Does (HFE) hemochromatosis exist in India?
20
Does (HFE) hemochromatosis exist in India? Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow
description
Does (HFE) hemochromatosis exist in India?. Rakesh Aggarwal Department of Gastroenterology SGPGI, Lucknow. Hemochromatosis. - PowerPoint PPT Presentation
Transcript of Does (HFE) hemochromatosis exist in India?
Does (HFE) hemochromatosis exist in India?
Rakesh Aggarwal Department of Gastroenterology
SGPGI, Lucknow
Hemochromatosis
A progressive increase in body iron content, leading to systemic iron loading of parenchymal cells (particularly hepatocytes) and, eventually, to organ disease.
Iron homeostasis in humans
Pietrangelo. New Engl J Med 2004; 350: 2383-97.
Hemochromatosis: Types
• Primary
• Secondary– Parenteral iron overload
• RBCs• Iron
– Anemias– Chronic liver disease (esp alcohol)
Hemochromatosis
Pietrangelo. New Engl J Med 2004; 350: 2383-97.
HFE gene frequency in Caucasians
Population sample
Country Sample size
Prevalence of C282
homozygotes
Allele frequenc
y
Electoral roll New Zealand 1,064 1 in 213 6.9%
Field survey Australia 3,011 1 in 188 7.3%Primary care USA 4,865 1 in 405 5.0%Health clinic USA 41,038 1 in 270 6.1%
Primary care USA/Canada 20,130 1 in 322 5.6%
Harrison SA, Bacon BR. J Hepatol 2003; 38: S14-S23.
C282Y HFE mutation: Indian population
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Kaur, 2003 Delhi 116 *1 232 0.4Thakur, 2004 Delhi 134 0 268 0.0
Garewal, 2005 Chandigarh 60 0 120 0.0
Panigrahi, 2006 Delhi 74 0 148 0.0
Dhillon, 2007 Chandigarh 100 0 200 0.0
Dhillon, 2007 Chandigarh 80 0 160 0.0
Agarwal, 2007 Lucknow 421 0 842 0.0Jain, 2011 Lucknow 502 0 1004 0.0Total 1 2974 0.034* PCR using sequence-specific primers
HFE C282Y: Indian Thallassemics
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Kaur, 2003 Delhi 75 *6 150 4.0
Garewal, 2005 Chandigarh 215 0 430 0.0
Agarwal, 2006 Lucknow 147 0 294 0.0Agarwal, 2007 Lucknow 308 0 616 0.0Sharma, 2007 Delhi 63 0 126 0.0Total 6 1616 0.371* PCR using sequence-specific primers
HFE C282Y: Indian liver disease patients
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Thakur, 2004 Delhi 249 0 498 0.0
Duseja, 2005** Chandigarh 16 0 32 0.0
Agarwal, 2006 Lucknow 65 0 130 0.0Panigrahi, 2006*** Delhi 31 0 62 0.0
Dhillon, 2007 Chandigarh 236 0 472 0.0
Jain, 2011 Lucknow 496 *1 992 0.1Total 1 2186 0.046* PCR-RFLP
** Non-alcoholic steatohepatitis*** With transferrin saturation >45%
H63D HFE mutation in Indian population
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
Kaur, 2003 Delhi 116 20 232 8.6Panigrahi, 2006 Delhi 74 6 148 4.1
Dhillon, 2007 Chandigarh 100 13 200 6.5
Dhillon, 2007 Chandigarh 80 6 160 3.8
Agarwal, 2007 Lucknow 421 47 842 5.6Jain, 2011 Lucknow 502 46 1004 4.6Total 138 2586 5.3
HFE H63D: Thallassemia / Liver disease
Study City Number of
subjects
Number of
Y alleles
Number of total
alleles
% of Y
allelles
ThallassemiaKaur, 2003 Delhi 75 19 150 12.7Agarwal, 2007 Lucknow 308 49 616 8.0Sharma, 2007 Delhi 63 8 126 6.3Total 76 892 8.5Chronic liver disease
Duseja, 2005 Chandigarh 16 4 32 12.5
Panigrahi, 2006 Delhi 31 8 62 12.9
Dhillon, 2007 Chandigarh 236 36 472 7.6
Jain, 2011 Lucknow 496 60 992 6.0Total 108 1558 6.9
Indian liver disease patients: Fe overload
Author N Findings
Thakur 249 24 (9.6%) had transferrin saturation >60%
Duseja 31 Only 1/23 (5%) had transferrin saturation >45%;Liver biopsy in 16: none had 3+/4+ Perl stain
Dhillon 236 Only 17 (7.2%) had iron overload
Jain 496 Only 13 (2.6%) had iron overload
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Shukla et al. Natl Med J India 2006; 19: 20-3.
Indian patients with iron overload
PCR-RFLP for C282Y
• HFE gene– None of the 5 patients had C282Y mutation– One had homozygous H63D mutation– None had previously known splice site
mutations– Four had a IVS2+4 T/C change
• HAMP gene (Hepcidin)– None had G71A or IVS2+1(-G) mutation
• SLC11A3 gene (Ferroportin)– None had G71A or IVS2+1(-G) mutation
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
1 2 3 4 5 6
3 4 52 61
GTATGTGGAGAGGGGGCAAGG
GTATGTGGAGAGGGGGCAAGG
GTACGTCGAGAGGGGGCAAGG
GTAYGTGGAGAGGGGGCAAGG
GTACGTCGAGAGGGGGCAAGG
GTAYGTGGAGAGGGGGCAAGG
Z92910.1
Patient #1
Patient #2
Patient #3
Patient #4
Patient #5 Y = T or C
Splice site
Intron
Exon
Indian patients with iron overload
Shukla et al. Natl Med J India 2006; 19: 20-3.
Other data from the Indian subcontinent
Family Origin Onset age
Protein Exon AA change
A Bangladesh 19 Hemojuvelin 3 C80YB Pakistan 26 Hemojuvelin 3 G99RC Pakistan 11 Hemojuvelin 3 G99RD Pakistan 23 Hemojuvelin 3 P192LE Pakistan 32 Hemojuvelin 3 L194PF Sri Lanka 17 Hemojuvelin 4 A343fsX2
3G Pakistan 21 Hepcidin 2 R42SfsH Thailand 38 Ferroportin 7 C326Y
Lok et al. Blood 2009; 114: 20-5.
Hemochromatosis in India: Summary
• Iron overload Occasional
• C282Y mutation Very infrequent
• C282Y HFE disease Extremely rare
