7 and inhibited BCL-xL
with WEHI-539. I then extracted the RNA and performed RNA-sequencing on the
DMSO control and WEHI-539-treated samples. The global RNA sequencing results
gave us an insight into the differentially expressed genes between DMSO control vs
WEHI-539-treated samples. This would provide us with the important clues of BCL-
xL-inhibition effects in pancreatic progenitors. I showed the PCA plot illustrating the
DMSO-treated samples and WEHI-treated samples localizing in different clusters (Fig
13A), suggesting the dissimilarity between the two populations of samples.
I also found that upon BCL-xL inhibition, certain clusters of genes were differentially
expressed in the global RNA-seq heatmap (Fig 13B), notably the pancreatic and
metabolic genes. These data indicate that apart from its prosurvival role, BCL-xL also
has non-canonical roles such as metabolic regulation in pancreatic progenitors which I
will explore in the subsequent sections in this thesis.
![Page 99: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/99.jpg)
71
3.5.1 Inhibition of BCL-xL decreases pancreatic progenitor transcripts
To further elucidate the other roles of BCL-xL, I generated a volcano plot showing the
differentially expressed genes upon inhibition of BCL-xL (Fig 14A). I then analyzed
the RNA-seq data and generated the heatmap illustrating differential pancreatic gene
expression using a 1.5 fold cutoff in terms of decreased fold change expression (P <
0.05). The heatmap results would subsequently give us an insight into the effects of
BCL-xL inhibition on the pancreatic genes. Upon WEHI-539 treatment on D7, I
observed many pancreatic genes such as RFX6, HHEX, GATA6 and GATA4 that are
downregulated (Fig 14B). I then used RT-QPCR to validate the RNA-seq data. The
majority of the pancreatic genes such as HNF1B, FOXA1, GATA4, GATA6, HNF4A,
HHEX, PDX1 and RFX6 exhibited a decrease in transcript expression when the cells
were treated with 10 µM WEHI-539 (P < 0.05) (Fig 14C). One interesting observation
is that PAX6 showed an increase in transcript expression when BCL-xL was inhibited.
B
A
Figure 13. RNA-Seq analysis showing groups of differentially expressed genes upon WEHI-
539 treatment. (A) Principal Component Analysis (PCA) plot showing the clustering of the
DMSO vs WEHI-539 treated samples. (B) Global heatmap showing the differential heatmap
expression when D7 pancreatic progenitors were treated with WEHI-539. Two prominent
differentially expressed groups of genes shown are the pancreatic and metabolic genes.
![Page 100: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/100.jpg)
72
The following genes HLXB9, SOX9 and HNF1A were not affected by the inhibition of
BCL-xL. This suggests that the inhibition of BCL-xL function did not have a global
impact on pancreatic gene expression as evidenced by the increase in PAX6 gene
expression and a lack of change in HLXB9, SOX9 or HNF1A.
Figure 14. RNA-Seq analysis reveal that the inhibition of BCL-xL function decreases the
expression of pancreatic genes. (A) Volcano plot representation of differentially expressed genes
between DMSO vs WEHI-539 treated samples. (B) Hierarchical clustering heatmap analysis of
pancreatic genes that were downregulated in WEHI-539-treated D7 cells. (C) RT-QPCR validation
of pancreatic progenitor transcripts in WEHI-539-treated D7 cells. The RNA-Seq was performed
with the assistance of Dr Shawn Hoon, Dr Choi Hyun Won, Dr Vidhya and Soumita.
C
A B
![Page 101: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/101.jpg)
73
To complement this data, I also cloned two pairs of shRNAs targeting BCL-xL with
scrambled shRNA as control. After transduction for 72 h, I observed that the shBCL-
xL transduced cells failed to exhibit a mesenchymal-epithelial transition (MET) that
typically occurred for wild-type cells (Fig 15A). I was able to knockdown BCL-xL
transcripts by 80 % (P < 0.05). Upon knockdown of BCL-xL, the expression of all the
pancreatic progenitor transcripts were decreased except for SOX9 (Fig 15B). Overall,
the evidence propose that BCL-xL may be indirectly involved in maintaining the
pancreatic progenitor transcript level, hence, contributing to the pancreatic progenitor
identity.
![Page 102: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/102.jpg)
74
3.5.2 Inhibition of BCL-xL decreases pancreatic progenitor protein expression
Next, I asked if the inhibition of BCL-xL would decrease the protein expression of
pancreatic progenitor genes and thus, I performed FACS on the WEHI-539 treated
cells. The rationale of this experiment is to allow us to assess the repercussions of
BCL-xL inhibition on the pancreatic progenitors at the protein level. I found that there
was a decrease from 92.7 % to 72.7 % BCL-xL+ cells upon inhibition using WEHI-
B
Figure 15. Effects of BCL-xL knockdown on D7 pancreatic progenitors. (A) Morphology of
pancreatic progenitors after shBCL-xL transduction. Scale bar represent 200 µm. (B) RT-QPCR
validation of pancreatic progenitor transcripts after knockdown of BCL-xL in D7 cells. A
representative of at least two independent experiments is shown. Asterisk (*) indicates P < 0.05
compared to shSCR control. All error bars indicate SD of three replicates in an independent
experiment.
A
b
![Page 103: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/103.jpg)
75
539. I further observed a decrease from 83.5 % to 44.7 % (PDX1+), 95.3 % to 78.2 %
(GATA4+), 88.3 % to 67.3 % (HNF4A+), 91.3 % to 67.4 % (HNF1B+) cells (Fig
16A). I then validated the data using immunofluorescence. From the
immunofluorescence data, I observed a decrease in the intensity of HNF4A, PDX1,
HNF1B and GATA4 staining (Fig 16B). Since these genes are important pancreatic
markers, our data propose that apart from the function of BCL-xL in prosurvival
effects, BCL-xL may also indirectly contribute to maintaining the pancreatic
progenitor identity of the cells.
A
Figure 16. Inhibition of BCL-xL decreases pancreatic progenitor protein expression. (A)
FACS was performed on DMSO vs WEHI-539 treated D7 pancreatic progenitors. The percentage
of BCL-xL+, PDX1+, GATA4+, HNF4A+ and HNFβ+ cells upon WEHI-539 treatment. (B)
Immunostaining showing HNF4A, PDX1, HNF1B and GATA4 intensity on WEHI-539 treated
pancreatic progenitors. Scale bar represent 50 μm. FACS and immunostaining were done with the
assistance of Alvin and Hwee Hui.
B
![Page 104: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/104.jpg)
76
3.5.3 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited
phenotype in pancreatic progenitors
Since BCL-xL inhibition resulted in a decreased expression level of pancreatic
progenitor transcripts, I asked the question if the overexpression of BCL-xL rescues
the Bcl-xL-inhibited phenotype after WEHI-539 treatment in pancreatic progenitors.
Thus, I inhibited BCL-xL on D7 using WEHI-539 for 24 h and then transfected
exogenous BCL-xL for 48 h. Our results indicate that BCL-xL overexpression was
successful even in the WEHI-treated sample (Fig 17A). However, I did not observe
any increase in the pancreatic progenitor transcripts such as HNF1B, GATA4, RFX6,
HHEX, HNF4A or PDX1 (Fig 17B). The results suggest that WEHI-539 effects may
not be restricted to BCL-xL.
A
Figure 17. Overexpression of BCL-xL does not rescue the BCL-xL-inhibited phenotype in
pancreatic progenitors. (A) Overexpression of BCL-xL for 24 h after WEHI-539 treatment on D7.
(B) Overexpression rescue of BCL-xL in pancreatic progenitors treated with WEHI-539. All error
bars indicate SD of three replicates in an independent experiment. Asterisk (*) indicates P < 0.05
compared to DMSO + GFP control.
B
![Page 105: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/105.jpg)
77
3.6 Metabolic genes were perturbed in pancreatic progenitors upon BCL-xL
inhibition
To examine the effects of BCL-xL inhibition on the various groups of genes, I used
DAVID 6.8 online software. The top 15 categories of downregulated genes were as
shown in Fig 18A. The results suggest that certain metabolic pathways were perturbed
when BCL-xL is inhibited in pancreatic progenitors. To uncover these pathways, I re-
looked at the RNA-seq data and observed perturbations in many groups of metabolic
genes. Out of the many metabolic genes, I curated a list of glycolysis genes that were
shown to be downregulated upon BCL-xL inhibition (Fig 18B). I validated three of
these genes, HK2, ALDH2 and ENO2 through RT-QPCR and confirmed that these
genes were downregulated in mRNA expression (Fig 18C).
![Page 106: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/106.jpg)
78
3.6.1 Inhibition of BCL-xL using WEHI-539 on D7 decreases glycolytic capacity
and glycolytic reserve in pancreatic progenitors
The previous results suggested a perturbation in glycolysis genes when BCL-xL was
inhibited. Hence, I asked the question if the inhibition of BCL-xL would lead to
defects in glycolytic functions in pancreatic progenitors. To answer this question, I
differentiated hESCs to D7 and treated the cells with WEHI-539 for 24 h. I then
utilized the Seahorse XFe96 analyzer to measure extracellular acidification rate
(ECAR) which corresponds to glycolysis rate.
Figure 18. Inhibition of BCL-xL perturbs metabolic genes in pancreatic progenitors. (A) Gene
ontology analysis of WEHI-539 treated D7 cells. (B) Heatmap of glycolysis genes upon WEHI-539
treatment (C) RT-QPCR validation of glycolysis genes upon WEHI-539 treatment. A
representative of at least two independent experiments is shown. All error bars indicate SD of three
replicates in an independent experiment. Asterisk (*) indicates P < 0.05 compared to DMSO
control.
A B
C
![Page 107: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/107.jpg)
79
I observed that the WEHI-539 treated cells exhibited a lower ECAR in the glycolysis
stress test as shown in Fig 19A. From the individual graph, I observed that the WEHI-
treated cells exhibited a decrease from 39.2 mpH/min to 29.7 mpH/min (glycolysis)
(Fig 19B), 57.2 mpH/min to 39.9 mpH/min (glycolytic capacity) (Fig 19B), 18.0
mpH/min to 10.2 mpH/min (glycolytic reserve) (Fig 19C) and 15.6 mpH/min to 8.4
mpH/min (non-glycolytic acidification) (Fig 19D). Overall, the evidence suggest that
BCL-xL could be indirectly involved in maintaining glycolytic functions in pancreatic
progenitors.
![Page 108: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/108.jpg)
80
3.6.2 Inhibition of BCL-xL using WEHI-539 on D7 decreases oxidative
phosphorylation in pancreatic progenitors
Since BCL-xL is localized on the mitochondria of the cell, I asked if there is any
substantial impact of BCL-xL inhibition on pancreatic progenitor mitochondrial
Figure 19. Inhibition of BCL-xL function decreases glycolytic functions in pancreatic
progenitors. (A) ECAR comparing DMSO vs WEHI-539 treated pancreatic progenitors. (B)
Individual component graphs of glycolysis, glycolytic capacity, glycolytic reserve and non-
glycolytic acidification. (C) Second repeat of ECAR comparing DMSO vs WEHI-539 treated
pancreatic progenitors. (D) Second repeat of individual component graphs of glycolysis, glycolytic
capacity, glycolytic reserve and non-glycolytic acidification. A representative of at least two
independent experiments is shown. All error bars indicate SD of 8 samples in an independent
experiment. Asterisk (*) indicates P < 0.05 compared to DMSO control.
B
D
A
C
![Page 109: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/109.jpg)
81
functions. To answer this question, I differentiated hESCs to D7 and treated the cells
with WEHI-539 for 24 h. I then utilized the Seahorse XF Cell Mito Stress Test to
evaluate if there are any perturbations in mitochondrial functions in pancreatic
progenitors. The rationale for this approach was as follows. Since BCL-xL impacts
mitochondrial physiology by regulating the pH of the intermembrane space, the
inhibition of BCL-xL would lead to decreased mitochondrial functions. This
experimental approach would give us an insight into the mitochondrial functions upon
BCL-xL inhibition. I observed that the oxygen consumption rate (OCR) is generally
decreased upon inhibition of BCL-xL (Fig 20A). I also showed in Fig 20B that basal
mitochondrial respiration is decreased from 118.1 pmol/min to 70.4 pmol/min whereas
ATP production is decreased from 99.2 pmol/min to 57.1 pmol/min. I also measured
the maximal respiration which is decreased from 250.9 pmol/min to 148.9 pmol/min
and the spare respiratory capacity also decreased from 132.7 pmol/min to 78.5
pmol/min (Fig 20B). Overall, the evidence propose that BCL-xL might be indirectly
involved in maintaining the oxidative phosphorylation process in pancreatic
progenitors.
![Page 110: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/110.jpg)
82
Figure 20. Inhibition of BCL-xL function decreases the mitochondrial functions in pancreatic
progenitors. (A) Mitochondrial respiration comparing DMSO vs WEHI-539 treated pancreatic
progenitors. (B) Individual component graphs of basal mitochondrial respiration, ATP production,
maximal respiration and spare respiratory capacity. (C) Repeat of mitochondrial respiration
comparing DMSO vs WEHI-539 treated pancreatic progenitors. (D) Repeat of individual
component graphs of basal mitochondrial respiration, ATP production, maximal respiration and
spare respiratory capacity. A representative of at least two independent experiments is shown. All
error bars indicate SD of 8 samples in an independent experiment. Asterisk (*) indicates P < 0.05
compared to DMSO control.
D
D
A
C
B
![Page 111: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/111.jpg)
83
3.7 Role of Wnt and Secreted Frizzled Receptor Proteins (SFRPs) in pancreatic
lineage specification
3.7.1 Heatmap of Wnt and SFRPs showing differential gene expression after
BCL-xL inhibition
Wnt signaling has been observed to regulate the development of mouse and human
pancreas (Sharon et al., 2019, Papadopoulou and Edlund, 2005). To understand the
impact of BCL-xL inhibition on Wnt and SFRPs genes, I re-assessed the RNA-seq
data and generated a heatmap consisting of the various Wnts and SFRPs genes using a
1.5 fold cutoff in terms of decreased fold change expression, (P < 0.05). From the
heatmap, I observed that Wnt molecules such as WNT5B, WNT7B, WNT2B, WNT8B,
WNT5A were upregulated (Fig 21A). Frizzled (fz) receptors that act as receptors in the
Wnt signaling pathway were decreased (FZD8, FZD6, FZD4, FZD7, FZF5, FZD2)
and increased (FZD10, FZD1, FZD3) (Fig 19A). I validated several Wnt genes
through RT-QPCR, showing an increase in transcript expression of WNT2B (Fig 21B).
A decrease in WNT5A and WNT5B transcripts expression was also observed (Fig 21C).
Of interest to us are the Secreted Frizzed-like Receptor Proteins (SFRPs) which share
structural similarity with the Wnt-binding domain on the fz receptors. As a result, they
are often classified as an antagonist of the Wnt signaling pathway. Our RNA-Seq data
suggest that SFRP5 was strongly downregulated while the others (SFRP1, SFRP2,
SFRP4) are upregulated (Fig 21A).
![Page 112: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/112.jpg)
84
3.7.2 SFRP5 transcript expression is decreased upon WEHI-539 treatment on D7
Since the various SFRPs were perturbed upon BCL-xL inhibition in pancreatic
progenitors, I then validated the RNA-seq data by RT-QPCR analysis of the various
SFRPs. I observed that SFRP5 is drastically downregulated upon BCL-xL inhibition
(Fig 22A). I also evaluated SFRP5 protein expression via immunofluorescence upon
WEHI-539 treatment on D7. SFRP5 protein expression was shown to be decreased on
A
Figure 21. Inhibition of BCL-xL perturbs the expression of Wnt-associated genes. (A) Heatmap
analysis revealed perturbation of WNT-associated genes. (B) Perturbed transcript expression in WNT2B,
upon BCL-xL inhibition. (C) Perturbed transcript expression in WNT5A and WNT5B upon BCL-xL
inhibition. A representative of at least two independent experiments is shown. Asterisk (*) indicates P <
0.05 compared to DMSO control. All error bars indicate SD of three replicates in an independent
experiment.
C
B
![Page 113: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/113.jpg)
85
D8 (Fig 22B). Next, I sought to assess the dynamics of SFRP5 transcripts expression
during the 17D differentiation. The rationale is to evaluate the importance of SFRP5 in
pancreatic specification. From the results, I observed that SFRP5 expression was
increased drastically from D7 (Fig 22C). The increase in SFRP5 transcript expression
continued until D14 before decreasing at D17. Taken in all, the results suggest that
SFRP5 is strongly downregulated after BCL-xL inhibition and that BCL-xL could act
in concert with SFRP5 to regulate pancreatic specification.
Figure 22. SFRP5 is involved in pancreatic specification. (A) Inhibition of BCL-xL perturbs
SFRP5 transcript expression. (B) SFRP5 protein expression after BCL-xL inhibition. Scale bar
represents 100 μm. (C) SFRP5 transcript expression trend during 17D differentiation. A
representative of at least two independent experiments is shown. Asterisk (*) indicates P < 0.05
compared to DMSO control. All error bars indicate SD of three replicates in an independent
experiment.
B C
A
![Page 114: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/114.jpg)
86
3.7.3 Knockdown of SFRP5 does not decrease the expression of pancreatic
progenitor transcripts
Since I hypothesized that SFRP5 plays an important role in pancreatic specification, I
cloned two pairs of shRNAs targeting SFRP5 and transduced them in D7 pancreatic
progenitors for 72 h. The rationale of this experimental approach is that if SFRP5 is
indeed critical for pancreatic progenitor generation, the knockdown of SFRP5 would
decrease the pancreatic progenitor transcripts expression level. After 72 h, I observed
that there was an increased cell death as indicated by the missing patches of cells
shown (Fig 23A). I also observed SFRP5 transcripts levels decreased after lentiviral
mediated knockdown (Fig 21B). However, I observed that the knockdown of SFRP5
did not decrease pancreatic progenitor transcripts (Fig 23B), suggesting that SFRP5 is
not involved in pancreatic specification.
Figure 23. Effects of SFRP5 knockdown on pancreatic progenitor transcript. (A) Morphology of
cells after SFRP5 knockdown. Scale bar represents 200 μm. (B) GATA4, HNF1B and PDX1
transcript expression after SFRP5 knockdown. Asterisk (*) indicates P < 0.05 compared to shSCR
control. All error bars indicate SD of three replicates in an independent experiment.
B
A
![Page 115: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/115.jpg)
87
3.8 Role of BCL-xL during pancreatic β-like cell differentiation
3.8.1 Dynamics of BCL-xL transcript in pancreatic β-like cell
I have shown in the previous section that BCL-xL is critical in the formation of early
pancreatic progenitors. BCL-xL has been shown to be important for insulin secretion
in β-cells (Zhou et al., 2000) and regulating prosurvival in human islets (Campbell et
al., 2012). In this section, I evaluated the dynamics of BCL-xL transcript during
differentiation into pancreatic β-like cells. The rationale of the experiment is to
determine if BCL-xL is important in pancreatic β-like cells using hPSC as a model.
Here, I used a 35D protocol to generate pancreatic β-like cells (Pagliuca et al., 2014)
(Fig 24A). I observed changes in morphological structure as hPSC differentiate into β-
like cells during the 35D differentiation (Fig 24B). Similar to using the 17D protocol, I
also observed increased apoptosis of the cells during the first 5 days of differentiation
(data not shown). As the single cells were incubated on a low attachment 6-well plate
on a rotating shaker, I observed the gradual increase in cell cluster size as
differentiation progressed from D1 onwards (Fig 24B). The differentiation continued
to D35 with the addition of the respective growth factors. At D35, I harvested the cells
and evaluated the transcript expression of several mature β-like cell markers. I was
able to generate INS+ cells as shown from the increased INS transcripts on D35 (Fig
24C). I also observed an increase in transcript expression of several mature β-cell
markers such as PDX1 and MAFA (Fig 24C). Importantly, I also observed an increased
BCL-xL transcript expression from D8 onwards (Fig 24C), suggesting that BCL-xL is
also involved in β-like cell generation.
![Page 116: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/116.jpg)
88
B
C
Figure 24. Dynamics of mature β-like cell markers and BCL-xL transcript during 35D
differentiation. (A) Schematics of 35D protocol used for generating pancreatic β-like cells. (B)
Morphology of the differentiating clumps at various stages during 35D differentiation. Scale bar
represents 500 μm. (C) D35 cells showing increase of INS, PDX1, MAFA and BCL-xL transcript
expression. A representative of at least two independent experiment is shown. Asterisk (*)
indicates P < 0.05 compared to D0 control. All error bars indicate SD of three replicates in an
independent experiment.
A
![Page 117: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/117.jpg)
89
3.8.2 Impact of BCL-xL inhibition on pancreatic β-like cell
In the previous section, I have shown that BCL-xL transcript expression is increased
from D8 onwards. To further elucidate its role in regulating the formation of β-like
cells, I used the 35D differentiation protocol to differentiate hPSC towards pancreatic
β-like cells (Pagliuca et al., 2014). I differentiated the hPSC to D8 and treated the cells
with DMSO and WEHI-539 for 24 h. The DMSO and WEHI-539-treated cells were
harvested at the respective time-points (Fig 25A). I observed a decrease in PDX1, INS
and MAFA transcripts expression on D35 upon WEHI-539 treatment, suggesting that
these β-like cells also lose their identity upon inhibition of BCL-xL (Fig 25B & 25C).
![Page 118: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/118.jpg)
90
Figure 25. Morphology and transcriptional profile of DMSO vs WEHI-539 treated cells during
differentiation into β-like cells. (A) Morphology of DMSO vs WEHI-539 treated cells during 35D
differentiation. (B) Transcriptional profile of DMSO vs WEHI-539 treated cells during 35D. (C)
Second repeat of transcriptional profile of DMSO vs WEHI-539 treated cells during 35D. A
representative of at least two independent experiment is shown. Asterisk (*) indicates P < 0.05
compared to DMSO control. All error bars indicate SD of three replicates in an independent
experiment.
B
C
A
![Page 119: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/119.jpg)
91
4 Effects of ER stressors, Tunicamycin and Thapsigargin on MIN6 cells
4.1 Tunicamycin upregulates ER stress transcripts and selected Bcl-2 family
of transcripts in MIN6 cells
In the previous section, I evaluated the role of BCL-xL in pancreatic progenitors. In
this chapter, I will evaluate the role of BIM in MIN6 (mouse β-cell line) and human
islets. The hypothesis is that increased BIM exon 3 to exon 4 ratio will decrease the
apoptosis of pancreatic β-cells. To test this hypothesis, I intended to overexpress the
various BIM isoforms by transducing pCDH- BIML, pCDH-BIMEL and pCDH-
BIMγ-containing lentiviruses into MIN6 and human islets. Since the transfected cells
are overexpressing BIML/BIMEL (promote apoptosis) and BIMγ (postulated to
protect against apoptosis based on increased BIM exon 3 to exon 4 ratios as per Ng et
al (Ng et al., 2012), I hypothesized that there are discrepancies in the expression level
of ER stress/Bcl-2 transcripts when the MIN6 cells are treated with
tunicamycin/thapsigargin.
Extended ER stress has been shown to promote apoptosis (Kim et al., 2008) and
pathogenesis of certain diseases such as diabetes and neurodegeneration (Ron and
Walter, 2007). The UPR is a defense response designed to restore equilibrium and to
alleviate ER stress. Hence, I sought to determine the tunicamycin-induced UPR in
MIN6 and to investigate if Bcl-2 family of proteins play a role in ER stress-promoted
apoptosis. MIN6 cells were incubated with an increasing amount of tunicamycin (0,
2.5, 5, 10 µM) for 24 h. Several ER stress-related genes such as Perk, Atf4, Atf6,
Sxbp1, Ire1a and Chop-10 were upregulated (Fig 26A). The results suggest that the
UPR is triggered in MIN6 cells. The unresolved effects of UPR would lead to
perturbation in the Bcl-2 family of genes. I then evaluated the expression of various
![Page 120: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/120.jpg)
92
Bcl-2 family of transcripts in (Fig 26B). I observed that tunicamycin was able to
induce an upregulation of Bim, Bax, Puma, Noxa and Bcl-2 transcripts even at a low
dose of 2.5 µM. Upregulation of these pro-apoptotic transcripts indicate that the MIN6
cells are possibly undergoing apoptosis. I also observed an increasing number of
apoptotic MIN6 cells after incubation with tunicamycin (Fig 26C).
B
C
Figure 26. Effects of tunicamycin dose treatment on MIN6 cells. (A) Effects of increasing
dosage of tunicamycin on ER stress transcripts in MIN6 cells. (B) Effects of increasing dosage of
tunicamycin on Bcl-2 family of transcripts in MIN6 cells. (C) Morphology of increasing dosage of
tunicamycin in MIN6 cells. Images were taken at 4X and also magnified 125X. Scale bar
represents 200 µM. Asterisk (*) indicates P < 0.05 compared to untreated control. All error bars
indicate SD of three replicates in an independent experiment.
A
![Page 121: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/121.jpg)
93
4.2 Thapsigargin upregulates ER stress transcripts and selected Bcl-2 family of
transcripts in MIN6 cells
Next, I asked if thapsigargin was also able to activate the UPR in MIN6 cells after 24
h of incubation. All of the ER stress-related genes such as Perk, Atf4, Atf6, Sxbp1,
Ire1a and Chop-10 were found to be upregulated even at a low dose of 2.5 µM (Fig
27A). Pro-apoptotic transcripts such as Bim, Bax, Bak, Bad, Puma, Noxa were also
upregulated (Fig 27B). The anti-apoptotic transcripts are also upregulated. Similar to
tunicamycin treatment, MIN6 cells treated with thapsigargin also showed an increase
of rounded apoptotic cells floating (Fig. 27C).
Figure 27. Effects of thapsigargin dose treatment on MIN6 cells. (A) Effects of increasing dosage
of thapsigargin on ER stress transcripts in MIN6 cells. (B) Effects of increasing dosage of
thapsigargin on the Bcl-2 family of transcripts in MIN6 cells. (C) Morphology of increasing dosage
of thapsigargin in MIN6 cells. Images were taken at 4X and also magnified 125X. Scale bar
represents 200 µM. (*) indicates P < 0.05 compared to untreated control. All error bars indicate SD
of three replicates in an independent experiment.
B
A
C
A
![Page 122: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/122.jpg)
94
4.3 Overexpression of BIM isoform transcripts in MIN6 cells
4.3.1 Overexpression of BIM isoform transcripts in the presence of
Tunicamycin/Thapsigargin did not perturb ER stress and Bcl-2 family of
transcripts in MIN6 cells
Hence, I sought to assess if the overexpression of the BIM isoforms will perturb the
ER stress/Bcl-2 family of transcripts. I transfected MIN6 cells with the various BIM
isoforms for 48 h and treated them with tunicamycin and thapsigargin at 2.5 µM for 24
h respectively. I processed both experiments in parallel. GFP is fused to all Bim
constructs; BIML, BIMEL, BIMγ in the pCDH vector. The pCDH vector was obtained
from a collaborator and we have thoroughly sequenced and confirmed the vector
before using it. In order to detect the specific BIM isoform, Bim primers were
designed flanking the entire Bim region. However, I also designed the primers that
flank the various BIM isoform regions; BIMEL, BIML and BIMγ. Hence, I could only
detect the specific Bim exons and not the entire Bim transcript. In Fig 28A, exon 2A is
shared by all three BIM isoforms but I found it to be more highly expressed in BIMγ
than BIML and BIMEL. BIMγ is the only isoform that contains exon 3. BIML/BIMEL
contain exon 4 that encodes the BH3 domain and is highly upregulated in both of
BIML/BIMEL-transfected MIN6 cells. This evidence proposes that the overexpression
of the BIM isoforms in MIN6 cells was successful at the transcript level.
Since the trigger of ER stress can potentially lead to pancreatic β-cell death in T1D, I
asked if the overexpression of BIM isoforms with tunicamycin/thapsigargin could lead
to perturbations in the ER stress transcripts. I investigated the expression of Perk, Atf4,
Atf, Sxbp1, Ire1a and Chop-10 (Fig 28B and 28D). In the BIMγ plus
![Page 123: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/123.jpg)
95
tunicamycin/thapsigargin-treated MIN6 cells, there was a non-statistically significant
decrease (P > 0.05) in Perk and Atf4 transcripts levels. The other arms of the ER stress
response such as Atf6 and Ire1α did not show any perturbation at the transcript levels.
Next, I investigated the transcript expression of Bim, Bax, Bak, Bad, Bid, Puma and
Noxa (Fig 28C and 28E). A higher expression level (non-statistically significant; P >
0.05) of pro-apoptotic Bak, Bid and Noxa with BIMγ overexpression in the presence of
tunicamycin in MIN6 cells was observed, although I hypothesized BIMγ to be
protective against apoptosis. In the BIMγ overexpression plus thapsigargin-treated
MIN6 cells, a non-statistically significant (P > 0.05) trend of increase in Bax transcript
level was observed. The treatment of BIML/BIMEL-overexpressed MIN6 cells with
tunicamycin/thapsigargin is expected to lead to a higher rate of apoptosis characterised
by a higher expression level of the pro-apoptotic genes and a lower expression level of
the anti-apoptotic genes. However, this was not observed, suggesting that
overexpression of the BIM isoforms in conjunction with tunicamycin/thapsigargin did
not lead to perturbation of both ER stress and Bcl-2 family of transcripts.
![Page 124: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/124.jpg)
96
D
A
Figure 28. Transcripts of Bcl-2 family genes in BIM isoform-overexpressing MIN6 cells under
ER stress. (A) Overexpression of BIM isoform transcripts in MIN6 cells. (B) Overexpression of BIM
isoform transcripts in the presence of tunicamycin effects on the ER stress transcripts in MIN6 cells.
(C) Overexpression of BIM isoform transcripts in the presence of tunicamycin effects on the Bcl-2
family of transcripts in MIN6 cells. (D) Overexpression of BIM isoform transcripts in the presence of
thapsigargin effects on the Bcl-2 family of transcripts in MIN6 cells. (E) Overexpression of BIM
isoform transcripts in the presence of thapsigargin effects on the Bcl-2 family of transcripts in MIN6
cells. Asterisk (*) indicates P < 0.05 compared to untransfected control. All error bars indicate SD of
three replicates in an independent experiment.
C
E
B
![Page 125: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/125.jpg)
97
4.4 Overexpression of BIM isoform transcripts in human islets
4.4.1 Overexpression of BIM isoform transcripts did not perturb ER stress and
BCL-2 family of transcripts in human islets
Next, I also performed overexpression of BIM isoform transcripts in human islets. All
of the three BIM isoforms contain exon 2A and it is clear that the overexpression of
exon 2a was higher as compared to the GFP control. Exon 3 was overexpressed up to
7-fold in the BIMγ sample as compared to the other samples, indicating that the
overexpression of BIMγ in human islets was working (Fig 29A). BIM exon 4 was
overexpressed in BIML and BIMEL >2.5 fold as compared to other samples. This
indicated that the overexpression of BIML and BIMEL was also working as they are
the exon 4-containing BIM isoforms (Fig 29A). Following the successful
overexpression of BIM isoforms in human islets, I also investigated if the BIM isoform
overexpression would perturb the ER stress transcripts in human islets (Fig 29B).
However, our results indicated that there were no perturbations in any of the ER stress
transcripts (PERK, XBP1, ATF4, ATF6 and CHOP-10). Next, I investigated if the
overexpression of the various BIM isoforms can lead to perturbations in the BCL-2
family of transcripts in human islets. BIM transcripts were overexpressed in both
BIML and BIMEL samples but not the BIMγ samples (Fig. 29C). Dismally, no
differences were observed for BAK, BID, PUMA, NOXA, BAD, BCL-XL, MCL1 and
BCL-2, when comparing the overexpressed samples to the GFP control (Fig 29C).
Overall, the evidence indicated that the overexpression of BIM isoforms did not
perturbed the ER stress and BCL-2 family of transcripts in the human islets.
![Page 126: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/126.jpg)
98
4.5 BIM isoforms can be overexpressed at the protein level in HEK293FT cells
In the previous section, experiments were performed to assess the perturbation of the
ER stress/BCL-2 family of transcripts at the RNA level. However, minimal
transcriptional changes were observed. To unequivocally confirm that our various
BIM isoform plasmids were indeed able to lead to an overexpression of BIM protein, I
Figure 29. Overexpression of BIM isoforms in human islets. (A) Overexpression of BIM isoform
transcripts in human islets. (B) Overexpression of BIM isoform transcripts effects on the ER stress
transcripts in human islets. (C) Overexpression of BIM isoform transcripts effects on the BCL-2
family of transcripts in human islets. Asterisk (*) indicates P < 0.05 compared to untransfected
control. All error bars indicate SD of three replicates in an independent experiment.
C
A
B
![Page 127: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/127.jpg)
99
performed confirmatory overexpression studies in HEK293FT cells after transfection
for 48 h. In GFP-transfected control, very little endogenous BIM protein was detected.
In the BIML-transfected lane, there was an 18 kDa band detected that corresponds to
the predicted molecular weight for BIML (Fig 30A). Two bands were observed for
BIMEL, one at 26 kDa and the other 18 kDa. The 26 kDa band likely corresponds to
BIMEL while the 18 kDa band corresponds to BIML (Fig 30A). In BIMγ-transfected
lane, a band at 16 kDa was observed (Fig 30A). Thus, the observed band most likely
corresponds to BIMγ. Here, I quantified the bands and confirmed that our plasmids are
indeed able to overexpress the various BIM isoforms at the protein level (Fig 30B)
Figure 30. Overexpression of BIM isoforms at the protein level in HEK293FT cells. (A) Western
blot analysis showing all three BIM isoforms, BIMEL (26 kDa), BIML (18 kDa) and BIMγ (16 kDa) in
HEK293FT cells. (B) Quantification of the overexpressed BIMEL, BIML and BIMγ bands.
4.6 BIML and BIMEL proteins are unable to be overexpressed at the protein
level in MIN6 cells
4.6.1 Overexpression of the BIM isoform proteins in MIN6 cells
Although the various BIM isoforms were overexpressed in MIN6 cells using the same
method as per HEK293FT cells, I was only able to detect the overexpression of BIMγ
A B
![Page 128: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/128.jpg)
100
protein 48 h post-transfection (Fig 31A & 31B). This was quite puzzling as all three
BIM isoforms can be overexpressed at the transcript level. Possible explanations could
be the tight translational control over BIML and BIMEL transcripts, or that the protein
could be degraded by 48 h post-transfection.
4.6.2 Time-course overexpression of BIML, BIMEL and BIMγ in MIN6 cells
Next, I asked if BIML/BIMEL protein might be overexpressed at earlier time-point. I
transfected MIN6 cells with the various BIM isoforms and harvested at several time-
points (6, 12, 24 and 48 h). However, no overexpression was detected for BIML and
BIMEL protein across the various time-points (Fig 32A). This suggests a tight
translational control over BIML and BIMEL transcripts. BIMγ was clearly
overexpressed as early as 12 h post-transfection (Fig 32B & 32C). I also validated the
overexpression of the BIM isoforms using immunofluorescence (Fig 32D). I was
unable to detect the overexpression of BIML and BIMEL even after 48 h of
overexpression whereas BIMγ was able to be overexpressed. Since BIMγ was the only
isoform that can be overexpressed, I proceeded to test the hypothesis that
A B
Figure 31. Overexpression of BIM isoforms at the protein level in MIN6 cells. (A) Western blot
analysis showing BIMγ overexpression at the protein level in MIN6. (B) Quantification of
overexpressed BIMEL, BIML and BIMγ bands.
![Page 129: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/129.jpg)
101
overexpression of BIMγ (increased BIM exon 3 to exon 4 ratios) can protect pancreatic
β-cells against apoptosis.
Figure 32. Overexpression of the various BIM isoforms, BIML, BIMEL and BIMγ in MIN6
cells. (A) Overexpression of BIML and BIMEL at 6, 12, 24 and 48 h. (B) Overexpression of BIMγ at
6, 12, 24 and 48 h. (C) Quantification of overexpressed BIMγ bands at 6, 12, 24 and 48 h. (D)
Immunofluorescence staining showing overexpression of all the BIM isoforms. Images were taken at
4X and also magnified 125X. Scale bar represents 200 µM.
A
B
D
C
![Page 130: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/130.jpg)
102
4.7 Overexpression of BIMγ was successful in Tunicamycin/Thapsigargin-treated
MIN6 cells.
To assess if BIMγ can protect against ER stressor-induced apoptosis, BIMγ was
overexpressed in MIN6 cells for 48 h and incubated with tunicamycin/thapsigargin at
2.5 µM for 24 h. The negative controls consisted of samples that were non-treated or
treated with tunicamycin/thapsigargin respectively. A GFP control which was non-
treated or treated with tunicamycin/thapsigargin respectively was also included. For
the BIMγ overexpression samples, I observed that the BIMγ protein was
overexpressed (Fig 33A & 33B). However, I also observed that upon Tunicamycin and
Thapsigargin treatment, BIMγ protein expression was reduced.
4.8 Overexpression of BIMγ was successful in MIN6 cells treated with cytokines
BIMγ was also overexpressed in MIN6 for 48 h followed by treatment with various
T1D-related cytokines to ascertain pathophysiological relevance. The negative
controls consisted of samples that were non-treated or treated with cytokines for
another 24 h. GFP controls were also included and were either non-treated or treated
A B
Figure 33. Overexpression of BIMγ was successful in MIN6 cells treated with
Tunicamycin/Thapsigargin. (A) MIN6 cells were overexpressed with BIMγ for 48 h and
treated with 2.5 µM of respective ER stressors for 24 h. (B) Quantification of the overexpressed
BIMγ bands.
![Page 131: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/131.jpg)
103
with cytokines. BIMγ was successfully overexpressed at the protein level (Fig 34A &
34B).
4.9 Overexpression of BIMγ in the presence of ER stressors or cytokines did not
confer protection against apoptosis in MIN6 cells
4.9.1 Overexpression of BIMγ in the presence of ER stressors did not perturb
other repertoire of BCL-2 proteins except for Bcl-xl
I next asked if the overexpression of BIMγ could perturb the repertoire of other BCL-2
proteins at the protein level. In the BIMγ overexpression samples, I did not observe
any changes in BAX, BAK and PUMA proteins. (Fig 35A, 35B, 35C). However, in
the in the BIMγ overexpression samples, I observed that BCL-2 was consistent but
interestingly BCL-xL showed increased protein expression (Fig 35C & 35D). This
.
.
B A
Figure 34. Overexpression of BIMγ was successful in MIN6 cells treated with cytokines. (A)
MIN6 cells were overexpressed with BIMγ for 48 h.and treated with 50 ng/ml of respective
cytokines for 24 h. (B) Quantification of the overexpressed BIMγ bands.
![Page 132: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/132.jpg)
104
suggests that BIMγ overexpression could possibly result in an increase in BCL-xL to
counter apoptosis.
Figure 35. Western blot analysis of BCL-2 family of proteins upon BIMγ overexpression in
MIN6 cells treated with ER stressors. (A) Western blot analysis of BAX expression in MIN6
cells after BIMγ overexpression for 48 h and subsequent 24 h of ER stressor treatment.
(B) Western blot analysis of BAK expression in MIN6 cells after BIMγ overexpression for 48 h
and subsequent 24 h of ER stressor treatment. (C) Western blot analysis of PUMA, BCL-xL and
BCL-2 expression in MIN6 cells after BIMγ overexpression for 48 h and subsequent 24 h of ER
stressor treatment. (D) Quantification of the BAX, BAK, PUMA, BCL-xL, and BCL-2 bands.
A
B
D
C
A
![Page 133: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/133.jpg)
105
4.9.2 Overexpression of BIMγ in the presence of cytokines did not perturb other
repertoire of BCL-2 proteins except for BCL-xL
BAX, BAK and PUMA protein expression levels were not significantly altered in the
presence of BIMγ overexpression and/or cytokines (Fig 36A & 36B). However, BCL-
2 and BCL-xL protein expression showed an upregulation in the GFP control and
BIMγ overexpression samples (Fig 36C & 36D). This could possibly indicate that
there might be a partial protection against apoptosis by upregulating BCL-xL.
![Page 134: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/134.jpg)
106
Figure 36. Western blot analysis of BCL-2 family of proteins upon BIMγ overexpression in
MIN6 cells treated with cytokines. (A) Western blot analysis of BAK expression in MIN6 cells
after BIMγ overexpression for 48 h and subsequent 24 h of cytokine treatment. (B) Western blot
analysis of BAX and PUMA expression in MIN6 cells after BIMγ overexpression for 48 h and
subsequent 24 h of cytokine treatment. (C) Western blot analysis of BCL-xL and BCL-2
expression. in MIN6 cells after BIMγ overexpression for 48 h and subsequent 24 h of cytokine
treatment. (D) Quantification of BAX, BAK, PUMA, BCL-xL and BCL-2 bands.
C
D
B A
![Page 135: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/135.jpg)
107
4.10 Cleaved caspase 3 was present in MIN6 cells overexpressed with BIMγ and
treated with ER stressors
Since the hypothesis was that the overexpression of BIMγ protects β-cells from ER
stress-induced cell death, I then evaluated cleaved caspase 3 expression which is the
final gateway in the apoptotic cascade. Results from the previous section showed that
BCL-xL was upregulated upon BIMγ overexpression, suggesting protection against
apoptosis in MIN6. Here, I showed that full-length caspase 3 was consistent
throughout the samples while the cleaved caspase 3 band was only observed in the
lanes treated with tunicamycin and thapsigargin (Fig 37A & 37B). Cleaved caspase 3
was detected BIMγ-overexpressed samples, indicating that the overexpression of
BIMγ and the upregulated BCL-xL was insufficient to protect MIN6 cells against ER
stress-induced cell death.
Figure 37. Cleaved caspase 3 was present in BIMγ overexpression in the presence of ER
stressors. (A) MIN6 cells were overexpressed with BIMγ for 48 h and treated with 2.5 µM of
respective ER stressors. (B) Quantification of the FL casp3 and Ccasp3 bands.
A
B
![Page 136: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/136.jpg)
108
4.11 Cleaved caspase 3 was present in MIN6 cells overexpressed with BIMγ and
treated with cytokines
Here, I showed that the full-length caspase 3 band was equal throughout the samples
while cleaved caspase 3 band was detected in all the samples (Fig 38A & 38B). The
original assumption was that the cytokines treatment would only lead to caspase 3
activation but in this case, it is unknown why apoptosis was also detected in the non-
treated samples. Overall, the evidence suggests that overexpression of BIMγ, in spite
of upregulation of BCL-xL, was unable to protect MIN6 against apoptosis.
Figure 38. Cleaved caspase 3 was present in BIMγ overexpression in the presence of
cytokines. (A) MIN6 cells were overexpressed with BIMγ for 48 h and treated with 50 ng/ml of
respective cytokines. (B) Quantification of the FL casp3 and Ccasp3 bands.
A
B
![Page 137: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/137.jpg)
109
5 Discussion (Part 1)
5.1 Decrease in apoptosis during differentiation of hPSC to pancreatic
progenitors
In this study, I observed increased cell death during the first five days of
differentiation and cell death drastically decreased thereafter on D7 (Fig 8). On D0 and
D3, I used 100 ng/ml Activin A, 3 µM CHIR9021 and 10 µM LY294002 to
differentiate the hPSC respectively. Usage of Activin A during the first few days has
been widely used in generating definitive endoderm cells from hPSC (D'Amour et al.,
2006, Jiang et al., 2007a, Basford et al., 2012, Pagliuca et al., 2014, D'Amour et al.,
2005, Nostro et al., 2011). The observation of increased cell death during the
generation of definitive endoderm coincides with many previous results from various
investigators (Wang et al., 2015, Qu et al., 2017). The usage of Activin A has also
been shown to cause cell death (Nishihara et al., 1993) in hybridoma and myeloma cell
lines. However, Activin A-induced apoptosis is repressed by BCL-2 in B cell
hybridoma cell lines (Koseki et al., 1995). Usage of LY294002, a PI3K inhibitor, has
been observed to induce cell death in many cell types in vitro (Fujiwara et al., 2008,
Jiang et al., 2010). Although these studies did not implicate the direct involvement of
BCL-2 family, it is well-understood that they play important roles in cell death and
survival.
![Page 138: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/138.jpg)
110
5.2 Changes in BCL-2 family of transcript expression levels during differentiation
of hPSC into pancreatic progenitors
BCL-2 family of genes are involved in cell survival and apoptosis (Adams and Cory,
1998, Gross et al., 1999). I reasoned that decreased apoptosis phenotype observed
during pancreatic progenitor differentiation is related to the changes in the BCL-2
levels of transcripts. Here, I reported that there were indeed changes in the BCL-2
family of transcripts expression levels during 17D differentiation. For pro-apoptotic
transcripts, I observed an increase of BIM, PUMA, BAD transcript expression from D5
to D7 (Fig 9A). For anti-apoptotic transcripts, I also observed an increase of BCL-xL
and BCL-2 transcripts expression from D5 to D7 (Fig 9C). To the best of our
knowledge, this is the first report of changes in BCL-2 gene expression during
pancreatic specification using hPSC as a model. Overall, the evidence suggest that
BCL-2 family of genes are involved during pancreatic differentiation and may be
critical for pancreatic lineage specification.
5.3 BCL-xL and BAK play important roles in pancreatic specification
I then found that BCL-xL protein is highly expressed on D7 onwards, possibly to
suppress the pro-apoptotic effects of BAK (Fig 10A). BCL-xL has also been found to
restraint BAK, a pro-apoptotic protein that is responsible for cellular apoptosis (Sattler
et al., 1997, Lee et al., 2016, Willis et al., 2005, Kodama et al., 2012). Surprisingly,
BAK protein expression is decreased from D7 onwards, suggesting an inverse
correlated relationship between BCL-xL and BAK. Although BAX can form
heterodimers with BAK during apoptosis (Dewson et al., 2012), I did not observe any
changes in BAX expression level (Fig 10A), suggesting that there is a decrease in the
![Page 139: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/139.jpg)
111
amount of heterodimers for inducing MOMP. Alternatively, BAK alone can induce
apoptosis by oligomerization through inserting exposed BH3 domain into the groove
of another BAK monomer (Dewson et al., 2009), suggesting that BAK alone can
induce apoptosis of pancreatic progenitors. Several of the proteins such as BIMEL,
BIML, PUMA and BCL-2 did not show any changes in expression throughout the 17D
differentiation, suggesting that they do not play a role in pancreatic lineage
differentiation. BIMS showed a decrease in expression from D7 onwards which
correlates to a similar expression to BAK. However, a paper reported that the BIMS
expression is not likely to be associated with BCL-xL as it does not interact with BCL-
xL in epithelial cells (Weber et al., 2007).
Since BCL-xL shows only an increase in protein expression from D7 onwards, I
postulate that there could be an unknown BH3-only protein that is temporarily holding
BCL-xL in check from D0 to D7. At the same time, BAX and BAK are constitutively
active, leading to a large amount of cell death observed. From D7 onwards, this
unknown BH3-only protein expression decreases and is no longer able to keep BCL-
xL in check any further. Hence, BCL-xL protein expression increase and this may
serve to suppress the proapoptotic BAK, leading to a decrease in apoptosis. This
finding fits the displacement model in the BCL-2 activation model.
5.4 BCL-xL is critical for the survival of pancreatic progenitors
In this part, I showed that BCL-xL is critical for pancreatic progenitor survival. To
study this, I inhibited BCL-xL at D7 using a specific inhibitor, WEHI-539 and I
observed that there was increased cleaved caspase 3 protein expression level in the
western blot (Fig 12A & 12B). The presence of cleaved caspase 3 upon WEHI-539
![Page 140: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/140.jpg)
112
suggests that BCL-xL is critical for prosurvival in pancreatic progenitors. This finding
confirms the separate observation of previous investigators that BCL-xL is critical for
prosurvival in human islets (Campbell et al., 2012) and mouse β-cells (Carrington et
al., 2009, Zhou et al., 2000). However, it is well-established that BCL-xL is not only
critical for pancreatic progenitor survival, but it is critical in a prosurvival role in many
different cell types (Yang et al., 2003, Nakamura et al., 2016, Bai et al., 2012). In the
area of embryonic development, the loss of BCL-xL has been shown to lead to
embryonic lethality by E13.5 in which a large amount of apoptosis was observed in the
developing hematopoietic and nervous systems (Motoyama et al., 1995). Furthermore,
BCL-xL is also vital in ensuring the neuron survival in the developing brain and spinal
cord. A conditional knock-out of Bcl2l1 in CNS neurons resulted in the mice having
lower numbers of catecholaminergic neurons (Savitt et al., 2005). These mice
eventually developed a decrease in striatal dopamine production and had a lower brain
mass. Another report highlights the importance of BCL-xL in maintaining the survival
of differentiated neuronal cortex that controls complex behavior (Nakamura et al.,
2016). Despite this evidence, not much is known on the role of BCL-xL during
pancreatic development. Taken together, our findings suggest the importance of BCL-
xL in prosurvival during pancreatic development.
5.5 BCL-xL plays an indirect role in pancreatic specification
I sought to identify other potential roles of BCL-xL in pancreatic progenitors. A
surprising finding was that inhibition of BCL-xL indirectly decreased pancreatic gene
expression during pancreatic differentiation. The volcano plot showed that pancreatic
genes were downregulated in expression level (Fig 14A). Further validation of the
pancreatic genes such as HNF1B. GATA4, HNF4A, PDX1 and many others, through
![Page 141: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/141.jpg)
113
RT-QPCR, showed downregulation in mRNA expression upon inhibition of BCL-xL
(Fig 14C). To our knowledge, BCL-xL has never been shown to direct pancreatic cell
lineage and this is the first report of BCL-xL indirectly influencing differentiation
towards pancreatic lineage. This could possibly suggest the indirect effects of BCL-xL
inhibition on pancreatic gene expression. Furthermore, I also complemented the data
by using shRNA targeting BCL-xL on D7 cells. Here, I observed that the majority of
pancreatic gene transcript expression such as HNF1B, GATA4, HNF4A, PDX1 were
also downregulated (Fig 15B). The decrease in BCL-xL protein expression has also
led to the decrease in PDX1+, GATA4+, HNF4A+ and HNF1B+ cells (Fig 16A). In
terms of influencing cell lineage decision, many other studies have shown that BCL-
xL can direct hematopoietic stem cells differentiation into myeloid and erythroid
lineage (Haughn et al., 2003), as well as direct the lineage of embryonic cortical
precursor cells (Chang et al., 2007). Through the use of hPSC modeling of pancreatic
lineage, our novel findings strongly suggest that BCL-xL could indeed influence hPSC
differentiation towards pancreatic lineage. This evidence highlights BCL-xL playing
an indirect role in influencing cell lineage specification.
However, a conflicting report showed that pancreas-specific Bcl-xl–knockout mice do
not show any phenotype in terms of the pancreas/body weight ratio when compared to
wildtype littermates (Ikezawa et al., 2017). While the authors did not report any gross
phenotype, they did not evaluate pancreatic gene expression or diabetes phenotypes.
Hence, they were unable to determine if there are deficiency of functions in Bcl-xl-
knockout mice islets.
Apparent discrepancies between the RT-QPCR results using WEHI-539 and shRNA
targeting BCL-xL is the expression of several genes such as PAX6, HLXB9 and
HNF1A. Due to the fact that pancreatic gene expression is dynamic, it suggests that
![Page 142: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/142.jpg)
114
there could be a delay in differentiation into pancreatic progenitors when BCL-xL is
reduced. Hence, I reasoned that this could be due to the difference in the treatment
time between WEHI-539 and shRNA targeting BCL-xL. WEHI-539 treatment was
incubated for 24 h (D7-D8) whereas shRNA transduction was incubated for 72 h (D7-
D10) to enhance knockdown efficiency. An alternative to resolve this issue is to
perform knockdown of BCL-xL at D5 and analyse the data at D8/D9. The second
alternative is to treat the cells with WEHI-539 on D8 and analyse the data on D9. This
will resolve the differences in treatment time between using WEHI-539 and shBCL-
xL. Furthermore, a previous study also showcased the differences between chemical
inhibitors and shRNAs, suggesting that in certain cases, the readout may generally be
the same but there could also be some differences due to off-target effects of the
chemical inhibitors (Weiss et al., 2007).
Another alternative involves the speculation that more differentiated pancreatic
progenitors are more dependent on BCL-xL for survival. When the populations of
cells are treated with WEHI-539 or shBCL-xL, the loss of BCL-xL could have led to a
loss of these more differentiated pancreatic progenitors, leaving behind the less
differentiated cells that account for the decreased pancreatic gene expression.
5.6 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited
phenotype in pancreatic progenitors
The results presented here showed that overexpression of BCL-xL on D8 after WEHI-
539 treatment was unable to rescue the BCL-xL-inhibited phenotype in pancreatic
progenitors. Evidence that the rescue experiment failed is that even though
overexpression of BCL-xL transcript was successful (Fig 17A), however, I did not
![Page 143: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/143.jpg)
115
observe any increase in the expression level of the various pancreatic genes in the
WEHI-539 + BCL-xL samples as compared to the WEHI-539 + GFP samples (Fig
17B). More work would need to be done on determining if the overexpression of BCL-
xL was successful at the protein level. This is because the structure of the
overexpressed BCL-xL protein might not fold properly and this could result in the
inability of exogenous BCL-xL to function. The data suggest that overexpression of
BCL-xL may be insufficient to rescue the BCL-xL-inhibited phenotype in pancreatic
progenitors and perhaps, additional factors are likely needed to be important in
pancreatic lineage specification. In addition, WEHI-539 may not specifically target
BCL-xL, hence the non-specific inhibition of other unknown genes may play a role in
preventing the downstream overexpression of exogenous BCL-xL. However, a report
mentioned that rescue effects of WEHI-539 treatment in human colon carcinoma cells
(RKO) was possible by having Tet-BCL-xL integrated. This stable RKO line
harbouring the tetracycline-inducible GFP-tagged Bcl-xL was able to induce BCL-xL
overexpression via induction of tetracycline (Bennett et al., 2016). This is in contrast
with my current method of exogenous BCL-xL overexpression via transfection.
5.7 BCL-xL is involved in maintaining the metabolic state of pancreatic
progenitors
In this report, I also uncovered a novel function of BCL-xL in regulating the metabolic
state of pancreatic progenitors. From the RNA-Seq data, I observed that glycolysis
gene transcripts were downregulated (Fig 18B). RT-QPCR validation confirmed that
certain glycolysis transcripts such as ENO2, HK2 and ALDOC expression were
downregulated (Fig 18C). In this study, I have shown that inhibition of BCL-xL in
pancreatic progenitors led to an overall decrease in glycolysis, including glycolytic
![Page 144: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/144.jpg)
116
capacity and glycolytic reserve (Fig 19B & 19D). I also observed that inhibition of
BCL-xL in pancreatic progenitors led to a decrease in basal mitochondrial respiration,
ATP production and maximal respiration (Fig 20B & 20D). I also noted a decrease in
the spare respiratory capacity, non-mitochondrial oxygen consumption and proton leak
(Fig 20B & 20D). This evidence agrees with several previous studies of BCL-xL being
involved in mitochondrial metabolic studies. In another study, it reported that BCL-xL
acts as a mediator between apoptosis and protein N-alpha-acetylation (Yi et al., 2011).
Through overexpression of BCL-xL in MEFs, the levels of protein N-acetylation and
Acetyl-CoA was reduced, contributing to apoptotic resistance in MEFs. Hence, it was
concluded that BCL-xL regulates Acetyl-CoA, a signaling molecule which in turn
regulates protein N-acetylation, conferring apoptotic sensitivity to metabolism in
MEFs. In another study, BCL-xL-deficient neurons exhibited a defect in control of
mitochondrial membrane potential, resulting in a leaky inner mitochondrial membrane
(Chen et al., 2011). Unable to maintain a normal membrane potential, the bcl-x-
deficient cells eventually depolarize and die off. Through interacting with the
mitochondrial F1F0 ATP synthase, BCL-xL was also shown to regulate the metabolic
efficiency of neurons (Alavian et al., 2011). These studies highlight the importance of
BCL-xL in the regulation of metabolism in different cell types. To our knowledge,
there are no reports of BCL-xL in regulating metabolism in pancreatic progenitors and
this novel finding provides a first insight on the importance of BCL-xL in regulating
both glycolysis and oxidative phosphorylation in D7 pancreatic progenitors.
![Page 145: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/145.jpg)
117
5.8 Inhibition of BCL-xL perturbs Wnt signaling pathway in pancreatic
progenitors
Wnt proteins are a group of cysteine-rich glycoproteins that are primarily defined by a
pattern of 22-24 conserved cysteine residues. Wnt signaling plays an important part in
developmental biology by contributing to tissue patterning, cell lineage determination,
polarity and proliferation (Cadigan and Nusse, 1997, Uren et al., 2000). In the human
genome, there are a total of 19 Wnt proteins. Wnt ligands can bind to receptors of the
Frizzled family, leading to the activation of downstream Wnt signaling through three
pathways: canonical Wnt-β-catenin signalling, the Wnt/Ca2+ pathway, and the planar
cell polarity pathway (Kuhl et al., 2000).
Importantly, Wnt signaling has been observed to be a key pathway in pancreas
development. Research has implicated that Wnt2b, Wnt4, Wnt5a and Wnt7b in the
development of the pancreas in mice (Heller et al., 2002, Papadopoulou and Edlund,
2005). Interestingly, none of the Wnt gene mutants showed any developmental defects
except for Wnt5/Wnt5a (Heller et al., 2002). The activation of β-catenin during
pancreas development resulted in complete pancreatic agenesis (Heiser et al., 2006).
Stimulation of β-catenin activity also promoted the redirection of intestine lineage into
liver and pancreas, implying that Wnt signaling is important specifying hindgut
lineage in the endoderm (McLin et al., 2007). Knocking down of β-catenin inhibitor,
Apc also resulted in the complete abolishment of pancreatic development in zebrafish
(Nadauld et al., 2004).
In another study, use of the Wnt inhibitor APC in vitro, promoted an increase in the
amount of differentiated endocrine cells, suggesting that suppression of Wnt signalling
is crucial for normal mice pancreas development (Sharon et al., 2019). These results
![Page 146: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/146.jpg)
118
propose that pancreatic development is tightly regulated via Wnt signaling. Further
studies on Wnt signaling functions could lead to deeper insights into pancreatic
development.
I showed that certain genes involved in Wnt signaling are perturbed, in particular,
upregulation of WNT2B. (Fig 21B). This finding has also been confirmed in the
previous investigation that Wnt2b, Wnt5a and Wnt7b are strongly implicated in mouse
pancreas development (Heller et al., 2002, Papadopoulou and Edlund, 2005), albeit in
rodents and not human pancreatic development. I also showed inhibition of BCL-xL
decreases WNT5A and WNT5B transcripts (Fig 21C). However, in a contrasting study
(Heller et al., 2002), the investigators reported that overexpression of Wnt5a resulted
in a decrease pancreas size, implying that pancreatic bud formation was incomplete,
thus, limiting the growth of the pancreas. This is in direct contrast with our
observation that a decrease in WNT5A transcripts disrupts pancreatic progenitor
specification. However, in another study that supports our results, the authors utilized
morpholinos (MOs), a sequence-specific translational inhibitor to inhibit Wnt5a in
both zebrafish and mouse (Kim et al., 2005). They reported that Wnt5/Fz2 plays an
important role in islet formation. One possible suggestion to resolve this contradiction
is that Wnt5a needs to be in the correct dosage as well as at the right developmental
stage for normal pancreas organogenesis.
5.9 A decrease in SFRP5 transcript expression is insufficient to decrease
pancreatic gene expression in vitro
There are five Secreted Frizzled Receptor Proteins (SFRP) members in humans,
mainly SFRP1, SFRP2, SFRP3, SFRP4 and SFRP5. Being the first group of proteins
to be identified as Wnt antagonists, they are made up of 300 amino acids containing a
![Page 147: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/147.jpg)
119
signal sequence, a small hydrophilic C-terminal domain and a Frizzled-like cysteine-
rich domain (CRD) (Rattner et al., 1997). As the name implies, SFRPs exhibited
similarity to Frizzled’s extracellular domain, suggesting that SFRPs would be able to
bind Wnt and inhibit Wnt signaling. Each member has highly specific and temporal
expression patterns, suggesting that they are critical for developmental processes
(Rattner et al., 1997, Leimeister et al., 1998). For instance, the deletion of a specific
sequence in the Frizzled CRD domain in SFRP3 is required to bind and inhibit Wnt-1
signaling (Lin et al., 1997). In another study, SFRP1 was shown to bind to Wingless
(Wg) in both co-precipitation and ELISA assays (Uren et al., 2000). However, the
deletion of a certain sequence in CRD did not affect SFRP1’s ability to bind to Wg
suggesting that other sites are involved in Wg binding.
SFRP5 exhibited an increasing expression trend during 17D differentiation (Fig 22C),
suggesting its importance in pancreatic progenitor differentiation. I also showed that
among the many SFRPs, only SFRP5 transcripts and protein is drastically reduced
upon BCL-xL inhibition (Fig 22A) and thus, I postulated that SFRP5 is important in
pancreatic specification. I was able to knockdown SFRP5 transcripts (Fig 23B) and I
observed a large amount of cell death (Fig 23A). I also showed that knockdown of
SFRP5 did not decrease pancreatic progenitor transcripts HNF1B, GATA4 and PDX1
(Fig 23B).
Based on the previous finding, Sfrp5 has been shown to inhibit Wnt11 and the deletion
of Sfrp5 failed to maintain pancreatic foregut identity in a Xenopus model (Li et al.,
2008). I reasoned that knockdown of SFRP5 transcript via lentivirus-mediated
transduction was insufficient to observe a decrease in the expression of pancreatic
progenitor transcripts. For future work, I will evaluate the knockdown of SFRP5
protein and confirm high efficiency of knockdown in all the pancreatic cells. Another
![Page 148: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/148.jpg)
120
solution is to ensure complete depletion of SFRP5, a feasible strategy is to have to
generate a SFRP5-knockout line and repeat the experiments to observe for any
phenotypes.
5.10 Inhibition of BCL-xL indirectly leads to a loss of pancreatic β-like cell
identity
Here, I reported that BCL-xL also showed increased transcript expression during 35D
generation protocol (β-like cells), suggesting that it is also indirectly involved in the
generation of pancreatic β-like cells (Fig 24C). Evidence that BCL-xL could be
indirectly important for the generation of pancreatic β-like cells is that PDX1, MAFA
and INS transcript expression were downregulated on D35 upon inhibition of BCL-xL
on D8 (Fig 25B & 25C). These results thus lend further credence to our earlier results
of decreased pancreatic progenitor transcript expression using the 17D differentiation
protocol (Fig 14C).
Many previous studies have link BCL-xL to cellular lineage specification and
functions in the areas of hematopoietic differentiation (Haughn et al., 2003) and
neurons differentiation (Nakamura et al., 2016). Taken together, this suggest that
BCL-xL contributes to many types of cell lineage development and functions.
![Page 149: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/149.jpg)
121
6 Discussion (Part 2)
6.1 Tunicamycin and Thapsigargin induce ER stress and perturb the
expression of Bcl-2 family of transcripts in MIN6 cells
The results presented here show that ER stressors including tunicamycin and
thapsigargin were able to induce the UPR in MIN6 cells by upregulating IRE1a, Perk
and Atf6. Tunicamycin is able to inhibit N-linked glycosylation of proteins by
DPAGT1 in the ER, inducing ER stress (Heifetz et al., 1979, Keller et al., 1979)
whereas thapsigargin inhibits sarcoplasmic and endoplasmic reticulum Ca2+-ATPase
(SERCA), eventually leading to depletion of calcium in the ER and increased cytosolic
calcium concentrations (Foufelle and Fromenty, 2016). However, the results suggest
that despite the difference in the mode of ER stress activation, all three ER stress
pathways are being activated as shown by an increase in Perk, Atf4, Atf6, Sxbp1, Ire1a
and Chop10 transcripts. (Fig 26A, 27A), consistent with a similarity in outcome.
Activation of Perk can stimulate apoptosis through increasing the expression of Atf4
and Chop10 (Ma et al., 2002, Jiang et al., 2004). Chop10 is an important mediator that
performs a key function in apoptosis (Oyadomari and Mori, 2004). As such, the
upregulation of Chop10 is linked to several pro-apoptotic effects downstream of ER
stress (Benavides et al., 2005, Tajiri et al., 2006, Oyadomari and Mori, 2004). It
includes the translocation of Bax from the cytosolic compartment to mitochondria
(Gotoh et al., 2004) and downregulation of Bcl-2, resulting in decrease of cellular
glutathione (McCullough et al., 2001) and subsequently exposing the cells to oxidative
stress (Ciccaglione et al., 2007). Bcl-2 family proteins are generally thought of as the
governors of apoptosis, both through the mitochondrial pathway and through ER stress
(Newmeyer and Ferguson-Miller, 2003) and also cell death regulated by ER stress. In
![Page 150: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/150.jpg)
122
this case, I also showed that tunicamycin/thapsigargin can also upregulate Bim, Bax,
Puma, Noxa and Bcl-2 (Fig 26B, 27B). This finding has also been reported earlier
(Oakes et al., 2006). This indicates that treatment with these ER stressors for 24 h was
able to induce ER stress and Bcl-2 family of genes expression. These findings were
confirmed independently by other groups who reported activation of the UPR
pathways using ER stressors albeit, in mouse β-cells (Rulifson et al., 2007, Grunnet et
al., 2009). Although the mode of ER stress activation by tunicamycin is different from
that of thapsigargin, the results suggest a similarity in the outcome. Both tunicamycin
and thapsigargin were able to induce similar outcome in ER stress activation such as
increase in Perk, Atf4, Atf6, Sxbp1, Ire1a and Chop10.
6.2 Overexpression of BIM isoforms did not perturb ER stress and BCL-2
family of transcripts in MIN6 cells and human islets
I reported that I was able to overexpress the various BIM isoforms, BIML, BIMEL
and BIMγ in MIN6 in the presence of Tunicamycin and Thapsigargin (Fig 28A).
However, even though overexpression was successful in both MIN6 and human islets,
I did not observe any perturbations in ER stress and Bcl-2 family of transcripts in both
MIN6 in Tunicamycin (Fig 28B, 28C) and Thapsigargin-treated samples (Fig 28D,
28E). I was also able to overexpress BIM isoforms in human islets (Fig 29A) but also
did not managed to observe perturbation in both ER stress (Fig 29B) and BCL-2
family of transcripts (Fig 29C). I reasoned that the BIM isoforms interactions take
place at the protein level and overexpression at the transcript level was insufficient to
perturb both ER stress and BCL-2 family of transcripts. It was also noted that BIML
and BIMEL are unable to be overexpressed at the protein level and this could possibly
account for the result shown.
![Page 151: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/151.jpg)
123
6.3 Inhibitory mechanisms prevent BIM protein from being overexpressed in
MIN6 cells
I was able to overexpress all of the BIM isoforms at the protein level in HEK293FT
(Fig 30A). but not MIN6 β-cells. However, I was only able to overexpress BIMγ in
MIN6 (Fig 31A). I did not observe any presence of GFP in MIN6 overexpressed with
BIML/BIMEL even after 48 h (Fig 32D). Moreover, western blot analysis also showed
no exogenous BIML and BIMEL proteins being overexpressed (Fig 32A). On the
other hand, BIMγ was successfully overexpressed at 48 h (Fig 32B). This suggests that
the BIML/BIMEL proteins were not translated at all in MIN6 cells. This strongly
suggests that there might be a difference in the regulation of BIM expression between
cancer cells and β-cell lines. Moreover, BIML and BIMEL were not overexpressed in
MIN6 cell line despite accumulating at RNA levels, possibly hinting a tight
translational/posttranslational control (Fig 32A). There have been explanations about
the repression of BIM in many cell types such as lymphocytes (Dijkers et al., 2000)
and fibroblasts (Weston et al., 2003). However, its repression in pancreatic β-cells is
still unknown. There might be cell-type specific differences in which BIML/BIMEL
are unable to be overexpressed in MIN6 cells. This could be due to BIML and BIMEL
proteins being rapidly degraded upon translation as Bim was found to be degraded by
the ubiquitin-proteasome system due to phosphorylation of Bim by p42/p44 MAPK
(Ley et al., 2003, Luciano et al., 2003). In other systems, Bim protein was also shown
in neurons (Meller et al., 2006) to be rapidly degraded after the cells experienced
physiological stimuli. The rapid degradation of the pro-apoptotic Bim protein using an
ubiquitin-proteasome system protects the cells from further damage, ensuring cell
survival. Such an ubiquitin-proteasome system could also possibly exist in the MIN6
mouse β-cell, thus degrading the exogenous BIML and BIMEL. Hence, I propose
![Page 152: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/152.jpg)
124
using MG132, a proteasome inhibitor that could possibly block BIML and BIMEL
protein degradation in MIN6 cells. Using this approach, I might be able to overexpress
BIML and BIMEL at the protein level and further evaluate if BIML and BIMEL can
perturb ER stress and Bcl-2 family of transcripts.
6.4 Overexpression of BIMγ induced upregulation of BCL-xL but did not protect
against apoptosis induced by ER stressors/cytokines
Here, I showed that the treatment of MIN6 cells with Tunicamycin and Thapsigargin
appeared to decrease the amount of BIMγ protein overexpression (Figure 33A). This
suggests that there may be some unknown mechanism of ER stressors which is able to
inhibit BIMγ overexpression. I also showed that the overexpression of BIMγ (an
increase in BIM exon 3 to exon 4) in the presence of ER stressors/cytokines was able
to upregulate BCL-xL protein expression in MIN6 (Fig 35C, 36C). However, despite
the presence of BCL-xL protein upregulation induced by BIMγ overexpression,
cleaved caspase 3 band was detected (Fig 37A & 38A). This implies that BIMγ-
induced increased expression of BCL-xL is insufficient to protect against apoptosis in
MIN6 cells.
I hypothesized that the increased ratio of exon 3 to exon 4 would protect the pancreatic
β-cells against ER stressors/cytokines-induced apoptosis. This theory was corroborated
by previously published evidence suggesting that the increase in BIM exon 3 to exon 4
ratio conferred intrinsic tyrosine kinase inhibitor-mediated resistance apoptosis in
chronic myeloid leukemia and epidermal growth factor receptor NSCLC cell lines (Ng
et al., 2012). However, this TKI-mediated resistance could be reversed by BH3-
mimetic drugs.
![Page 153: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/153.jpg)
125
In this case, even though I showed BCL-xL protein were upregulated upon BIMγ
overexpression (increased BIM exon 3 to exon 4 ratio), it was insufficient to protect
against apoptosis in MIN6 cells, possibly suggesting that other prosurvival or pro-
apoptotic factors may be required.
7 Conclusion
Here, I conclude that BCL-xL is a key anti-apoptotic protein that is important in the
survival of pancreatic progenitors. Apart from that, BCL-xL also played a role in
influencing differentiation of hPSC towards pancreatic lineage as high levels of BCL-
xL protein were observed from D7 onwards. I also found that BAK was decreased on
D7 onwards during pancreatic differentiation, suggesting that low levels of BAK
protein were necessary for pancreatic specification. Furthermore, the loss of BCL-xL
function also led to a decrease in glycolysis functions and oxidative phosphorylation in
pancreatic progenitors. This evidence highlights BCL-xL critical role in pancreatic
progenitors. I also conclude that the loss of BCL-xL led to perturbations in Wnt genes
such as WNT2B, WNT5A and WNT5B. Most importantly, it also led to a decrease in
SFRP5 transcript and protein expression. Even though SFRP5 was shown to maintain
pancreatic foregut identity in a Xenopus model, I did not observe perturbation in
pancreatic gene expression after SFRP5 knockdown, suggesting that there could be
some contradictions on the role of SFRP5 in maintaining pancreatic lineage in-vitro. I
also showed that BCL-xL plays an important role in maintaining the identity of β-like
cells generated from hPSC.
I also conclude that Tunicamycin and Thapsigargin were able to induce ER stress and
perturb the Bcl-2 family of transcripts. Further observations revealed that all three
![Page 154: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/154.jpg)
126
BIM isoforms, BIML, BIMEL and BIMγ were successfully overexpressed in
HEK293FT. However, only BIMγ was successfully overexpressed in MIN6 cells,
suggesting a tight translational/posttranslational control of BIML and BMEL proteins
in MIN6 cells. I also showed that the increased BIM exon 3 to exon 4 ratio through
overexpression of BIMγ was able to indirectly upregulate BCL-xL protein expression.
However, this was insufficient to protect mouse β-cells against apoptosis. Thus, I
reasoned that the reduction of BIM exon 4 is the key to confer protection against β-
cells apoptosis.
Collectively, I provided the possible involvement of BCL-xL in human pancreatic
progenitors/human β-like cells and BIM in terminally-differentiated mouse β-
cells/human islets.
![Page 155: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/155.jpg)
127
8 Future work
8.1 Future work for Chapter 3
To our knowledge, I am the first to show that BCL-xL might be indirectly involved
during hPSC differentiation towards the pancreatic lineage. Hence, further work would
need to be done as described below.
I also intend to perform co-immunoprecipitation studies to confirm the interaction
between BAK and BCL-xL during differentiation to pancreatic progenitors.
I intend to address the failure of BCL-xL overexpression to rescue the BCL-xL-
inhibited phenotype in pancreatic progenitors. I suggest using western blot and
immunofluorescence to establish the overexpression of BCL-xL at the protein level in
pancreatic progenitors. I also reasoned that there might be additional cofactors that are
needed for the rescue to work.
I performed knockdown of SFRP5 and assumed that it did not decrease pancreatic
gene transcripts. I intend to use western blot and confirm that SFRP5 is successfully
knockdown at the protein level before making this assumption.
For long term work, it may be possible to investigate the functions of BCL-xL further
through a conditional deletion of Bcl-xl in mouse pancreas. Using this system, it
would be possible to study the effects of Bcl-xl knockout in mouse pancreas
development in-vivo using RT-QPCR, immunofluorescence and western blot to probe
for mouse β-cell markers. In addition, it is also possible to evaluate the functional
impact of Bcl-xl knockout mouse β-cells using glucose-stimulated insulin secretion
(GSIS). Another work to be done in the long term would be to generate a BCL-xL
knockout hPSC model and subject the cells to both 17D and 35D differentiation.
Using RT-QPCR and western blot to probe for β-cell markers, I would be able to
![Page 156: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/156.jpg)
128
evaluate the effects of complete BCL-xL knockout on pancreatic progenitors and β-
like cells. On the other hand, it may be possible to generate a SFRP5-knockout hPSC
line to ensure complete depletion of SFRP5 and repeat the experiments to observe for
any phenotypes.
8.2 Future work for Chapter 4
Since I evaluated that the increase in BIM exon 3 to exon 4 ratio does not decrease the
ability of ER stressors to initiate apoptosis in β-cells, I propose using lentiviral-
mediated knockdown approach to target BIM exon 4. This will allow us to determine if
the decreased exon 4 levels can protect against apoptosis in pancreatic β-cells. I would
also perform the experiments in EndoC-BH2, an immortalized human β-cell line to
show its significance in human studies. Our results also suggested that BIML and
BIMEL were not able to be overexpressed at the protein level in MIN6 cells. One
possible solution is to use MG132, a proteasome inhibitor. If BIML and BIMEL are
indeed degraded at the protein level, the usage of MG132 could block the degradation
process. I might be able to overexpress BIML and BIMEL at the protein level
successfully. Using this approach, I can then evaluate the overexpression of the pro-
apoptotic isoforms of BIML and BIMEL effects on ER stress and Bcl-2 family of
transcripts.
![Page 157: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/157.jpg)
129
9 References
Adachi, M., Zhao, X. & Imai, K. 2005. Nomenclature of dynein light chain-linked
BH3-only protein Bim isoforms. Cell Death Differ, 12, 192-3.
Adams, J. M. 2003. Ways of dying: multiple pathways to apoptosis. Genes Dev, 17,
2481-95.
Adams, J. M. & Cory, S. 1998. The Bcl-2 protein family: arbiters of cell survival.
Science, 281, 1322-6.
Akgul, C., Moulding, D. A. & Edwards, S. W. 2004. Alternative splicing of Bcl-2-
related genes: functional consequences and potential therapeutic applications.
Cellular and molecular life sciences : CMLS, 61, 2189-99.
Alavian, K. N., Li, H., Collis, L., Bonanni, L., Zeng, L., Sacchetti, S., Lazrove, E.,
Nabili, P., Flaherty, B., Graham, M., Chen, Y., Messerli, S. M., Mariggio, M.
A., Rahner, C., Mcnay, E., Shore, G. C., Smith, P. J., Hardwick, J. M. & Jonas,
E. A. 2011. Bcl-xL regulates metabolic efficiency of neurons through
interaction with the mitochondrial F1FO ATP synthase. Nat Cell Biol, 13,
1224-33.
Allagnat, F., Cunha, D., Moore, F., Vanderwinden, J. M., Eizirik, D. L. & Cardozo, A.
K. 2011. Mcl-1 downregulation by pro-inflammatory cytokines and palmitate
is an early event contributing to beta-cell apoptosis. Cell death and
differentiation, 18, 328-37.
Allison, J., Thomas, H., Beck, D., Brady, J. L., Lew, A. M., Elefanty, A., Kosaka, H.,
Kay, T. W., Huang, D. C. & Strasser, A. 2000. Transgenic overexpression of
human Bcl-2 in islet beta cells inhibits apoptosis but does not prevent
autoimmune destruction. International immunology, 12, 9-17.
Annis, M. G., Soucie, E. L., Dlugosz, P. J., Cruz-Aguado, J. A., Penn, L. Z., Leber, B.
& Andrews, D. W. 2005. Bax forms multispanning monomers that oligomerize
to permeabilize membranes during apoptosis. EMBO J, 24, 2096-103.
Aranovich, A., Liu, Q., Collins, T., Geng, F., Dixit, S., Leber, B. & Andrews, D. W.
2012. Differences in the mechanisms of proapoptotic BH3 proteins binding to
Bcl-XL and Bcl-2 quantified in live MCF-7 cells. Mol Cell, 45, 754-63.
Assady, S., Maor, G., Amit, M., Itskovitz-Eldor, J., Skorecki, K. L. & Tzukerman, M.
2001. Insulin production by human embryonic stem cells. Diabetes, 50, 1691-
7.
Bae, J., Leo, C. P., Hsu, S. Y. & Hsueh, A. J. 2000. MCL-1S, a splicing variant of the
antiapoptotic BCL-2 family member MCL-1, encodes a proapoptotic protein
possessing only the BH3 domain. J Biol Chem, 275, 25255-61.
Bai, H., Chen, K., Gao, Y. X., Arzigian, M., Xie, Y. L., Malcosky, C., Yang, Y. G.,
Wu, W. S. & Wang, Z. Z. 2012. Bcl-xL enhances single-cell survival and
expansion of human embryonic stem cells without affecting self-renewal. Stem
Cell Res, 8, 26-37.
Barbu, A., Welsh, N. & Saldeen, J. 2002. Cytokine-induced apoptosis and necrosis are
preceded by disruption of the mitochondrial membrane potential (Deltapsi(m))
in pancreatic RINm5F cells: prevention by Bcl-2. Molecular and cellular
endocrinology, 190, 75-82.
Basford, C. L., Prentice, K. J., Hardy, A. B., Sarangi, F., Micallef, S. J., Li, X., Guo,
Q., Elefanty, A. G., Stanley, E. G., Keller, G., Allister, E. M., Nostro, M. C. &
Wheeler, M. B. 2012. The functional and molecular characterisation of human
![Page 158: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/158.jpg)
130
embryonic stem cell-derived insulin-positive cells compared with adult
pancreatic beta cells. Diabetologia, 55, 358-71.
Belka, C. & Budach, W. 2002. Anti-apoptotic Bcl-2 proteins: structure, function and
relevance for radiation biology. Int J Radiat Biol, 78, 643-58.
Benavides, A., Pastor, D., Santos, P., Tranque, P. & Calvo, S. 2005. CHOP plays a
pivotal role in the astrocyte death induced by oxygen and glucose deprivation.
Glia, 52, 261-75.
Bennett, A., Sloss, O., Topham, C., Nelson, L., Tighe, A. & Taylor, S. S. 2016.
Inhibition of Bcl-xL sensitizes cells to mitotic blockers, but not mitotic drivers.
Open Biol, 6.
Billen, L. P., Kokoski, C. L., Lovell, J. F., Leber, B. & Andrews, D. W. 2008. Bcl-XL
inhibits membrane permeabilization by competing with Bax. PLoS Biol, 6,
e147.
Boise, L. H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L.
A., Mao, X., Nunez, G. & Thompson, C. B. 1993. bcl-x, a bcl-2-related gene
that functions as a dominant regulator of apoptotic cell death. Cell, 74, 597-
608.
Borowiak, M., Maehr, R., Chen, S., Chen, A. E., Tang, W., Fox, J. L., Schreiber, S. L.
& Melton, D. A. 2009. Small molecules efficiently direct endodermal
differentiation of mouse and human embryonic stem cells. Cell stem cell, 4,
348-58.
Bougneres, P. F., Carel, J. C., Castano, L., Boitard, C., Gardin, J. P., Landais, P., Hors,
J., Mihatsch, M. J., Paillard, M., Chaussain, J. L. & Et Al. 1988. Factors
associated with early remission of type I diabetes in children treated with
cyclosporine. N Engl J Med, 318, 663-70.
Bouillet, P., Cory, S., Zhang, L. C., Strasser, A. & Adams, J. M. 2001. Degenerative
disorders caused by Bcl-2 deficiency prevented by loss of its BH3-only
antagonist Bim. Dev Cell, 1, 645-53.
Bouillet, P., Metcalf, D., Huang, D. C., Tarlinton, D. M., Kay, T. W., Kontgen, F.,
Adams, J. M. & Strasser, A. 1999. Proapoptotic Bcl-2 relative Bim required for
certain apoptotic responses, leukocyte homeostasis, and to preclude
autoimmunity. Science, 286, 1735-8.
Bouillet, P. & Strasser, A. 2002. BH3-only proteins - evolutionarily conserved
proapoptotic Bcl-2 family members essential for initiating programmed cell
death. J Cell Sci, 115, 1567-74.
Brolen, G. K., Heins, N., Edsbagge, J. & Semb, H. 2005. Signals from the embryonic
mouse pancreas induce differentiation of human embryonic stem cells into
insulin-producing beta-cell-like cells. Diabetes, 54, 2867-74.
Bruin, J. E., Rezania, A. & Kieffer, T. J. 2015a. Replacing and safeguarding pancreatic
beta cells for diabetes. Sci Transl Med, 7, 316ps23.
Bruin, J. E., Rezania, A., Xu, J., Narayan, K., Fox, J. K., O'neil, J. J. & Kieffer, T. J.
2013. Maturation and function of human embryonic stem cell-derived
pancreatic progenitors in macroencapsulation devices following transplant into
mice. Diabetologia, 56, 1987-98.
Bruin, J. E., Saber, N., Braun, N., Fox, J. K., Mojibian, M., Asadi, A., Drohan, C.,
O'dwyer, S., Rosman-Balzer, D. S., Swiss, V. A., Rezania, A. & Kieffer, T. J.
2015b. Treating diet-induced diabetes and obesity with human embryonic stem
cell-derived pancreatic progenitor cells and antidiabetic drugs. Stem cell
reports, 4, 605-20.
![Page 159: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/159.jpg)
131
Buckner, J. H. 2010. Mechanisms of impaired regulation by
CD4(+)CD25(+)FOXP3(+) regulatory T cells in human autoimmune diseases.
Nat Rev Immunol, 10, 849-59.
Cadigan, K. M. & Nusse, R. 1997. Wnt signaling: a common theme in animal
development. Genes Dev, 11, 3286-305.
Cai, J., Yu, C., Liu, Y., Chen, S., Guo, Y., Yong, J., Lu, W., Ding, M. & Deng, H.
2010. Generation of homogeneous PDX1(+) pancreatic progenitors from
human ES cell-derived endoderm cells. Journal of molecular cell biology, 2,
50-60.
Callewaert, H. I., Gysemans, C. A., Ladriere, L., D'hertog, W., Hagenbrock, J.,
Overbergh, L., Eizirik, D. L. & Mathieu, C. 2007. Deletion of STAT-1
pancreatic islets protects against streptozotocin-induced diabetes and early
graft failure but not against late rejection. Diabetes, 56, 2169-73.
Campbell, P. D., Weinberg, A., Chee, J., Mariana, L., Ayala, R., Hawthorne, W. J.,
O'connell, P. J., Loudovaris, T., Cowley, M. J., Kay, T. W., Grey, S. T. &
Thomas, H. E. 2012. Expression of pro- and antiapoptotic molecules of the
Bcl-2 family in human islets postisolation. Cell transplantation, 21, 49-60.
Cao, Z., Umek, R. M. & Mcknight, S. L. 1991. Regulated expression of three C/EBP
isoforms during adipose conversion of 3T3-L1 cells. Genes & development, 5,
1538-52.
Cardozo, A. K., Heimberg, H., Heremans, Y., Leeman, R., Kutlu, B., Kruhoffer, M.,
Orntoft, T. & Eizirik, D. L. 2001a. A comprehensive analysis of cytokine-
induced and nuclear factor-kappa B-dependent genes in primary rat pancreatic
beta-cells. The Journal of biological chemistry, 276, 48879-86.
Cardozo, A. K., Kruhoffer, M., Leeman, R., Orntoft, T. & Eizirik, D. L. 2001b.
Identification of novel cytokine-induced genes in pancreatic beta-cells by high-
density oligonucleotide arrays. Diabetes, 50, 909-20.
Cardozo, A. K., Ortis, F., Storling, J., Feng, Y. M., Rasschaert, J., Tonnesen, M., Van
Eylen, F., Mandrup-Poulsen, T., Herchuelz, A. & Eizirik, D. L. 2005.
Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase
2b and deplete endoplasmic reticulum Ca2+, leading to induction of
endoplasmic reticulum stress in pancreatic beta-cells. Diabetes, 54, 452-61.
Carrington, E. M., Mckenzie, M. D., Jansen, E., Myers, M., Fynch, S., Kos, C.,
Strasser, A., Kay, T. W., Scott, C. L. & Allison, J. 2009. Islet beta-cells
deficient in Bcl-xL develop but are abnormally sensitive to apoptotic stimuli.
Diabetes, 58, 2316-23.
Cartron, P. F., Gallenne, T., Bougras, G., Gautier, F., Manero, F., Vusio, P., Meflah,
K., Vallette, F. M. & Juin, P. 2004. The first alpha helix of Bax plays a
necessary role in its ligand-induced activation by the BH3-only proteins Bid
and PUMA. Mol Cell, 16, 807-18.
Certo, M., Del Gaizo Moore, V., Nishino, M., Wei, G., Korsmeyer, S., Armstrong, S.
A. & Letai, A. 2006. Mitochondria primed by death signals determine cellular
addiction to antiapoptotic BCL-2 family members. Cancer cell, 9, 351-65.
Chang, M. Y., Sun, W., Ochiai, W., Nakashima, K., Kim, S. Y., Park, C. H., Kang, J.
S., Shim, J. W., Jo, A. Y., Kang, C. S., Lee, Y. S., Kim, J. S. & Lee, S. H.
2007. Bcl-XL/Bax proteins direct the fate of embryonic cortical precursor
cells. Mol Cell Biol, 27, 4293-305.
Chen, L., Willis, S. N., Wei, A., Smith, B. J., Fletcher, J. I., Hinds, M. G., Colman, P.
M., Day, C. L., Adams, J. M. & Huang, D. C. 2005a. Differential targeting of
![Page 160: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/160.jpg)
132
prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary
apoptotic function. Molecular cell, 17, 393-403.
Chen, L., Willis, S. N., Wei, A., Smith, B. J., Fletcher, J. I., Hinds, M. G., Colman, P.
M., Day, C. L., Adams, J. M. & Huang, D. C. 2005b. Differential targeting of
prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary
apoptotic function. Mol Cell, 17, 393-403.
Chen, S., Borowiak, M., Fox, J. L., Maehr, R., Osafune, K., Davidow, L., Lam, K.,
Peng, L. F., Schreiber, S. L., Rubin, L. L. & Melton, D. 2009. A small
molecule that directs differentiation of human ESCs into the pancreatic lineage.
Nature chemical biology, 5, 258-65.
Chen, Y. B., Aon, M. A., Hsu, Y. T., Soane, L., Teng, X., Mccaffery, J. M., Cheng, W.
C., Qi, B., Li, H., Alavian, K. N., Dayhoff-Brannigan, M., Zou, S., Pineda, F.
J., O'rourke, B., Ko, Y. H., Pedersen, P. L., Kaczmarek, L. K., Jonas, E. A. &
Hardwick, J. M. 2011. Bcl-xL regulates mitochondrial energetics by stabilizing
the inner membrane potential. J Cell Biol, 195, 263-76.
Chinnaiyan, A. M. 1999. The apoptosome: heart and soul of the cell death machine.
Neoplasia, 1, 5-15.
Cho, C. H., Hannan, N. R., Docherty, F. M., Docherty, H. M., Joao Lima, M., Trotter,
M. W., Docherty, K. & Vallier, L. 2012. Inhibition of activin/nodal signalling
is necessary for pancreatic differentiation of human pluripotent stem cells.
Diabetologia, 55, 3284-95.
Cho, Y. M., Lim, J. M., Yoo, D. H., Kim, J. H., Chung, S. S., Park, S. G., Kim, T. H.,
Oh, S. K., Choi, Y. M., Moon, S. Y., Park, K. S. & Lee, H. K. 2008.
Betacellulin and nicotinamide sustain PDX1 expression and induce pancreatic
beta-cell differentiation in human embryonic stem cells. Biochemical and
biophysical research communications, 366, 129-34.
Chujo, D., Foucat, E., Nguyen, T. S., Chaussabel, D., Banchereau, J. & Ueno, H.
2013. ZnT8-Specific CD4+ T cells display distinct cytokine expression profiles
between type 1 diabetes patients and healthy adults. PLoS One, 8, e55595.
Ciccaglione, A. R., Marcantonio, C., Tritarelli, E., Equestre, M., Vendittelli, F.,
Costantino, A., Geraci, A. & Rapicetta, M. 2007. Activation of the ER stress
gene gadd153 by hepatitis C virus sensitizes cells to oxidant injury. Virus
research, 126, 128-38.
Cnop, M., Welsh, N., Jonas, J. C., Jorns, A., Lenzen, S. & Eizirik, D. L. 2005.
Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many
differences, few similarities. Diabetes, 54 Suppl 2, S97-107.
Colli, M. L., Nogueira, T. C., Allagnat, F., Cunha, D. A., Gurzov, E. N., Cardozo, A.
K., Roivainen, M., Op De Beeck, A. & Eizirik, D. L. 2011a. Exposure to the
viral by-product dsRNA or Coxsackievirus B5 triggers pancreatic beta cell
apoptosis via a Bim / Mcl-1 imbalance. PLoS pathogens, 7, e1002267.
Colli, M. L., Nogueira, T. C., Allagnat, F., Cunha, D. A., Gurzov, E. N., Cardozo, A.
K., Roivainen, M., Op De Beeck, A. & Eizirik, D. L. 2011b. Exposure to the
viral by-product dsRNA or Coxsackievirus B5 triggers pancreatic beta cell
apoptosis via a Bim / Mcl-1 imbalance. PLoS Pathog, 7, e1002267.
Czabotar, P. E., Lee, E. F., Van Delft, M. F., Day, C. L., Smith, B. J., Huang, D. C.,
Fairlie, W. D., Hinds, M. G. & Colman, P. M. 2007. Structural insights into the
degradation of Mcl-1 induced by BH3 domains. Proc Natl Acad Sci U S A,
104, 6217-22.
![Page 161: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/161.jpg)
133
D'amour, K. A., Agulnick, A. D., Eliazer, S., Kelly, O. G., Kroon, E. & Baetge, E. E.
2005. Efficient differentiation of human embryonic stem cells to definitive
endoderm. Nature biotechnology, 23, 1534-41.
D'amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G.,
Moorman, M. A., Kroon, E., Carpenter, M. K. & Baetge, E. E. 2006.
Production of pancreatic hormone-expressing endocrine cells from human
embryonic stem cells. Nature biotechnology, 24, 1392-401.
Danial, N. N. & Korsmeyer, S. J. 2004. Cell death: critical control points. Cell, 116,
205-19.
Desagher, S., Osen-Sand, A., Nichols, A., Eskes, R., Montessuit, S., Lauper, S.,
Maundrell, K., Antonsson, B. & Martinou, J. C. 1999. Bid-induced
conformational change of Bax is responsible for mitochondrial cytochrome c
release during apoptosis. The Journal of cell biology, 144, 891-901.
Dewson, G., Kratina, T., Czabotar, P., Day, C. L., Adams, J. M. & Kluck, R. M. 2009.
Bak activation for apoptosis involves oligomerization of dimers via their
alpha6 helices. Mol Cell, 36, 696-703.
Dewson, G., Ma, S., Frederick, P., Hockings, C., Tan, I., Kratina, T. & Kluck, R. M.
2012. Bax dimerizes via a symmetric BH3:groove interface during apoptosis.
Cell Death Differ, 19, 661-70.
Dijkers, P. F., Medema, R. H., Lammers, J. W., Koenderman, L. & Coffer, P. J. 2000.
Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the
forkhead transcription factor FKHR-L1. Current biology : CB, 10, 1201-4.
Distelhorst, C. W. & Bootman, M. D. 2011. Bcl-2 interaction with the inositol 1,4,5-
trisphosphate receptor: role in Ca(2+) signaling and disease. Cell calcium, 50,
234-41.
Dzhagalov, I., Dunkle, A. & He, Y. W. 2008. The anti-apoptotic Bcl-2 family member
Mcl-1 promotes T lymphocyte survival at multiple stages. J Immunol, 181,
521-8.
Eizirik, D. L., Cagliero, E., Bjorklund, A. & Welsh, N. 1992. Interleukin-1 beta
induces the expression of an isoform of nitric oxide synthase in insulin-
producing cells, which is similar to that observed in activated macrophages.
FEBS letters, 308, 249-52.
Eizirik, D. L. & Mandrup-Poulsen, T. 2001. A choice of death--the signal-transduction
of immune-mediated beta-cell apoptosis. Diabetologia, 44, 2115-33.
Eldor, R., Yeffet, A., Baum, K., Doviner, V., Amar, D., Ben-Neriah, Y., Christofori,
G., Peled, A., Carel, J. C., Boitard, C., Klein, T., Serup, P., Eizirik, D. L. &
Melloul, D. 2006. Conditional and specific NF-kappaB blockade protects
pancreatic beta cells from diabetogenic agents. Proceedings of the National
Academy of Sciences of the United States of America, 103, 5072-7.
Elouil, H., Bensellam, M., Guiot, Y., Vander Mierde, D., Pascal, S. M., Schuit, F. C.
& Jonas, J. C. 2007. Acute nutrient regulation of the unfolded protein response
and integrated stress response in cultured rat pancreatic islets. Diabetologia,
50, 1442-52.
Enders, A., Bouillet, P., Puthalakath, H., Xu, Y., Tarlinton, D. M. & Strasser, A. 2003.
Loss of the pro-apoptotic BH3-only Bcl-2 family member Bim inhibits BCR
stimulation-induced apoptosis and deletion of autoreactive B cells. J Exp Med,
198, 1119-26.
Eskes, R., Desagher, S., Antonsson, B. & Martinou, J. C. 2000. Bid induces the
oligomerization and insertion of Bax into the outer mitochondrial membrane.
Mol Cell Biol, 20, 929-35.
![Page 162: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/162.jpg)
134
Fang, W., Rivard, J. J., Mueller, D. L. & Behrens, T. W. 1994. Cloning and molecular
characterization of mouse bcl-x in B and T lymphocytes. Journal of
immunology, 153, 4388-98.
Ferraro, A., Socci, C., Stabilini, A., Valle, A., Monti, P., Piemonti, L., Nano, R., Olek,
S., Maffi, P., Scavini, M., Secchi, A., Staudacher, C., Bonifacio, E. &
Battaglia, M. 2011. Expansion of Th17 cells and functional defects in T
regulatory cells are key features of the pancreatic lymph nodes in patients with
type 1 diabetes. Diabetes, 60, 2903-13.
Foufelle, F. & Fromenty, B. 2016. Role of endoplasmic reticulum stress in drug-
induced toxicity. Pharmacol Res Perspect, 4, e00211.
Fujiwara, M., Izuishi, K., Sano, T., Hossain, M. A., Kimura, S., Masaki, T. & Suzuki,
Y. 2008. Modulating effect of the PI3-kinase inhibitor LY294002 on cisplatin
in human pancreatic cancer cells. J Exp Clin Cancer Res, 27, 76.
Garcia-Saez, A. J., Ries, J., Orzaez, M., Perez-Paya, E. & Schwille, P. 2009.
Membrane promotes tBID interaction with BCL(XL). Nat Struct Mol Biol, 16,
1178-85.
Gotoh, T., Terada, K., Oyadomari, S. & Mori, M. 2004. hsp70-DnaJ chaperone pair
prevents nitric oxide- and CHOP-induced apoptosis by inhibiting translocation
of Bax to mitochondria. Cell death and differentiation, 11, 390-402.
Green, D. R. & Kroemer, G. 2004. The pathophysiology of mitochondrial cell death.
Science, 305, 626-9.
Griffiths, G. J., Dubrez, L., Morgan, C. P., Jones, N. A., Whitehouse, J., Corfe, B. M.,
Dive, C. & Hickman, J. A. 1999. Cell damage-induced conformational changes
of the pro-apoptotic protein Bak in vivo precede the onset of apoptosis. The
Journal of cell biology, 144, 903-14.
Gross, A., Jockel, J., Wei, M. C. & Korsmeyer, S. J. 1998. Enforced dimerization of
BAX results in its translocation, mitochondrial dysfunction and apoptosis. The
EMBO journal, 17, 3878-85.
Gross, A., Mcdonnell, J. M. & Korsmeyer, S. J. 1999. BCL-2 family members and the
mitochondria in apoptosis. Genes & development, 13, 1899-911.
Grunnet, L. G., Aikin, R., Tonnesen, M. F., Paraskevas, S., Blaabjerg, L., Storling, J.,
Rosenberg, L., Billestrup, N., Maysinger, D. & Mandrup-Poulsen, T. 2009.
Proinflammatory cytokines activate the intrinsic apoptotic pathway in beta-
cells. Diabetes, 58, 1807-15.
Gysemans, C. A., Ladriere, L., Callewaert, H., Rasschaert, J., Flamez, D., Levy, D. E.,
Matthys, P., Eizirik, D. L. & Mathieu, C. 2005. Disruption of the gamma-
interferon signaling pathway at the level of signal transducer and activator of
transcription-1 prevents immune destruction of beta-cells. Diabetes, 54, 2396-
403.
Hamasaki, A., Sendo, F., Nakayama, K., Ishida, N., Negishi, I., Nakayama, K. &
Hatakeyama, S. 1998. Accelerated neutrophil apoptosis in mice lacking A1-a, a
subtype of the bcl-2-related A1 gene. J Exp Med, 188, 1985-92.
Hart, A., Papadopoulou, S. & Edlund, H. 2003. Fgf10 maintains notch activation,
stimulates proliferation, and blocks differentiation of pancreatic epithelial cells.
Developmental dynamics : an official publication of the American Association
of Anatomists, 228, 185-93.
Haughn, L., Hawley, R. G., Morrison, D. K., Von Boehmer, H. & Hockenbery, D. M.
2003. BCL-2 and BCL-XL restrict lineage choice during hematopoietic
differentiation. J Biol Chem, 278, 25158-65.
![Page 163: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/163.jpg)
135
Hebrok, M. 2003. Hedgehog signaling in pancreas development. Mechanisms of
development, 120, 45-57.
Hebrok, M., Kim, S. K. & Melton, D. A. 1998. Notochord repression of endodermal
Sonic hedgehog permits pancreas development. Genes & development, 12,
1705-13.
Heermeier, K., Benedict, M., Li, M., Furth, P., Nunez, G. & Hennighausen, L. 1996.
Bax and Bcl-xs are induced at the onset of apoptosis in involuting mammary
epithelial cells. Mechanisms of development, 56, 197-207.
Heifetz, A., Keenan, R. W. & Elbein, A. D. 1979. Mechanism of action of
tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate
transferase. Biochemistry, 18, 2186-92.
Heiser, P. W., Lau, J., Taketo, M. M., Herrera, P. L. & Hebrok, M. 2006. Stabilization
of beta-catenin impacts pancreas growth. Development, 133, 2023-32.
Heller, R. S., Dichmann, D. S., Jensen, J., Miller, C., Wong, G., Madsen, O. D. &
Serup, P. 2002. Expression patterns of Wnts, Frizzleds, sFRPs, and
misexpression in transgenic mice suggesting a role for Wnts in pancreas and
foregut pattern formation. Dev Dyn, 225, 260-70.
Hill, M. M., Adrain, C., Duriez, P. J., Creagh, E. M. & Martin, S. J. 2004. Analysis of
the composition, assembly kinetics and activity of native Apaf-1 apoptosomes.
The EMBO journal, 23, 2134-45.
Hockenbery, D. M., Oltvai, Z. N., Yin, X. M., Milliman, C. L. & Korsmeyer, S. J.
1993. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell, 75,
241-51.
Hsu, Y. T., Wolter, K. G. & Youle, R. J. 1997. Cytosol-to-membrane redistribution of
Bax and Bcl-X(L) during apoptosis. Proceedings of the National Academy of
Sciences of the United States of America, 94, 3668-72.
Huang, D. C. & Strasser, A. 2000. BH3-Only proteins-essential initiators of apoptotic
cell death. Cell, 103, 839-42.
Ikezawa, K., Hikita, H., Shigekawa, M., Iwahashi, K., Eguchi, H., Sakamori, R.,
Tatsumi, T. & Takehara, T. 2017. Increased Bcl-xL Expression in Pancreatic
Neoplasia Promotes Carcinogenesis by Inhibiting Senescence and Apoptosis.
Cell Mol Gastroenterol Hepatol, 4, 185-200 e1.
Inman, G. J., Nicolas, F. J., Callahan, J. F., Harling, J. D., Gaster, L. M., Reith, A. D.,
Laping, N. J. & Hill, C. S. 2002. SB-431542 is a potent and specific inhibitor
of transforming growth factor-beta superfamily type I activin receptor-like
kinase (ALK) receptors ALK4, ALK5, and ALK7. Molecular pharmacology,
62, 65-74.
Jensen, J. 2004. Gene regulatory factors in pancreatic development. Developmental
dynamics : an official publication of the American Association of Anatomists,
229, 176-200.
Jiang, H., Fan, D., Zhou, G., Li, X. & Deng, H. 2010. Phosphatidylinositol 3-kinase
inhibitor(LY294002) induces apoptosis of human nasopharyngeal carcinoma in
vitro and in vivo. J Exp Clin Cancer Res, 29, 34.
Jiang, H. Y., Wek, S. A., Mcgrath, B. C., Lu, D., Hai, T., Harding, H. P., Wang, X.,
Ron, D., Cavener, D. R. & Wek, R. C. 2004. Activating transcription factor 3
is integral to the eukaryotic initiation factor 2 kinase stress response. Molecular
and cellular biology, 24, 1365-77.
Jiang, J., Au, M., Lu, K., Eshpeter, A., Korbutt, G., Fisk, G. & Majumdar, A. S. 2007a.
Generation of insulin-producing islet-like clusters from human embryonic stem
cells. Stem cells, 25, 1940-53.
![Page 164: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/164.jpg)
136
Jiang, W., Shi, Y., Zhao, D., Chen, S., Yong, J., Zhang, J., Qing, T., Sun, X., Zhang,
P., Ding, M., Li, D. & Deng, H. 2007b. In vitro derivation of functional
insulin-producing cells from human embryonic stem cells. Cell research, 17,
333-44.
Juan, W. C., Roca, X. & Ong, S. T. 2014. Identification of cis-acting elements and
splicing factors involved in the regulation of BIM Pre-mRNA splicing. PloS
one, 9, e95210.
Kamada, S., Shimono, A., Shinto, Y., Tsujimura, T., Takahashi, T., Noda, T.,
Kitamura, Y., Kondoh, H. & Tsujimoto, Y. 1995. bcl-2 deficiency in mice
leads to pleiotropic abnormalities: accelerated lymphoid cell death in thymus
and spleen, polycystic kidney, hair hypopigmentation, and distorted small
intestine. Cancer Res, 55, 354-9.
Kane, D. J., Sarafian, T. A., Anton, R., Hahn, H., Gralla, E. B., Valentine, J. S., Ord,
T. & Bredesen, D. E. 1993. Bcl-2 inhibition of neural death: decreased
generation of reactive oxygen species. Science, 262, 1274-7.
Keller, R. K., Boon, D. Y. & Crum, F. C. 1979. N-Acetylglucosamine- 1 -phosphate
transferase from hen oviduct: solubilization, characterization, and inhibition by
tunicamycin. Biochemistry, 18, 3946-52.
Kim, H., Rafiuddin-Shah, M., Tu, H. C., Jeffers, J. R., Zambetti, G. P., Hsieh, J. J. &
Cheng, E. H. 2006. Hierarchical regulation of mitochondrion-dependent
apoptosis by BCL-2 subfamilies. Nature cell biology, 8, 1348-58.
Kim, H. J., Schleiffarth, J. R., Jessurun, J., Sumanas, S., Petryk, A., Lin, S. & Ekker,
S. C. 2005. Wnt5 signaling in vertebrate pancreas development. BMC Biol, 3,
23.
Kim, I., Xu, W. & Reed, J. C. 2008. Cell death and endoplasmic reticulum stress:
disease relevance and therapeutic opportunities. Nature reviews. Drug
discovery, 7, 1013-30.
Kim, J. H., Sim, S. H., Ha, H. J., Ko, J. J., Lee, K. & Bae, J. 2009. MCL-1ES, a novel
variant of MCL-1, associates with MCL-1L and induces mitochondrial cell
death. FEBS Lett, 583, 2758-64.
King Pan Ng, Axel M Hillmer, Charles T H Chuah, Wen Chun Juan, Tun Kiat Ko,
Audrey S M Teo, Pramila N Ariyaratne, Naoto Takahashi, Kenichi Sawada,
Yao Fei, Sheila Soh, Wah Heng Lee, John W J Huang, John C Allen Jr, Xing
Yi Woo, Niranjan Nagarajan, Vikrant Kumar, Anbupalam Thalamuthu, Wan
Ting Poh, Ai Leen Ang, Hae Tha Mya, Gee Fung How, Li Yi Yang, Liang Piu
Koh, Balram Chowbay, Chia-Tien Chang, Veera S Nadarajan, Wee Joo Chng,
Hein Than, Lay Cheng Lim, Yeow Tee Goh, Shenli Zhang, Dianne Poh,
Patrick Tan, Ju-Ee Seet, Mei-Kim Ang, Noan-Minh Chau, Quan-Sing Ng,
Daniel S W Tan, Manabu Soda, Kazutoshi Isobe, Markus M Nöthen, Tien Y
Wong, Atif Shahab, Xiaoan Ruan, Valère Cacheux-Rataboul, Wing-Kin Sung,
Eng Huat Tan, Yasushi Yatabe, Hiroyuki Mano, Ross a Soo, Tan Min Chin,
Wan-Teck Lim, Ruan, Y. & Ong, S. T. 2012. A common BIM deletion
polymorphism mediates intrinsic resistance and inferior responses to tyrosine
kinase inhibitors in cancer. Nature Medicine, 18, 521-528.
Kodama, T., Hikita, H., Kawaguchi, T., Shigekawa, M., Shimizu, S., Hayashi, Y., Li,
W., Miyagi, T., Hosui, A., Tatsumi, T., Kanto, T., Hiramatsu, N., Kiyomizu,
K., Tadokoro, S., Tomiyama, Y., Hayashi, N. & Takehara, T. 2012. Mcl-1 and
Bcl-xL regulate Bak/Bax-dependent apoptosis of the megakaryocytic lineage at
multistages. Cell Death Differ, 19, 1856-69.
![Page 165: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/165.jpg)
137
Korsmeyer, S. J., Shutter, J. R., Veis, D. J., Merry, D. E. & Oltvai, Z. N. 1993. Bcl-
2/Bax: a rheostat that regulates an anti-oxidant pathway and cell death.
Seminars in cancer biology, 4, 327-32.
Korsmeyer, S. J., Wei, M. C., Saito, M., Weiler, S., Oh, K. J. & Schlesinger, P. H.
2000. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX
into pores that result in the release of cytochrome c. Cell Death Differ, 7, 1166-
73.
Koseki, T., Yamato, K., Krajewski, S., Reed, J. C., Tsujimoto, Y. & Nishihara, T.
1995. Activin A-induced apoptosis is suppressed by BCL-2. FEBS Lett, 376,
247-50.
Kozopas, K. M., Yang, T., Buchan, H. L., Zhou, P. & Craig, R. W. 1993. MCL1, a
gene expressed in programmed myeloid cell differentiation, has sequence
similarity to BCL2. Proc Natl Acad Sci U S A, 90, 3516-20.
Kroon, E., Martinson, L. A., Kadoya, K., Bang, A. G., Kelly, O. G., Eliazer, S.,
Young, H., Richardson, M., Smart, N. G., Cunningham, J., Agulnick, A. D.,
D'amour, K. A., Carpenter, M. K. & Baetge, E. E. 2008. Pancreatic endoderm
derived from human embryonic stem cells generates glucose-responsive
insulin-secreting cells in vivo. Nature biotechnology, 26, 443-52.
Ku, B., Liang, C., Jung, J. U. & Oh, B. H. 2011. Evidence that inhibition of BAX
activation by BCL-2 involves its tight and preferential interaction with the BH3
domain of BAX. Cell research, 21, 627-41.
Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R. & Moon, R. T. 2000. The Wnt/Ca2+
pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet,
16, 279-83.
Kutlu, B., Cardozo, A. K., Darville, M. I., Kruhoffer, M., Magnusson, N., Orntoft, T.
& Eizirik, D. L. 2003. Discovery of gene networks regulating cytokine-induced
dysfunction and apoptosis in insulin-producing INS-1 cells. Diabetes, 52,
2701-19.
Kuwana, T., Bouchier-Hayes, L., Chipuk, J. E., Bonzon, C., Sullivan, B. A., Green, D.
R. & Newmeyer, D. D. 2005a. BH3 domains of BH3-only proteins
differentially regulate Bax-mediated mitochondrial membrane permeabilization
both directly and indirectly. Molecular cell, 17, 525-35.
Kuwana, T., Bouchier-Hayes, L., Chipuk, J. E., Bonzon, C., Sullivan, B. A., Green, D.
R. & Newmeyer, D. D. 2005b. BH3 domains of BH3-only proteins
differentially regulate Bax-mediated mitochondrial membrane permeabilization
both directly and indirectly. Mol Cell, 17, 525-35.
Leber, B., Lin, J. & Andrews, D. W. 2007. Embedded together: the life and death
consequences of interaction of the Bcl-2 family with membranes. Apoptosis,
12, 897-911.
Lee, E. F., Grabow, S., Chappaz, S., Dewson, G., Hockings, C., Kluck, R. M.,
Debrincat, M. A., Gray, D. H., Witkowski, M. T., Evangelista, M.,
Pettikiriarachchi, A., Bouillet, P., Lane, R. M., Czabotar, P. E., Colman, P. M.,
Smith, B. J., Kile, B. T. & Fairlie, W. D. 2016. Physiological restraint of Bak
by Bcl-xL is essential for cell survival. Genes Dev, 30, 1240-50.
Leimeister, C., Bach, A. & Gessler, M. 1998. Developmental expression patterns of
mouse sFRP genes encoding members of the secreted frizzled related protein
family. Mech Dev, 75, 29-42.
Letai, A., Bassik, M. C., Walensky, L. D., Sorcinelli, M. D., Weiler, S. & Korsmeyer,
S. J. 2002. Distinct BH3 domains either sensitize or activate mitochondrial
apoptosis, serving as prototype cancer therapeutics. Cancer cell, 2, 183-92.
![Page 166: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/166.jpg)
138
Ley, R., Balmanno, K., Hadfield, K., Weston, C. & Cook, S. J. 2003. Activation of the
ERK1/2 signaling pathway promotes phosphorylation and proteasome-
dependent degradation of the BH3-only protein, Bim. The Journal of
biological chemistry, 278, 18811-6.
Li, J., Lee, B. & Lee, A. S. 2006. Endoplasmic reticulum stress-induced apoptosis:
multiple pathways and activation of p53-up-regulated modulator of apoptosis
(PUMA) and NOXA by p53. The Journal of biological chemistry, 281, 7260-
70.
Li, Y., Rankin, S. A., Sinner, D., Kenny, A. P., Krieg, P. A. & Zorn, A. M. 2008.
Sfrp5 coordinates foregut specification and morphogenesis by antagonizing
both canonical and noncanonical Wnt11 signaling. Genes Dev, 22, 3050-63.
Lin, K., Wang, S., Julius, M. A., Kitajewski, J., Moos, M., Jr. & Luyten, F. P. 1997.
The cysteine-rich frizzled domain of Frzb-1 is required and sufficient for
modulation of Wnt signaling. Proc Natl Acad Sci U S A, 94, 11196-200.
Lipson, K. L., Fonseca, S. G., Ishigaki, S., Nguyen, L. X., Foss, E., Bortell, R.,
Rossini, A. A. & Urano, F. 2006. Regulation of insulin biosynthesis in
pancreatic beta cells by an endoplasmic reticulum-resident protein kinase
IRE1. Cell metabolism, 4, 245-54.
Llambi, F., Moldoveanu, T., Tait, S. W., Bouchier-Hayes, L., Temirov, J., Mccormick,
L. L., Dillon, C. P. & Green, D. R. 2011. A unified model of mammalian BCL-
2 protein family interactions at the mitochondria. Mol Cell, 44, 517-31.
Llambi, F., Wang, Y. M., Victor, B., Yang, M., Schneider, D. M., Gingras, S.,
Parsons, M. J., Zheng, J. H., Brown, S. A., Pelletier, S., Moldoveanu, T., Chen,
T. & Green, D. R. 2016. BOK Is a Non-canonical BCL-2 Family Effector of
Apoptosis Regulated by ER-Associated Degradation. Cell, 165, 421-33.
Loo, L. S. W., Lau, H. H., Jasmen, J. B., Lim, C. S. & Teo, A. K. K. 2018. An arduous
journey from human pluripotent stem cells to functional pancreatic beta cells.
Diabetes Obes Metab, 20, 3-13.
Lovell, J. F., Billen, L. P., Bindner, S., Shamas-Din, A., Fradin, C., Leber, B. &
Andrews, D. W. 2008. Membrane binding by tBid initiates an ordered series of
events culminating in membrane permeabilization by Bax. Cell, 135, 1074-84.
Luciani, D. S., White, S. A., Widenmaier, S. B., Saran, V. V., Taghizadeh, F., Hu, X.,
Allard, M. F. & Johnson, J. D. 2013. Bcl-2 and Bcl-xL suppress glucose
signaling in pancreatic beta-cells. Diabetes, 62, 170-82.
Luciano, F., Jacquel, A., Colosetti, P., Herrant, M., Cagnol, S., Pages, G. & Auberger,
P. 2003. Phosphorylation of Bim-EL by Erk1/2 on serine 69 promotes its
degradation via the proteasome pathway and regulates its proapoptotic
function. Oncogene, 22, 6785-93.
Ma, A., Pena, J. C., Chang, B., Margosian, E., Davidson, L., Alt, F. W. & Thompson,
C. B. 1995. Bclx regulates the survival of double-positive thymocytes. Proc
Natl Acad Sci U S A, 92, 4763-7.
Ma, Y., Brewer, J. W., Diehl, J. A. & Hendershot, L. M. 2002. Two distinct stress
signaling pathways converge upon the CHOP promoter during the mammalian
unfolded protein response. Journal of molecular biology, 318, 1351-65.
Makin, G. W., Corfe, B. M., Griffiths, G. J., Thistlethwaite, A., Hickman, J. A. &
Dive, C. 2001. Damage-induced Bax N-terminal change, translocation to
mitochondria and formation of Bax dimers/complexes occur regardless of cell
fate. The EMBO journal, 20, 6306-15.
![Page 167: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/167.jpg)
139
Marani, M., Tenev, T., Hancock, D., Downward, J. & Lemoine, N. R. 2002.
Identification of novel isoforms of the BH3 domain protein Bim which directly
activate Bax to trigger apoptosis. Mol Cell Biol, 22, 3577-89.
Marciniak, S. J. & Ron, D. 2006. Endoplasmic reticulum stress signaling in disease.
Physiological reviews, 86, 1133-49.
Martin, M., Gallego-Llamas, J., Ribes, V., Kedinger, M., Niederreither, K., Chambon,
P., Dolle, P. & Gradwohl, G. 2005. Dorsal pancreas agenesis in retinoic acid-
deficient Raldh2 mutant mice. Developmental biology, 284, 399-411.
Mathai, J. P., Germain, M. & Shore, G. C. 2005. BH3-only BIK regulates BAX,BAK-
dependent release of Ca2+ from endoplasmic reticulum stores and
mitochondrial apoptosis during stress-induced cell death. The Journal of
biological chemistry, 280, 23829-36.
Matveyenko, A. V., Georgia, S., Bhushan, A. & Butler, P. C. 2010. Inconsistent
formation and nonfunction of insulin-positive cells from pancreatic endoderm
derived from human embryonic stem cells in athymic nude rats. American
journal of physiology. Endocrinology and metabolism, 299, E713-20.
Mccullough, K. D., Martindale, J. L., Klotz, L. O., Aw, T. Y. & Holbrook, N. J. 2001.
Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating
Bcl2 and perturbing the cellular redox state. Molecular and cellular biology,
21, 1249-59.
Mckenzie, M. D., Jamieson, E., Jansen, E. S., Scott, C. L., Huang, D. C., Bouillet, P.,
Allison, J., Kay, T. W., Strasser, A. & Thomas, H. E. 2010. Glucose induces
pancreatic islet cell apoptosis that requires the BH3-only proteins Bim and
Puma and multi-BH domain protein Bax. Diabetes, 59, 644-52.
Mclean, A. B., D'amour, K. A., Jones, K. L., Krishnamoorthy, M., Kulik, M. J.,
Reynolds, D. M., Sheppard, A. M., Liu, H., Xu, Y., Baetge, E. E. & Dalton, S.
2007. Activin a efficiently specifies definitive endoderm from human
embryonic stem cells only when phosphatidylinositol 3-kinase signaling is
suppressed. Stem cells, 25, 29-38.
Mclin, V. A., Rankin, S. A. & Zorn, A. M. 2007. Repression of Wnt/beta-catenin
signaling in the anterior endoderm is essential for liver and pancreas
development. Development, 134, 2207-17.
Mehmeti, I., Lenzen, S. & Lortz, S. 2011. Modulation of Bcl-2-related protein
expression in pancreatic beta cells by pro-inflammatory cytokines and its
dependence on the antioxidative defense status. Molecular and cellular
endocrinology, 332, 88-96.
Meller, R., Cameron, J. A., Torrey, D. J., Clayton, C. E., Ordonez, A. N., Henshall, D.
C., Minami, M., Schindler, C. K., Saugstad, J. A. & Simon, R. P. 2006. Rapid
degradation of Bim by the ubiquitin-proteasome pathway mediates short-term
ischemic tolerance in cultured neurons. J Biol Chem, 281, 7429-36.
Meyerovich, K., Violato, N. M., Fukaya, M., Dirix, V., Pachera, N., Marselli, L.,
Marchetti, P., Strasser, A., Eizirik, D. L. & Cardozo, A. K. 2017. MCL-1 Is a
Key Antiapoptotic Protein in Human and Rodent Pancreatic beta-Cells.
Diabetes, 66, 2446-2458.
Mfopou, J. K., Chen, B., Sui, L., Sermon, K. & Bouwens, L. 2010. Recent advances
and prospects in the differentiation of pancreatic cells from human embryonic
stem cells. Diabetes, 59, 2094-101.
Miani, M., Barthson, J., Colli, M. L., Brozzi, F., Cnop, M. & Eizirik, D. L. 2013a.
Endoplasmic reticulum stress sensitizes pancreatic beta cells to interleukin-
1beta-induced apoptosis via Bim/A1 imbalance. Cell Death Dis, 4, e701.
![Page 168: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/168.jpg)
140
Miani, M., Barthson, J., Colli, M. L., Brozzi, F., Cnop, M. & Eizirik, D. L. 2013b.
Endoplasmic reticulum stress sensitizes pancreatic beta cells to interleukin-
1beta-induced apoptosis via Bim/A1 imbalance. Cell death & disease, 4, e701.
Millman, J. R., Xie, C., Van Dervort, A., Gurtler, M., Pagliuca, F. W. & Melton, D. A.
2016. Generation of stem cell-derived beta-cells from patients with type 1
diabetes. Nature communications, 7, 11463.
Molotkov, A., Molotkova, N. & Duester, G. 2005. Retinoic acid generated by Raldh2
in mesoderm is required for mouse dorsal endodermal pancreas development.
Developmental dynamics : an official publication of the American Association
of Anatomists, 232, 950-7.
Morishima, N., Nakanishi, K., Tsuchiya, K., Shibata, T. & Seiwa, E. 2004.
Translocation of Bim to the endoplasmic reticulum (ER) mediates ER stress
signaling for activation of caspase-12 during ER stress-induced apoptosis. The
Journal of biological chemistry, 279, 50375-81.
Motoyama, N., Wang, F., Roth, K. A., Sawa, H., Nakayama, K., Nakayama, K.,
Negishi, I., Senju, S., Zhang, Q., Fujii, S. & Et Al. 1995. Massive cell death of
immature hematopoietic cells and neurons in Bcl-x-deficient mice. Science,
267, 1506-10.
Nadauld, L. D., Sandoval, I. T., Chidester, S., Yost, H. J. & Jones, D. A. 2004.
Adenomatous polyposis coli control of retinoic acid biosynthesis is critical for
zebrafish intestinal development and differentiation. J Biol Chem, 279, 51581-
9.
Nakamura, A., Swahari, V., Plestant, C., Smith, I., Mccoy, E., Smith, S., Moy, S. S.,
Anton, E. S. & Deshmukh, M. 2016. Bcl-xL Is Essential for the Survival and
Function of Differentiated Neurons in the Cortex That Control Complex
Behaviors. J Neurosci, 36, 5448-61.
Nakayama, K., Nakayama, K., Negishi, I., Kuida, K., Sawa, H. & Loh, D. Y. 1994.
Targeted disruption of Bcl-2 alpha beta in mice: occurrence of gray hair,
polycystic kidney disease, and lymphocytopenia. Proc Natl Acad Sci U S A,
91, 3700-4.
Nechushtan, A., Smith, C. L., Hsu, Y. T. & Youle, R. J. 1999. Conformation of the
Bax C-terminus regulates subcellular location and cell death. EMBO J, 18,
2330-41.
Newmeyer, D. D. & Ferguson-Miller, S. 2003. Mitochondria: releasing power for life
and unleashing the machineries of death. Cell, 112, 481-90.
Ng, F. W., Nguyen, M., Kwan, T., Branton, P. E., Nicholson, D. W., Cromlish, J. A. &
Shore, G. C. 1997. p28 Bap31, a Bcl-2/Bcl-XL- and procaspase-8-associated
protein in the endoplasmic reticulum. J Cell Biol, 139, 327-38.
Ng, K. P., Hillmer, A. M., Chuah, C. T., Juan, W. C., Ko, T. K., Teo, A. S.,
Ariyaratne, P. N., Takahashi, N., Sawada, K., Fei, Y., Soh, S., Lee, W. H.,
Huang, J. W., Allen, J. C., Jr., Woo, X. Y., Nagarajan, N., Kumar, V.,
Thalamuthu, A., Poh, W. T., Ang, A. L., Mya, H. T., How, G. F., Yang, L. Y.,
Koh, L. P., Chowbay, B., Chang, C. T., Nadarajan, V. S., Chng, W. J., Than,
H., Lim, L. C., Goh, Y. T., Zhang, S., Poh, D., Tan, P., Seet, J. E., Ang, M. K.,
Chau, N. M., Ng, Q. S., Tan, D. S., Soda, M., Isobe, K., Nothen, M. M., Wong,
T. Y., Shahab, A., Ruan, X., Cacheux-Rataboul, V., Sung, W. K., Tan, E. H.,
Yatabe, Y., Mano, H., Soo, R. A., Chin, T. M., Lim, W. T., Ruan, Y. & Ong, S.
T. 2012. A common BIM deletion polymorphism mediates intrinsic resistance
and inferior responses to tyrosine kinase inhibitors in cancer. Nature medicine,
18, 521-8.
![Page 169: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/169.jpg)
141
Nishihara, T., Okahashi, N. & Ueda, N. 1993. Activin A induces apoptotic cell death.
Biochem Biophys Res Commun, 197, 985-91.
Noble, J. A., Valdes, A. M., Varney, M. D., Carlson, J. A., Moonsamy, P., Fear, A. L.,
Lane, J. A., Lavant, E., Rappner, R., Louey, A., Concannon, P., Mychaleckyj,
J. C., Erlich, H. A. & Type 1 Diabetes Genetics, C. 2010. HLA class I and
genetic susceptibility to type 1 diabetes: results from the Type 1 Diabetes
Genetics Consortium. Diabetes, 59, 2972-9.
Nogueira, T. C., Paula, F. M., Villate, O., Colli, M. L., Moura, R. F., Cunha, D. A.,
Marselli, L., Marchetti, P., Cnop, M., Julier, C. & Eizirik, D. L. 2013. GLIS3, a
susceptibility gene for type 1 and type 2 diabetes, modulates pancreatic beta
cell apoptosis via regulation of a splice variant of the BH3-only protein Bim.
PLoS genetics, 9, e1003532.
Nostro, M. C., Sarangi, F., Ogawa, S., Holtzinger, A., Corneo, B., Li, X., Micallef, S.
J., Park, I. H., Basford, C., Wheeler, M. B., Daley, G. Q., Elefanty, A. G.,
Stanley, E. G. & Keller, G. 2011. Stage-specific signaling through TGFbeta
family members and WNT regulates patterning and pancreatic specification of
human pluripotent stem cells. Development, 138, 861-71.
O'connor, L., Strasser, A., O'reilly, L. A., Hausmann, G., Adams, J. M., Cory, S. &
Huang, D. C. 1998. Bim: a novel member of the Bcl-2 family that promotes
apoptosis. The EMBO journal, 17, 384-95.
O'reilly, L. A., Cullen, L., Visvader, J., Lindeman, G. J., Print, C., Bath, M. L., Huang,
D. C. & Strasser, A. 2000. The proapoptotic BH3-only protein bim is
expressed in hematopoietic, epithelial, neuronal, and germ cells. The American
journal of pathology, 157, 449-61.
Oakes, S. A., Lin, S. S. & Bassik, M. C. 2006. The control of endoplasmic reticulum-
initiated apoptosis by the BCL-2 family of proteins. Current molecular
medicine, 6, 99-109.
Oakes, S. A., Scorrano, L., Opferman, J. T., Bassik, M. C., Nishino, M., Pozzan, T. &
Korsmeyer, S. J. 2005. Proapoptotic BAX and BAK regulate the type 1 inositol
trisphosphate receptor and calcium leak from the endoplasmic reticulum.
Proceedings of the National Academy of Sciences of the United States of
America, 102, 105-10.
Oltvai, Z. N., Milliman, C. L. & Korsmeyer, S. J. 1993. Bcl-2 heterodimerizes in vivo
with a conserved homolog, Bax, that accelerates programmed cell death. Cell,
74, 609-19.
Opferman, J. T., Iwasaki, H., Ong, C. C., Suh, H., Mizuno, S., Akashi, K. &
Korsmeyer, S. J. 2005. Obligate role of anti-apoptotic MCL-1 in the survival of
hematopoietic stem cells. Science, 307, 1101-4.
Opferman, J. T., Letai, A., Beard, C., Sorcinelli, M. D., Ong, C. C. & Korsmeyer, S. J.
2003. Development and maintenance of B and T lymphocytes requires
antiapoptotic MCL-1. Nature, 426, 671-6.
Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y.,
Cowan, C. A., Chien, K. R. & Melton, D. A. 2008. Marked differences in
differentiation propensity among human embryonic stem cell lines. Nature
biotechnology, 26, 313-5.
Otonkoski, T., Beattie, G. M., Mally, M. I., Ricordi, C. & Hayek, A. 1993.
Nicotinamide is a potent inducer of endocrine differentiation in cultured human
fetal pancreatic cells. The Journal of clinical investigation, 92, 1459-66.
Oyadomari, S. & Mori, M. 2004. Roles of CHOP/GADD153 in endoplasmic reticulum
stress. Cell death and differentiation, 11, 381-9.
![Page 170: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/170.jpg)
142
Oyadomari, S., Takeda, K., Takiguchi, M., Gotoh, T., Matsumoto, M., Wada, I.,
Akira, S., Araki, E. & Mori, M. 2001. Nitric oxide-induced apoptosis in
pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway.
Proceedings of the National Academy of Sciences of the United States of
America, 98, 10845-50.
Pagliuca, F. W., Millman, J. R., Gurtler, M., Segel, M., Van Dervort, A., Ryu, J. H.,
Peterson, Q. P., Greiner, D. & Melton, D. A. 2014. Generation of functional
human pancreatic beta cells in vitro. Cell, 159, 428-39.
Papadopoulou, S. & Edlund, H. 2005. Attenuated Wnt signaling perturbs pancreatic
growth but not pancreatic function. Diabetes, 54, 2844-51.
Park, H. A., Licznerski, P., Mnatsakanyan, N., Niu, Y., Sacchetti, S., Wu, J., Polster,
B. M., Alavian, K. N. & Jonas, E. A. 2017. Inhibition of Bcl-xL prevents pro-
death actions of DeltaN-Bcl-xL at the mitochondrial inner membrane during
glutamate excitotoxicity. Cell Death Differ, 24, 1963-1974.
Pecot, J., Maillet, L., Le Pen, J., Vuillier, C., Trecesson, S. C., Fetiveau, A., Sarosiek,
K. A., Bock, F. J., Braun, F., Letai, A., Tait, S. W. G., Gautier, F. & Juin, P. P.
2016. Tight Sequestration of BH3 Proteins by BCL-xL at Subcellular
Membranes Contributes to Apoptotic Resistance. Cell Rep, 17, 3347-3358.
Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. P., Chipperfield, H., Tan, E. K.,
Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W.,
Colman, A. & Dunn, N. R. 2007. Directed differentiation of human embryonic
stem cells into the pancreatic endocrine lineage. Stem cells and development,
16, 561-78.
Pierson, W., Cauwe, B., Policheni, A., Schlenner, S. M., Franckaert, D., Berges, J.,
Humblet-Baron, S., Schonefeldt, S., Herold, M. J., Hildeman, D., Strasser, A.,
Bouillet, P., Lu, L. F., Matthys, P., Freitas, A. A., Luther, R. J., Weaver, C. T.,
Dooley, J., Gray, D. H. & Liston, A. 2013. Antiapoptotic Mcl-1 is critical for
the survival and niche-filling capacity of Foxp3(+) regulatory T cells. Nat
Immunol, 14, 959-65.
Piro, S., Lupi, R., Dotta, F., Patane, G., Rabuazzo, M. A., Marselli, L., Santangelo, C.,
Realacci, M., Del Guerra, S., Purrello, F. & Marchetti, P. 2001. Bovine islets
are less susceptible than human islets to damage by human cytokines.
Transplantation, 71, 21-6.
Pirot, P., Eizirik, D. L. & Cardozo, A. K. 2006. Interferon-gamma potentiates
endoplasmic reticulum stress-induced death by reducing pancreatic beta cell
defence mechanisms. Diabetologia, 49, 1229-36.
Pirot, P., Ortis, F., Cnop, M., Ma, Y., Hendershot, L. M., Eizirik, D. L. & Cardozo, A.
K. 2007. Transcriptional regulation of the endoplasmic reticulum stress gene
chop in pancreatic insulin-producing cells. Diabetes, 56, 1069-77.
Print, C. G., Loveland, K. L., Gibson, L., Meehan, T., Stylianou, A., Wreford, N., De
Kretser, D., Metcalf, D., Kontgen, F., Adams, J. M. & Cory, S. 1998.
Apoptosis regulator bcl-w is essential for spermatogenesis but appears
otherwise redundant. Proc Natl Acad Sci U S A, 95, 12424-31.
Qu, S., Yan, L., Fang, B., Ye, S., Li, P., Ge, S., Wu, J., Qu, D. & Song, H. 2017.
Generation of enhanced definitive endoderm from human embryonic stem cells
under an albumin/insulin-free and chemically defined condition. Life Sci, 175,
37-46.
Rabinovitch, A., Suarez-Pinzon, W., Strynadka, K., Ju, Q., Edelstein, D., Brownlee,
M., Korbutt, G. S. & Rajotte, R. V. 1999. Transfection of human pancreatic
![Page 171: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/171.jpg)
143
islets with an anti-apoptotic gene (bcl-2) protects beta-cells from cytokine-
induced destruction. Diabetes, 48, 1223-9.
Rasschaert, J., Liu, D., Kutlu, B., Cardozo, A. K., Kruhoffer, M., Tf, O. R. & Eizirik,
D. L. 2003. Global profiling of double stranded RNA- and IFN-gamma-
induced genes in rat pancreatic beta cells. Diabetologia, 46, 1641-57.
Rattner, A., Hsieh, J. C., Smallwood, P. M., Gilbert, D. J., Copeland, N. G., Jenkins,
N. A. & Nathans, J. 1997. A family of secreted proteins contains homology to
the cysteine-rich ligand-binding domain of frizzled receptors. Proc Natl Acad
Sci U S A, 94, 2859-63.
Reimertz, C., Kogel, D., Rami, A., Chittenden, T. & Prehn, J. H. 2003. Gene
expression during ER stress-induced apoptosis in neurons: induction of the
BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis
pathway. The Journal of cell biology, 162, 587-97.
Rezania, A., Bruin, J. E., Arora, P., Rubin, A., Batushansky, I., Asadi, A., O'dwyer, S.,
Quiskamp, N., Mojibian, M., Albrecht, T., Yang, Y. H., Johnson, J. D. &
Kieffer, T. J. 2014. Reversal of diabetes with insulin-producing cells derived in
vitro from human pluripotent stem cells. Nature biotechnology, 32, 1121-33.
Rezania, A., Bruin, J. E., Riedel, M. J., Mojibian, M., Asadi, A., Xu, J., Gauvin, R.,
Narayan, K., Karanu, F., O'neil, J. J., Ao, Z., Warnock, G. L. & Kieffer, T. J.
2012. Maturation of human embryonic stem cell-derived pancreatic progenitors
into functional islets capable of treating pre-existing diabetes in mice.
Diabetes, 61, 2016-29.
Rezania, A., Bruin, J. E., Xu, J., Narayan, K., Fox, J. K., O'neil, J. J. & Kieffer, T. J.
2013. Enrichment of human embryonic stem cell-derived NKX6.1-expressing
pancreatic progenitor cells accelerates the maturation of insulin-secreting cells
in vivo. Stem Cells, 31, 2432-42.
Rezania, A., Riedel, M. J., Wideman, R. D., Karanu, F., Ao, Z., Warnock, G. L. &
Kieffer, T. J. 2011. Production of functional glucagon-secreting alpha-cells
from human embryonic stem cells. Diabetes, 60, 239-47.
Ron, D. & Walter, P. 2007. Signal integration in the endoplasmic reticulum unfolded
protein response. Nature reviews. Molecular cell biology, 8, 519-29.
Rong, Y. & Distelhorst, C. W. 2008. Bcl-2 protein family members: versatile
regulators of calcium signaling in cell survival and apoptosis. Annual review of
physiology, 70, 73-91.
Rosse, T., Olivier, R., Monney, L., Rager, M., Conus, S., Fellay, I., Jansen, B. &
Borner, C. 1998. Bcl-2 prolongs cell survival after Bax-induced release of
cytochrome c. Nature, 391, 496-9.
Rulifson, I. C., Karnik, S. K., Heiser, P. W., Ten Berge, D., Chen, H., Gu, X., Taketo,
M. M., Nusse, R., Hebrok, M. & Kim, S. K. 2007. Wnt signaling regulates
pancreatic beta cell proliferation. Proceedings of the National Academy of
Sciences of the United States of America, 104, 6247-52.
Russ, H. A., Parent, A. V., Ringler, J. J., Hennings, T. G., Nair, G. G., Shveygert, M.,
Guo, T., Puri, S., Haataja, L., Cirulli, V., Blelloch, R., Szot, G. L., Arvan, P. &
Hebrok, M. 2015. Controlled induction of human pancreatic progenitors
produces functional beta-like cells in vitro. EMBO J, 34, 1759-72.
Santin, I., Moore, F., Colli, M. L., Gurzov, E. N., Marselli, L., Marchetti, P. & Eizirik,
D. L. 2011. PTPN2, a candidate gene for type 1 diabetes, modulates pancreatic
beta-cell apoptosis via regulation of the BH3-only protein Bim. Diabetes, 60,
3279-88.
![Page 172: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/172.jpg)
144
Santosa, M. M., Low, B. S., Pek, N. M. & Teo, A. K. 2015. Knowledge Gaps in
Rodent Pancreas Biology: Taking Human Pluripotent Stem Cell-Derived
Pancreatic Beta Cells into Our Own Hands. Front Endocrinol (Lausanne), 6,
194.
Sattler, M., Liang, H., Nettesheim, D., Meadows, R. P., Harlan, J. E., Eberstadt, M.,
Yoon, H. S., Shuker, S. B., Chang, B. S., Minn, A. J., Thompson, C. B. &
Fesik, S. W. 1997. Structure of Bcl-xL-Bak peptide complex: recognition
between regulators of apoptosis. Science, 275, 983-6.
Savitt, J. M., Jang, S. S., Mu, W., Dawson, V. L. & Dawson, T. M. 2005. Bcl-x is
required for proper development of the mouse substantia nigra. J Neurosci, 25,
6721-8.
Schmitt, E., Beauchemin, M. & Bertrand, R. 2007. Nuclear colocalization and
interaction between bcl-xL and cdk1(cdc2) during G2/M cell-cycle checkpoint.
Oncogene, 26, 5851-65.
Schneider, A., Rieck, M., Sanda, S., Pihoker, C., Greenbaum, C. & Buckner, J. H.
2008. The effector T cells of diabetic subjects are resistant to regulation via
CD4+ FOXP3+ regulatory T cells. J Immunol, 181, 7350-5.
Schulz, T. C., Young, H. Y., Agulnick, A. D., Babin, M. J., Baetge, E. E., Bang, A. G.,
Bhoumik, A., Cepa, I., Cesario, R. M., Haakmeester, C., Kadoya, K., Kelly, J.
R., Kerr, J., Martinson, L. A., Mclean, A. B., Moorman, M. A., Payne, J. K.,
Richardson, M., Ross, K. G., Sherrer, E. S., Song, X., Wilson, A. Z., Brandon,
E. P., Green, C. E., Kroon, E. J., Kelly, O. G., D'amour, K. A. & Robins, A. J.
2012. A scalable system for production of functional pancreatic progenitors
from human embryonic stem cells. PloS one, 7, e37004.
Segev, H., Fishman, B., Ziskind, A., Shulman, M. & Itskovitz-Eldor, J. 2004.
Differentiation of human embryonic stem cells into insulin-producing clusters.
Stem cells, 22, 265-74.
Sharon, N., Vanderhooft, J., Straubhaar, J., Mueller, J., Chawla, R., Zhou, Q.,
Engquist, E. N., Trapnell, C., Gifford, D. K. & Melton, D. A. 2019. Wnt
Signaling Separates the Progenitor and Endocrine Compartments during
Pancreas Development. Cell Rep, 27, 2281-2291 e5.
Shim, J. H., Kim, S. E., Woo, D. H., Kim, S. K., Oh, C. H., Mckay, R. & Kim, J. H.
2007. Directed differentiation of human embryonic stem cells towards a
pancreatic cell fate. Diabetologia, 50, 1228-38.
Shimizu, S., Eguchi, Y., Kosaka, H., Kamiike, W., Matsuda, H. & Tsujimoto, Y. 1995.
Prevention of hypoxia-induced cell death by Bcl-2 and Bcl-xL. Nature, 374,
811-3.
Slee, E. A., Harte, M. T., Kluck, R. M., Wolf, B. B., Casiano, C. A., Newmeyer, D. D.,
Wang, H. G., Reed, J. C., Nicholson, D. W., Alnemri, E. S., Green, D. R. &
Martin, S. J. 1999. Ordering the cytochrome c-initiated caspase cascade:
hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-
dependent manner. The Journal of cell biology, 144, 281-92.
Southern, C., Schulster, D. & Green, I. C. 1990. Inhibition of insulin secretion by
interleukin-1 beta and tumour necrosis factor-alpha via an L-arginine-
dependent nitric oxide generating mechanism. FEBS letters, 276, 42-4.
Sui, L., Mfopou, J. K., Chen, B., Sermon, K. & Bouwens, L. 2013. Transplantation of
human embryonic stem cell-derived pancreatic endoderm reveals a site-
specific survival, growth, and differentiation. Cell transplantation, 22, 821-30.
![Page 173: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/173.jpg)
145
Sumantran, V. N., Ealovega, M. W., Nunez, G., Clarke, M. F. & Wicha, M. S. 1995.
Overexpression of Bcl-XS sensitizes MCF-7 cells to chemotherapy-induced
apoptosis. Cancer Res, 55, 2507-10.
Sun, J., Mao, L. Q., Polonsky, K. S. & Ren, D. C. 2016. Pancreatic beta-Cell Death
due to Pdx-1 Deficiency Requires Multi-BH Domain Protein Bax but Not Bak.
The Journal of biological chemistry, 291, 13529-34.
Sun, Y. F., Yu, L. Y., Saarma, M., Timmusk, T. & Arumae, U. 2001. Neuron-specific
Bcl-2 homology 3 domain-only splice variant of Bak is anti-apoptotic in
neurons, but pro-apoptotic in non-neuronal cells. J Biol Chem, 276, 16240-7.
Tajiri, S., Yano, S., Morioka, M., Kuratsu, J., Mori, M. & Gotoh, T. 2006. CHOP is
involved in neuronal apoptosis induced by neurotrophic factor deprivation.
FEBS letters, 580, 3462-8.
Takahashi, K. & Yamanaka, S. 2006. Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell, 126, 663-76.
Takahashi, K. & Yamanaka, S. 2013. Induced pluripotent stem cells in medicine and
biology. Development, 140, 2457-61.
Takeuchi, H., Nakatsuji, N. & Suemori, H. 2014. Endodermal differentiation of human
pluripotent stem cells to insulin-producing cells in 3D culture. Scientific
reports, 4, 4488.
Tan, Y., Lin, Y., Li, K., Xiao, X., Liang, J., Cai, J., Guo, L., Li, C., Zhu, W., Xing, F.,
Mai, J., Gu, J., Tan, X., Yin, W., Lu, B., Qiu, P., Su, X., Gao, M., Hu, J., He,
S., Lu, L., Gong, S., Yan, G. & Zhang, H. 2018. Selective Antagonism of Bcl-
xL Potentiates M1 Oncolysis by Enhancing Mitochondrial Apoptosis. Hum
Gene Ther, 29, 950-961.
Teo, A. K., Ali, Y., Wong, K. Y., Chipperfield, H., Sadasivam, A., Poobalan, Y., Tan,
E. K., Wang, S. T., Abraham, S., Tsuneyoshi, N., Stanton, L. W. & Dunn, N.
R. 2012. Activin and BMP4 synergistically promote formation of definitive
endoderm in human embryonic stem cells. Stem cells, 30, 631-42.
Teo, A. K., Gupta, M. K., Doria, A. & Kulkarni, R. N. 2015a. Dissecting
diabetes/metabolic disease mechanisms using pluripotent stem cells and
genome editing tools. Molecular metabolism, 4, 593-604.
Teo, A. K., Lau, H. H., Valdez, I. A., Dirice, E., Tjora, E., Raeder, H. & Kulkarni, R.
N. 2016. Early Developmental Perturbations in a Human Stem Cell Model of
MODY5/HNF1B Pancreatic Hypoplasia. Stem cell reports, 6, 357-67.
Teo, A. K., Tsuneyoshi, N., Hoon, S., Tan, E. K., Stanton, L. W., Wright, C. V. &
Dunn, N. R. 2015b. PDX1 binds and represses hepatic genes to ensure robust
pancreatic commitment in differentiating human embryonic stem cells. Stem
cell reports, 4, 578-90.
Teo, A. K., Valdez, I. A., Dirice, E. & Kulkarni, R. N. 2014. Comparable generation
of activin-induced definitive endoderm via additive Wnt or BMP signaling in
absence of serum. Stem cell reports, 3, 5-14.
Teo, A. K., Wagers, A. J. & Kulkarni, R. N. 2013. New opportunities: harnessing
induced pluripotency for discovery in diabetes and metabolism. Cell
metabolism, 18, 775-91.
Thomas, D., Yang, H., Boffa, D. J., Ding, R., Sharma, V. K., Lagman, M., Li, B.,
Hering, B., Mohanakumar, T., Lakey, J., Kapur, S., Hancock, W. W. &
Suthanthiran, M. 2002. Proapoptotic Bax is hyperexpressed in isolated human
islets compared with antiapoptotic Bcl-2. Transplantation, 74, 1489-96.
![Page 174: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/174.jpg)
146
Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J.,
Marshall, V. S. & Jones, J. M. 1998. Embryonic stem cell lines derived from
human blastocysts. Science, 282, 1145-7.
Tonnesen, M. F., Grunnet, L. G., Friberg, J., Cardozo, A. K., Billestrup, N., Eizirik, D.
L., Storling, J. & Mandrup-Poulsen, T. 2009. Inhibition of nuclear factor-
kappaB or Bax prevents endoplasmic reticulum stress- but not nitric oxide-
mediated apoptosis in INS-1E cells. Endocrinology, 150, 4094-103.
Trincavelli, M. L., Marselli, L., Falleni, A., Gremigni, V., Ragge, E., Dotta, F.,
Santangelo, C., Marchetti, P., Lucacchini, A. & Martini, C. 2002. Upregulation
of mitochondrial peripheral benzodiazepine receptor expression by cytokine-
induced damage of human pancreatic islets. Journal of cellular biochemistry,
84, 636-44.
Tripathi, P., Koss, B., Opferman, J. T. & Hildeman, D. A. 2013. Mcl-1 antagonizes
Bax/Bak to promote effector CD4(+) and CD8(+) T-cell responses. Cell Death
Differ, 20, 998-1007.
Tsujimoto, Y. 1989. Overexpression of the human BCL-2 gene product results in
growth enhancement of Epstein-Barr virus-immortalized B cells. Proc Natl
Acad Sci U S A, 86, 1958-62.
Tzung, S. P., Fausto, N. & Hockenbery, D. M. 1997. Expression of Bcl-2 family
during liver regeneration and identification of Bcl-x as a delayed early
response gene. Am J Pathol, 150, 1985-95.
Uren, A., Reichsman, F., Anest, V., Taylor, W. G., Muraiso, K., Bottaro, D. P.,
Cumberledge, S. & Rubin, J. S. 2000. Secreted frizzled-related protein-1 binds
directly to Wingless and is a biphasic modulator of Wnt signaling. J Biol
Chem, 275, 4374-82.
Van De Casteele, M., Kefas, B. A., Ling, Z., Heimberg, H. & Pipeleers, D. G. 2002.
Specific expression of Bax-omega in pancreatic beta-cells is down-regulated
by cytokines before the onset of apoptosis. Endocrinology, 143, 320-6.
Van Lummel, M., Duinkerken, G., Van Veelen, P. A., De Ru, A., Cordfunke, R.,
Zaldumbide, A., Gomez-Tourino, I., Arif, S., Peakman, M., Drijfhout, J. W. &
Roep, B. O. 2014. Posttranslational modification of HLA-DQ binding islet
autoantigens in type 1 diabetes. Diabetes, 63, 237-47.
Vander Heiden, M. G., Chandel, N. S., Schumacker, P. T. & Thompson, C. B. 1999.
Bcl-xL prevents cell death following growth factor withdrawal by facilitating
mitochondrial ATP/ADP exchange. Molecular cell, 3, 159-67.
Vander Heiden, M. G., Li, X. X., Gottleib, E., Hill, R. B., Thompson, C. B. &
Colombini, M. 2001. Bcl-xL promotes the open configuration of the voltage-
dependent anion channel and metabolite passage through the outer
mitochondrial membrane. The Journal of biological chemistry, 276, 19414-9.
Vegas, A. J., Veiseh, O., Gurtler, M., Millman, J. R., Pagliuca, F. W., Bader, A. R.,
Doloff, J. C., Li, J., Chen, M., Olejnik, K., Tam, H. H., Jhunjhunwala, S.,
Langan, E., Aresta-Dasilva, S., Gandham, S., Mcgarrigle, J. J., Bochenek, M.
A., Hollister-Lock, J., Oberholzer, J., Greiner, D. L., Weir, G. C., Melton, D.
A., Langer, R. & Anderson, D. G. 2016. Long-term glycemic control using
polymer-encapsulated human stem cell-derived beta cells in immune-
competent mice. Nat Med, 22, 306-11.
Veis, D. J., Sorenson, C. M., Shutter, J. R. & Korsmeyer, S. J. 1993. Bcl-2-deficient
mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and
hypopigmented hair. Cell, 75, 229-40.
![Page 175: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/175.jpg)
147
Vikstrom, I., Carotta, S., Luthje, K., Peperzak, V., Jost, P. J., Glaser, S., Busslinger,
M., Bouillet, P., Strasser, A., Nutt, S. L. & Tarlinton, D. M. 2010. Mcl-1 is
essential for germinal center formation and B cell memory. Science, 330, 1095-
9.
Wandzioch, E. & Zaret, K. S. 2009. Dynamic signaling network for the specification
of embryonic pancreas and liver progenitors. Science, 324, 1707-10.
Wang, H., Luo, X., Yao, L., Lehman, D. M. & Wang, P. 2015. Improvement of Cell
Survival During Human Pluripotent Stem Cell Definitive Endoderm
Differentiation. Stem Cells Dev, 24, 2536-46.
Weber, A., Paschen, S. A., Heger, K., Wilfling, F., Frankenberg, T., Bauerschmitt, H.,
Seiffert, B. M., Kirschnek, S., Wagner, H. & Hacker, G. 2007. BimS-induced
apoptosis requires mitochondrial localization but not interaction with anti-
apoptotic Bcl-2 proteins. The Journal of cell biology, 177, 625-36.
Wei, M. C., Lindsten, T., Mootha, V. K., Weiler, S., Gross, A., Ashiya, M.,
Thompson, C. B. & Korsmeyer, S. J. 2000. tBID, a membrane-targeted death
ligand, oligomerizes BAK to release cytochrome c. Genes & development, 14,
2060-71.
Wei, M. C., Zong, W. X., Cheng, E. H., Lindsten, T., Panoutsakopoulou, V., Ross, A.
J., Roth, K. A., Macgregor, G. R., Thompson, C. B. & Korsmeyer, S. J. 2001.
Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction
and death. Science, 292, 727-30.
Weiss, W. A., Taylor, S. S. & Shokat, K. M. 2007. Recognizing and exploiting
differences between RNAi and small-molecule inhibitors. Nat Chem Biol, 3,
739-44.
Welsh, N., Eizirik, D. L., Bendtzen, K. & Sandler, S. 1991. Interleukin-1 beta-induced
nitric oxide production in isolated rat pancreatic islets requires gene
transcription and may lead to inhibition of the Krebs cycle enzyme aconitase.
Endocrinology, 129, 3167-73.
Weston, C. R., Balmanno, K., Chalmers, C., Hadfield, K., Molton, S. A., Ley, R.,
Wagner, E. F. & Cook, S. J. 2003. Activation of ERK1/2 by deltaRaf-1:ER*
represses Bim expression independently of the JNK or PI3K pathways.
Oncogene, 22, 1281-93.
Willimott, S., Merriam, T. & Wagner, S. D. 2011. Apoptosis induces Bcl-XS and
cleaved Bcl-XL in chronic lymphocytic leukaemia. Biochemical and
biophysical research communications, 405, 480-5.
Willis, S. N., Chen, L., Dewson, G., Wei, A., Naik, E., Fletcher, J. I., Adams, J. M. &
Huang, D. C. 2005. Proapoptotic Bak is sequestered by Mcl-1 and Bcl-xL, but
not Bcl-2, until displaced by BH3-only proteins. Genes & development, 19,
1294-305.
Wong, L. F., Ralph, G. S., Walmsley, L. E., Bienemann, A. S., Parham, S., Kingsman,
S. M., Uney, J. B. & Mazarakis, N. D. 2005. Lentiviral-mediated delivery of
Bcl-2 or GDNF protects against excitotoxicity in the rat hippocampus. Mol
Ther, 11, 89-95.
Xu, X., Browning, V. L. & Odorico, J. S. 2011. Activin, BMP and FGF pathways
cooperate to promote endoderm and pancreatic lineage cell differentiation from
human embryonic stem cells. Mechanisms of development, 128, 412-27.
Xu, X., Kahan, B., Forgianni, A., Jing, P., Jacobson, L., Browning, V., Treff, N. &
Odorico, J. 2006. Endoderm and pancreatic islet lineage differentiation from
human embryonic stem cells. Cloning and stem cells, 8, 96-107.
![Page 176: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/176.jpg)
148
Yamamura, K., Kamada, S., Ito, S., Nakagawa, K., Ichihashi, M. & Tsujimoto, Y.
1996. Accelerated disappearance of melanocytes in bcl-2-deficient mice.
Cancer Res, 56, 3546-50.
Yang, C. C., Lin, H. P., Chen, C. S., Yang, Y. T., Tseng, P. H., Rangnekar, V. M. &
Chen, C. S. 2003. Bcl-xL mediates a survival mechanism independent of the
phosphoinositide 3-kinase/Akt pathway in prostate cancer cells. J Biol Chem,
278, 25872-8.
Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B. & Korsmeyer, S. J. 1995.
Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and
promotes cell death. Cell, 80, 285-91.
Ye, F., Duvillie, B. & Scharfmann, R. 2005. Fibroblast growth factors 7 and 10 are
expressed in the human embryonic pancreatic mesenchyme and promote the
proliferation of embryonic pancreatic epithelial cells. Diabetologia, 48, 277-
81.
Yi, C. H., Pan, H., Seebacher, J., Jang, I. H., Hyberts, S. G., Heffron, G. J., Vander
Heiden, M. G., Yang, R., Li, F., Locasale, J. W., Sharfi, H., Zhai, B.,
Rodriguez-Mias, R., Luithardt, H., Cantley, L. C., Daley, G. Q., Asara, J. M.,
Gygi, S. P., Wagner, G., Liu, C. F. & Yuan, J. 2011. Metabolic regulation of
protein N-alpha-acetylation by Bcl-xL promotes cell survival. Cell, 146, 607-
20.
Youle, R. J. & Strasser, A. 2008. The BCL-2 protein family: opposing activities that
mediate cell death. Nat Rev Mol Cell Biol, 9, 47-59.
Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y. & Deng, H. 2009.
Highly efficient differentiation of human ES cells and iPS cells into mature
pancreatic insulin-producing cells. Cell research, 19, 429-38.
Zhang, K. & Kaufman, R. J. 2006. Protein folding in the endoplasmic reticulum and
the unfolded protein response. Handbook of experimental pharmacology, 69-
91.
Zhou, Y. P., Pena, J. C., Roe, M. W., Mittal, A., Levisetti, M., Baldwin, A. C., Pugh,
W., Ostrega, D., Ahmed, N., Bindokas, V. P., Philipson, L. H., Hanahan, D.,
Thompson, C. B. & Polonsky, K. S. 2000. Overexpression of Bcl-x(L) in beta-
cells prevents cell death but impairs mitochondrial signal for insulin secretion.
Am J Physiol Endocrinol Metab, 278, E340-51.
Zhou, Y. P., Teng, D., Dralyuk, F., Ostrega, D., Roe, M. W., Philipson, L. &
Polonsky, K. S. 1998. Apoptosis in insulin-secreting cells. Evidence for the
role of intracellular Ca2+ stores and arachidonic acid metabolism. The Journal
of clinical investigation, 101, 1623-32.
Ziegler, A. G., Rewers, M., Simell, O., Simell, T., Lempainen, J., Steck, A., Winkler,
C., Ilonen, J., Veijola, R., Knip, M., Bonifacio, E. & Eisenbarth, G. S. 2013.
Seroconversion to multiple islet autoantibodies and risk of progression to
diabetes in children. JAMA, 309, 2473-9.
Zorn, A. M. & Wells, J. M. 2007. Molecular basis of vertebrate endoderm
development. International review of cytology, 259, 49-111.
![Page 177: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/177.jpg)
149
10 Author’s publications
1. Loo, S.W.L., Lau, H.H., Jasmen, J., Lim, C.S., and Teo, K.K.A. (2017). An
arduous journey from human pluripotent stem cells to functional pancreatic β-
cells. Diabetes, Obesity and Metabolism, in press
2. Loo S.W.L., Vethe. H., Paulo J,A., Jasmen J., Jackson N., Bjørlykke Y.,
Valdez I.A., Vaudel M., Barsnes H., Gygi S.P, Teo K.K.A., Ræder H., &
Kulkarni R.N. (2019). Dynamic proteome profiling of human pluripotent stem
cell-derived pancreatic progenitors. (Stem Cells).
3. Loo S.W.L., Soetedjo A.A.P., H.H Lau., Linh N.L., Vidhya G.K., S Ghosh, H.
Choi, Roca X., Hoon S., and Teo K.K.A. BCL-xL/BCL2L1 is a critical anti-
apoptotic protein that suppresses BAK to promote pancreatic specification
from human pluripotent stem cells. (In revision).
4. Lau H.H., Ng N.H.J., Loo S.W.L., Jasmen J, Teo K.K.A. (2017). The
molecular functions of hepatocyte nuclear factors in and beyond the liver. J
Hepatol, S0168-8278(17)32451-0
5. Lau, H.H, Nur S.A, Loo, S.W.L., Vidhya G.K., Hoon S. and Teo, K.K.A
(2018). ERK1/2 signaling is indispensable for definitive endoderm formation
(In revision)
![Page 178: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/178.jpg)
150
11 Posters, awards, invited talk
Posters
1. Islet Biology: From cell birth to death, Keystone conference, Colorado
2. 79th Scientific sessions American Diabetes Association, San Francisco
Awards
1. Most Original Idea prize - A*STAR-P&G 1st Singapore Biotechnology Young
Entrepreneur Scheme (YES) Competition 2016
2. 1st Prize - NTU-Quintiles Challenge 2016 – Predicting Patients’ quality risk
3. Selected as one of the 100 leaders of tomorrow (LoT) from around the world to
participate in the Global Biotech Revolution GapSummit 2017 held in
Washington D.C.
4. International Society for Stem Cell Research Travel award 2017
5. Finalist at 2018 Falling Walls Labs Singapore
![Page 179: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/179.jpg)
151
12. Appendix – Western blot films
Figure 39. Full western blot films corresponding to Figure 10A. Full western blot films of
BIM, PUMA and BAX.
![Page 180: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/180.jpg)
152
Figure 40. Full western blot films corresponding to Figure 10A. Full western blot films of
BAK, BCL-xL and MCL-1.
![Page 181: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/181.jpg)
153
Figure 41. Full western blot films corresponding to Figure 10A. Full western blot films of
Cleaved CASP3, FL CASP3 and β-ACTIN.
![Page 182: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/182.jpg)
154
Figure 42. Full western blot films corresponding to Figure 12A and 12B. Full western blot
films of BIM, PUMA, BAX, BAK, BCL-xL and BCL-2.
![Page 183: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/183.jpg)
155
Figure 43. Full western blot films corresponding to Figure 12A and 12B. Full western blot
films of MCL-1, Cleaved CASP3, FL CASP3 and β-ACTIN.
Figure 44. Full western blot films corresponding to Figure 30. Full western blot films of BIM
and β-ACTIN.
![Page 184: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/184.jpg)
156
Figure 45. Full western blot films corresponding to Figure 31A. Full western blot films of
BIMγ and β-ACTIN.
Figure 46. Full western blot films corresponding to Figure 32A & 32B. Full western blot films
of BIML, BIMEL, BIMγ and β-ACTIN.
![Page 185: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/185.jpg)
157
Figure 47. Full western blot films corresponding to Figure 33A. Full western blot films of
BIMγ and β-ACTIN.
Figure 48. Full western blot films corresponding to Figure 34A. Full western blot films of
BIMγ and β-ACTIN.
![Page 186: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/186.jpg)
158
Figure 49. Full western blot films corresponding to Figure 35A, 35B and 35C Full western
blot films of BAX, PUMA, BCL-2, BCL-xL and β-ACTIN
Figure 50. Full western blot films corresponding to Figure 36A, 36B and 36C Full western
blot films of BAK, BAX, BCL-xL, PUMA, BCL-2 and β-ACTIN
![Page 187: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/187.jpg)
159
Figure 51. Full western blot films corresponding to Figure 37A. Full western blot films of
Cleaved CASP3 and FL CASP3
Figure 52. Full western blot films corresponding to Figure 38A. Full western blot films of
Cleaved CASP3 and FL CASP3
![Page 188: DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY ... PhD...DYNAMICS OF BCL-2 FAMILY OF PROTEINS IN EARLY PANCREATIC PROGENITORS AND β-CELLS LARRY LOO SAI WENG SCHOOL OF BIOLOGICAL SCIENCES](https://reader035.fdocuments.in/reader035/viewer/2022070112/605841964b9ea54648637532/html5/thumbnails/188.jpg)
160