System. Appl. Microbiol. 21,454-460 (1998) SYSTEMATIC AND _©_G_us_ta_v_Fi_sc_he_r ¥_e_r1_ag _________________ APPLIED MICROBIOLOGY

Discrimination Among Pediocin AcH/PA-1 Producer Strains by Comparison of ped8 and pedD Amplified Genes and by Multiplex PCR assay

DIEGO MORA, CARLO PARINI, MARIA GRAZIA FORTINA, and PIER LUIGI MANACHINI

Department of Food Science and Microbiology, Industrial Microbiology section, University of Milano, 20133 Milano, Italy

Received June 9, 1998

Summary

Pediococcus acidilactici, Pediococcus parvulus and Lactobacillus plantarum pediocin AcHlPA-1 pro­duces strains were studied with the aim to investigate their common genetic pediocin determinant using pedA, pedB, pedC and pedD gene-targeted PCR assay. Single Strand Conformation Polymorphism and restriction analysis of pedA and pedC amplified fragments from the three different species did not show any differences in sequence while these analysis carried out on pedB and pedD amplified fragments highlighted differences related to the three species analyzed harboring these plasmid encoded genes. Fur­thermore different multiplex PCR assays using IdhD, pedA and pedD as target genes were developed to clearly identify the pediocin AcH/PA-1 producer strains and to obtain the simultaneous identification of the P. acidilactici strains.

Key words: Identification - Pediocin AcH/PA-1 - PCR - SSCP - Pediococcus acidilactici - Pediococcus parvulus - Lactobacillus plantarum

Introduction

The importance of lactic acid bacteria (LAB) in the food industry, as widely known, is related to their use as starter cultures in dairy, meat and vegetable fermented products. These microorganisms are involved in the ex­tension of the shelf life and the improving of the hygienic quality of several fermented and not fermented products both for the production of lactic acid or the secretion of antibacterial compounds like bacteriocins (STILES, 1996). As regards the genus Pediococcus, one of the most known bacteriocin is the pediocin AcHlPA-1 (BHUNIA et aI., 1988; MARUGG et aI., 1992; MOTLAGH et aI., 1994).

The pediocin AcHlPA-1 belongs to the class II of bac­teriocins (KLAENHAMMER, 1993) and shows a wide range of inhibitory spectrum particularly as regards to Listeria monocytogenes, Staphylococcus aureus, Clostridium per­fringens and Clostridium botulinum (BHUNIA et aI., 1988; BHUNIA et aI., 1991; OKEREKE and MONTVILLE, 1991). For these reasons P. acidilactici pediocin producer strains have been studied for their potential role in sever­al food biopreservation processes (STILES and HASTINGS, 1991; GOFF et aI., 1996; STILES, 1996).

LAB strains isolated from different environments may often produce the same bacteriocins indicating that the genes involved in the biosynthesis of these molecules are

wide spread, as was found for lactocin S. structural gene (RODRIGUEZ et aI., 1995). Recent studies underlined that also pediocin AcHlPA-1 is secreted in other species and genera of LAB probably as a consequence of the mobility of the plasmid involved in the pediocin production. Actu­ally, also P. parvulus strains ATO 34 and 77, and Lacto­bacillus plantarum WHE 92 are able to produce the pe­diocin, but with some differences as regards the cultural condition affecting the production of the peptide (ENNA­HAR et aI., 1996, BENNIK et aI., 1997).

In the last few years several studies were carried out with the aim to develop PCR analysis in order to identify lactobacilli that may produce well-characterized bacteri­ocins (RODRIGUEZ et ai., 1995; REMIGER et aI., 1996; JOOSTEN et aI., 1997). In our knowledge only few studies concerning the specific detection of P. acidilactici pe­diocin producer strains were developed and two of them were based on monoclonal antibody-colony immunoblot method or Southern hybridization experiment (BHUNIA and JOHNSON, 1992; BHUNIA et aI., 1994). Recently, the specific PCR detection of pediocin PA-1 producer pedio­cocci was developed using a primer set targeted to the plasmid region encompassed pedA and pedB genes (re­sponsible of the prepediocine synthesis and the immunity

Discrimination among pediocin AcH/PA-1 producer strains 455

functions respectively) and performed on a plasmid DNA purified by ethidium bromide-cesium chloride density gradient ultracentrifugation (RODRIGUEZ et al., 1997). On the other hand no studies were performed to discrim­inate among pediocin AcH/PA-l producers strains of dif­ferent species.

The purpose of this research was, firstly to verify if the pediocin AcH/PA-1 producers strains of three different species show similar genetic organization of the pediocin operon. Secondly a comparative study, through Single Strand Conformation Polymorphism (SSCP) and restric­tion analysis of the plasmid genes involved in the pe­diocin production, in P. acidilactici, P. parvulus and L. plantarum strains was carried out with the aim to evalu­ate if there were any differences which could be related to the pediocin producing species. Furthermore, another purpose of this study was also to design and optimize a multiplex PCR assay useful for the identification of P. acidilactici pediocin AcH/PA-1 producer strains based on the detection of the essential plasmid genes involved in the pediocin production after a simple and fast procedure of DNA extraction.

Material and Methods

Bacterial strains and culture conditions: Strains were rou­tinely maintained at 4 °C after growth at their optimum tem­perature for 12 or 24 h in MRS broth (Difco). For longer term maintenance, stock cultures were stored in 20% (v/v) glycerol, 80% (v/v) MRS at -20°C and -80 0c. The strains of LAB used in this work their origin and their relevant characteristics are shown in Table 1.

Table 1. Strain tested, origin and relevant characteristics.

DNA preparation: For the PCR reaction 100 rl of an over­night culture in MRS broth were added to 400 rl of TE IX buffer (10 mM Tris-HCI, 1 mM NazEDTA, pH 8) containing 0.45 mg/ml of lysozyme (Sigma). This suspension was incubat­ed for 30 min at 37°C and then added with SDS and proteinase K (Sigma) to a final concentration respectively of 0.6% (wt/vol) and 7 U/ml. After incubation for 30 min the solution was ex­tracted with an equal volume of phenol molecular biology grade. The DNA was then precipitated by ading 1110 volume of sodium acetate and 2 volumes of 95% ethanol. The DNA pellet was air dried and subsequently dissolved in 50 rl of sterilized water HPLC grade and stored at -20°C.

Primer selection and PCR conduction: All the sets of primer targeted to the genes involved in the pediocin AcHiPA -1 pro­duction were designed on the sequence published by MARUGG et al. (1992). The sequence of the primers and their location are shown in Table 2. Before the use of the primers in PCR experi­ments their sequences were checked in the prokaryotes EMBL database using the EBI sequence homology searches, FASTA (PEARSON and LEPMAN, 1988; PEARSON, 1990) to be sure that no significant matches were present with other genes. PCR experi­ment were carried out in a volume of 25 or 100 rl containing: 1 or 3 rl of bacterial genomic DNA solution obtained as above, 1/10 volume of lOX reaction buffer (DiaTech®); 200 rM of each deoxynucleoside triphosphate (dNTP); 2.5 mM of MgClz; 0.5 rM of each primer (Amersham Pharmacia Biotech); and 0.02 U/rl of Taq polymerase (DiaTech®). All amplification reac­tions were performed in a Gene Amp. PCR System 2400 (Per­kin-Elmer). The temperature profile used consisted of the fol­lowing primary DNA denaturation step of 94°C for 1 min fol­lowed by 35 cycles of 45 sec at 94 °c, 1 min at 65°C and 2 min at 72 0C. The final extension was continued for 7 min at 72 0C. Following the amplification, 8 rl of product were electrophore­ses at 5 V/cm (1.5% agarose gel, 0.2 mg/ml of ethidium bro­mide) in TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8) and photographed in UV light.

Strain Origin and relevant characteristics

Pediococcus sp. Pediococcus sp. Pediococcus sp. Pediococcus acidilactici P ediococcus acidilactici Pediococcus acidilactici Pediococcus acidilactici P ediococcus acidilactici Pediococcus acidilactici Pediococcus acidilactici P ediococcus acidilactici pediococcus parvulus Pediococcus parvulus Lactobacillus plantarum Lactobacillus sp.

psp2(al; fermented Italian sausages Pdi 11 (a); sour dough PG(a); sour dough pib); pediocin AcH/PA-l producer strain PAC 1.0(e); pediocin AcH/PA-1 producer strain PAC 750 pid l; Pac 1.0 cured strain DSMZ20238 DSNZ 20284T

ATCC 8042 ATCC 12697 ATCC 25740 ATO 34«); pediocin AcH/PA-l producer strain ATO 77(el; pediocin AcH/PA-1 producer strain WHE 92(£); pediocin AcH/PA-l producer strain NCK 537(d; test strain bacteriocins sensible for the activity assay

(al = Strains kindly provided by Prof. A. GALLI VOLONTERIO, Department of Food Science and Microbiology, Agricultural, Food and Ecological Microbiology section, University of Milan, Italy.

(h) = Strains kindly provided by Prof. BIBEK RAY, Department of Animal Science, Food Microbiology Laboratory, University of Wyoming.

(c) = Strains kindly provided by Dr. T. R. KLAENHAMMER, Department of Food Science, College of Agriculture and Life Sciences, North Carolina State University, obtained by Dr. G. GIRAFFA, Experimental Dairy Institute, Lodi, Italy.

(d) = Strains kindly provided by Dr. G. GIRAFFA, Experimental Dairy Institute, Lodi, Italy. Ie) = Strains kindly provided by Dr. E. KETS, Agrotechnological Research Institute (ATO-DLO), Wageningen. (f) = Strains kindly provided by Mr. ALAIN STRASSER, AERIAL, Schiltigheim, France.

456 D. MORA et al.

Table 2. Plasmid, sequence and position of the primers used in the polymerase chain reaction.

Primer/Plasmid Sequence (5' ---j 3') Descriptionla ) Reference

PedAIF AAGAAATGGCCAATATCATTGGTGGT this study PedAIR CATTTATGATTACCTTGATGTCCACC pedA,157 this study PedBF ATGAATAAGACTAAGTCGGAACAT this study PedBR TTGGCTAGGCCACGTATTGGTAGT pedB,336 this study PedCF AACCATGGGTTCTAAGAAATTTTGG this study PedCR AAGGAATTCCCAGGTGACTACTGATTATTG pedC, 548 this study PedD2F AACCATGGGTTGGACTCAAAAATGGCAC this study PedDIF TCTAGGGAAATAACTGCTCTAGAGCA pedD, 773 Ib) this study PedD2R AAGAATTCGTCAGGCTATTCTTGATT pedD,2196 this study IdhDF GGACTTGATAACGTACCCGC MORA et al., 1997 IdhDR GTTCCGTCTTGCATTTGACC IdhD,449 MORA et al., 1997 pSRQ220Ie) containing the pediocin KOK,].le)

AcH/PA-loperon

la) = Gene target and dimension of the amplified fragment (bp). Ib) = Dimension of the amplified fragment using PedD2R as reverse primer. Ie) = Plasmid kindly provided by Dr. JAN KOK, Department of Genetics, Groningen Biomolecular Sciences and Biotechnology Insti­

tute, university of Groningen, The Netherlands.

Restriction and SSCP analysis of the amplified fragments: Restriction digestion of the amplified fragments was carried out for 3 h at 37 or 60°C in 20 )II reaction mixture containing 7 )II of the PCR product solution, 2 )II of incubation buffer and 5-10 U of one of the following restriction enzymes, Alu I, Hae III, Hha I, Hpa I, Rsa I, Taq I (Amersham Pharmacia Biotech). Re­striction digests were subsequently analyzed by electrophoresis at 5 Vlcm in TAE buffer (4% wt/vol high resolution agarose gel, BDH, containing 0.2 mg/ml of ethium bromide) and pho­tographed in UV light.

For the SSCP analy~is the 10 )II of PCR or restriction products plus 5 )II of gel loading solution were denaturated at 94 DC for 14 min and immediately cooled on ice. After few minutes 5 )II of the solution were analyzed in 6% acrilamide gel electrophoresis (acrilamide:bis-acrilamide, 29:1 wt/wt) in TBE buffer (90 mM Tris-borate, 2 mM NazEDTA, pH 8). The gel was run at 5 Vlcm in TBE buffer, stained in a solution containing 0.5 )Ig/ml of ethid­ium bromide and photographed in UV light.

Southern hybridization: Amplified fragments from pediocin producer strains were separated electrophoretic ally in agarose gel and transferred to nylon membranes (Boehringer) by Southern blot (SAMBROOK et al., 1985). Plasmid pSRQ220 carrying the pe­diocin operon was used as template for the amplification of pedAf, pedBf, pedCf and pedDf fragments (Table 2). The ampli­fied fragments obtained were then DIG-dUTP labelled by random priming with the Labelling and detection Kit (Boehringer) and used as probes in hybridization experiments. Hydridization was performed according to the manufacturer's recommendations with prehybridisation and hybridization steps in 50% (wt/vol) formamide at 42°C and stringency washes in O.1X SSC, at 68°C.

Antibacterial activity test: P. acidilactici strains were stabbed onto MRS plates and incubated at 37°C for 3 h, and then 15 ml of soft agar containing about 106 CFU of the indicator strain Lactobacillus ap. NCK 537 were poured over the plates. After incubation for 24 h at 37°C, the plates were checked for inhibi­tion zones.

Results

Several pediocin AcH/PA-1 producer strains belonging to three different species of LAB were analyzed with the

aim to verify their common pediocin genetic determi­nants. In this context total DNA of the strains analyzed was extracted and used as template in several PCR as­says. In preliminary experiments carried out using single PCR amplification, all the four primer set selected (Table 2) on the published sequence of pedA, pedB, pedC and pedD genes allowed the amplification of fragments of the expected dimension only in the strains P. acidilactici PAC 1.0, F, that were known to carry the plasmid harboring the pediocin AcH/PA-1 operon, P. parvulus ATO 34, ATO 77 and L. plantarum WHE 92, that produce the same pediocin, and also in the isolate Psp2. No amplifi­cation signals were obtained for the other two isolates, for all the international collection strains and for the PAC 1.0 cured strain. Though it is known that in PAC 1.0 the immunity function is encoded by the chromo­some (VENEMA et aI., 1995) no amplification signal was found using primer set targeted to pedB gene.

As shown in Figure 1A two different fragment of 781 (pedDlE) and 2193 bp (pedDf) were amplified from the pedD gene of PAC 1.0 strain, while three sets of primers were designed for the amplification of a 157 (pedAf), 336 (pedBf) and 548 bp (pedCf) fragments respectively from pedA, pedB and pedC genes. In order to verify the specificity of the amplified fragment obtained, we carried out a Southern hybridization experiment using as probe the same fragments amplified from the plasmid pSRQ220. Positive signals were present in all the ampli­fied fragments obtained both for P. acidilactici, P. parvu­Ius and Lactobacillus plantarum strains as shown in Fig­ure lB. These strains were also positive tot he activity test even if they showed different dimensions of the inhi­bition areas ranging from 6 mm for P. acidilactici strains to 4 and 3 mm respectively for L. plantarum and P. parvulus strains (Figures 1 C).

In order to evaluate differences in the sequence among the genes involved in the pediocin production of the dif­ferent species analyzed, restriction and SSCP analysis of

Discrimination among pediocin AcH/PA-1 producer strains 457

23 .. 51678 11 12 13 14 15 16 17 18 19 2 21 I 22 2J 24 25

B

1 3 4 5 6

Fig. 1. A) PCR detection of pedA, pedB, pedC and pedD genes. B) Southern hybridization using pedAf, pedBf, pedCf and pedDH amplified fragments as probes. For both the pictures lane 1, PAC 1.0-pedAf; lane 2, PAC 1.0-pedBf; lane 3, PAC 1.0-pedCf; lane 4, PAC 1.0-pedD1f: lane 5, PAC 1.0-pedDf; lane 6, Psp2-pedAf; lane 7, Psp2-pedBf; lane 8, Psp2-pedCf; lane 9, Psp2-pedD1f; lane 10, F-pedD1f; lane 11, F-pedCf; lane 12, F-pedBf; lane 13, F-pedAf; lane 14, ATO 34-pedAf; lane 15, ATO 34-pedBf; lane 16, ATO 34-pedCf; lane 17, ATO 34-pedDlf; lane 18, ATO 77-pedD1f; lane 19, ATO 77-pedCf; lane 20, ATO 77-pedBf; lane 21, ATO 77-pedAf; lane 22, WHE 92-pedAf; lane 23, WHE 92-pedBf; lane 24, WHE 92-pedCf; lane 25, WHE 92-pedDlf; M = Molecular weight marker VI (Boehringer), 2176, 1766, 1230, 1033,653,517,453,394,298,234,220, 154 bp. C) Activity test using Lacto­bacillus sp. NCK 537 as indicator strain. 1 - P. acidilactici PAC 1.0; 2 - Psp2; 3 - P. parvulus ATO 34; 4 - ATO 77; 5 - Lactobacil­lus plantarum WHE 92; 6 - DSMZ 20284T •

the amplified fragment obtained were carried out. The dimension of the fragments obtained for pedB, pedC and pedD were according with the theoretic restriction evalu­ated on the published sequences with some exemption for pedD. The results of the SSCP and restriction analysis of pedAf and pedCf amplified fragments from the three different species did not show any differences in se­quence, while restriction analysis of pedDf and SSCP analysis on pedBf amplified fragments highlighted differ­ences related to the three different species analyzed har­boring these plasmid encoded genes (Figure 2). Restric­tion analysis using Hae III revealed different profiles be­tween pedD gene of P. acidilactici and not P. acidilactici strains due to an additional Hae III restriction site in P. parvulus ATO 34, ATO 77 and L. plantarum pedDf am­plified fragment, while the pattern profiles obtained using Alu I (Figure 2A) clearly discriminate P. parvulus strains from the other species for the lack of one restric­tion site for Alu I. As far as pedB genes are concerned, re­striction analysis with Alu I, Hae III, Hha I, Rsa I and

Taq I did not show differences among pedBf amplified fragment. Thus we carried out the SSCP analysis of the amplified fragment pedBf. The data obtained underlined two different profiles: one typical of P. acidilactici strains and one characteristic of P. parvulus and L. plantarum strains (Figure 2B).

Two different multiplex PCR assay were also devel­oped using the primer set PedA1F-PedA1R, specific for the pedA gene and PedD1F-PedD2R, specific for the pedD gene. These two sets of primers were alternatively used with the primers IdhDF and IdhDR designed for the species-specific amplification of a 449 bp fragment from the IdhD gene (ldhDf) in P. acidilactici strains (MORA et aI., 1997). As shows in Figure 3A the amplified fragment pedAf was present in the strains P. acidilactici PAC 1.0, F, Psp2, P. parvulus ATO 34, ATO 77 and L. plantarum WHE 92, while the additional amplified fragment IdhDf was present only in the strains belonging to the P. acidi­lactici species. A second multiplex PCR reaction was then optimized using the additional primer set PedDlF-

458 D. MORA et al.

2 1

lu I Ha I

2 j 4

Fig. 2. A) Restriction profile of pedD amplified fragment using Alu I and Hae III. Lane 1, P. acidilactici Psp2; lane 2, PAC 1.0; lane 3, P. parvulus ATO 34; lane 4, ATO 77; lane 5, Lactobacillus plantarum WHE 92; M, molecular weight marker VI (Boehringer), 2176,1766,1230,1033,653,517,453,394,298,234,220, 154 bp. B) SSCP analysis of pedB amplified fragment. Lane 1, P. acidi­lactici PAC 1.0; lane 2, Psp2; lane 3, F; lane 4, P. parvulus ATO 34; lane 5, ATO 77; lane 6, Lactobacillus plantarum WHE 92.

1 ..

1 J .. ~ 6 •

PedD2R. As shown in Figure 3B three amplification sig­nals (pedAf, pedDlf, IdhDf) were present in the three strains (Psp2, PAC 1.0, F) of P. acidilactici, while only pedAf and pedDlf were amplified in the pediocin pro­ducer strains of p. parvulus (ATO 34, ATO 77) and Lac­tobacillus plantarum (WHE 92).

Fig. 3. A) pedA and IdhD gene targeted multiplex PCR reac­tion; B) pedA, pedD and IdhD gene targeted multiplex PCR re­action. For both the pictures: lane 1, P. acidilactici DSMZ 20284T ; lane 2, Psp2; lane 3, F; lane 4, PAC 1.0; lane 5, PAC 750F; lane 6, P. parvulus ATO 34; lane 7, ATO 77; lane 8, Lac­tobacillus plantarum WHE 92; lane 9, negative control; M, molecular weight marker VI (Boehringer), 2176, 1766, 1230, 1033,653,517,453,394,298,234,220,154 bp.

Discrimination among pediocin AcHIPA-l producer strains 459

Discussion

Since the discovery of pediocin AcH/PA-1 (BHUNIA et aI., 1988; MARUGG et aI., 1992) in P. acidilactici strains several studies were carried out with the aim to use the pediocin producer strains directly in food for the growth preservation of food-associated pathogens as Listeria monocytogenes (STILES and HASTINGS, 1991; GOFF et aI., 1996). Despite the wide range activity of the pediocin AcHlPA-1 against several pathogens the use of pediocin producer strains in biopreservation processes was limited by the cultural growth characteristics of the species P. acidilactici. The discovery of the presence of the pediocin AcH/PA-1 producer strains belonging to other species as P. parvulus and Lactobacillus plantarum (ENNAHAR et aI., 1996, BENNIK et aI., 1997) suggested the possibility to utilize pediocin producer strains in a more wide range of food processes.

Through this study we have also verified that the three species analyzed showed similar genetic organisation of the pediocin AcHlPA-1 production. Moreover the com­parison of pedA, pedB, pedC and pedD genes of the three different species permitted to highlight differences that could be related to the different producing species.

In preliminary experiments all the primer sets selected on the sequence of the four pediocin genes were tested on several strains known to carry the pediocin AcHIPA-1 operon. This first approach was useful of the detection of a new P. acidilactici pedilactici pediocin producer strain, the Psp2 isolates from fermented Italian sausage. South­ern hybridization experiment using as probe the pedAf, pedBf, pedCf and pedDlf amplified fragment from the plasmid pSRQ220 confirmed the specificity of the select­ed primer showing also that a common organization of the bacteriocin operon was present in P. parvulus and L. plantarum strains. In addition all the strains positive to the amplification of the four genes involved in the pe­diocin production were also positive to the activity test using Lactobacillus sp. NCK 537 as sensible strain and according to BENNIK et al. (1997), the activity of P. parvulus strains was lower than the activity evaluated P. acidilactici strains. Furthermore a difference in activity could be also found between the two strains of P. parvu­Ius.

The comparison of pedAf, pedBf, pedCf and pedDf was then carried out by SSCP and restriction analysis. No differences in sequence were observed in pedA and pedC gene, responsible for the coding of the pre-pediocin and for the protein involved in the peptide transport out of the cell (KLAENHAMMER et aI., 1992). An unexpected sequence variation among the species analyzed was ob­served by SSCP analysis in pedB gene, despite its limited dimension (336 bp). All the pediocin producer strains ap­pear to be clustered in two groups the first including P. acidilactici strains and the second one comprising P. parvulus and L. plantarum producer strains.

The differences among pedB genes were highlighted by SSCP but not by restriction analysis using several four base cutting enzymes. These results show that the differ­ences pointed out in SSCP are probably consequence of

single point mutations, because the SSCP analysis high­lights differences in the position of each single strand as a consequence of different conformations assumed. How­ever in our case slight differences were also observed in the migration of the double strand, suggesting that length variations could be present On the other hand variation in immunity proteins of two identical bacteriocins such as sakacin A and curvacin A was observed (AXELSSON et aI., 1993; TICHACZEK et aI., 1993) suggesting that no di­rect interaction occurs between bacteriocins and their immunity proteins (NES et aI., 1996).

As regards to pedD gene, the restriction analysis of pedDf amplified fragment using Hae III and Alu I high­lighted that three different sequences were present for each of the three species analyzed. The high dimension of the pedDf fragment (2196 bp) did not allow any SSCP analysis. The differences observed among the genes in­volved in the immunity (pedB) and in the processing! transport (pedD) of the pediocin AcH/PA-1 could be the evidence of different evolutions of the pediocin operon in the three species analyzed. The sequence variation evalu­ated in pedD gene could be also related to the different amount of pediocin produced by P. parvulus and L. plan­tarum compared with P. acidilactici strains (ENNAHAR et aI., 1996; BENNIK et aI., 1997). In fact, as reported by ENNAHAR et al. (1996), the pediocin AcHlPA-1 produced by L. plantarum WHE 92 appear quantitatively higher compared to P. acidilactici, with the final pH of the cul­ture medium exceeds 5.0. While in this condition its pro­duction from P. acidilactici is considerably reduced. EN­NAHAR et al. (1996) suggested that this evidence could be due to a difference between L. plantarum and P. acidilac­tici posttranlational processing of the prepediocin to pe­diocin in which pedD gene is directly involved (VENEMA et aI., 1995).

Despite the importance of pediocin AcH/PA-1 produc­er strains in food biopreservation processes (STILES, 1996) rapid and accurate assays were never developed for their detection and simultaneous identification at a species level. Here we present several PCR reaction based on a simple DNA extraction useful both for the detection of pediocin AcH/PA-1 producer strains and for the simul­taneous identification of the species P. acidilactici. With regard to the multiplex peR reactions optimized in this study, the presence of pedAf and/or pedDlf amplified fragments allows the readily identification of the pe­diocin producer strains, while the presence of an addi­tionalldhDf fragment allows the ascription of the strains tested to the species P. acidilactici. The use of more then one gene of he pediocin operon in a multiplex PCR reac­tion should be preferable to avoid false negative reaction or false positive due to aspecific primer/template match­ing. Moreover the presence of a species-specific primer set is useful when we are looking for pediocin producer strains of a determined species.

In conclusion, the genetic determinants related to the pediocin production were compared for the first time among P. acidilactici, P. parvulus and L. plantarum pro­ducer strains and relevant differences in sequence in pedB and pedD genes were observed by SSCP and using

460 D. MORA et al.

the restriction analysis of the amplified genes. Moreover, considering that the differences observed in these plas­mid genes seem to be related to the species harboring the pediocin plasmid, a simple SSCP or restriction analysis on pedBf or pedDf amplified fragment could be useful for the discrimination among pediocin AcH/PA-l pro­ducer strain in a preliminary screening procedure. In this context rapid and accurate multiplex PCR reactions use­ful for the detection and the simultaneously identifica­tion of P. acidilactici pediocin AcH/PA-l producer strains were also developed.

Acknowledgment This research was supported by a grant of the Ministry of

the University and Technological and Scientific Research (MURST 60%). We thank Dr. DANIELE DAFFONCHIO for his pre­cious and useful suggestions as regards the SSCP analysis.

References

AXELSSON, L., HOLK, A., BIRKELAND, S. E., AUKRUST, T., BLOM, H.: Cloning and nucleotide sequencing of a gene from Lacto­bacillus sake LB706 necessary for sakacin A production and immunity. Appl. environ. Microbiol. 59,2868-2875 (1993).

BENNIK, M. H. J., SMID, E. J., GORRIS, L. G. M.: Vegetable-asso­ciated Pediococcus parvulus produces Pediocin PA-1. Appl. Environ. Microbiol. 63, 2074-2076 (1997).

BHUNIA, A. K., JOHNSON, M. c., RAY, B.: Purification, character­ization and antimicrobial spectrum of a bacteriocin produced by Pediococcus acidilactici. J. Appl. Bacteriol. 65, 261-268 (1988).

BHUNA, A. K., JOHNSON, M. c., RAY, B., KALCHAYAN, N.: Mode of action of pediocin AcH from Pediococcus acidilactici H on sensitive bacterial strains. J. App!. Bacterio!' 70, 25-33 (1991).

BHUNIA, A. K., JOHNSTON, M. G.: Monoclonal antibody-colona immunoblot method specific for isolation of Pediococcus acidilactici from foods and correlation with pediocin (bac­teriocin) production. Appl. Environ. Microbiol. 58, 2315-2320 (1992).

BHUNIA, A. K., BHOWMIK, T. K., JOHNSON, M. G.: Determina­tion of bacteriocin-encoding plasmids of Pediococcus acidi­lactici strains by Southern hybridization. Lett. App!. Micro­bio!' 18, 168-170 (1994).

ENNAHAR, S., AOUDE-WERNER, D., SOROKINE, 0., VAN DORSE­LAER, A., BRINGEL, E, HUBERT, J.-c., HASSELMANN, c.: Pro­duction of pediocin AcH by Lactobacillus plantarum WHE 92 isolated from cheese. App!. Environ. Microbio!. 62, 4381-4387 (1996).

GOFF, J. H., BHUNIA, A. K., JOHNSON, M. G.: Complete inhibi­tion of low levels of Listeria monocytogenes on refrigerates chicken meat with pediocin AcH bound to heat-killed pedio­coccus acidilactici cells. J. Food Protect. 59, 1187-1192 (1996).

GROMPE, M.: The rapid detection of unknown mutations in nu­cleic acids. Nature gen. 5, 111-'-117 (1993).

KLAENHAMMER, T. R.: Genetics of bacteriocins produced by lac­tic acid bacteria, FEMS Microbio!. Rev. 12,39-86 (1993).

JOOSTEN, H. L. M. J., RODRIGUEZ, E., NUNEZ, M.: PCR detec­tion of sequences similar to the AS-48 structural gene in bac-

teriocin-producing enterococci. Lett. Appl. Microbiol. 24, 40-42 (1997).

MARUGG, J. D., GONZALEZ, C. E, KUNKA, B. S., LEBEBOER, A. M., PUCCI, M. J., TOONEN, M. Y., WALKER, S. A., ZIET­MUDLER, L. C. M., VANDERBERGH, P. A.: Cloning, expression, and nucleotide sequence of genes involved in the production of pediocin PA-I, a bacteriocin from Pediococcus acidilactici PAC 1.0. Appl. Environ. Microbio!. 58, 2360-2367 (1992).

MOTLAGH, A., BUKHTIYAROVA, M., RAY, B.: Complete nucleotide sequence of pSMB 74, a plasmid encoding the production of pediocin AcH in Pediococcus acidilactici,. Lett. App!. Micro­bioI. 18,305-312 (1994).

MORA, D., FORTINA, M. G., PARINI, c., MANACHINI, P. L.: Iden­tification of Pediococcus acidilactici and Pediococcus pen­tosaceus based on 16S rRNA and IdhD gene-targeted multi­plex PCR analysis. FEMS Microbiol. Lett. 151, 231-236 (1997).

NES, I. E, DIEP, D. B., HARVESTEIN, L. S., BRURBERG, M. B., Eu­SINK, v., HOLO, H.: Biosyntesis of bacteriocins in lactic acid bacteria. Ant. Leeuwenhoek 70, 113-128 (1996).

OKEREKE, A., MONTVILLE, T. J.: Bacteriocin inhibition of Clostridium botulinum spores by lactic acid bacteria. J. Food Protect. 54, 349-353 (1991).

PEARSON, W. R., LIPMAN, D. J.: Improved Tools for Biological Sequence Analysis. Proc. Nat!' Acad. Sci. 85, 2444-2448 (1988).

PEARSON, W. R.: Rapid and Sensitive Sequence comparison with FASTP and FASTA. Meth. Enzym. 183, 63-98 (1990).

REMIGER, A., EHRMANN, M. A., VOGEL, R. E: Identification of bacteriocin-encoding genes in lactobacilli by polymerase chain reaction (PCR). System. Appl. Microbiol. 19, 28-34 (1996).

RODRiGEZ, J. M., CiNTAS, L. M., CASAUS, P., MARTiNEZ, M. I., SUARZ, A., HERNANDEZ, P. E.: PCR detection of the lactocin S structural gene in bacteriocin-producing lactobacilli from meat. Appl. Environ. Microbiol. 61,2802-2805 (1995).

RODRiGUEZ, J. M., CiNTAS, L. M., CASAUS, P., MARTiNEZ, M. I., SUAREZ, A., HERNANDEZ, P. E.: Detection of pediocin PA-1-producing pediococci by rapid molecular biology techniques. Food Microbiol. 14,363-371 (1997).

SAMBROOK, J., FRITSCH, E. E, MANIATIS, T.: Molecular cloning: a laboratory manua!' Cold Spring Harbor Laboratory, New York 1989.

STILES, M. E., HASTINGS, J. W.: Bacteriocin production by lactic acid bacteria: potential for use in meat preservation. Trends Food Sc. Tech. October, 247-251 (1991).

STILES, M. E.: Biopreservation by lactic acid bacteria. Ant. Leeuwenhoek 70, 331-345 (1996).

TICHACZEK, P. S., VOGEL, R. E, HAMMES, W. P.: Cloning and se­quencing of curA encoding curvacin A, the bacteriocin pro­duced by Lactobacillus curvatus LTH1174. Arch. Microbiol. 160,279-283 (1993).

VENEMA, K., KOK, J., MARUGG, J. D., TOONEN, M. Y., LEDE­BOER, A. M., VENEMA, G., CHIKINDAS, M. L.: Functional analysis of the pediocin operon of Pediococcus acidilactici PAC 1.0: PedB is the immunity protein and PedD is the pre­cursor processmg enzyme. Mol. Microbiol. 17, 515-522 (1995).

Corresponding author: Dr. DIEGO MORA, DI.S.T.A.M. - Sezione Microbiologia Industriale, Via Celoria, 2, 20133, Milano, Italy. Tel.: 00 39 2 2 39 5581; Fax: 00 39 2 70 63 08 29; E-mail: diegom@net4u.it