Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10...
Transcript of Dove Medical Press Web view0.001 32 (64) 19 (76) 0.431 Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10...
Supplementary material 1 Antibiotics tested in this studyClass Abbreviation Antibiotic Concentration
AminoglycosidesGM Gentamicin 10 ugNET Netilmicin 30 ugAMK Amikacin 30 ug
Fluoroquinolones
OFX Ofloxacin 5 ugLVX Levofloxacin 5 ugNOR Norfloxacin 10 ugAN Nalidixic acid 30 ugCIP Ciprofloxacin 5 ug
Penicillin AM Ampicillin 10 ug
1st-4th generation cephalosporins
CF Cefalotin 30 ugCFX Cefuroxime 30 ugCFZ Ceftazidime 30 ugCTX Cefotaxime 30 ugCRO Ceftriaxone 30 ugFEP Cefepime 30 μg
Monobactamic ATM Aztreonam 30 μgPenicillin with ESBL
inhibitor AMC Amoxicillin-clavulanic acid 20/10 μg
Sulphas TSX Trimetropim/ Sulphametoxazol 1.25/ 23.75ug
Nitrofurans MAC Nitrofurantoin 300 ugPhosfonic acids FOS Fosfomycin 200 μg
Phenicols C Cloramphenicol 30 ugTetracyclines TE Tetracyclin 30mgpolymyxins CL Colistin 10mg
Carbapenemics ETP Ertapenem 10mgClinical & Laboratory Standards Institute (CLSI)1
1
Supplementary material 2 Genes and PAI sought in this study
PCR Genes oligonucleotides SequenceLengthBase pairs (bp)
Reference Positive control
Tm (C°)
mPCR1
fimH FimH F CCTACAGCTGAACCCAAAG 210 Arenas-Hernández unpublished data
E. coli CFT073 57.7
FimH 188 R CGAAAGATCTACGACCAG
fliC FliC 242 F GCTGTCCGAAATCAACAACAA 304 Arenas-Hernández unpublished dataFliC 445 R GGCTATCGTACCGGAACCATT
satA satA 978F CCAAAACAATGCAGATACCAC 384 Arenas-Hernández unpublished datasatA 1321R ATTACCTTACCATTTCCGCTT
iucD iucD-30F GCTGTGGCTGGTAACTCAGG 512 Arenas-Hernández unpublished dataiucD512R TGCTTCACACAGGGTGGTAAAT
mPCR2
iha IhaEMSAR CGGAATTCCGATCTCCGATCATGTTAACCG 150 Rashid et al., 20062
E. coli CFT073+
E. coli O59I61.4
IhaEMSAL CGGAATTCCGGCATGCCGAGGCAGTCGTTA
vatP vatP-86F TAGCGCGCAATTCAACAATA 226 Arenas-Hernández unpublished datavat226R GCAGATAGTGCCAGAGAGGTAAG
vatA vatA1076F CCTGGGACATAATGGTCAGAT 330 Arenas-Hernández unpublished datavatA1406R CTGGCAATATTCACGCTACTG
papGIII papG1/G3 F CATGGCTGGTTGTTCCTAAACAT 421 Tiba et al. 20083
papG2/G3 R TCCAGAGACTGTGCAGAAGGAC
papGII papG2 113F GGAATGTGGTGATTACTCAAAGG 562 Tiba et al. 20083
papG2/G3 R TCCAGAGACTGTGCAGAAGGAC
mPCR3
papA papA-45F CAGATATCTCTGGTGTGTTCAGTAA 641 Arenas-Hernández unpublished data
E. coli GAG1 61.4
papA+31R GGTCTTGCCTCACCCTGTAA
satP satP 82F AGCAAGCTGTTAGTAACCAACC 880 Arenas-Hernández unpublished datasatP 773R GAGCCGCTGTCTCCGAATA
hlyA hlyA-133F ACTCATGTTGGTAAAGTATCAGAAT 1, 280 Arenas-Hernández unpublished datahlyA1348R AGCCAGTACAGTGCTTATCGTTG
PCRcnf-1 cnf-1 CNF1-71F CTCGCCCAGTGATTAGGTATTC 3, 100 Arenas-Hernández unpublished data E. coli GAG1 61.4CNF1 +60R GCGCTAACAAAACAGCACAAGG
PAI mPCR-1
PAIICFT073RPAi GGACATCCTGTTACAGCGCGCA 930 Sabaté et. al., 20064
E. coli CFT073
60.1
RPAf TCGCCACCAATCACAGCGAAC
PAIIICFT073cft073.2Ent1 ATGGATGTTGTATCGCGC 400 Sabaté et. al., 20064
cftO73.2Ent2 ACGAGCATGTGGATCTGC
PAI mPCR-2
PAIIJ96papGIF TCGTGCTCAGGTCCGGAATTT 400 Sabaté et. al., 20064
E. coli J96papGIR TGGCATCCCACATTATCG
PAIIIJ96hlyd GGATCCATGAAAACATGGTTAATGGG 2,400 Sabaté et. al., 20064
cnf GATATTTTTGTTGCCATTGGTTACC
Supplementary material 3 Antibiotic resistance in UPEC strains by study group and geographic area
Class of antibiotics Specifics antibioticsPregnant (n= 75) p=0.743 Non-pregnant (n= 75) p= 0.601
Sonora Pueblapb Sonora Puebla
pb
n=50 (%) n=25 (%) n=50 (%) n=25 (%)
AminoglycosidesAmikacin 31 (62) 24 (96) 0.001 32 (64) 19 (76) 0.431
Gentamicin 21 (42) 14 (56) 0.327 22 (44) 10 (49) 0.807Netilmicin 5 (10) 4 (24) 0.164 2 (4) 5 (20) 0.037
β-lactams
Ampicillin 50 (100) 25 (100) - 50 (100) 25 (100) -Cefalotine 48 (96) 24 (96) 1 49 (98) 25 (100) 1
Cefuroxime 41 (82) 25 (100) 0.025 50 (100) 23 (92) 0.108Cefotaxime 35 (70) 20 (80) 0.417 47 (94) 20 (80) 0.107Ceftazidime 37 (74) 21 (84) 0.393 33 (66) 19 (76) 0.435Ceftriaxone 41 (82) 24 (96) 0.15 50 (100) 24 (96) 0.333Cefepime 19 (38) 8 (32) 0.799 14 (28) 6 (24) 0.787
Aztreonam 20 (40) 15 (60) 0.141 15 (30) 11 (44) 0.304Amoxicillin/ Clavulanic Ácid 37 (74) 23 (92) 0.075 47 (94) 22 (84) 212
Fluoroquinolones
Nalidixic ácid 37 (74) 17 (68) 0.596 37 (74) 18 (72) 1Ciprofloxacin 29 (58) 10 (40) 0.152 22 (44) 13 (52) 0.624
Ofloxacin 27 (54) 12 (48) 0.634 18 (36) 14 (56) 0.137Norfloxacin 28 (56) 13 (32) 0.055 19 (38) 14 (56) 0.149
Levofloxacin 29 (58) 13 (32) 0.049 16 (32) 11 (44) 0.321Nitrofurantoins Nitrofurantoin 20 (40) 16 (64) 0.085 41 (82) 17 (68) 0.242Sulphonamides Cotrimoxazole 32 (64) 11 (44) 0.137 35 (70) 17 (68) 1Phosphonates Fosfomycin 2 (4) 5 (20) 0.037 2 (4) 1 (4) 1
Phenicols Chloramphenicol 30 (60) 9 (36) 0.085 25 (50) 11 (44) 0.806Tetracyclines Tetracyclin 35 (70) 13 (52) 0.304 29 (58) 18 (72) 0.313Polimixyns Colistin 35 (70) 14 (56) 0.136 34 (68) 17 (68) 1
Carbapenems Ertapenem 6 (12) 5 (20) 0.489 4 (8) 0 (0) 0.294
2
pb: Fisher test exact. In bold the statistically significant values.
3
Supplementary material 4.1 Possible classification and type of beta-lactamases, according to the antibiotic resistance by Kirby-Bauer and substrate profile by double-disk diffusion test, of isolated strains of pregnant and non-pregnant women in Puebla.
Strain Source AMP AMC1GC 2GC 3GC 3GC 3GC 4GC CARB
ATM Substrate Profile β-lactamaseCF CFX CFZ CTX CRO FEP ETP3 Pregnant R R R R S S R S S S FEP ESBL
11 Pregnant R R R R S R R S S S CFZ ESBL13 Pregnant R S R R S S R S S S FEP ESBL16 Pregnant R R R R R R R S S S CFZ,CTX ESBL20 Pregnant R R R R R R R R S R CTX ESBL22 Pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL27 Pregnant R R R R R R S S S R CFZ ESBL30 Pregnant R R R R R R R S S R CRO,ATM ESBL35 Pregnant R R R R R R R R S R CTX,FEP, ATM ESBL37 Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL38 Pregnant R R R R R R R R S R CTX,FEP, ATM ESBL39 Pregnant R R R R R R R S S R FEP ESBL42 Pregnant R R R R R R R R R R CTX,FEP,ATM CP45 Pregnant R R R R R R R S S R CTX,FEP,ATM ESBL46 Pregnant R R R R R R R S R R ATM CP47 Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL50 Pregnant R R R R R R R R S R CTX ESBL1 Non- Pregnant R R R R S S R S S S FEP ESBL
26 Non- Pregnant R R R R R R R S S R CFZ ESBL29 Non- Pregnant R R R R R R R R S R CTX,CRO,FEP ESBL33 Non- Pregnant R R R R R R R R S R CTX,CRO,FEP,ATM ESBL36 Non- Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL
1GC: First generation Cephalosporin; 2GC: Second generation Cephalosporin; 3GC: Third generation Cephalosporin; 4GC: Fourth generation Cephalosporin; R: Resistant; S: Sensitive; ESBL: Extended spectrum β -lactamase ; CP: Carbapenemase; AMP: Ampicilin; AMC: Amoxicilin/Clavulanic Acid; CF: Cefalotin; CFX: Cefuroxime; FEP: Cefepime; CFZ: Ceftazidime; CTX: Cefotaxime; ATM: Aztreonam; CRO: Ceftriaxone. This analysis was carry out following the criteria of Bush et al., 2010 and Piccazo et al., 2011 5,6.
4
Supplementary material 4.2 Possible classification and type of beta-lactamases, according to the antibiotic resistance by Kirby-Bauer and substrate profile by double-disk diffusion test, of isolated strains of pregnant women in Sonora (n=22)
Strain Source AMP AMC1GC 2GC 3GC 3GC 3GC 4GC CARB
ATM Substrate Profile β-lactamaseCF CFX CFZ CTX CRO FEP ETP2 Pregnant R R R R R R R R S R CFZ,CTX,ATM ESBL5 Pregnant R R R R R R R R S R CTX,ATM ESBL6 Pregnant R R R R S S R S S S CRO,ATM ESBL7 Pregnant R R R R S S S S S S CFZ ESBL8 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL9 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL
13 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL16 Pregnant R R R R R R R R S R CTX,FEP,ATM ESBL17 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL18 Pregnant R R R R R R R R R R CFZ,CTX,CRO,FEP, ATM CP19 Pregnant R R R R R R R R R R CTX,FEP, ATM CP21 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL22 Pregnant R R R S R S S S S S CFZ ESBL23 Pregnant R R R R R R R R S R CFZ,CTX,CRO,FEP, ATM ESBL27 Pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL28 Pregnant R R R R R R R R S S CFZ,CTX,FEP,ATM ESBL29 Pregnant R R R R R R R R S S CFZ,CTX,FEP,ATM ESBL32 Pregnant R S R R R R R S S S CTX ESBL34 Pregnant R R R R S R R S S S CRO ESBL36 Pregnant R R R R S S R S S S CFZ ESBL40 Pregnant R R R R R S S S S S CFZ ESBL44 Pregnant R R R R R R R R R S CTX,FEP CP
5
1GC: First generation Cephalosporin; 2GC: Second generation Cephalosporin; 3GC: Third generation Cephalosporin; 4GC: Fourth generation Cephalosporin; R: Resistant; S: Sensitive; ESBL: Extended spectrum β -lactamase ; CP: Carbapenemase; AMP: Ampicilin; AMC: Amoxicilin/Clavulanic Acid; CF: Cefalotin;
CFX: Cefuroxime; FEP: Cefepime; CFZ: Ceftazidime; CTX: Cefotaxime; ATM: Aztreonam; CRO: Ceftriaxone. This analysis was carry out following the criteria of Bush et al., 2010 and Piccazo et al., 2011 5,6.
6
Supplementary material 4.3 Possible classification and type of beta-lactamases, according to the antibiotic resistance by Kirby-Bauer and substrate profile by double-disk diffusion test, of isolated strains of non-pregnnt women in Sonora (n=23)
Strain Source AMP AMC1GC 2GC 3GC 3GC 3GC 4GC CARB
ATM Substrate Profile β-lactamaseCF CFX CFZ CTX CRO FEP ETP2 Non-pregnant R R R R R R R S S S CFZ,CRO ESBL6 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL7 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL8 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL9 Non-pregnant R R R R R R R R S R CTX,FEP,ATM ESBL
10 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL11 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL12 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL13 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL17 Non-pregnant R R R R R R R R S R FEP ESBL18 Non-pregnant R R R R R R R S S R CTX ESBL19 Non-pregnant R R R R S R R S S S CFZ,CRO ESBL22 Non-pregnant R R R R S R R S R S CFZ,FEP CP24 Non-pregnant R R R R S R R S S S CFZ,CTX ESBL37 Non-pregnant R S R R R R R S S S CFZ,FEP ESBL40 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL41 Non-pregnant R R R R S R R S S S CRO ESBL42 Non-pregnant R R R R R R R R S R CTX,CRO,FEP,ATM ESBL45 Non-pregnant R R R R S R R S S S CFZ,CTX,CRO ESBL47 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL48 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL49 Non-pregnant R R R R R R R R S R CFZ,CTX,FEP,ATM ESBL50 Non-pregnant R R R R S R R S S S CFZ,CTX,FEP ESBL
7
1GC: First generation Cephalosporin; 2GC: Second generation Cephalosporin; 3GC: Third generation Cephalosporin; 4GC: Fourth generation Cephalosporin; R: Resistant; S: Sensitive; ESBL: Extended spectrum β -lactamase ; CP: Carbapenemase; AMP: Ampicilin; AMC: Amoxicilin/Clavulanic Acid; CF: Cefalotin; CFX: Cefuroxime; FEP: Cefepime; CFZ: Ceftazidime; CTX: Cefotaxime; ATM: Aztreonam; CRO: Ceftriaxone. This analysis was carry out following the criteria of Bush et al., 2010 and Piccazo et al., 2011 5,6.
8
Supplementary material 5 ESBL production and antibiotic resistance in UPEC strains from Sonora and Puebla
Antibiotic
SONORAn= 100
PUEBLAn= 50
Pregnantn= 50
Non-pregnantn= 50
Pregnantn= 25
Non-pregnantn= 25
ESBL+n=22 (%)
ESBL-n=28 (%) pb ESBL+
n= 23 (%)ESBL-
n= 27 (%) pb ESBL+n= 17 (%)
ESBL-n= 8 (%) pb BLEE+
n= 5 (%)BLEE-
n= 20 (%) pb
Amikacin 15 (68) 16 (57) 0.55 16 (70) 16 (59) 0.55 17 (100) 7 (88) 0.32 4 (80) 15 (75) 1Gentamicin 11 (50) 10 (36) 0.39 13 (57) 9 (33) 0.15 10 (59) 4 (50) 1 3 (60) 7 (35) 0.35Netilmicin 2 (9) 3 (11) 1 0 (0) 2 (7) 0.49 6 (35) 0 (0) 0.12 1 (20) 4 (20) 1
Nalidixic acid 18 (82) 19 (68) 0.33 15 (65) 22 (81) 0.21 14 (82) 3 (38) 0.06 2 (40) 16 (80) 0.11Ciprofloxacin 16 (72) 13 (46) 0.08 12 (52) 10 (37) 0.39 9 (53) 1 (12.5) 0.08 1 (20) 12 (60) 0.16
Ofloxacin 15 (68) 12 (43) 0.09 10 (43) 8 (30) 0.56 10 (59) 2 (25) 0.2 2 (40) 12 (60) 0.62Norfloxacin 15 (68) 13 (46) 0.15 10 (43) 9 (33) 0.56 8 (47) 0 (0) 0.02 2 (40) 12 (60) 0.62
Levofloxacin 16 (72) 13 (46) 0.08 10 (43) 6 (22) 0.13 8 (47) 0 (0) 0.02 1 (20) 10 (50) 0.34Trimethoprim-
Sulfamethoxazole 19 (86) 13 (46) 0.006 22 (96) 13 (48) 0 8 (47) 3 (38) 1 4 (80) 13 (65) 1
Nitrofurantoin 9 (40) 11 (39) 1 17 (74) 24 (89) 0.26 10 (59) 6 (75) 0.66 5 (100) 11 (55) 0.12Chloramphenicol 16 (72) 14 (50) 0.14 14 (61) 11 (41) 0.25 6 (35) 3 (38) 1 0 (0) 11 (55) 0.04
Ampicillin 22 (100) 28 (100) - 23 (100) 27 (100) - 17 (100) 8 (100) - 5 (100) 20 (100) -Cefalotin 22 (100) 26 (93) 0.49 22 (96) 27 (100) 0.46 17 (100) 7 (88) 0.32 5 (100) 20 (100) -
Cefuroxime 21 (95) 20 (71) 0.06 23 (100) 27 (100) - 17 (100) 8 (100) - 5 (100) 18 (90) 1Ceftazidime 18 (82) 19 (68) 0.33 17 (74) 16 (59) 0.37 14 (82) 7 (88) 1 4 (80) 15 (75) 1Cefotaxime 17 (77) 18 (65) 0.36 23 (100) 24 (88) 0.23 15 (88) 5 (62.5) 0.28 4 (80) 16 (80) 1Ceftriaxone 19 (86) 22 (79) 0.71 23 (100) 27 (100) - 16 (94) 8 (100) 1 5 (100) 19 (95) 1Cefepime 15 (68) 4 (14) 0 14 (61) 0 (0) 0 8 (47) 0 (0) 0.02 2 (40) 4 (20) 0.56
Aztreonam 15 (68) 5 (18) 0 15 (65) 0 (0) 0 12 (70) 3 (38) 0.19 4 (80) 7 (35) 0.13Amoxicilin- clavulanic
acid 21 (95) 16 (57) 0 22 (96) 25 (93) 1 16 (94) 7 (88) 1 5 (100) 16 (80) 0.54
Fosfomycin 1 (4) 1 (4) 1 0 (0) 2 (7) 0.49 3 (18) 2 (25) 1 1 (20) 0 (0) 0.2Colistin 16 (72) 19 (68) 0.76 14 (61) 20 (74) 0.37 10 (59) 4 (50) 1 2 (40) 15 (75) 0.28
Tetratcyclin 22 (100) 13 (46) 0 15 (65) 14 (52) 0.39 10 (59) 3 (38) 0.4 3 (60) 15 (75) 0.59Ertapenem 3 (12) 3 (11) 1 1 (4) 3 (11) 0.61 2 (12) 3 (38) 0.28 0 (0) 0 (0) -
pb: Fisher test exact. In bold the statistically significant values
9
Supplementary material 6.1 (Figure 2 data). Virulence genes distribution in E. coli isolates from urine of pregnant and non-pregnant women from Sonora (A) and Puebla (B), Mexico.
(A) E. coli isolates from women in Sonora (n=100) p valuea1= 0.170
Genes Pregnant (%)n=50
Non-pregnant (%)n=50
Totaln=100 (%) p valuea2
fimH 50 (100) 50 (100) 100 (100) -
papG+papA 13 (26) 6 (12) 19 (19) 0.124
iha 23 (46) 33 (66) 56 (56) 0.069
iucD 46 (92) 44 (88) 90 (90) 0.740
satA+satP 13 (26) 16 (32) 29 (29) 0.659
vatA+vatP 17 (34) 12 (24) 29 (29) 0.378
hlyA 22 (44) 11 (22) 33 (33) 0.032
cnf1 7 (14) 5 (10) 12 (12) 0.759
ªfliC 19 (38) 14 (28) 33 (33) 0.306
(B) E. coli isolates from women in Puebla (n=50) pa1= 0.300
Genes Pregnant (%)n=25
Non-pregnant (%)n=25
Totaln=50 (%) p valuea2
fimH 25 (100) 25 (100) 50 (100) -
papG+papA 10 (40) 12 (48) 22 (44) 0.776
Iha 15 (60) 17 (68) 32 (64) 0.768
iucD 21 (84) 19 (76) 40 (80) 0.725
satA+satP 10 (40) 11 (44) 21 (42) 1
vatA+vatP 10 (40) 3 (12) 13 (26) 0.050
hlyA 14 (56) 8 (32) 22 (44) 0.153
cnf1 2 (8) 7 (28) 9 (18) 0.138
fliC 11 (44) 4 (16) 15 (30) 0.062
fimH: gene that codified for the type 1 pilus adhesin; papG+papA: genes that codified for adhesin and pilin of the type P pili; iha: gene that codified for the enterobactin receptor/Irg homologue adhesin; iucD: gene that codified for the aerobactin receptor; satA+satP: genes that codified for autotransporter and peptidase regions of the secreted autotransporter toxin; vatA+vatP: genes that codified for autotransporter and peptidase regions of the vacuolating autotransporter toxin; hlyA: gene that codified for the pro-α-hemolysin; cnf-1: gene that codified for the cytotoxic necrotizing factor; fliC: gene that codified for the subunit of flagelin. pa1: Statistic analysis of the number of virulence genes between study groups; pa2: Statistic analysis of the major prevalence of each virulence genes between study groups. In bold the statistically significance results. pa: Fisher’s exact test.
10
Supplementary material 6.2 Prevalence of virulence genes by geographical areaGen Sonora n= 100 (%) Puebla n= 50 (%) pa
fimH 100 (100) 50 (100) -papG+papA 19 (19) 22 (44) 0.001
iha 56 (56) 32 (64) 0.38iucD 90 (90) 40 (80) 0.12
satA+satP 29 (29) 21 (42) 0.14vatA+vatP 29 (29) 13 (26) 0.84
hlyA 33 (33) 22 (44) 0.1cnf-1 12 (12) 9 (18) 0.32fliC 33 (33) 15 (30) 1
pc: x2; -: the value of p could not be obtained; In bold the statistically significant values.
11
Supplementary material 7 Prevalence of genes reported in PAIs
Gen/PAI Sonoraa
n (%)Pueblab
n (%)hlyA 33 (33) 22 (44)
PAI ICFT073 35 (35) 29 (58)
PAI IJ96 9 (9) 9 (18)
PAI IIJ96 8 (8) 13 (26)
cnf-1 12 (12) 9 (18)PAI IIJ96 8 (8) 13 (26)
papG+papA 19 (19) 22 (44)PAI ICFT073 35 (35) 29 (58)
PAI IICFT073 36 (36) 18 (36)
PAI IJ96 9 (9) 9 (18)a. 100 was the total number of strains; b. 50 was the total number of strainsIn bold virulence factors that are localized in PAIs
12
Supplementary material 8.1. Iron uptake phenotype of UPEC strains isolated from Puebla.
C-: Negative control. Strains 20 and 23 have halo with double coloration (Yellow-Orange). The method was modify from Sung et al., 2011 7.
Supplementary material 8.2. Hemolysis phenotype of UPEC strains isolated from Puebla
C-: Negative control
13
Supplementary Material 9 Correlation between hemolytic phenotype and hlyA genotype in UPEC strains isolated from Sonora and Puebla
Study group hemolytic phenotype Genotype (hlyA) hlyA+hemolytic phenotypePregnant from Sonora 19 (38) 22 (44) 8 (16)
Non-pregnant from Sonora 28 (56) 11 (22) 6 (12)
Pregant from Puebla 11 (44) 14 (56) 6 (24)
Non-pregnant from Puebla 7 (28) 8 (32) 2 (8) Pregnant from Sonora n= 50; Non-pregnant from Sonora n= 50; Pregnant from Puebla n=25; Non-pregnant from Puebla n=25.
14
Supplementary 10.1 Serotypes found in the E. coli strains isolated from pregnant women (n = 25) in Puebla and pathotypes or associated clinical reports.
SerotypeSerotype associated to
pathotype or clinic case
n (%) Accumulated % Reference
O18ac:H7UPEC
2 (8%)36% Wiles, Kulesus, &
Mulvey, 20088O25:H4 4 (16%)O6:H1 3 (12%)
O7:H18 ETEC 1 (4%) 4% Cravioto, R.J. Gross, 19799
O1:H- STEC or UPEC 1 (4%) 4%
Blanco, et al., 2004; Constantiniu,2013; Rodriguez-Angeles,
2002; Wiles, Kulesus, & Mulvey, 20088,10–12
O2:H6 Heteropathogenic E. coli 2 (8%) 8% Bielaszewska, et al.,
201413
O15:H1 Isolated from diarrhea in Mexico
1 (4%)8% Bourdin, et al.,201414
O48:H30 1 (4%)
O8:H25 isolated from lactating calves 1 (4%) 4%
Donaldson, et al., 200615
OR:H4Unreported
2 (8%)16% -
O139:H9 2 (8%)O?:H-
NT
1 (4%)
28% -O?:H? 2 (8%)
O?:H36 1 (4%)O?:H40 1 (4%)O25:H? 2 (8%)
UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin-producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.
15
Serotype Serotype associated to pathotype or clinic case n=25 (%) Accumulated % Reference
O1:H6
UPEC
1 (4%)
28%
Wiles, Kulesus, & Mulvey, 20088
O102:H6 2 (8%) Molina-López, et al., 201116
O25:H4 3 (12%) Wiles, Kulesus, & Mulvey, 20088O6:H1 1 (4%)
O27:H-
ETEC
1 (4%)
16% Cravioto, R.J. Gross, 19799CrO7:H18 2 (8%)
OR:H10 1 (4%)
OR:H- STEC 1 (4%) 4% Constantiniu, 200211
O15:H18 EAEC, EPEC and isolated from ITU cases in USA 2 (8%) 8%
Regua-Mangia, et al., 2010; Rodriguez-Angeles,
20028,10–12
O2:H6 Hereropatogenic E. coli 2 (8%) 8% Bielaszewska, et al., 201413
O16:H-
Unreported
1 (4%)
24% -OR:H4 1 (4%)
OR:H7 4 (16%)
O?:H-NT
2 (8%)16% -
O?:H? 2 (8%)Supplementary10.2 Serotypes found in the E. coli strains from non-pregnant women (n=25) in Puebla and pathotypes or associated clinical reports.UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.
16
Supplementary 10.3 Serotypes found in the E. coli strains isolated from pregnant women (n = 50) in Sonora
Serotype Serotype associated to -pathotype or clinic case n=50 (%) Accumulated % Reference
025:H4
UPEC
8 (16%)
28%Wiles, et al., 20088
06:H1 4 (8%)
O153:H6 2 (4%) Regua-Mangia. et al., 201017
O78:H- STEC 3 (6%) 8%Lienemann & Salo,
201218
O6:H10 1 (2%) Blanco, et al., 200319
O75:H- UPEC or STEC 4 (8%) 8% Rodriguez-Angeles, 200210
O44:H18 EAEC 1 (2%) 2% Rodriguez-Angeles, 200210
O15:H18 EAEC, EPEC and isolated from ITU cases in USA 3 (6%) 6% Regua-Mangia, et al.,
201017
O2:H6 Heteropatogenic E. coli 2 (4%) 4% Bielaszewska, et al., 201413
O2:H4 Isolated from diarrhea in humans
1 (2%) 6% Bourdin, et al., 201414
OR:H9 2 (4%)
O20:H9 Isolated from neonatal sepsis 9 (18%) 18% Carrillo-Casas, et al., 201320C
O165:H10 Associated with hemolytic uremic syndrome 1 (2%) 2% Regua-Mangia, et al.,
201017
O2:H- Others 1 (2%)4% Pearce, et al., 201021
O21:H10 1 (2%)O132:H10
Unreported
1 (2%)
10% -
O149:H20 1 (2%)O175:H5 1 (2%)O41:H34 1 (2%)
O78:H1 1 (2%)
O?:H-NT
1 (2%)6% -O?:H1 1 (2%)
O?:H11 1 (2%)UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.
17
UPEC, Uropathogenic Escherichia coli; ETEC, Enterotoxigenic Escherichia coli; STEC, Shiga toxin producing Escherichia coli; Heteropateropathogenic E. coli, First serotype associated with hybrid strains UPEC-DAEC; NT, Not typable; DAEC, Diarreagenic Escherichia coli; -, No reference association.
Supplementary 10.4 Serotypes found in the E. coli strains isolated from non-pregnant women (n = 50) in Sonora.
Serotype Serotype associated to pathotype or clinic case n=50 (%) Accumulate
d % Reference
O75:H44UPEC
1 (2%)18% Wiles, et al, 2008;
Sainz, et al,20088,22O25:H4 4 (8%)O6:H1 4 (8%)
O153:H18
STEC
1 (2%)
10%
Zhang, et al., 200223
O73:H18 1 (2%)O78:H- 1 (2%) Cravioto, et al., 19799
O8:H19 1 (2%) Blanco, et al., 200319
O9:H21 1 (2%)
O75:H- UPEC or STEC 2 (4%) 4% Regua-Manguia, et al. 201017
O7:H15 ETEC 1 (2%) 2% Rowe, et al., 19799
015:H18 EAEC, EPEC and isolated from UTI cases 3 (6%) 6%Rodriguez-Angeles,
2002; Regua-Mangia, et al., 201010,17
O2:H6 Heteropatogenic E. coli 1 (2%) 2% Bielaszewska, et al., 201413
O20:H9 Isolated from neonatal sepsis 4 (8%) 8% Carrillo-Casas, et al., 201320
O22:H1 Isolated from diarrhea in humans 1 (2%) 12% Bourdin, et al., 201414
O44:H18 5 (10%)O101:H9 Isolated from animal infections 1 (2%) 6% Poppe, et al., 200424
O9:H- 2 (4%) Blanco, et al.,200319
O178:H10
Unreported
1 (2%)
18% -
O21:H4 1 (2%)O53:H10 1 (2%)
O8:H1 1 (2%)O8:H25 1 (2%)OR:H19 1 (2%)OR:H25 1 (2%)O1:H15 2 (4%)O?:H-
NT
1 (2%)
14% -
O?:H10 1 (2%)O?:H18 1 (2%)O?:H7 1 (2%)O?:H9 1 (2%)
O101:H? 1 (2%)O48:H? 1 (2%)
19
The results were analyzed using two samples test and Fisher test using the Minitab 18, Statistix 10 trial and GraphPad Prims 6 software. The level of significance was set at a p value 0.05.
In this document we shown the statistical analysis for each result in the paper.
ANTIBIOTIC RESISTANCE
This table show the number of tested antibiotics to which each strain obtain in Sonora Resist,
Strain ID Number of antibiotics tested antibiotics to which each strain is resistant
Non-pregnant women from Sonora
Pregnant women from Sonora
1 13 12
2 16 18
3 10 8
4 9 5
5 6 18
6 18 10
7 12 7
8 20 20
9 19 18
10 17 7
11 18 10
12 14 11
13 18 20
14 11 6
15 18 3
16 10 18
17 15 10
18 13 21
19 10 19
20 14 8
21 13 20
22 13 8
23 10 19
24 11 10
25 14 17
26 14 8
27 12 20
20
28 12 22
29 14 21
30 7 12
31 15 12
32 18 11
33 14 11
34 12 13
35 12 13
36 18 11
37 9 16
38 11 12
39 15 6
40 14 11
41 12 16
42 21 19
43 11 16
44 16 19
45 13 10
46 13 17
47 20 17
48 17 7
49 16 21
50 16 21
Then we compare the mean of resistance between the two study groups (strains from preganant women vs strains from non-pregnant women in Sonora)
Descriptive Statistics
Study group MeanStandard deviation Minimum Median Maximum asymmetry
Non-pregnant women
13.880 3.414 6.000 14.000 21.000 0.03
Pregnant women 13.700 5.281 3.000 12.500 22.000 -0.09
Two samples test
μ₁: media de la muestra 1
µ₂: media de la muestra
21
2
Diferencia: μ₁ - µ₂
No se presupuso igualdad de varianzas para este análisis.
Estadísticas descriptivas
Muestra NMedia Desv.Est.
Errorestándarde lamedia
Muestra 1 50 13.88 3.40 0.48
Muestra 2 50 13.70 5.20 0.74
Estimación de la diferencia
Diferencia
IC de 95%para ladiferencia
0.180 (-1.567, 1.927)
Prueba
Hipótesis nula H₀: μ₁ - µ₂ = 0
Hipótesis alterna
H₁: μ₁ - µ₂ ≠ 0
Valor T GL Valor p
0.20 84 0.838
Then we analyze if there was a difference in the resistance to each specific antibiotic between both groups.
Estadísticas tabuladas: Amikacina, Columnas de la hoja de trabajo
Filas: Amikacina Columnas: Columnas de la hoja de trabajo
SonoraGestantes
Sonora Nogestantes Todo
Amikacina Resistente 31 32 63
Amikacina Sensible 19 18 37
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
22
1
Estadísticas tabuladas: Gentamicina, Columnas de la hoja de trabajo
Filas: Gentamicina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_1
Sonora Nogestantes_1 Todo
Gentamicina Resistente 21 22 43
Gentamicina Sensible 29 28 57
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1.00000
Estadísticas tabuladas: Netilmicina, Columnas de la hoja de trabajo
Filas: Netilmicina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_2
Sonora Nogestantes_2 Todo
Netilmicina Resistente 5 2 7
Netilmicina Sensible 45 48 93
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.436032
Estadísticas tabuladas: Ácido nalidixico, Columnas de la ... a de trabajo
Filas: Ácido nalidixico Columnas: Columnas de la hoja de trabajo
SonoraGestantes_3
Sonora Nogestantes_3 Todo
Ácido nalidixico Resistente 37 37 74
Ácido nalidixico Sensible 13 13 26
Todo 50 50 100
23
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: Ciprofloxacino, Columnas de la hoja de trabajo
Filas: Ciprofloxacino Columnas: Columnas de la hoja de trabajo
SonoraGestantes_4
Sonora Nogestantes_4 Todo
Ciprofloxacina Resistente 29 22 51
Ciprofloxacina Sensible 21 28 49
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.229902
Estadísticas tabuladas: Ofloxacino, Columnas de la hoja de trabajo
Filas: Ofloxacino Columnas: Columnas de la hoja de trabajo
SonoraGestantes_5
Sonora Nogestantes_5 Todo
Ofloxacina Resistente 27 18 45
Ofloxacina Sensible 23 32 55
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.107356
Estadísticas tabuladas: Norfloxacino, Columnas de la hoja de trabajo
Filas: Norfloxacino Columnas: Columnas de la hoja de trabajo
SonoraGestantes_6
Sonora Nogestantes_6 Todo
Norfloxacina Resistente 28 19 47
Norfloxacina Sensible 22 31 53
24
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.108508
Estadísticas tabuladas: Levofloxacino, Columnas de la hoja de trabajo
Filas: Levofloxacino Columnas: Columnas de la hoja de trabajo
SonoraGestantes_7
Sonora Nogestantes_7 Todo
Levofloxacina Resistente 29 16 45
Levofloxacina Sensible 21 34 55
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0154245
Estadísticas tabuladas: Ampicilina, Columnas de la hoja de trabajo
Filas: Ampicilina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_8
Sonora Nogestantes_8 Todo
Ampicilina Resistente
50 50 100
Ampicilina Sensible 0 0 0
Todo 50 50 100
Contenido de la celda Conteo
* ERROR * No se puede calcular la Prueba exacta de Fisher.
Estadísticas tabuladas: Cefalotina, Columnas de la hoja de trabajo
Filas: Cefalotina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_9
Sonora Nogestantes_9 Todo
Cefalotina Resistente 48 49 97
25
Cefalotina Sensible 2 1 3
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: Cefuroxima, Columnas de la hoja de trabajo
Filas: Cefuroxima Columnas: Columnas de la hoja de trabajo
SonoraGestantes_10
Sonora Nogestantes_10 Todo
Cefuroxima Resistente 41 50 91
Cefuroxima Sensible 9 0 9
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0026342
Estadísticas tabuladas: Ceftazidima, Columnas de la hoja de trabajo
Filas: Ceftazidima Columnas: Columnas de la hoja de trabajo
SonoraGestantes_11
Sonora Nogestantes_11 Todo
Ceftazidima Resistente 37 33 70
Ceftazidima Sensible 13 17 30
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.513094
Estadísticas tabuladas: Cefotaxima, Columnas de la hoja de trabajo
Filas: Cefotaxima Columnas: Columnas de la hoja de trabajo
26
SonoraGestantes_12
Sonora Nogestantes_12 Todo
Cefotaxima Resistente 35 47 82
Cefotaxima Sensible 15 3 18
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0033040
Estadísticas tabuladas: Ceftriaxona, Columnas de la hoja de trabajo
Filas: Ceftriaxona Columnas: Columnas de la hoja de trabajo
SonoraGestantes_13
Sonora Nogestantes_13 Todo
Ceftriaxona Resistente 41 50 91
Ceftriaxona Sensible 9 0 9
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0026342
Estadísticas tabuladas: Cefepime, Columnas de la hoja de trabajo
Filas: Cefepime Columnas: Columnas de la hoja de trabajo
SonoraGestantes_14
Sonora Nogestantes_14 Todo
Cefepime Resistente 19 14 33
Cefepime Sensible 31 36 67
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.395160
Estadísticas tabuladas: Aztreonam, Columnas de la hoja de trabajo
27
Filas: Aztreonam Columnas: Columnas de la hoja de trabajo
SonoraGestantes_15
Sonora Nogestantes_15 Todo
Aztreonam Resistente 20 15 35
Aztreonam Sensible 30 35 65
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.401883
Estadísticas tabuladas: Amoxicilina-Ácido Clavulánico, ... ja de trabajo
Filas: Amoxicilina-Ácido Clavulánico Columnas: Columnas de la hoja de trabajo
SonoraGestantes_16
Sonora Nogestantes_16 Todo
Amoxicilina-Ácido Clavulánico R 37 47 84
Amoxicilina-Ácido Clavulánico S 13 3 16
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0122176
Estadísticas tabuladas: Trimetoprim con sulfametoxazol, ... de trabajo
Filas: Trimetoprim con sulfametoxazol Columnas: Columnas de la hoja de trabajo
SonoraGestantes_17
Sonora Nogestantes_17 Todo
Trimetoprim con sulfametoxazol 32 35 67
18 15 33
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.670942
28
Estadísticas tabuladas: Nitrofurantoina, Columnas de la ... a de trabajo
Filas: Nitrofurantoina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_18
Sonora Nogestantes_18 Todo
Nitrofurantoina Resistente 20 41 61
Nitrofurantoina Sensible 30 9 39
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0000303
Estadísticas tabuladas: Cloramfenicol, Columnas de la hoja de trabajo
Filas: Cloramfenicol Columnas: Columnas de la hoja de trabajo
SonoraGestantes_19
Sonora Nogestantes_19 Todo
Cloramfenicol Resistente 30 25 55
Cloramfenicol Sensible 20 25 45
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.421552
Estadísticas tabuladas: Fosfomicina, Columnas de la hoja de trabajo
Filas: Fosfomicina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_20
Sonora Nogestantes_20 Todo
Fosfomicina Resistente
2 2 4
Fosfomicina Sensible 48 48 96
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
29
1
Estadísticas tabuladas: Colistina, Columnas de la hoja de trabajo
Filas: Colistina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_21
Sonora Nogestantes_21 Todo
Colistina Resistente 35 34 69
Colistina Sensible 15 16 31
Todo 50 50 100
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: Tetraciclina, Columnas de la hoja de trabajo
Filas: Tetraciclina Columnas: Columnas de la hoja de trabajo
SonoraGestantes_22
Sonora Nogestantes_22 Todo
Tetraciclina Resistente 35 29 64
Tetraciclina Sensible 15 31 46
Todo 50 60 110
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0323160
Estadísticas tabuladas: Ertapenem, Columnas de la hoja de trabajo
Filas: Ertapenem Columnas: Columnas de la hoja de trabajo
SonoraGestantes_23
Sonora Nogestantes_23 Todo
Ertapenem Resistente 6 4 10
Ertapenem Sensible 44 46 90
Todo 50 50 100
Contenido de la celda Conteo
30
Prueba exacta de Fisher
Valor p
0.740666
The same analysis was done for strains from Puebla
Estadísticos descriptivos: Puebla No gestantes, Puebla Gestantes
Estadísticas
Variable Media
Errorestándarde lamedia Desv.Est.
Varianza Suma Mínimo Mediana Máximo
Puebla No gestantes 14.360
0.772 3.861 14.907 359.000 6.000 15.000 21.000
Puebla Gestantes 14.280
0.877 4.383 19.210 357.000 7.000 15.000 24.000
Prueba T e IC de dos muestras: Puebla No gestantes, Puebla Gestantes
Método
μ₁: media de Puebla No gestantes
µ₂: media de Puebla Gestantes
Diferencia: μ₁ - µ₂
No se presupuso igualdad de varianzas para este análisis.
Estadísticas descriptivas
Muestra N MediaDesv.Est.
Errorestándarde lamedia
Puebla No gestantes 25
14.36 3.86 0.77
Puebla Gestantes 25
14.28 4.38 0.88
Estimación de la diferencia
Diferencia
IC de 95%para ladiferencia
0.08 (-2.27, 2.43)
Prueba
Hipótesis nula H₀: μ₁ - µ₂ = 0
31
Hipótesis alterna
H₁: μ₁ - µ₂ ≠ 0
Valor T GL Valor p
0.07 47 0.946
Estadísticas tabuladas: AMIKACINA, Columnas de la hoja de trabajo
Filas: AMIKACINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes
Puebla Nogestantes Todo
Amikacina Resistente 24 19 43
Amikacina Sensible 1 6 7
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0982776
Estadísticas tabuladas: GENTAMICINA, Columnas de la hoja de trabajo
Filas: GENTAMICINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_1
Puebla Nogestantes_1 Todo
Gentamicina Resistente 14 10 24
Gentamicina Sensible 11 15 26
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.396104
Estadísticas tabuladas: NETILMICINA, Columnas de la hoja de trabajo
Filas: NETILMICINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_2
Puebla Nogestantes_2 Todo
Netilmicina Resistente 6 5 11
32
Netilmicina Sensible 19 20 39
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: ÁCIDO NALIDIXICO, Columnas de ... de trabajo
Filas: ÁCIDO NALIDIXICO Columnas: Columnas de la hoja de trabajo
PueblaGestantes_3
Puebla Nogestantes_3 Todo
Ácido nalidixico Resistente 17 18 35
Ácido nalidixico Sensible 8 7 15
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: CIPROFLOXACINO, Columnas de ... a de trabajo
Filas: CIPROFLOXACINO Columnas: Columnas de la hoja de trabajo
PueblaGestantes_4
Puebla Nogestantes_4 Todo
Ciprofloxacina Resistente 10 13 23
Ciprofloxacina Sensible 15 12 27
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.570916
Estadísticas tabuladas: OFLOXACINO, Columnas de la hoja de trabajo
Filas: OFLOXACINO Columnas: Columnas de la hoja de trabajo
33
PueblaGestantes_5
Puebla Nogestantes_5 Todo
Ofloxacina Resistente 12 14 26
Ofloxacina Sensible 13 11 24
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.777512
Estadísticas tabuladas: NORFLOXACINO, Columnas de la ... de trabajo
Filas: NORFLOXACINO Columnas: Columnas de la hoja de trabajo
PueblaGestantes_6
Puebla Nogestantes_6 Todo
Norfloxacina Resistente 8 14 22
Norfloxacina Sensible 17 11 28
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.153647
Estadísticas tabuladas: LEVOFLOXACINO, Columnas de la ... de trabajo
Filas: LEVOFLOXACINO Columnas: Columnas de la hoja de trabajo
PueblaGestantes_7
Puebla Nogestantes_7 Todo
Levofloxacina Resistente 8 11 19
Levofloxacina Sensible 17 14 31
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.560744
Estadísticas tabuladas: AMPICILINA, Columnas de la hoja de trabajo
34
Filas: AMPICILINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_8
Puebla Nogestantes_8 Todo
Ampicilina Resistente
25 25 50
Ampicilina Sensible 0 0 0
Todo 25 25 50
Contenido de la celda Conteo
* ERROR * No se puede calcular la Prueba exacta de Fisher.
Estadísticas tabuladas: CEFALOTINA, Columnas de la hoja de trabajo
Filas: CEFALOTINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_9
Puebla Nogestantes_9 Todo
Cefalotina Resistente 24 25 49
Cefalotina Sensible 1 0 1
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: CEFUROXIMA, Columnas de la hoja de trabajo
Filas: CEFUROXIMA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_10
Puebla Nogestantes_10 Todo
Cefuroxima Resistente 25 23 48
Cefuroxima Sensible 0 2 2
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.489796
Estadísticas tabuladas: CEFTAZIDIMA, Columnas de la hoja de trabajo
35
Filas: CEFTAZIDIMA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_11
Puebla Nogestantes_11 Todo
Ceftazidima Resistente 21 19 40
Ceftazidima Sensible 4 6 10
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.725202
Estadísticas tabuladas: CEFOTAXIMA, Columnas de la hoja de trabajo
Filas: CEFOTAXIMA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_12
Puebla Nogestantes_12 Todo
Cefotaxima Resistente 20 20 40
Cefotaxima Sensible 5 5 10
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: CEFTRIAXONA, Columnas de la hoja de trabajo
Filas: CEFTRIAXONA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_13
Puebla Nogestantes_13 Todo
Ceftriaxona Resistente 24 24 48
Ceftriaxona Sensible 1 1 2
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
36
Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo
Filas: CEFEPIME Columnas: Columnas de la hoja de trabajo
PueblaGestantes_14
Puebla Nogestantes_14 Todo
Cefepime Resistente 8 6 14
Cefepime Sensible 17 19 36
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.753614
Estadísticas tabuladas: AZTREONAM, Columnas de la hoja de trabajo
Filas: AZTREONAM Columnas: Columnas de la hoja de trabajo
PueblaGestantes_15
Puebla Nogestantes_15 Todo
Aztreonam Resistente 15 11 26
Aztreonam Sensible 10 14 24
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.396104
Estadísticas tabuladas: AMOXICILINA-ÁCIDO ... s de la hoja de trabajo
Filas: AMOXICILINA-ÁCIDO CLAVULÁNICO Columnas: Columnas de la hoja de trabajo
PueblaGestantes_16
Puebla Nogestantes_16 Todo
Amoxicilina-Ácido Clavulánico R 23 21 44
Amoxicilina-Ácido Clavulánico S 2 4 6
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.667101
37
Estadísticas tabuladas: TRIMETOPRIM CON ... nas de la hoja de trabajo
Filas: TRIMETOPRIM CON SULFAMETOXAZOL Columnas: Columnas de la hoja de trabajo
PueblaGestantes_17
Puebla Nogestantes_17 Todo
Trimetoprim con sulfametoxazol 11 17 28
14 8 22
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.153647
Estadísticas tabuladas: NITROFURANTOINA, Columnas ... ja de trabajo
Filas: NITROFURANTOINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_18
Puebla Nogestantes_18 Todo
Nitrofurantoina Resistente 16 17 33
Nitrofurantoina Sensible 9 8 17
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: CLORAMFENICOL, Columnas de ... ja de trabajo
Filas: CLORAMFENICOL Columnas: Columnas de la hoja de trabajo
PueblaGestantes_19
Puebla Nogestantes_19 Todo
Cloramfenicol Resistente 9 11 20
Cloramfenicol Sensible 16 14 30
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher38
Valor p
0.773287
Estadísticas tabuladas: FOSFOMICINA, Columnas de la hoja de trabajo
Filas: FOSFOMICINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_20
Puebla Nogestantes_20 Todo
Fosfomicina Resistente
5 1 6
Fosfomicina Sensible 20 24 44
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.189463
Estadísticas tabuladas: COLISTINA, Columnas de la hoja de trabajo
Filas: COLISTINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_21
Puebla Nogestantes_21 Todo
Colistina Resistente 14 17 31
Colistina Sensible 11 8 19
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.560744
Estadísticas tabuladas: TETRACICLINA, Columnas de la hoja de trabajo
Filas: TETRACICLINA Columnas: Columnas de la hoja de trabajo
PueblaGestantes_22
Puebla Nogestantes_22 Todo
Tetraciclina Resistente 13 18 31
Tetraciclina Sensible 12 7 19
Todo 25 25 50
39
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.243634
Estadísticas tabuladas: ERTAPENEM, Columnas de la hoja de trabajo
Filas: ERTAPENEM Columnas: Columnas de la hoja de trabajo
PueblaGestantes_23
Puebla Nogestantes_23 Todo
Ertapenem Resistente 5 0 5
Ertapenem Sensible 20 25 45
Todo 25 25 50
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0501520
Then we compare the resistance between geographic area (pregnant from Sonora vs pregnant from Puebla and non-pregnant from Sonora vs non-pregnant from Puebla) and again we use fisher test exact.
Analysis of resistance between geographic area (pregnant women)
Estadísticos descriptivos: Sonora Gestantes, Puebla Gestantes
Estadísticas
Variable Media
Errorestándarde lamedia Varianza Suma Mínimo Mediana Máximo
Sonora Gestantes 13.700 0.747 27.888 685.000 3.000 12.500 22.000
Puebla Gestantes 14.280 0.877 19.210 357.000 7.000 15.000 24.000
Prueba T de dos muestras e IC
T DE DOS MUESTRAS PARA RESISTENCIA DE SONORA GESTANTES VS PUEBLA GESTANTES
Método
μ₁: media de la muestra 1
µ₂: media de la muestra 2
Diferencia: μ₁ - µ₂40
No se presupuso igualdad de varianzas para este análisis.
Estadísticas descriptivas
Muestra NMedia Desv.Est.
Errorestándarde lamedia
Muestra 1 25 14.17 4.38 0.88
Muestra 2 50 13.80 5.28 0.75
Estimación de la diferencia
Diferencia
IC de 95%para ladiferencia
0.38 (-1.93, 2.69)
Prueba
Hipótesis nula H₀: μ₁ - µ₂ = 0
Hipótesis alterna
H₁: μ₁ - µ₂ ≠ 0
Valor T GL Valor p
0.33 56 0.743
Estadísticas tabuladas: AMIKACINA, Columnas de la hoja de trabajo
Filas: AMIKACINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes
PueblaGestantes Todo
Amikacina Resistente 31 24 55
Amikacina Sensible 19 1 20
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0017493
Estadísticas tabuladas: GENTAMICINA, Columnas de la hoja de trabajo
Filas: GENTAMICINA Columnas: Columnas de la hoja de trabajo
41
SonoraGestantes_1
PueblaGestantes_1 Todo
Gentamicina Resistente 21 14 35
Gentamicina Sensible 29 11 40
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.327681
Estadísticas tabuladas: NETILMICINA, Columnas de la hoja de trabajo
Filas: NETILMICINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_2
PueblaGestantes_2 Todo
Netilmicina Resistente 5 6 11
Netilmicina Sensible 45 19 64
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.164134
Estadísticas tabuladas: ÁCIDO NALIDIXICO, Columnas de ... de trabajo
Filas: ÁCIDO NALIDIXICO Columnas: Columnas de la hoja de trabajo
SonoraGestantes_3
PueblaGestantes_3 Todo
Ácido nalidixico Resistente 37 17 54
Ácido nalidixico Sensible 13 8 21
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.596183
Estadísticas tabuladas: CIPROFLOXACINO, Columnas de ... a de trabajo
42
Filas: CIPROFLOXACINO Columnas: Columnas de la hoja de trabajo
SonoraGestantes_4
PueblaGestantes_4 Todo
Ciprofloxacina Resistente
29 10 39
Ciprofloxacina Sensible 21 15 36
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.152476
Estadísticas tabuladas: OFLOXACINO, Columnas de la hoja de trabajo
Filas: OFLOXACINO Columnas: Columnas de la hoja de trabajo
SonoraGestantes_5
PueblaGestantes_5 Todo
Ofloxacina Resistente 27 12 39
Ofloxacina Sensible 23 13 36
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.634340
Estadísticas tabuladas: NORFLOXACINO, Columnas de la ... de trabajo
Filas: NORFLOXACINO Columnas: Columnas de la hoja de trabajo
SonoraGestantes_6
PueblaGestantes_6 Todo
Norfloxacina Resistente 28 8 36
Norfloxacina Sensible 22 17 39
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0557165
43
Estadísticas tabuladas: LEVOFLOXACINO, Columnas de la ... de trabajo
Filas: LEVOFLOXACINO Columnas: Columnas de la hoja de trabajo
SonoraGestantes_7
PueblaGestantes_7 Todo
Levofloxacina Resistente 29 8 37
Levofloxacina Sensible 21 17 38
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0497151
Estadísticas tabuladas: AMPICILINA, Columnas de la hoja de trabajo
Filas: AMPICILINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_8
PueblaGestantes_8 Todo
Ampicilina Resistente 50 25 75
Ampicilina Sensible 0 0 0
Todo 50 25 75
Contenido de la celda Conteo
* ERROR * No se puede calcular la Prueba exacta de Fisher.
Estadísticas tabuladas: CEFALOTINA, Columnas de la hoja de trabajo
Filas: CEFALOTINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_9
PueblaGestantes_9 Todo
Cefalotina Resistente 48 24 72
Cefalotina Sensible 2 1 3
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
44
Estadísticas tabuladas: CEFUROXIMA, Columnas de la hoja de trabajo
Filas: CEFUROXIMA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_10
PueblaGestantes_10 Todo
Cefuroxima Resistente 41 25 66
Cefuroxima Sensible 9 0 9
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0250838
Estadísticas tabuladas: CEFTAZIDIMA, Columnas de la hoja de trabajo
Filas: CEFTAZIDIMA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_11
PueblaGestantes_11 Todo
Ceftazidima Resistente 37 21 58
Ceftazidima Sensible 13 4 17
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.393294
Estadísticas tabuladas: CEFOTAXIMA, Columnas de la hoja de trabajo
Filas: CEFOTAXIMA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_12
PueblaGestantes_12 Todo
Cefotaxima Resistente 35 20 55
Cefotaxima Sensible 15 5 20
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.417336
45
Estadísticas tabuladas: CEFTRIAXONA, Columnas de la hoja de trabajo
Filas: CEFTRIAXONA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_13
PueblaGestantes_13 Todo
Ceftriaxona Resistente 41 24 65
Ceftriaxona Sensible 9 1 10
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.150249
Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo
Filas: CEFEPIME Columnas: Columnas de la hoja de trabajo
SonoraGestantes_14
PueblaGestantes_14 Todo
Cefepime Resistente 19 8 27
Cefepime Sensible 31 17 48
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.799042
Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo
Filas: CEFEPIME Columnas: Columnas de la hoja de trabajo
SonoraGestantes_14
PueblaGestantes_14 Todo
Cefepime Resistente 19 8 27
Cefepime Sensible 31 17 48
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
46
Valor p
0.799042
Estadísticas tabuladas: AZTREONAM, Columnas de la hoja de trabajo
Filas: AZTREONAM Columnas: Columnas de la hoja de trabajo
SonoraGestantes_15
PueblaGestantes_15 Todo
Aztreonam Resistente 20 15 35
Aztreonam Sensible 30 10 40
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.141307
Estadísticas tabuladas: AMOXICILINA-ÁCIDO ... s de la hoja de trabajo
Filas: AMOXICILINA-ÁCIDO CLAVULÁNICO Columnas: Columnas de la hoja de trabajo
SonoraGestantes_16
PueblaGestantes_16 Todo
Amoxicilina-Ácido Clavulánico R 37 23 60
Amoxicilina-Ácido Clavulánico S 13 2 15
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0757365
Estadísticas tabuladas: TRIMETOPRIM CON ... nas de la hoja de trabajo
Filas: TRIMETOPRIM CON SULFAMETOXAZOL Columnas: Columnas de la hoja de trabajo
SonoraGestantes_17
PueblaGestantes_17 Todo
Trimetoprim con sulfametoxazol 32 11 43
18 14 32
Todo 50 25 75
Contenido de la celda Conteo
47
Prueba exacta de Fisher
Valor p
0.137766
Estadísticas tabuladas: NITROFURANTOINA, Columnas ... ja de trabajo
Filas: NITROFURANTOINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_18
PueblaGestantes_18 Todo
Nitrofurantoina Resistente 20 16 36
Nitrofurantoina Sensible 30 9 39
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0851649
Estadísticas tabuladas: CLORAMFENICOL, Columnas de ... ja de trabajo
Filas: CLORAMFENICOL Columnas: Columnas de la hoja de trabajo
SonoraGestantes_19
PueblaGestantes_19 Todo
Cloramfenicol Resistente 30 9 39
Cloramfenicol Sensible 20 16 36
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0851649
Estadísticas tabuladas: FOSFOMICINA, Columnas de la hoja de trabajo
Filas: FOSFOMICINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_20
PueblaGestantes_20 Todo
Fosfomicina Resistente 2 5 7
Fosfomicina Sensible 48 20 68
Todo 50 25 75
48
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0374944
Estadísticas tabuladas: COLISTINA, Columnas de la hoja de trabajo
Filas: COLISTINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_21
PueblaGestantes_21 Todo
Colistina Resistente
35 14 49
Colistina Sensible 15 11 26
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.304327
Estadísticas tabuladas: TETRACICLINA, Columnas de la hoja de trabajo
Filas: TETRACICLINA Columnas: Columnas de la hoja de trabajo
SonoraGestantes_22
PueblaGestantes_22 Todo
Tetraciclina Resistente 35 13 48
Tetraciclina Sensible 15 12 27
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.136497
Estadísticas tabuladas: ERTAPENEM, Columnas de la hoja de trabajo
Filas: ERTAPENEM Columnas: Columnas de la hoja de trabajo
SonoraGestantes_23
PueblaGestantes_23 Todo
Ertapenem Resistente 6 5 11
49
Ertapenem Sensible 44 20 64
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.489947
Analysis of resistance between geographic area (Non-pregnant women)
Estadísticos descriptivos: Sonora No gestantes, Puebla No gestantes
Estadísticas
Variable Media
Errorestándarde lamedia Varianza Suma Mínimo Mediana Máximo
Sonora No gestantes 13.880 0.483 11.659 694.000 6.000 14.000 21.000
Puebla No gestantes 14.360 0.772 14.907 359.000 6.000 15.000 21.000
Prueba T de dos muestras e IC
T DE DOS MUESTRAS PARA RESISTENCIA ENTRE SONORA NO GESTANTES VS PUEBLA NO GESTANTES
Método
μ₁: media de la muestra 1
µ₂: media de la muestra 2
Diferencia: μ₁ - µ₂
No se presupuso igualdad de varianzas para este análisis.
Estadísticas descriptivas
Muestra NMedia Desv.Est.
Errorestándarde lamedia
Muestra 1 25 14.36 3.86 0.77
Muestra 2 50 13.88 3.41 0.48
Estimación de la diferencia
Diferencia
IC de 95%para ladiferencia
0.480 (-1.357, 2.317)
50
Prueba
Hipótesis nula H₀: μ₁ - µ₂ = 0
Hipótesis alterna
H₁: μ₁ - µ₂ ≠ 0
Valor T GL Valor p
0.53 43 0.601
Estadísticas tabuladas: AMIKACINA, Columnas de la hoja de trabajo
Filas: AMIKACINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes
Sonora Nogestantes Todo
Amikacina Resistente 19 32 51
Amikacina Sensible 6 18 24
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.431416
Estadísticas tabuladas: GENTAMICINA, Columnas de la hoja de trabajo
Filas: GENTAMICINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_1
Sonora Nogestantes_1 Todo
Gentamicina Resistente 10 22 32
Gentamicina Sensible 15 28 43
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
51
0.807699
Estadísticas tabuladas: NETILMICINA, Columnas de la hoja de trabajo
Filas: NETILMICINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_2
Sonora Nogestantes_2 Todo
Netilmicina Resistente
5 2 7
Netilmicina Sensible 20 48 68
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.0374944
Estadísticas tabuladas: ÁCIDO NALIDIXICO, Columnas de ... de trabajo
Filas: ÁCIDO NALIDIXICO Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_3
Sonora Nogestantes_3 Todo
Ácido nalidixico Resistente 18 37 55
Ácido nalidixico Sensible 7 13 20
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: CIPROFLOXACINA, Columnas de ... a de trabajo
Filas: CIPROFLOXACINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_4
Sonora Nogestantes_4 Todo
Ciprofloxacina Resistente
13 22 35
Ciprofloxacina Sensible 12 28 40
Todo 25 50 75
52
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.624943
Estadísticas tabuladas: OFLOXACINA, Columnas de la hoja de trabajo
Filas: OFLOXACINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_5
Sonora Nogestantes_5 Todo
Ofloxacina Resistente 14 18 32
Ofloxacina Sensible 11 32 43
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.137766
Estadísticas tabuladas: NORFLOXACINA, Columnas de la ... de trabajo
Filas: NORFLOXACINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_6
Sonora Nogestantes_6 Todo
Norfloxacina Resistente 14 19 33
Norfloxacina Sensible 11 31 42
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.149742
Estadísticas tabuladas: LEVOFLOXACINA, Columnas de la ... de trabajo
Filas: LEVOFLOXACINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_7
Sonora Nogestantes_7 Todo
Levofloxacina Resistente 11 16 27
53
Levofloxacina Sensible 14 34 48
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.321042
Estadísticas tabuladas: AMPICILINA, Columnas de la hoja de trabajo
Filas: AMPICILINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_8
Sonora Nogestantes_8 Todo
Ampicilina Resistente 25 50 75
Ampicilina Sensible 0 0 0
Todo 25 50 75
Contenido de la celda Conteo
* ERROR * No se puede calcular la Prueba exacta de Fisher.
Estadísticas tabuladas: CEFALOTINA, Columnas de la hoja de trabajo
Filas: CEFALOTINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_9
Sonora Nogestantes_9 Todo
Cefalotina Resistente 25 49 74
Cefalotina Sensible 0 1 1
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: CEFUROXIMA, Columnas de la hoja de trabajo
Filas: CEFUROXIMA Columnas: Columnas de la hoja de trabajo
Sonora Nogestantes_10
Puebla Nogestantes_1
Todo
54
0
Cefuroxima Resistente 50 23 73
Cefuroxima Sensible 0 2 2
Todo 50 25 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.108108
Estadísticas tabuladas: CEFTAZIDIMA, Columnas de la hoja de trabajo
Filas: CEFTAZIDIMA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_11
Sonora Nogestantes_11 Todo
Ceftazidima Resistente 19 33 52
Ceftazidima Sensible 6 17 23
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.435423
Estadísticas tabuladas: CEFOTAXIMA, Columnas de la hoja de trabajo
Filas: CEFOTAXIMA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_12
Sonora Nogestantes_12 Todo
Cefotaxima Resistente 20 47 67
Cefotaxima Sensible 5 3 8
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.107894
Estadísticas tabuladas: CEFTRIAXONA, Columnas de la hoja de trabajo
55
Filas: CEFTRIAXONA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_13
Sonora Nogestantes_13 Todo
Ceftriaxona Resistente 24 50 74
Ceftriaxona Sensible 1 0 1
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.333333
Estadísticas tabuladas: CEFEPIME, Columnas de la hoja de trabajo
Filas: CEFEPIME Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_14
Sonora Nogestantes_14 Todo
Cefepime Resistente 6 14 20
Cefepime Sensible 19 36 55
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.787614
Estadísticas tabuladas: AZTREONAM, Columnas de la hoja de trabajo
Filas: AZTREONAM Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_15
Sonora Nogestantes_15 Todo
Aztreonam Resistente 11 15 26
Aztreonam Sensible 14 35 49
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.304327
56
Estadísticas tabuladas: AMOXICILINA-ÁCIDO ... s de la hoja de trabajo
Filas: AMOXICILINA-ÁCIDO CLAVULÁNICO Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_16
Sonora Nogestantes_16 Todo
Amoxicilina-Ácido Clavulánico R 21 47 68
Amoxicilina-Ácido Clavulánico S 4 3 7
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.212736
Estadísticas tabuladas: ... METOXAZOL, Columnas de la hoja de trabajo
Filas: TRIMETOPRIM-SULFAMETOXAZOL Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_17
Sonora Nogestantes_17 Todo
Trimetoprim con sulfametoxazol 17 35 52
8 15 23
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: NITROFURANTOINA, Columnas ... ja de trabajo
Filas: NITROFURANTOINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_18
Sonora Nogestantes_18 Todo
Nitrofurantoina Resistente 17 41 58
Nitrofurantoina Sensible 8 9 17
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
57
Valor p
0.242016
Estadísticas tabuladas: CLORAMFENICOL, Columnas de ... ja de trabajo
Filas: CLORAMFENICOL Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_19
Sonora Nogestantes_19 Todo
Cloramfenicol Resistente 11 25 36
Cloramfenicol Sensible 14 25 39
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.806675
Estadísticas tabuladas: FOSFOMICINA, Columnas de la hoja de trabajo
Filas: FOSFOMICINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_20
Sonora Nogestantes_20 Todo
Fosfomicina Resistente 1 2 3
Fosfomicina Sensible 24 48 72
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: COLISTINA, Columnas de la hoja de trabajo
Filas: COLISTINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_21
Sonora Nogestantes_21 Todo
Colistina Resistente
17 34 51
Colistina Sensible 8 16 24
Todo 25 50 7558
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
1
Estadísticas tabuladas: TETRACICLINA, Columnas de la hoja de trabajo
Filas: TETRACICLINA Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_22
Sonora Nogestantes_22 Todo
Tetraciclina Resistente 18 29 47
Tetraciclina Sensible 7 21 28
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.313488
Estadísticas tabuladas: ERTAPENEM, Columnas de la hoja de trabajo
Filas: ERTAPENEM Columnas: Columnas de la hoja de trabajo
Puebla Nogestantes_23
Sonora Nogestantes_23 Todo
Ertapenem Resistente 0 4 4
Ertapenem Sensible 25 46 71
Todo 25 50 75
Contenido de la celda Conteo
Prueba exacta de Fisher
Valor p
0.294500
REFERENCES
1. CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement.; 2017.
59
2. Rashid RA, Tarr PI, Moseley SL. Expression of the Escherichia coli IrgA homolog adhesin is regulated by the ferric uptake regulation protein. Microb Pathog. 2006. doi:10.1016/j.micpath.2006.07.006
3. Tiba MR, Yano T, Leite DDS. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev Inst Med Trop Sao Paulo. 2008. doi:10.1590/S0036-46652008000500001
4. Sabate M, Moreno E, Perez T, Andreu A, Prats G. Pathogenicity island markers in commensal and uropathogenic Escherichia coli isolates. Clin Microbiol Infect. 2006;12(9):880-886. doi:10.1111/j.1469-0691.2006.01461.x
5. Bush K, Jacoby GA. Updated Functional Classification of -Lactamases. Antimicrob Agents Chemother. 2010;54(3):969-976. doi:10.1128/AAC.01009-09
6. Picazo JJ, Gobernado M, Cruz FJ, et al. Procedimientos En Microbiología Clínica.; 2011. https://www.seimc.org/contenidos/documentoscientificos/procedimientosmicrobiologia/seimc-procedimientomicrobiologia14.pdf.
7. Shin SH, Lim Y, Lee SE, Yang NW, Rhee JH. CAS agar diffusion assay for the measurement of siderophores in biological fluids. J Microbiol Methods. 2001;44(1):89-95. doi:10.1016/S0167-7012(00)00229-3
8. Wiles TJ, Kulesus RR, Mulvey MA. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp Mol Pathol. 2008;85(1):11-19. doi:10.1016/j.yexmp.2008.03.007
9. A. Cravioto, R.J. Gross SMS and BR. STRAINS OF ESCHERICHIA COLI FROM EXTRAINTESTINAL SOURCES : LACK OF. 1979;6:41-44.
10. Rodriguez-Angeles MG. Principales caracter??sticas y diagn??stico de los grupos pat??genos de Escherichia coli. Salud Publica Mex. 2002;44(5):464-475. doi:10.1590/S0036-36342002000500011
11. Constantiniu S. Escherichia coli enterohemoragic – an emerged pathogen of human infections - Part II. Non-O157 Escherichia coli. J Prev Med. 2002;10(4):57-73.
12. Blanco JE, Blanco M, Alonso MP, et al. Serotypes , Virulence Genes , and Intimin Types of Shiga Toxin ( Verotoxin ) -Producing Escherichia coli Isolates from Human Patients : Prevalence in Lugo , Spain , from 1992 through 1999. J Clin Microbiol. 2013;42(1):311-319. doi:10.1128/JCM.42.1.311
13. Bielaszewska M, Schiller R, Lammers L, et al. Heteropathogenic virulence and phylogeny reveal phased pathogenic metamorphosis in Escherichia coli O2: H6. EMBO Mol Med. 2014;6(3):347-357. doi:10.1002/emmm.201303133
14. Bourdin G, Navarro A, Sarker SA, et al. Coverage of diarrhoea-associated Escherichia coli isolates from different origins with two types of phage cocktails. Microb Biotechnol. 2014;7(2):165-176. doi:10.1111/1751-7915.12113
15. Donaldson SC, Straley BA, Hegde N V., Sawant AA, DebRoy C, Jayarao BM. Molecular epidemiology of ceftiofur-resistant escherichia coli isolates from dairy calves. Appl Environ Microbiol. 2006;72(6):3940-3948. doi:10.1128/AEM.02770-05
16. Molina-López J, Aparicio-Ozores G, Ribas-Aparicio RM, et al. Drug resistance, serotypes, and phylogenetic groups among uropathogenic Escherichia coli including O25-ST131 in Mexico City. J Infect Dev Ctries. 2011;5(12):840-849. doi:10.3855/jidc.1703
17. Regua-Mangia AH, Irino K, Da Silva Pacheco R, Pimentel Bezerra RM, Santos Périssé AR, Teixeira LM. Molecular characterization of uropathogenic and diarrheagenic Escherichia coli pathotypes. J Basic Microbiol. 2010;50(SUPPL. 1):107-115. doi:10.1002/jobm.200900364
18. Lienemann T, Salo E. Shiga Toxin – producing Escherichia coli Serotype O78 : H – in Family, Finland, 2009 Taru. Emerg Infect …. 2012;18(4):577-581. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3309701/.
19. Blanco M, Blanco JE, Mora a, et al. Types of Shiga Toxin ( Verotoxin ) -Producing Escherichia coli Isolates from Healthy Sheep in Spain Serotypes , Virulence Genes , and Intimin Types of Shiga Toxin ( Verotoxin ) -Producing Escherichia coli Isolates from Healthy Sheep in Spain. Society. 2003;41(4):1351-1356. doi:10.1128/JCM.41.4.1351
20. Carrillo-Casas EM, Suástegui-Urquijo Z, Arroyo-Escalante S, et al. E. coli outbreak in a neonate intensive care unit in a general hospital in Mexico City. Folia Microbiol (Praha). 2013;58(3):229-234. doi:10.1007/s12223-012-0202-x
21. Pearce JL, Bettelheim KA, Luke RKJ, Goldwater PN. Serotypes of Escherichia coli in Sudden Infant Death Syndrome. J Appl Microbiol. 2010;108(2):731-735. doi:10.1111/j.1365-2672.2009.04473.x
60
22. Sainz E, Rosario T, Reyes M, Vicente P, Patricia M, Eslava C. Resistencia a antimicrobianos de cepas de E. coli de diversos serotipos aisladas de pacientes de un Hospital Psiquiátrico. Rev Mex Ciencias Farm. 2008.
23. Zhang W, Bielaszewska M, Kuczius T, Karch H. Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx1c) in Escherichia coli strains isolated from humans. J Clin Microbiol. 2002. doi:10.1128/JCM.40.4.1441-1446.2002
24. Poppe C, Martin L, Gyles C, et al. Acquisition and transfer of resistance to extended-spectrum cephalosporins by Salmonella Newport and E. coli in the intestinal tract of turkey poults. Guelph Food Saf Semin Ser Symp Guelph,. 2004;71(3):1184-1192. doi:10.1128/AEM.71.3.1184
61