DEFINING THE MOLECULAR BASIS OF HOST RANGE IN PAPAYA RINGSPOT VIRUS (PRSV)

AUSTRALIA

The thesis submitted to the Queensland University of Technology for the

Degree of Doctor of Philosophy

By

Nishantha Jayathilake

Cluster for Molecular Biotechnology

Science Research Centre,

School of Life Sciences

Queensland University of Technology

iii

ABSTRACT

The potyvirus Papaya ringspot virus (PRSV) is widespread throughout the

world in cucurbits (such as zucchini, watermelon, pumpkin etc) and papaya

(papaw). There are two serologically indistinguishable strains of PRSV, which

can only be differentiated on the basis of host range. PRSV-P is able to infect

both papaya and cucurbits whereas PRSV-W only infects cucurbits. Both

infections drastically reduce the yield and market quality of the fruit.

Australian isolates of PRSV-P and –W are very closely related and there is

evidence that PRSV-P arose by mutation from PRSV-W. The aim of this

project was to investigate the molecular basis of the host range difference

between Australian isolates of PRSV-P and –W.

The close relationship between Australian PRSV-P and -W isolates at the

molecular level made this an ideal system to investigate molecular host

range determinants through the development of full-length infectious cDNA

clones. Initially, the complete genomes of PRSV-P and -W were each

incorporated into two overlapping clones; one included the CaMV 35S

promoter fused to the 5’ one third of the PRSV genome and the second

included the 3’ two thirds of the genome (including a 33 nucleotide poly(A)

tail) fused to a CaMV35S terminator. Full-length clones could not be obtained

from subcloning of these fragments due to apparent toxicity in E.coli. Several

approaches were subsequently undertaken to overcome this problem. In an

attempt to prevent transcription of potentially toxic sequences, a plant intron

(St-Ls1 IV2 intron) was engineered into the first coding region (P1) of the

PRSV-W genome. Although clones were obtained using this strategy these

could not be effectively maintained in E.coli. An alternative strategy involved

subcloning of the genome into a low copy number vector, pACYC177, to

minimise expression of toxic sequences. Again this resulted in clones that

produced very small colonies, which were hard to culture and which gave

very low plasmid yields. These plasmids were also difficult to maintain in E.

coli.

iv

A final, successful strategy was developed using overlapping long distance

PCR (OE-LD PCR) to generate full-length infectious PCR products of both

PRSV-P (rPRSV-P) and -W (rPRSV-W) incorporating a CaMV 35S promoter

and terminator. Infectious PCR products of both strains were inoculated onto

squash cotyledons in vitro by microprojectile bombardment and subsequently

mechanically inoculated to squash with greater than 86% efficiency.

RPRSV-P subsequently infected papaya with 96% efficiency while, as

expected, rPRSV-W was unable to infect papaya.

Once a system for generating infectious clones was developed, both

sequence analysis and recombination of infectious clones was utilised to

investigate the underlying host range mechanism. The complete genomes of

PRSV-P and -W were sequenced and compared to each other and to five

full- length sequences of overseas PRSV isolates that were available.

Sequence analysis confirmed the close relationship between the Australian

PRSV isolates (97.8% nucleotide and 98.4% amino acid identity over the

whole genome), supporting the mutation theory between both Australian and

Asian P and W pairs. However, there was no consistent amino acid

difference over the whole genome that correlated with host range or a single

site that could be implicated, suggesting that the mutation and possibly the

position of the mutation is different at least between Asian and Australian

isolates and potentially differs at each mutation event.

To better localise the P/W mutation within the PRSV genome, five different

recombinant hybrid PRSVs (rhPRSV1-5) were generated in which 5’, middle

or 3’ regions of the PRSV-P and -W genomes were exchanged. Infectivity of

all hybrids was confirmed in squash, however, only hybrids including the 3’

third of the PRSV-P genome were able to infect papaya, suggesting that this

region encodes the papaya host range determinant. The region implicated

encodes the genome-linked protein (VPg), NIa protease, replicase (NIb), coat

protein (CP) and 3’ UTR. While further identification of the host range

determinants was not possible due to time constraints, based on studies with

other potyviruses, there is a strong basis for implication of the VPg.

Sequence analysis identified only 2 amino acid differences between the VPg

v

of Australian PRSV-P and -W isolates in regions previously implicated in

pathogenicity. These will be targeted for mutagenesis in ongoing studies.

Identification of the genes/sequences involved in the determination of host

range in PRSV will provide valuable information as to the sequence of events

that lead to infection and will lead to a better understanding of the

significance of changing hosts in the molecular evolution of PRSV, an

essential requirement for the development of long-term sustainable control

strategies against PRSV.

vi

TABLE OF CONTENTS

TITLE PAGE i ABSTRACT iii TABLE OF CONTENTS vi LIST OF FIGURES xii LIST OF TABLES xvi LIST OF ABBREVIATIONS xviii DECLARATION xxi ACKNOWLEDGEMENTS xxii CHAPTER 1 INTRODUCTION 1

1.1 POTYVIRUSES 1

1.1.1 Description 1

1.1.2 Genome structure and gene function 3

1.1.2.1 P1 protein 4

1.1.2.2 HC-Pro protein 5

1.1.2.3 P3 protein & 6K1 8

1.1.2.4 CI protein 9

1.1.2.5 6K2 peptide 10

1.1.2.6 NIa protein 10

1.1.2.7 NIb protein 12

1.1.2.8 Coat protein 13

1.1.2.9 Untranslated regions 14

vii

1.2 PAPAYA RINGSPOT VIRUS (PRSV) 15

1.2.1 Description 15

1.2.2 Genome organisation: comparision with other

potyviruses 20

1.2.3 PRSV in Australia 23

1.3 POTYVIRAL HOST RANGE DITERMINANTS 24

1.3.1 CP and HC-Pro 25

1.3.2 VPg 26

1.3.3 P3, 6K1 and CI 28

1.4 AIMS AND OBJECTIVES 30

CHAPTER 2 GENERAL METHODS AND MATERIALS 31

2.1 GENERAL REAGENTS 31

2.1.1 Sources of special reagents 31

2.1.2 General solutions and media 31

2.2 GENERAL METHODS FOR VIRUS PURIFICATION AND

DETECTION 32

2.2.1 Source and maintenance of virus isolates 32

2.2.2 Enzyme-linked immunosorbent assay (ELISA) 32

2.2.3 Electron microscopy 33

2.3 GENERAL METHODS FOR NUCLEIC ACID EXTRACTION

AND AMPLIFICATION 33

2.3.1 Preparation of crude RNA extract 33

2.3.2 cDNA synthesis 34

2.3.3 Polymerase chain reaction (PCR) 34

2.3.3.1 Standard PCR 34

3.2.3.2 Long-distance PCR ( LD-PCR) 35

viii

2.3.3.3 Overlapping extension long distance

PCR (OE-LD-PCR) 35

2.4 GENERAL METHODS FOR NUCLEIC ACID ANALYSIS 36

2.4.1 Small-scale preparation of plasmid DNA using

alkaline lysis 36

2.4.2 Large-scale plasmid preparation 36

2.4.2 Spectrophotometric determination of nucleic

acid concentration 36

2.4.4 Restriction enzyme analysis 37

2.4.5 Agarose gel electrophoresis 37

2.4.6 DNA sequencing 37

2.4.7 Gel purification of DNA 37

2.5 GENERAL METHODS FOR CLONING 38

2.5.1 Ligation of PCR products into T-tailed vectors 38

2.5.2 Ligation of blunt/sticky end fragments into vectors 38

2.5.3 Transformation of E.coli 38

CHAPTER 3 GENERATION OF INFECTIOUS CLONES OF PRSV-W AND PRSV-P 39

3.1 INTRODUCTION 39

3.2 METHODS AND MATERIALS 41

3.2.1 Oligonucleotide primers 41

3.2.2 Amplification of 5’ and 3’ Megaprimers 42

3.2.3 Cloning of full-length PRSV-P and -W genomes

in 3 overlapping clones 42

3.2.3.1 Preparation of PRSV RNA 42

3.2.3.2 First-strand cDNA synthesis 44

ix

3.2.3.3 PCR Amplification of the PRSV genomes

in three overlapping fragments 44

3.2.3.4 Cloning of PRSV-W and PRSV-P

overlapping fragments 44

3.2.5 Generation of a full-length PRSV-W clone 47

3.2.5.1 insertion of MluI site in p5’Triplet-W 47

3.2.5.2 Generation of pTwin-W 47

3.2.5.2 Subcloning to generate a full-length clone 47

3.2.6 Generation of an intron-containing infectious clone

of PRSV-W 50

3.2.6.1 Insertion of an intron into the P1-coding

region of p5’Triplet-W 50

3.2.6.2 Construction of an intron containing full-length

PRSV-W 53

3.2.7 Generation of a full-length PRSV-W in a low copy

number vector 53

3.2.8 Generation of full-length infectious PCR product

of PRSV- W and PRSV-P 57

3.2.9 Infectivity of full-length PRSV-P and PRSV- W PCR

Products 59 3.2.9.1 Preparation of PCR products for

bombardment 59

3.2.9.2 Bombardment of squash cotyledons with

full-length PCR products 59

3.2.9.3 Detection of PRSV infection and mechanical

inoculation of squash seedlings 60

3.2.9.4 Detection of PRSV infection in inoculated

squash and papaya plants 60

3.3 RESULTS 61

3.3.1 Cloning of PRSV-P and PRSV-W genomes in three

overlapping clones 61

3.3.2 Generation of a full-length PRSV-W infectious clone 63

x

3.3.3 Generation of an infectious PRSV-W clone

containing a plant intron 68

3.3.4 Construction of full-length PRSV-W in a low copy

number vector 72

3.3.5 Generation of full-length infectious PCR products of

PRSV by OE-LD-PCR 77

3.3.6 Infectivity of full-length PCR products of PRSV-P

and PRSV-W 77

3.4 DISCUSSION 85

CHAPTER 4 SEQUENCE ANALYSIS OF THE COMPLETE GENOMES

OF AUSTRALIAN ISOLATES OF PRSV 94

4.1 INTRODUCTION 94

4.2 METHODS AND MATERIALS 95

4.2.1 Oligonucleotide primers 95

4.2.2 Source of PRSV clones 95

4.2.3 Sequencing of PRSV-P and PRSV-W genomes 98

4.3 RESULTS 103

4.3.1 Australian PRSV- P and -W genomes 103

4.3.2 Comparison of Australian isolates to other

full-length PRSV sequences 110

4.3.4 Search for putative host range determinants 113

4.4 DISCUSSION 114

xi

CHAPTER 5 LOCALISATION OF PRSV-P AND PRSV-W HOST RANGE DETERMINANTS BY GENERATION OF RECOMBINANT HYBRID PRSV TRANSCRIPTS 118

5.1 INTRODUCTION 118

5.2 METHODS AND MATERIALS 119

5.2.1 Generation of recombinant PCR products of

PRSV-P and PRSV-W 119

5.2.2.1 Construction of pTwin-W+P and

pTwin-P+W clones 119

5.2.2.2 Amplification of recombinant full-length

PCR products by OE-LD-PCR 121

5.2.3 Infectivity of recombinant PCR products 121

5.3 RESULTS 123

5.3.1 Generation of recombinant PRSV PCR products 123

5.3.2 Infectivity of hybrid PCR products in squash 124

5.3.3 Infectivity of recombinant hybrid PRSVs in papaya 132

5.3.4 Confirmation of the integrity of rhPRSVs in vivo 135

5.4 DISCUSSION 137

CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS 143 REFERENCES 150

APPENDIX I 183

LIST OF FIGURES

Figure 1.1 General genome organisation of potyviruses. 4

Figure 1.2 PRSV-P symptoms in mature papaya tree. 17 Figure 1.3 PRSV-P symptoms on papaya fruit. 18

Figure 1.4 PRSV-W symptoms in cucurbits. 19

Figure 1.5 Average % of identity of PRSV proteins with homologous

proteins of six additional potyviruses. 22

Figure 3.1 Strategy for the amplification of megaprimers. 43

Figure 3.2 Strategy for amplification and cloning of the full

PRSV-W genome as three overlapping fragments. 46

Figure 3.3 Strategy for generation of pTwin-W from plasmids

p3’Triplet-W and pMiddle Triplet-W. 48

Figure 3.4 Strategy for generation of full-length clone of PRSV-W

from plasmids p5’Triplet-W* and pTwin-W. 49

Figure 3.5 Strategy for insertion of an intron into the P1-coding

region and construction of p5’Int.Triplet-W. 51, 52

Figure 3.6 Strategy for the generation of a full-length, intron

containing PRSV-W clone from plasmids

p5’Int.Triplet-W and pTwin-W. 54

Figure 3.7 Strategy for generation of full-length low copy

number PRSV-W clone. 55, 56

xiii

Figure 3.8 Strategy for generation of full-length PCR product of

PRSV-W by OE-LD-PCR. 58

Figure 3.9 Three overlapping PCR products representing

full-length PRSV-W. 62

Figure 3.10 Restriction analysis of clones p5’Triplet-W,

pMiddle Triplet-W and p3’Triplet-W. 64, 65

Figure 3.11 Restriction analysis of pTwin-W. 66

Figure 3.12 Restriction analysis of putative full-length PRSV-W clone. 67

Figure3.13 PCR products generated and used for construction

of p5’Int.Triplet-W. 69, 70

Figure 3.14 Purified intron-containing full-length PRSV-W plasmid. 71

Figure 3.15 Restriction analysis with MluI/ BamHI of plasmids

resulting from ligation of the insert of p5’Triplet-W into

low copy number vector pACYC 177. 73

Figure 3.16 Restriction digestion of clones pTwin-W and p5’LC.Triplet-W

during generation of low copy number full-length PRSV-W

plasmid, pFull.LC-W. 74

Figure 3.17 Purified low copy number full-length PRSV-W

plasmid (pFull.LC-W). 75

Figure 3.18 PCR analysis of full-length low copy number PRSV-W

plasmid (pFull.LC-W) showing the presence of P1 and

NIa fragments. 76

Figure 3.19 OE-LD-PCR product of full length PRSV-W. 78

xiv

Figure 3.20 Symptoms of rPRSV-W and -P infection in squash

and papaya. 82

Figure 3.21 Electron micrographs of typical PRSV virons identified in

negative stained leaf dips following inoculation with

rPRSV-W and rPRSV-P. 83

Figure 3.22 RT-PCR analysis of plants inoculated with rPRSV-W to

detect P1, NIa and CP-coding regions. 84

Figure 4.1 Representative of the five overlapping clones used to

generate full-length PRSV genome sequences. 99

Figure 4.2 Location of primers used in cDNA synthesis, PCR

amplification and sequencing of p5’Triplet of

PRSV-P and –W. 100

Figure 4.3 Location of primers used in cDNA synthesis,

PCR amplification and sequencing of the

pMiddle Triplet-P and –W. 101

Figure 4.4 Location of primers used in cDNA synthesis, PCR

amplification and sequencing of the p3’Triplet-P and –W. 102

Figure 4.5 Amino acid sequence alignment of the complete

polyprotein of Australian isolates of PRSV-W

and -P with five overseas isolates. 105-109

Figure 4.6 Nucleotide and amino acid sequence divergence

of full-length PRSV genomes presented as

phylogenetic trees. 111

xv

Figure 5.1 Strategy for generation of pTwin-W+P from p3’Triplet-P

and pMiddle Triplet-W. 120

Figure 5.2 Recombinant hybrid PCR products of PRSV. 122

Figure 5.3 Restriction analysis of pTwin-P+W. 125

Figure 5.4 Agarose gel showing 11027bp PCR product representing

full-length recombinant hybrid PRSV amplified

by OE-LD- PCR. 126

Figure 5.5 RT-PCR amplification of the P1 and CP-coding regions

from rhPRSVs in squash plants that were positive for

PRSV by ELISA. 133

Figure 5.6 RT-PCR analysis of P1 and CP-coding regions of

rhPRSVs in inoculated papaya plants. 136

Figure 6.1. Diagramatic representation of VPg of PRSV-P & W

Showing amino acid differences between pairs of geographic

isolates. 148

xvi

LIST OF TABLES

Table 1.1 Comparision of the genome size of potyviruses. 21

Table 3.1 Summary of infectivity assays (ELISA and symptoms)

on plants inoculated with full-length PRSV-W PCR product. 80

Table 3.2 Summary of infectivity assays (ELISA and symptoms) on

plants inoculated with full-length PRSV-W PCR product. 81

Table 4.1 Sequence of oligonucleotides used in cloning and

sequencing of PRSV-P and -W genomes. 96,97

Table 4.2 Percent divergence between whole genomes of

PRSV isolates. 104

Table 4.3 Percent divergence between coding regions and corresponding

proteins of PRSV isolates compared to AUS-W. 112

Table 5.1 Summary of clones use to make recombinant infectious

PCR products of PRSV. 121

Table 5.2 Assessment of infectivity (ELISA and symptoms) of

recombinant hybrid PRSV PCR product,

rhPRSV1 (WWP), in squash. 127

Table 5.3 Assessment of infectivity (ELISA and symptoms) of

recombinant hybrid PRSV PCR product,

rhPRSV2 (PWW), in squash. 128

Table 5.4 Assessment of infectivity (ELISA and symptoms) of

recombinant hybrid PRSV PCR product,

rhPRSV3 (PPW), in squash. 129

xvii

Table 5.5 Assessment of infectivity (ELISA and symptoms)

of recombinant hybrid PRSV PCR product,

rhPRSV4 (WPP), in squash. 130

Table 5.6 Assessment of infectivity (ELISA and symptoms)

of recombinant hybrid PRSV PCR product,

rhPRSV5 (PWP), in squash. 131

Table 5.7 Assessment of infectivity of rhPRSVs in papaya plants

mechanically inoculated with rhPRSV infected squash. 134

xviii

LIST OF ABBREVIATIONS

A absorbance

bp base pair(s)

BSA bovine serum albumin 0C degrees Celsius

CaMV 35S cauliflower mosaic virus 35S promoter

cDNA complementary deoxyribonucleic acid

CI cylindrical inclusion protein

CP coat protein

dATP deoxyadenosine triphosphate

DEPC diethylpyrocarbonate

dCTP deoxycytidine triphosphate

dGTP deoxyguanosine triphosphate

dTTP deoxythymidine triphosphate

DMSO dimethylsulphoxide

DNA deoxyribonucleic acid

dpi days post inoculation

DsRNA double-stranded ribonucleic acid

DTT dithiothreitol

E.coli Escherichia coli

EDTA ethylenediaminetetra-acetic acid

ELISA enzyme linked immunosorbent assay

g gram(s)

GFP green fluorescent protein

xg gravity

GUS β- glucuronidase

HC-Pro helper component protease

hr hours

IPTG isopropyl-β-D-thiogalactopyranoside

kb kilobase(s)

kDa kilodalton(s)

LD-PCR long-distance polymerase chain reaction

xix

mg milligram(s)

min minutes(s)

mL millilitre(s)

mmol millimole(s)

mM millimolar

MP movement protein

MW molecular weight

NIa nuclear inclusion protein a

NIb nuclear inclusion protein b

ng nanogram(s)

nm nanometres(s)

nt nucleotide(s)

OE-PCR overlapping-extension polymerase chain reaction

OE-LD-PCR overlapping-extension long distance PCR

ORF open reading frame

P1 first protein encoded by potyvirus genome

P3 third protein encoded by potyvirus genome

PBS phosphate buffered saline

PBST phosphate buffered saline with Tween-20

PCR polymerase chain reaction

pmol picomole(s)

RNA ribonucleic acid

RT reverse transcriptase

RT-PCR reverse transcription polymerase chain reaction

S seconds(s)

SDS sodium dodecyl sulphate

SEL size exclusion limit

TAE tris-acetate, EDTA

Taq Thermus aquaticus

TE tris-EDTA

Tris tris (hydroxylmethyl) aminome

UTR untranslated region

UV ultraviolet

V volts

xx

VPg genome linked protein

X-gal 5-brom-4-chloro-3-indolyl-β -D-galactopyranoside

μg microgram(s)

μL microlitre(s)

μM micromolar

xxi

STATEMENT OF AUTHORSHIP

“The work contained in this thesis has not been previously submitted for a

degree or diploma at any other higher education institution. To the best of my

knowledge and belief, the thesis contains no material previously published or

written by another person except where due reference is made”.

Signed: Nishantha Jayathilake Date:

xxii

AKNOWLEDGEMENTS I would like to acknowledge all those who assisted me in one way or another in

the completion of this work.

Most importantly, I would like to express my gratitude to my mother my best

friend and most trusted confidant who has always there for me and inspired me

to learn and to continue learning.

I express my heartfelt gratitude for the advice guidance and suggestions given

by my supervisor, Dr Marion Bateson, during preparation of this thesis. Also, I

gratefully appreciate the molecular biology training received from her during the

past five years.

I would especially like to thank Prof. James Dale, for his guidance and

friendship through this project and for providing me with some great

opportunities along the way.

My profound thanks are also extended to the people in the Plant Biotechnology

group of the Centre for Molecular Biotechnology who have contributed both

knowledge and friendship.

I would also like to thank the many other people in the Centre for Molecular

Biotechnology and School of Life Sciences who have helped in numerous ways

over the years and without whose help this thesis would not have been

completed.

This work would not be possible without personal support from others. My

deepest thanks go to my wonderful wife Hemanthi and my family for their

patience, encouragement, continuous moral support and prayers, expressing

their love and care for me.

1

CHAPTER 1 INTRODUCTION Although there is considerable knowledge of the molecular host range

determinants of a number of plant virus groups, the host range determinants

of potyviruses, the largest family of plant viruses, are only now being

elucidated. Papaya ringspot virus (PRSV) is a species of the potyvirus genus

and is widespread throughout the world. There are two serologically

indistinguishable strains of PRSV, which can only be differentiated on the

basis of their host range. PRSV type P (PRSV-P) is able to infect both

papaya and cucurbits, whereas PRSV type W (PRSV-W) only infects

cucurbits. Both infections drastically reduce the yield and market quality of

the fruit. PRSV-P and –W are very closely related strains and it is thought

that, at least in Australia, PRSV-P arose by mutation from PRSV-W (Bateson

et al., 1994). However, the molecular basis for this mutation has not yet been

defined. Identification of the molecular host range determinants of PRSV will

contribute to a general understanding of potyvirus host range and will help

define the significance of this ability to change host in the molecular evolution

of PRSV.

1.1 POTYVIRUSES

1.1.1 Description The Potyviridae is the largest and economically most important plant virus

family with over 200 species described (Hall et al., 1998). It constitutes

about 25% of known plant viruses and causes diseases in almost all

commercial crops. A large number of potyviruses are important plant

pathogens and cause substantial losses in crop plants of economic

importance such as cereal, millet, fruit, vegetable, sugarcane, oilseed,

ornamentals, fodder and pasture in different parts of the world.

The Potyviridae are divided into six recognised genera, namely Potyvirus,

Bymovirus, Macluravirus, Tritimovirus, Rymovirus and Ipomovirus (van

Regenmortel et al., 2000). Members of the potyvirus genus are transmitted

2

by aphids in a nonpersistent manner and some are also seed transmitted.

Macluraviruses have aphid vectors and are transmitted in a nonpersistent,

noncirculative manner. Rymoviruses and Tritimoviruses are transmitted by

mites, Bymoviruses by fungi and Ipomoviruses are whitefly-borne. Unless

otherwise indicated, in this review, potyviruses will refer to species of the

potyvirus genus, which includes PRSV.

Potyviruses have flexuous, filamentous virions 680-900 nm long and 11-15

nm wide (Shukla and Ward, 1989). Each virion is made up of about 2000

units of a single structural protein surrounding one molecule of positive

sense ssRNA of approximately 10,000 nucleotides (Purcifull et al., 1984).

More than 200 aphid species are known to be vectors of potyviruses

(Edwardson and Christie, 1991). Two virus encoded proteins, the helper

component proteinase (HC-Pro) and the coat protein (CP) are needed for

aphid transmission of potyviruses (Pirone, 1981; 1991; Pirone and Blanc,

1996). It has been found that the N-terminal region of the CP contains a

conserved amino acid motif, Asp-Ala-Gly (DAG), essential for successful

transmission of the virus by the aphids (Lopez-Moya et al., 1999).

Potyviruses infect a wide range of plants, however individual viruses usually

have narrow host ranges within one to three families or genera (Hollings and

Brunt, 1981; Shukla et al., 1994), although some plants are susceptible to a

wide range of potyviruses. For example, a number of potyviruses are able to

induce local lesion infection in legumes, Chenopodium spp and Nicotiana

benthamiana (Shukla et al., 1994). The initial infection process in

potyviruses is poorly understood. Infection can only occur through seed

transmission (only some viruses), physical damage of a plant by insect

vectors or mechanical inoculation (Shukla et al., 1994).

Most potyviruses induce visible symptoms on the leaves, stems, flowers,

fruit and seeds while some do not induce any symptoms. Symptoms induced

by potyvirus infections are generally similar (Hollings and Brunt, 1981;

Shukla et al., 1994). Longitudinal chlorotic or necrotic streaks or both are

frequently induced in monocotyledonous plants. Vein clearing, mosaic

3

mottling, necrosis and distortion of leaves are common symptoms on

dicotyledonous plants. Stunting and reduction of crop yield are also

common. However, the presence and severity of symptoms are variable and

dependent on the particular virus and the strain or isolate (Shukla et al.,

1994).

1.1.2 Genome structure and gene function

Knowledge of the molecular biology of viruses and the functions of the

various proteins encoded by their genomes is essential for the development

of new strategies to control plant viruses. New technologies such as the two-

hybrid systems (Hong et al., 1995; Urcuqui-Inchima et al., 1999; Daròs et al.,

1999; Wang et al., 2000) and the incorporation of reporter genes, such as

green fluorescent protein (GFP) or ß-glucuronidase (GUS) into viral

genomes (Dolja et al., 1992; Schaad and Carrington, 1996; Oparka et al.,

1996; Verver et al., 1998; German-Retana et al., 2000) or fused to proteins

(Li and Carrington, 1993; Rao, 1997) has greatly facilitated the study of

viruses in recent years.

Potyviruses belong to the picorna-like supergroup of viruses whose RNAs

have a protein (VPg) covalently bound to the 5’-end of the genome, a

poly(A) tail at the 3’-end and whose genomes are expressed as a large

polyprotein which is subsequently cleaved co- and/or post-translationally by

proteases to yield functional proteins (Dougherty and Carrington, 1988).

These include a conserved set of genes encoding nonstructural proteins that

are involved in RNA replication. The order of the proteins within the

polyprotein is: first protein (P1), helper component (HC-Pro), third protein

(P3), cylindrical inclusion protein (CI), small nuclear inclusion protein (NIa),

which includes an N-terminal VPg and C-terminal protease domain, large

nuclear inclusion protein (NIb) and coat protein (CP). Small, 6KDa, proteins

are located between the CI and NIa and between the P3 and CI in some

potyviruses (Fig.1.1). Both the VPg and the CP are found in virions, whereas

4

Figure 1.1. General genome organisation of potyviruses

the P1, HC-Pro, P3, CI, NIa and NIb proteins are detected in infected plants

(Dougherty and Carrington, 1988; Rodriguez-Cerezo and Shaw, 1991).

Most of these proteins have been shown to be multifunctional while all the

proteins are involved in genome amplification (reviewed in Urcuqui-Inchima

et al., 2001).

1.1.2.1 P1 protein The P1 protein is one of three proteinases encoded by the potyvirus genome

and autocatalytically cleaves itself from the polyprotein. Conserved amino

acids corresponding to the proteinase catalytic domain have been identified

in the C terminus of all potyvirus P1 proteins (Verchot et al., 1991; Urcuqui-

Inchima et al., 2001). The catalytic triad His, Asp, Ser, typical of the serine-

type proteinases, was identified in the C terminus of the Tobacco etch virus

(TEV) P1 protein (Verchot et al., 1992). Among the different potyviruses,

these amino acids are well conserved with Phe replacing Asp in Potato virus

Y-O (PVY-O) (Yang et al., 1998a). Self-cleavage at the boundary between

P1 and HC-Pro is essential for viability. Tobacco vein mottling virus (TVMV)

C-terminal P1 mutants, where P1 proteinase activity was inactivated, were

not viable, while mutations in the N terminus of the P1 had no affect on virus

viability (Klein et al., 1994). Similar results were found for TEV (Verchot and

Carrington, 1995a). Evidence also suggested that separation of the P1 and

HC-Pro rather than proteinase activity itself is essential for viral infectivity

(Verchot and Carrington, 1995b). Similar results were also found for the

Tritimovirus, Wheat streak mosaic virus (WSMV) (Choi et al., 2002). Non-

poly (A) P1 HC-Pro P3 CI NIa NIb CP

6K1 6K2 VPg

5

specific RNA binding activity in the P1-coding region has been reported for

several potyviruses including TVMV (Brantley and Hunt, 1993), Turnip

mosaic virus (TuMV) (Soumounou and Laliberte, 1994) and Potato virus A

(PVA) (Merits et al., 1998).

Arbatova et al. (1998) reported localisation of PVY P1 protein with

cytoplasmic inclusion bodies and suggested it could be involved in virus cell-

to-cell movement. However, several studies indicate that P1 was not

localised near the plasmodesmata and all P1 mutants were able to move

systemically in infected plants (Urcuqui-Inchima et al., 2001).

The P1 is the least conserved protein among potyviruses (Urcuqui-Inchima

et al., 2001). Sequence identity between Yam mosaic virus (YMV) isolates

was only 65% in the P1 protein compared to about 80% in the HC-Pro, P3

and NIb proteins (Aleman-Verdaguer et al., 1997). High variability in the P1

has also been reported for other potyvirus isolates including PVY (72.8%-

100% amino acid sequence identity between 12 isolates) (Tordo et al.,

1995) and Zucchini yellow mosaic virus (ZYMV) (53.3%-57% amino acid

sequence identity) (Wisler et al., 1995).

1.1.2.2 HC-Pro protein

The potyviral helper component-proteinase (HC-Pro) is a multifunctional

protein involved in aphid transmission, long distance movement, polyprotein

processing, genome amplification, symptom expression and suppression of

posttranscriptional gene silencing.

Early studies demonstrated the involvement of the potyviral HC-Pro in aphid

transmission (Atreya and Pirone, 1993). Evidence suggests that the HC-Pro

must be in a biologically active form to enable transmission of virions (Govier

and Kassanis, 1974; Govier et al., 1977). Based on purification experiments,

Thornbury et al. (1985) suggested that biologically active TVMV HC-Pro is

probably present as a dimer in infected plants. Specific interaction between

CP and HC-Pro (Pirone, 1981), as well as interaction between the HC-Pro

6

and the aphid stylet (Peng et al., 1998), is required for aphid transmission of

potyviruses. Using a protein blotting-overlay assay, Blanc et al. (1997)

demonstrated that only the HC-Pro from an aphid transmissible strain of

TVMV interacted with CP while the HC-Pro from a non-aphid transmissible

strain did not. Also, TVMV mutants in the highly conserved DAG motif

located in the N terminus of the CP were poorly aphid transmissible and

showed decreased interaction with HC-Pro. Studies on the capacity of a

given HC-Pro to retain a given virion in the insect stylets demonstrated that

different aphid species transmit potyviruses to different extents (Wang et al.,

1998).

Significant research has been undertaken to determine the domains that

control aphid transmission. The aphid transmission helper function appears

to require residues within the N-terminal and central region of HC-Pro

(Thornbury et al., 1990; Atreya et al., 1992; Atreya and Pirone, 1993). The

highly conserved ‘KITC' tetra peptide (Lys-Ile/Leu-Thr/Ser-Cys) is found

within a Cys-rich motif in the N-terminal region of the potyvirus HC-Pro

(Thornbury et al., 1990) and is thought to be involved in interaction with the

aphid mouthparts (Blanc et al., 1998). A Lys to Glu change in the KITC

motif of Potato virus C (PVC) HC-Pro, which is a naturally occurring non-

aphid transmissible variant of PVY, had no effect on the ability of the HC-Pro

to bind virions or CP (Blanc et al., 1998). However, only PVY HC-Pro was

present in the food canal of aphids suggesting that the Lys to Glu mutation

of PVC affected HC-Pro stylet interaction (Blanc et al., 1998). In contrast, all

the mutations within the highly conserved Pro-Thr-Lys (PTK) motif, in the

central region of the ZYMV HC-Pro, abolished aphid transmission and

binding to virions (Peng et al., 1998) suggesting that the region permitting

binding to virions lies outside of the N-terminal domain. Interestingly, the N-

terminal region, which includes the KITC motif, has been implicated in

homodimerisation (Urcuqui-Inchima et al., 1999); this ability of HC-Pro to

dimerise may be important for aphid transmission (Urcuqui-Inchima et al.,

1999).

7

Gal-On and Raccah (2000) recently reported that substitution of Ile for Arg in

the conserved FRNK (Phe-Arg-Asn-Lys) motif in the central region of the

HC-Pro affected symptom expression. Cucumber, melon and watermelon

infected with ZYMV containing this mutation were symptomless while

symptoms in squash were altered from severe to mild although

accumulation of the virus reached a level similar to that of wild type ZYMV

(Gal-On and Raccah, 2000). As well, single amino acid changes in the HC-

Pro of Plum pox virus (PPV) caused dramatic effects on symptoms in

herbaceous hosts (Saenz et al., 2001).

The central region of the HC-Pro also appears to be involved in replication.

Mutation of the TEV HC-Pro in the highly conserved Ile-Gly-Asn (IGN) or

Cys-Cys/Ser-Cys (CC/SC) motifs abolished RNA amplification and systemic

movement of the virus, respectively (Cronin et al., 1995). The potyvirus HC-

Pro binds non-specifically to single-stranded nucleic acids with a preference

for RNA (Maia and Bernardi, 1996; Merits et al, 1998). In PVY, two

independent RNA binding domains were identified in the central region of

the HC-Pro (Urcuqui-Inchima et al., 2000).

The HC-Pro has been implicated in cell-to-cell movement of several

potyviruses including PPV (Saenz et al., 2002), TEV (Cronin et al., 1995;

Kasschau et al., 1997), Sweet potato feathery mottle virus (SPFMV) (Sonoda

et al, 2000), Bean common mosaic necrosis virus (BCMNV) and Lettuce

mosaic virus (LMV) (Rojas et al., 1997).

The HC-Pro has been implicated as the region responsible for the synergism

seen between potyviruses and unrelated viruses that results in more severe

symptoms and increased virus accumulation in systemically infected leaves

(Pruss et al., 1997). When SPFMV HC-Pro coding region was introduced into

a Potato virus X (PVX) virus vector it enhanced symptom severity on N.

benthamiana and long distance movement in Ipomea nil and SPMFV HC-Pro

was localised to the phloem of I. nil (Sonoda et al., 2000). The same

synergism was observed for PPV HC-Pro, which enhanced the pathogenicity

of PVX in N. clevelandii and N. benthamiana (Saenz et al., 2002).

8

It has also been demonstrated that the HC-Pro functions as an effective

suppressor of post-transcriptional gene silencing (PTGS) (Anandalakshimi et

al., 1998; Brigneti et al., 1998; Kasschau and Carrington, 1998; Kasschau

and Carrington 2001). Kasschau and Carrington (2001) suggested that the

role of HC-Pro in long distance movement and genome replication depends

on PTGS suppression. They demonstrated that mutations that caused long

distance movement and replication defects also caused defects in PTGS

suppression while mutations that did not interfere with long distance

movement and replication of the virus were similar to wild type HC-Pro in

PTGS suppression.

Like the P1 protein, the HC-Pro cleaves itself from the polyprotein. The

proteolytically active domain has been localised to the C terminus of the HC-

Pro (Carrington et al., 1989) where autocatalytic cleavage occurs at a

conserved Gly-Gly dipeptide at the junction with P3. Among 19 TEV HC-Pro

mutants tested only those with alterations at Cys-649 and His-722 were

defective for HC-Pro autocatalytic activity implicating them as active site

residues and suggesting that the HC-Pro is a cysteine-like proteinase (Oh

and Carrington, 1989). Mutation studies to investigate the amino acid

sequence requirements surrounding the HC-Pro C-terminal cleavage site of

TEV identified four conserved amino acids (Tyr, Val, Gly and Gly) flanking

the cleavage site as essential for recognition of the cleavage site (Carrington

and Herndon, 1992). Mutations affecting the active site residues His-Cys-Gly

of TEV inhibited proteolytic activity and these mutants were amplification

defective (Kasschau and Carrington, 1995). Amplification activity was

unable to be restored by insertion of the TEV NIa cleavage site between the

HC-Pro and P3 coding regions suggesting that an active HC-Pro proteinase

is required in cis for TEV genome amplification.

1.1.2.3 P3 protein & 6K1 The P3 and 6K proteins have been implicated in replication and

pathogenicity. TVMV (Rodriguez-Cerezo et al., 1993) and TEV (Langenberg

and Zhang, 1997) P3 were localised in the cytoplasm and nucleus,

9

respectively. In TVMV, P3 was associated with the CI protein at early

stages of the formation of the cylindrical inclusion bodies and in TEV, P3

was found associated with NIa. Nevertheless, both studies concluded that

the P3 could be involved in virus amplification. In support of this, mutations

in the P3 of TVMV eliminated replication in plants and protoplasts (Klein et

al., 1994).

P3 has recently been implicated in pathogenicity in a number of studies.

Mutations between P3 and 6K1 peptide in PPV resulted in symptomless viral

infections (Riechmann et al., 1995), although virus concentration was not

affected. Saenz et al. (2000) reported the presence of a pathogenicity

determinant in the C-terminal region of the P3/6K1 complex of PPV. They

found the size of this determinant and the kind of symptoms that it induced

were host dependent. P3/6K1 has also been identified as a determinant of

pathogenicity for Pea seed-borne mosaic virus (PSbMV) in peas containing

the resistance gene sbm-2 (Johansen et al., 2001) and for TVMV in Brassica

napus differential line 165 (Jenner et al., 2002). This is discussed further in

section 1.4.

1.1.2.4 CI protein

The potyviral CI protein has NTP binding, NTPase, RNA binding and RNA

helicase activity (Lain et al., 1990; Lain et al., 1991; Fernandez et al., 1995).

The CI protein has seven conserved segments in its N-terminal half

(reviewed in Kadare and Haenni, 1997). These conserved regions have

been implicated in functions including RNA binding activity (segment VI),

NTPase activity (segment II, V) and NTP binding (segment I) (Fernandez et

al, 1995; Fernandez and Garcia, 1996). The function of these segments in

potyviruses is reviewed in Urcuqui-Inchima et al. (2001).

ATPase activity in infected cells was identified in cytoplasmic vesicles close

to the CI inclusions (Chen et al., 1994) that were proposed to be sites of viral

RNA synthesis. There is other, if somewhat limited, evidence for the

involvement of CI in replication. Mutations in the CI of TVMV and TEV were

10

reportedly able to eliminate replication (Klein et al., 1994; Carrington et al.,

1998).

The presence of ATPase activity was also observed in plasmodesmata

(Chen et al., 1994), implicating the CI in cell-to-cell movement. Although

experiments suggest the CI is not a movement protein in the same way as

the HC-Pro or CP (Rojas et al., 1997), studies have supported the

localisation of CI close to plasmodesmata and often in structures crossing

the cell wall into neighbouring cells (Rodriguez-Cerezo et al., 1997; Rojas et

al., 1997). In addition, several mutants of TEV in which replication was not

inhibited, did not move out of the infected cell or were defective in systemic

movement (Carrington et al., 1998). These results support the involvement

of CI in cell-to-cell movement.

1.1.2.5 6K2 peptide

The 6K2 peptide has been implicated in genome amplification and anchoring

of the replication apparatus to ER-like membranes (reviewed by Urcuqui-

Inchima et al., 2001). The 6K2 peptide of TEV was able to abolish transport

of the TEV NIa to the nucleus when bound to the NIa (Restrepo-Hartwig and

Carrington, 1992). Mutations that prevented correct cleavage of the 6K2/NIa

junction resulted in debilitated or non-viable virus (Restrepo-Hartwig and

Carrington, 1994). The central hydrophobic domain of the 6K2 peptide was

shown to be necessary for binding the 6K2 to ER-derived membranes

(Schaad et al., 1997). However, targeting to these membranes may also

require VPg or NIa with 6K2.

1.1.2.6 NIa protein NIa, the small nuclear inclusion protein, is usually found co-localised with the

large nuclear inclusion protein (NIb) in the nucleus, often, but not always in

inclusion bodies. The NIa is composed of two domains, the N-terminal

genome-linked protein (VPg) domain, and the C-terminal proteinase domain

(Dougherty and Parks, 1991). The VPg is required in viral replication and

11

host genotype specificity (Schaad et al., 1997). The VPg attaches covalently

to the 5’ terminus of the genomic RNA through a phosphodiester linkage

with the hydroxyl group of a conserved Tyr (Murphy et al., 1990). Mutation of

the Tyr residue involved in covalent attachment of the VPg to TVMV viral

RNA affected virus replication in protoplasts and also eliminated NIb-NIa

interaction (Hong et al., 1995). These results led Hong et al. (1995) to

conclude that the NIb protein interacts with the VPg domain of the NIa and

that this interaction requires a functional RNA attachment site. Also, this

interaction may be important for the initiation of viral RNA synthesis in

infected cells. Plochocka et al. (1996) used a three-dimensional model of the

PVY VPg to demonstrate covalent attachment of the terminal A residue with

the specific Tyr residue facilitated exposure of the 5’ RNA sequence

enabling interaction with other components for (+) and (-) strand RNA

replication. PVA VPg was shown to bind RNA in a sequence nonspecific

manner (Merits et al., 1998). Using northwestern blots (Merits et al., 1998)

and UV cross-linking assays (Daròs and Carrington, 1997), the NIa was

shown to be able to bind RNA either as NIa-Pro, NIa, 6K2-NIa or VPg. The

precise RNA binding domains of potyvirus NIa have not been characterised

and no RNA binding sequence motifs have been identified (Urcuqui-Inchima

et al., 2001).

The VPg has been shown to be involved in determining host specificity for

systemic movement or replication in several potyviruses including TEV

(Schaad et al., 1997), TVMV (Nicolas et al., 1997), PSbMV (Keller et al.,

1998; Borgstrom and Johansen, 2001) and PVA (Rajamaki and Valkonen,

1999; Guo et al., 2001). This is discussed further in section 1.4

The NIa is the major potyviral proteinase involved in cis and trans proteolytic

cleavage of the C-terminal two thirds of the potyviral polyprotein into

functional proteins (Carrington and Dougherty, 1987). There are at least six

cleavage sites in the viral polyprotein recognised by the NIa protease

(Carrington et al., 1993). Cleavage sites within the polyprotein have a

conserved consensus motif e.g. in TEV the consensus is Glu-x-x-Tyr-x-

Gln↓Ser/Gly where cleavage occurs between the Gln-Gly dipeptides

12

(Carrington et al., 1988). The NIa proteases from TEV and TuMV have

been over-expressed and purified (Kim et al., 1995; Parks et al, 1995) and

the recombinant proteases were shown to be catalytically active. However, a

truncated NIa protease lacking the C-terminal 20-24 amino acids resulting

from autocatalytic activity of the recombinant protease was shown to be less

active (Kim et al., 1995, Parks et al., 1995). In a later study, Kim et al. (1998)

reported that mutation of the C-terminal conserved residues Phe, Val, Lys,

Ile and Leu in the TuMV NIa protease did not exhibit any significant effect on

the cleavage between NIa and NIb, suggesting that the conserved residues

are not essential for the cleavage of the NIa – NIb junction sequence. Earlier

mutational studies on TEV NIa protease indicated that His-46, Asp-81 and

Cys-151 constitute the catalytic triad (Dougherty et al., 1989). Attempts to

delineate the region involved in substrate binding revealed that the C-

terminal 150 amino acid residues of the NIa protease contained the

necessary information for recognition of the cleavage site, and the specificity

determinants were confined to at least three sub-domains between amino

acids 94-166, 166-183, 183-243 of the TEV NIa protease (Parks and

Dougherty, 1991). However, specific amino acid residues involved in

substrate recognition could not be identified. NIa sequence between

positions 40 and 49 was found to be sufficient for nuclear localisation.

Gus/NIa fusion proteins lacking this sequence were unable to translocate to

the nucleus (Schaad et al., 1996).

1.1.2.7 NIb protein

The NIb is the potyviral RNA dependent RNA polymerase (RdRp),

characterised by the presence of a conserved GDD motif and has been

shown to have replicase activity (Koonin, 1991; Hong and Hunt, 1996) and

as might be expected, binds RNA (Merits et al., 1998). Like the NIa, NIb was

found to accumulate in the nucleus of infected cells (Baunoch et al., 1991;

Dougherty and Hiebert, 1980), sometimes in inclusion bodies. Translocation

of the NIb to the nucleus is facilitated by two independent nuclear localisation

signals (Li et al., 1997). The function of the NIb in the nucleus is still

unknown as replicase activity occurs in the cytoplasm or associated with

13

membranes. Using a two-hybrid system, the TVMV NIb protein was shown to

interact with both NIa and CP as well as with itself (Hong et al., 1995).

Mutations in the GDD domain abolished the NIb-CP interaction but not the

NIb-NIa interaction. Unlike TVMV, no self-interaction was found with the NIb

of TEV (Li et al., 1997) or ZYMV (Wang et al., 2000). NIb was found to

interact with NIa through its VPg (Hong et al., 1995; Fellers et al., 1998) or

protease domain (Li et al., 1997; Daròs et al., 1999). ZYMV NIb was also

shown to interact with its host (cucurbit) poly (A) binding protein (Wang et al.,

2000), although the significance to virus replication is unknown.

1.1.2.8 Coat protein CP is a multifunctional protein involved in aphid transmission, cell-to-cell and

systemic movement, encapsidation of viral RNA and the regulation of viral

RNA amplification (Urcuqui-Inchima et al., 2001). The CP can be divided

into 3 general regions, N- and C- terminal regions that are exposed on the

surface of the virion and a highly conserved core region (Shukla and Ward,

1989). Mechanical inoculation after removal of the N and C termini by trypsin

digestion suggested that these regions are not involved in infectivity (Shukla

et al., 1988). The conserved DAG motif, located near the N terminus of the

CP is important in aphid transmission of the virus (Harrison and Robinson,

1988). In TVMV and TEV, most substitutions and all deletions in the DAG

motif resulted in loss or drastic reduction of aphid transmissibility (Atreya et

al., 1995; Lopez-Moya et al., 1999). Some mutations introduced in residues

adjacent to the DAG motif in TEV also affected transmissibility, suggesting

regions other than the DAG motif are required for efficient transmission

(Lopez-Moya et al., 1999). The N-terminal region of the CP must interact

with HC-Pro for successful transmission (Salomon and Bernardi, 1995;

Blanc et al, 1997). Mutations in the DAG motif of TVMV not only abolished

or reduced transmissibility but prevented or reduced binding of the CP with

the HC-Pro (Blanc et al., 1997). In contrast, no interaction was detected

between PVA CP and HC-Pro using the two-hybrid system (Guo et al.,

1999).

14

Mutational studies of the TEV CP revealed that CP is necessary for cell-to-

cell and long-distance movement (Dolja et al., 1994). Deletion of a part of

the N-terminal region of the CP resulted in virus that was defective in cell-to-

cell movement and blocked in systemic movement. A mutation within the

core region of the CP affected virus assembly and subsequently cell-to-cell

movement, while mutations in either the N- or C-terminal regions or both

caused inhibition of systemic movement.

The main function of the CP is to encapsidate the viral RNA, requiring only

the core domain of the CP (Shukla and Ward, 1989). Mutagenesis studies

within the core region of the CP have identified amino acids essential for

virus assembly in a number of studies (Jagadish et al., 1993; Dolja et al.,

1994; Dolja et al., 1995; Varrelmann and Maiss, 2000). Mutations in the

core that affect assembly cannot be trans-complemented by wild type virus

(Varrelmann and Maiss, 2000).

The CP and NIb have been shown to interact (Hong et al., 1995), an

interaction that involves the GDD motif, suggesting the CP is involved in

regulation of RNA synthesis. It has been shown that translation of at least

part of the CP coding region, rather than the presence of the CP itself, can

stimulate genome amplification (Mahajan et al., 1996). This process

functions in cis.

1.1.2.9 Untranslated regions Untranslated regions exist at both the 5’ and 3’ end of the potyviral genome. Potyviral 5’ untranslated regions range in length, are especially rich in

adenine residues and have few guanine residues (Gallie et al., 1987).

Carrington and Freed (1990) showed that the 5’UTR of TEV can function as

an enhancer of translation in plant cells. This was also demonstrated for the

PSbMV 5’UTR (Nicolaisen et al., 1992). Riechmann et al. (1992) suggested

that some conserved regions located in the 5’UTRs of PPV, TEV, TVMV and

PVY may play a role in translation, replication or virus encapsidation.

15

The potyviral 3’UTRs are heterogenous in length, sequence and predicted

secondary structure (Quemada et al., 1990). The primary and secondary

structure of the 3'UTR for potyviruses has been postulated to be involved in

specific replicase recognition for minus-strand synthesis; however, this

function has yet to be attributed to a specific region or sequence. The 3’UTR

is also polyadenylated; this has been shown to be essential for infectivity and

is mediated by polyadenylation sites in the 3’UTR (Takahashi and Uyeda,

1999).

1.2 PAPAYA RINGSPOT VIRUS (PRSV)

1.2.1 Description

Papaya ringspot virus (PRSV) is a member of the potyvirus genus in the

family Potyviridae. PRSV isolates are divided into two strains, type P and W,

which are serologically and morphologically identical and can only be

differentiated on the basis of their host range (Gonsalves and Ishii, 1980).

Although originally classified as different potyviruses (PRSV-W was originally

Watermelon mosaic virus 1), amino acid similarity of approximately 98% of

the NIb, as well as the CP and 3’UTR of US isolates of PRSV-P and -W,

confirmed they are strains of the same virus (Quemada et al., 1990).

PRSV-W isolates naturally infect only cucurbits while PRSV-P isolates infect

both cucurbits and papaya. The experimental host range of PRSV-P

includes 15 species in three families (Caricaceae, Chenopodiaceae,

Cucurbitaceae) while PRSV-W infects 38 species of 11 genera in two

families (Cucurbitaceae, Chenopodiaceae) (Edwardson and Christie, 1986).

The symptoms of PRSV-P include mottling, ringspots and distortion of

leaves (Fig. 1.2), rings and spots on fruit (Fig. 1.3) and streaks with a greasy

or water-soaked appearance on stems and petioles while PRSV-W induces

mottling and distortion of leaves and fruits (Fig.1.4) (Purcifull et al., 1984).

Variation in symptoms is dependent on virus isolate, stage of infection, plant

size and vigour, and temperature (Purcifull et al., 1984).

16

It has been shown that PRSV-P isolates are transmitted by 21 aphid species

in 11 genera with Myzus persicae and Aphis gossypii the most important

natural vectors (Purcifull et al., 1984). PRSV-W isolates are transmitted by

24 aphid species in 15 genera with Myzus persicae, Acyrthosiphum solani,

Aphis craccivora and Macrosiphum euphorbiae as natural vectors (Purcifull

et al., 1984; Shukla et al., 1994). PRSV is not thought to be seed-transmitted

in papaya or cucurbit seed (Purcifull et al., 1984; Shukla et al., 1994).

However, there is one report of seed transmission of PRSV-P in seed of a

local papaya cultivar in the Philippines (Bayot et al., 1990). Papaya leaf-

distortion mosaic virus (PLDMV) identified in papaya in Japan, also shows

the same symptoms of infection as PRSV-P and was first identified as an

isolate of PRSV-P but was subsequently shown to be distinct from PRSV-P

(Maoka et al., 1996).

PRSV is widespread throughout the world. PRSV-P is found in most tropical

and sub-tropical areas where papaya is grown. PRSV-W occurs wherever

cucurbits are grown (Purcifull et al., 1984); however, it has not been reported

in South Africa although the closely related cucurbit virus Moroccan

watermelon mosaic virus (MWMV) is widespread (Lecoq et al., 2002). The

extensive list of countries known to have PRSV include USA, South

America, Caribbean, India, Taiwan, Australia, Thailand, Sri Lanka, Middle

East, Mexico, Germany, France and Italy (De La Rosa and Lastra, 1983;

Purcifull et al., 1984; Shukla et al., 1994). PRSV-P has had devastating

effects on the papaya industry around the world. PRSV was first reported in

Hawaii in 1945 (Jensen, 1949). In Hawaii, PRSV-P became widespread on

Oahu in the early 1950's and has since spread to all commercial papaya

growing regions (Gonsalves, 1998). The virus has drastically affected papaya

17

Figure 1.2 PRSV-P infected papaya.

18

Figure 1.3 PRSV-P infected papaya fruit. Arrows indicate

typical ringspots symptoms on fruit.

19

A B

C

Figure 1.4 PRSV-W infected cucurbits. A & B: Symptoms on

leaves. C: Symptoms on the fruit

20

production and in severely infected regions, PRSV-P infection has eliminated

papaya as a cash crop, resulting in loss of income for farmers and reduced

quality and availability of fruit for consumers. PRSV-P had destroyed most of

the commercial plantations on the west coast of Southern Taiwan within four

years after it was first recorded in 1975 and production dropped 60% in this

period (Yeh et al., 1988). Also, export markets to Hong Kong and Japan

were lost and the industry now has difficulty in supplying even the domestic

market (Yeh et al., 1988). In Brazil, yield reductions averaging 70% have

been measured (Rezende and Costa, 1993). In the Philippines, papaya

production decreased by 85% in six years after PRSV-P was identified in

1982 (Opina, 1991). PRSV-P is also the limiting factor to papaya production

in Mexico and it was reported that up to 90% of plants die from the disease

within a year of planting (Mora-Aquilera et al., 1993).

1.2.2 Genome organisation: comparison with other potyviruses

PRSV virions are flexuous filaments, approximately 780nm long x12nm wide

(Purcifull et al., 1984), containing a single molecule of linear, positive-sense,

ssRNA approximately 10.3kb in length (Yeh et al., 1992).

The complete nucleotide sequence of two isolates of PRSV-P, PRSV HA

(Hawaiian isolate) (Yeh et al., 1992) and PRSV YK (Taiwanese isolate)

(Wang and Yeh, 1997) have been published. Several other full-length

sequences have recently been submitted directly to GenBank (see chapter

4). The PRSV genome has a similar organisation to other members of the

potyvirus genus (Yeh et al., 1992; Wang and Yeh, 1997). The viral RNA of

PRSV is relatively large compared to other potyvirus sequences, which are

generally between 9-10kb long (Table 1.1), although SPFMV is larger

(10.8kb). The average amino acid identity of each protein of PRSV

compared with those of seven other potyviruses is less than 58.6% (Fig.

1.5). There is a 5’UTR of 85 nucleotides, which is short compared to many

other potyvirus 5’UTRs and a 3’UTR of 209 nucleotides which is

polyadenylated (Yeh et al., 1992). PRSV has a relatively long P1 coding

region compared with other potyviruses (Wang and Yeh, 1997). The P1

21

Table 1.1 . Comparision of the genome size of potyviruses (data extracted

from National Centre for Biotechnology Information (NCBI)).

Virus

Size (bp)

Locus

Yam mosaic virus 9608 NC_004752 Potato virus Y strain N isolate N-Jg 9700 AY166867 Peru tomato mosaic virus 9899 NC_004573 Wild potato mosaic virus 9878. NC_004426 Maize dwarf mosaic virus 9515 NC_003377 Sweet potato feathery mottle virus 10820 NC_001841 Johnson grass mosaic virus 9779 NC_003606 Plum pox virus isolate PENN 9786 AF401296 Soybean mosaic virus 9588 AB100443 Sugarcane mosaic virus 9589 SMO278405 Sorghum mosaic virus strain H 9613 SMU57358 Dasheen mosaic virus 10038 NC_003537 Bean common mosaic necrosis virus 9612 NC_004047 Potato virus A 9585 NC_004039 Potato virus V 9848 NC_004010 Leek yellow stripe virus 10142 NC_004011 Cowpea aphid-borne mosaic virus 9465 NC_004013 Cocksfoot streak virus 9663 NC_003742 Lettuce mosaic virus 10080 NC_003605 Clover yellow vein virus 9584 NC_003536 Bean yellow mosaic virus 9532 NC_003492 Zucchini yellow mosaic virus 9591 NC_003224 Peanut mottle virus 9709 NC_002600 Tobacco etch virus 9494 NC_001555 Turnip mosaic virus 9835 NC_002509 Tobacco vein mottling virus 9475 NC_001768 Pea seed-borne mosaic virus 9924 NC_001671 Pepper mottle virus 9640 NC_001517 Scallion mosaic virus 9324 SMO316084 Bean common mosaic virus cowpea isolate Y

10062 BCO312438

22

Figure.1.5. Average % identity of PRSV proteins with homologous proteins

of six additional potyviruses (TEV, TVMV, PVY, PSbMV, Pepper mottle virus

(PeMV), Soybean mosaic virus (SMV)). (Based on the data reported in Yeh

(1994))

protein appears to be the most variable potyviral protein and shows a wide

variation in size (from 29K-63K) among reported potyviruses (Yeh, 1994).

Between the P1 proteins of Taiwanese and Hawaiian PRSV isolates there is

only 70.9% nucleotide identity and 66.7% amino acid identity (Wang and

Yeh, 1997). This high level of variability is also seen within isolates from a

particular country. Henderson (1999) reported 81.41% nucleotide and

76.97% amino acid similarity between the P1 proteins of PRSV-P and W

from Thailand. The Australian PRSV-P and W isolates were reported to be

96.89% and 95.43% similar at the nucleotide and amino acid levels,

respectively (Henderson, 1999).

Next to the P1 protein, the P3 and 6K1 are the least conserved between

PRSV and other potyviruses (Fig.1.5), suggesting that the function of these

proteins may be more virus specific (Yeh, 1994). Remaining proteins range

from 43 to 59% identity with homologous potyvirus proteins (Fig.1.5) (Yeh,

1994). Between the Hawaiian and Taiwanese PRSV-P isolates, amino acid

sequence identity between proteins (excluding P1) ranged from 91.2% (6K1)

to 97.6% (CI) (Wang and Yeh, 1997).

Characterisation of the CP and/or 3’UTR has been reported for several

PRSV isolates (Nagel and Hiebert, 1985; Quemada et al., 1990; Bateson

VPg proteinase

49.4% 43.1%

33.9%

P1 HC Pro P3 CI NIa NIb CP

6K1

14.3% 49.1% 30.6% 55.1% 59.5% 54.5%

23

and Dale, 1992; Wang and Yeh, 1992; Bateson et al., 1994; Bateson et al.,

2002). These studies showed that differences in the CP sequence among

PRSV strains were located mostly in the N terminus and include differences

in number of amino acids as has been demonstrated in other potyviruses

(Shukla et al., 1994). This variation in the CP of PRSV is related to the

difference in geographic origin rather than host specificity (Wang and Yeh,

1997; Bateson et al., 1994; Bateson et al., 2002).

1.2.3 PRSV in Australia

PRSV-W was first recorded in Australia in 1978 (Greber, 1978) and is now

prevalent in most cucurbit growing regions in Queensland, northern New

South Wales and the Northern Territory (Persley, 1997). PRSV-P was first

recorded in Australia in 1991 (Thomas and Dodman, 1993) and it is still

restricted to South East Queensland.

PRSV has a significant economic impact on Queensland cucurbit and

papaya growing regions (Persley, 1997). Almost all cultivars of watermelon

and pumpkin are susceptible to PRSV-W. In the Northern Territory, PRSV-W

causes significant problems in Cucumis melo (rockmelon) and Citrullis

lanatus (watermelon). In Queensland, PRSV-W is of major economic

importance in Cucurbita maxima (Queensland blue pumpkin) and Cucurbita

pepo (zucchini). PRSV-W often occurs as a co-infection with ZYMV resulting

in severe yield losses in cucurbits. When PRSV-P was first reported in

Queensland, restrictions on movement of papaya were put in place and all

symptomatic plants located on commercial properties were destroyed in an

attempt to control the disease. To date, this has been successful. As well,

several immune transgenic papaya lines were developed against this PRSV-

P isolate (Lines et al., 2002) which are available to the industry should the

virus move out of South East Queensland. While it was initially assumed

that PRSV-P had been introduced from overseas, subsequent studies

comparing the coat protein sequences of Australian PRSV-P and -W

isolates with several overseas isolates (Bateson et al., 1994) demonstrated

very low levels of variability (< 2% nucleotide variability) between Australian

24

P and W isolates compared to overseas isolates (up to 12% nucleotide

variability). This close relationship between Australian isolates and the

presence of PRSV-W in Australia at least 20 years before PRSV-P led to the

hypothesis that, at least in Australia, PRSV-P may have arisen by mutation

from PRSV-W (Bateson et al., 1994). As yet the molecular basis of this

mutation is unknown.

1.3 POTYVIRAL HOST RANGE DETERMINANTS It is well established that plant viruses spread from cell to cell by an active

process involving the interaction of specific viral and host factors. Plant

viruses enter host cells through wound sites, which are induced mechanically

or by vector organisms. Spread of infection throughout the plant from the

initially infected cells occurs by two processes. First, viruses spread to

neighbouring cells from initially infected cells; this is short distance or cell-to-

cell movement. A second, long-distance movement allows the viruses to

enter the vascular system and spread systemically throughout the plant. The

host range of a plant virus can be affected by blocking systemic infection at

several stages: (i) initial infection and viral uncoating, (ii) replication of the

virus, (iii) cell-to-cell movement (short distance movement) and (iv)

movement into the vascular system (long distance movement) (v) stimulation

of plant cell defence mechanisms. All of these factors seem to have some

role in host range determination (Matthews, 1991; Schaad et al., 1996).

For most plant virus groups, movement involves one or more specialized

virus-encoded proteins called movement proteins (MPs) (Revers et al.,

1999). Cell-to-cell and long-distance movement of plant virus has been

identified as primary determinants of host range within plant virus groups.

The ability of a virus to move through a plant and cause a systemic infection

is highly dependent upon the host specific interactions, particularly

movement through the plasmodesmata, which connect plant cells together to

form a symplasm (Atabekov and Dorokhor, 1984). Although it is accepted

that plant viruses spread via plasmodesmata, it has been shown that the

typical molecular size exclusion limit (SEL) of plasmodesmata is significantly

25

smaller than would be necessary to allow passage of either the smallest

virus particle or viral nucleoprotein complexes (Dickinson, 1996). Therefore

viral infection must lead to alteration of the aperture structure or size when

viruses spread using plasmodesmata. Studies suggested that the MPs

induce plasmodesmata gating, and then move through the pore carrying viral

nucleic acid to adjacent cells (Derrick et al., 1992; Ding,1998; Fujiwara et

al.,1993; Noueiry et al., 1994; Zambryski and Crawford, 2000). Further,

gating increases the plasmodesmata size exclusion limit for transport of large

molecules between cells. Plasmodesmata between mesophyll cells of

transgenic plants expressing MP have an SEL that is ~10-fold higher than

that of plasmodesmata of control plants.

Potyviruses do not encode a dedicated movement protein (Revers et al.,

1999) but movement functions have been allocated to several proteins, a

number of which have been implicated as determinants of pathogenicity.

1.3.1 CP and HC-Pro

The CP and HC-Pro of potyviruses have been implicated in host range; there

is also evidence that they interact to facilitate systemic infection. The

potyvirus CP was hypothesised to be involved in host range when the CPs of

strains of Sugarcane mosaic virus (SCMV), which differed in host range,

were shown to have a hypervariable region (21-68 amino acids in length) in

the surface exposed N terminus (Frenkel et al., 1991; Xiao et al., 1993).

Although these regions appeared to correlate with host range, this has not

been confirmed. The CP has also been implicated in host range through its

putative movement function. The core region of the CP of TEV was shown to

be essential for cell-to-cell movement and virion assembly, while the N and C

termini were necessary for long distance movement (Dolja et al., 1994;

1995). Comparative studies with TEV in tobacco line Havana 425, which

supports systemic infection, and line V20, which suppresses long distance

movement, demonstrated that the virus was blocked at entry to or exit from

sieve elements (Schaad and Carrington, 1996). They suggested that long-

distance movement of TEV requires a set of host functions that were

26

different to those involved in cell-to- cell movement. Cronin et al. (1995)

demonstrated that the central region of TEV HC-Pro was also required for

long distance movement of TEV and proposed that the HC-Pro and CP

interact to form an active transport complex. Experiments with PVA

supported this concept of co-ordinated interaction between the HC-Pro and

CP (Andrejeva et al., 1999). PVA isolate PVA-B11 differs from isolate PVA-U

as it is not transmitted by aphids and does not systemically infect potato

(Solanum tuberosum L. cv. Pentland Ivory). The authors demonstrated that

the phenotypic effects resulting from simultaneous mutation of the CP and

HC-Pro were different from the expected ‘sum’ of individual mutations and

this suggests coordinated functions of HC-Pro and CP in accumulation and

movement of PVA. On the other hand, Andersen and Johansen (1998)

showed that a change from Ser to Pro at amino acid 47 in the CP of PSbMV

restricted systemic movement of the virus in Chenopodium quinoa.

Interestingly, the CP of PVY was reported to complement cell-to-cell

movement of a CP movement-deficient PVX mutant by a mechanism other

than coating of virions (Fedorkin et al., 2000) while the HC-Pro of SPFMV

reportedly enhances the long distance movement of PVX in Ipomea nil

(Sonoda et al., 2000). Interestingly, while single amino acid changes in the

HC-Pro of subisolates of PPV-PS had a significant effect on virus symptoms

in a range of Nicotiana species (herbaceous hosts) and modified infectivity

on peach seedlings (woody host) (Saenz et al., 2001), the amino acids

eliminating infectivity of 2 subisolates on peach seedlings were not found in

the HC-Pro. Recently, it was reported that expression of the 5’ terminal

region of the TEV genome, including the P1 and HC-Pro coding sequences,

in transgenic plants facilitated the movement of PPV in tobacco (Saenz et al.,

2002). This complementing activity was disturbed by mutation in the HC-Pro

coding sequence of TEV implicating the HC-Pro in long distance movement

(Saenz et al., 2002).

1.3.2 VPg

Recently, the N terminus of the small nuclear inclusion protein (NIa), which

encodes the viral genome linked protein (VPg), has been implicated as a

27

host range determinant of several potyviruses including TVMV (Nicolas et al.,

1997); TEV (Schaad et al., 1997), PSbMV (Keller et al., 1998, Borgstrom and

Johansen, 2001; Hjulsager et al., 2002), PVY (Masuta et al., 1999), PVA

(Rajamaki and Valkonen, 1999; Rajamaki and Valkonen, 2002) and TuMV

(Leonard et al., 2000). In TVMV, 4 amino acids in the VPg were sufficient to

overcome resistance of the recessive va gene in tobacco (Nicolas et al.,

1997). Similarly, a single amino acid change in the VPg of PVY correlated

with the ability to overcome resistance of the va gene (Masuta et al., 1998).

Evidence suggested this was acting at the level of cell-to-cell movement. The

V20 cultivar of Nicotiana tabacum restricts systemic infection by most TEV

strains, including TEV-HAT, but is fully susceptible to TEV-Oxnard. Chimeric

viruses assembled from TEV-HAT and TEV-Oxnard implicated the VPg

domain as a host range determinant of this virus (Schaad et al., 1997).

Pisum sativum line 269818 (sbm-1/sbm-1) is susceptible to PSbMV

pathotype P4 but resistant to the biochemically and serologically related

pathotype P1. Using recombinant infectious clones, the VPg was implicated

as the pathogenicity determinant overcoming sbm-1 resistance (Keller et al.,

1998). Resistance appeared to be at the level of replication rather than cell-

to-cell movement. Subsequently, mutational analysis of the VPg of P1 and

P4 isolates revealed that changes affecting amino acids 105 to 117 in the

central region of VPg influenced virulence on P. sativum line 26981

(Borgstrom and Johansen, 2001).

PVA-M is restricted to the inoculated leaves of Nicandra physaloides while

PVA-B11 infects plants systemically. Site directed mutagenesis of the cDNA

clones of PVA-B11 and PVA-M suggested that the 6K2 protein and the VPg

are determinants of systemic infection in N. physaloides (Rajamaki and

Valkonen, 1999). Furthermore, a recent study by Rajamaki and Valkonen

(2002) showed that virus strain specific resistance to systemic infection with

PVA in Solanum commersonii is overcome by a single amino acid

substitution in the VPg.

28

Interactions have been shown to take place between the VPg of potyviruses

and translation eukaryotic initiation factors involved in initiation of translation

of capped mRNA’s. TuMV VPg has been shown to interact with eIF(iso)4E

of Arabidopsis thaliana (Wittmann et al., 1997) and wheat (Leonard et al.,

2000) as well as eIF4e of Arabidopsis (Leonard et al., 2000), while TEV VPg

was shown to interact with eIF4E from tobacco (Schaad et al., 2000). In

TuMV, the interaction domain was mapped to a stretch of 35 amino acids in

the N terminus of the VPg (Leonard et al., 2000) and is conserved among

potyviruses. This region incorporates the conserved Tyr residue which

covalently links the VPg to the viral RNA. A single amino acid substitution at

a highly conserved Asp residue found within this region completely abolished

the interaction preventing infection of A. thaliana (Leonard et al., 2000).

Interaction between translation initiation factors and the VPg of other types of

viruses has also been reported e.g Tomato ringspot virus (TRV), a Nepovirus

interacts with eIF(iso)4E from Arabidopsis (Leonard et al., 2002). A mutant

line of Arabidopsis lacking the gene encoding eIF(iso)4E but with wild-type

phenotype was isolated (Duprat et al., 2002) and found to be resistant to

TuMV and LMV but not to a Nepovirus or a Cucumovirus. This indicates that

eIF(iso)4E is required for susceptibility to potyviruses but is not essential for

plant growth. A natural recessive resistance gene (pvr2) that confers

resistance to PVY in pepper has been shown to correspond to an eIF4E

gene (Ruffel et al., 2002).

1.3.3 P3, 6K1 and CI

In several instances, pathogenicity determinants have been identified in the

region of the genome incorporating the P3 and 6K1 proteins and on occasion

the CI (Saenz et al., 2000; Dallot et al., 2001; Johansen et al., 2001; Jenner

et al., 2002). PPV–R and PPV-PS induce different symptoms in Nicotiana

clevelandii. Using chimeric PPV-R/PS viruses, the pathogenicity

determinants of these strains were localised to the genomic fragment that

encodes 173 amino acids from the C-terminal part of the P3 and the 6K1

protein (Saenz et al., 2000). This region was sufficient to give PPV-PS

symptoms, although the same region was not sufficient in reciprocal

29

recombinants. Specific sequences in the CI were also required to elicit the

symptoms of PPV-R in N. clevelandii. The same, although smaller region (74

amino acids) determined symptom differences in Pisum sativum.

While pathogenicity determinants in the P-1 pathotype of PSbMV on P.

sativum cv. PI 269818 (with recessive gene sbm-1) were mapped to the VPg

(see 1.3.2.1), determinants in a second PSbMV pathotype, P-2 (resistant to a

second recessive gene sbm-2 in P. sativum cv. Bonneville) were mapped to

the P3-6K1 coding region (Johansen et al., 2001). Resistance afforded by

sbm-2 on P-2 was shown to affect an early step in infection, possibly

replication or cell-to-cell movement (Johansen et al., 2001).

Pathogenic determinants influencing systemic infection of 2 different PPV

isolates on plum were localised to the P3-6K1 coding region using chimeric

virus clones (Dallot et al., 2001). In contrast, determinants of local and

systemic infection in peach were not located accurately and may be

influenced by multiple regions of the genome within the P3-6K1-CI (Dallot et

al., 2000). It was concluded that infection of plum and peach was governed

by different determinants. Two different pathogenicity determinants were

identified in TuMV (Jenner et al., 2002), one in the P3 and one in the CI.

These regions were shown to be pathogenicity determinants for two different

resistance genes in Brassica napus line 165.

Although one of the economically most important plant virus families, and

with a host range that extends (as a family) to most plant families, the

molecular basis of host range in the Potyviridae is still not well defined,

although several coding regions have been implicated in pathogenicity acting

at different levels including movement, cell-to-cell and long distance

movement. It appears that the molecular basis of host range/pathogenicity in

potyviruses is quite complex with single or multiple genome regions involved

as well as single or multiple amino acid substitutions. Determinants may vary

between virus isolates but in general these changes appear to influence the

interaction of the particular potyviral protein with host factors.

30

1.4 AIMS AND OBJECTIVES The most notable and currently only difference between PRSV-P and PRSV-

W is the ability to infect papaya. While early sequence data for USA isolates

demonstrated the close relationship of these two biotypes (Quemada et al.,

1990), it was the historical order of their appearance in Australia and the even

closer relationship between the CP of PRSV-P and -W in Australia that led to

the theory that PRSV-P mutates from PRSV-W (Bateson et al., 1994). As yet,

the molecular host range determinants (HRDs) have not been defined

although defining this mutation and its potential role in the molecular

epidemiology of PRSV has significant implications for control of the virus. To

date, sequence analysis of several genome regions has demonstrated a high

level of similarity between Australian P and W isolates in the P1 (Henderson,

1999), CP (Bateson et al., 1994) and HC-Pro (Stokoe, 1996). Comparison of

the available sequences of Australian PRSV-P and W isolates with overseas

isolates has yet to identify a consistent change that could be attributed to host

range in papaya. However, previous work at QUT investigating P1 as a

potential HRD (Henderson, 1999) has provided a range of tools with which to

continue the identification of potential HRDs in PRSV.

Therefore the aim of this project was to identify the molecular HRDs of PRSV

in papaya through the following specific objectives:

(i) To clone the genomes of Australian isolates of PRSV-P and PRSV-W

and generate infectious clones

(ii) To sequence both genomes fully and compare the data to each other

and other available full-length sequences to identify putative HRDs

(iii) To generate recombinants between the two genomes to firstly, localise the

HRD to a general region of the genome and subsequently, to use sequence

data, further recombinants and mutagenesis to identify the specific HRDs.

31

CHAPTER 2 GENERAL METHODS AND MATERIALS

2.1 GENERAL REAGENTS

2.1.1 Sources of special reagents

DNA molecular weight marker X, (λ 1 Kb DNA ladder) was obtained from

Roche Diagnostics. The low copy number vector pACYC177 was purchased

from New England Biolabs and pGEM-T and pGEM-T Easy were obtained

from Promega. Oligonucleotide primers were commercially prepared by

Bresatec or Pacific Oligos in 5 OD standard purity. All restriction enzymes

were obtained from Roche Diagnostics. All general laboratory chemicals

were analytical grade and were purchased from Sigma, BDH or Ajax

chemicals. Agarose was obtained from Progen.

2.1.2 General solutions and media

Agarose gel loading buffer (6X): 0.25% bromophenol blue, 0.25% xylene

cyanol FF, 15% Ficoll (Type 400)

1 X TAE buffer: 10mM Tris-acetate. 0.5mM EDTA, pH 7.8

1 X TBE buffer: 9mM Tris-Borate, 2mM EDTA

LB broth:1% (w/v) bacto-tryptone, 0.5% (w/v) bacto-yeast extract, and

171mM sodium chloride.

LB agar: LB broth containing 1.5% bacto-agar

Terrific broth: 1.2% (w/v) bacto-tryptone, 2.4% (w/v) bacto-yeast extract,

0.4% (v/v) glycerol, 17mM monopotassium phosphate, 72mM dipotassium

phosphate.

IPTG: isopropyl-β-D-thiogalactopyranoside prepared as 500 μg/ml in sterile H2O.

X-gal: 5 bromo-4-choloro-3-indolyl-β-D-galactopyranoside, 2% (w/v)

prepared in dimethylformamide (DMF).

PBST: 0.14M sodium chloride, 8mM disodium phosphate, 1.4mM

monopotassium phosphate, 2.7mM potassium chloride, 0.05% Tween-20.

PBST/PVP: PBST containing 0.2% BSA, 2% PVP (MW 24000-40000).

32

Phenol: 100mM Tris-HCl pH 8.0 equilibrated phenol containing 0.1% 8-

hydroxyquinoline.

Phenol/Chloroform: 1:1 mixture of phenol and chloroform.

Carbonate coating buffer: 0.16% (w/v) Sodium carbonate, 0.29% (w/v) Sodium

bicarbonate and 1% (w/v) Polyvinylpyrrolidone (MW 24-40,000), PH 9.6.

2.2 GENERAL METHODS FOR VIRUS PURIFICATION AND DETECTION 2.2.1 Source and maintenance of virus isolates

Australian isolates of PRSV-P and W that have been partially characterised

in previous molecular studies [CP (Bateson et al., 1994); P1 (Henderson,

1999), were used in this study. PRSV-P was collected from field grown

Carica papaya plants at Bridgeman Downs in South East Queensland.

PRSV-W was collected from field grown cucurbits at Gatton in South East

Queensland. Material was used immediately or stored at -80oC. PRSV

isolates were propagated in squash (Cucurbita pepo var. Green buttons, S &

G deeds Pty.Ltd.) plants. Cotyledons of 10 day old seedlings were dusted

with carborundum and inoculated with sap prepared from infected leaves

ground in 0.1M potassium phosphate buffer (pH 7.0). Symptoms generally

appeared within 12-14 days and young leaves showing symptoms were

harvested for virus purification at 21 days.

2.2.2 Enzyme-linked immunosorbent assay (ELISA)

A standard plate-trapped ELISA method was used as described by Mowat

and Dawson (1987). Tissue (100mg) was ground in 1mL of 50mM carbonate

coating buffer pH 9.6 using an EppendorfTM micropestle grinder and 200μL

aliquots were coated onto the wells of immunosorb microtitre plates (Nunc).

The plates were incubated in a humid box at 40C overnight. Primary

antibody, raised in a rabbit to a glasshouse isolate of PRSV-W (Bateson,

1995), was diluted 1:1000 in PBST/PVP containing 2% BSA. The wells were

washed 4-5 times with PBST and 200μL of the primary antibody solution was

33

added and incubated for 1.5 hr at room temperature. The wells were washed

thoroughly 4-5 times with PBST and 200μL of swine anti-rabbit lgG-

horseradish peroxidase conjugate (DAKO), diluted 1:2000 in PBST/PVP with

0.2% BSA, was added and incubated at room temperature for 1 hr. Plates

were washed again and reactions measured colorimetrically using o-

phenylenediamine (OPD) (Sigma) and hydrogen peroxide according to the

manufacturers instructions. Results were recorded as +/- colour reaction

compared to buffer and healthy plant tissue controls or measured

spectrophotometrically at A460nm after 10 minutes using BeckmanTM Biomek

plate reader. Readings were considered positive when absorbance values

were at least three times greater than the healthy control.

2.2.3 Electron microscopy

Virus particles in crude leaf dips were visualized by negative staining.

Approximately 50mg of infected tissue was ground in 1mL of 2% potassium

phosphotungstate (PTA), pH 5.8 using an Eppendorf TM micropestle grinder.

A 20μL aliquot of the preparation was pipetted onto a Formvar coated copper

grid and the excess liquid removed by blotting with filter paper. Particles

were visualised at X25,000 magnification using a JEOL 1200 EX

transmission electron microscope.

2.3 GENERAL METHODS FOR NUCLEIC ACID EXTRACTION AND AMPLIFICATION

2.3.1 Preparation of crude RNA extract

RNA was extracted from plant tissue in high pH glycine buffer as described

by Robertson et al. (1991). Healthy and diseased plant tissues (60mg) were

frozen in liquid nitrogen and ground to a fine powder using an Eppendorf TM

micropestle grinder. A 500μL aliquot of extraction buffer G (100mM glycine,

pH 9.5, 100mM NaCl, 10mM EDTA) was added and the sample ground until

thawed. The extract was emulsified with an equal volume of phenol by

34

vortexing for approximately 30 sec. The aqueous phase was collected after

centrifugation at 12,000xg for 15 min at 40C and precipitated by the addition

of 0.1 volume of 3M Na acetate (pH 5.5) and 2.5 volumes of 100% ethanol.

The pellet was collected by centrifugation at 12,000 xg at 40C for 30 min,

washed in 70% ethanol and dried under vacuum. The pellet was

resuspended in 50μL sterile distilled water and stored at -80oC.

2.3.2 cDNA synthesis

For first-strand cDNA synthesis, 5-10μL aliquots of crude RNA extract

(section 2.3.1) were mixed with 30pmol of appropriate primer and heated at

940C for 5 min then quenched immediately on ice before the addition of

remaining components. The final cDNA reaction contained 50mM Tris-HCl

pH 8, 50mM KCl, 10mM MgCl2, 1mM DTT, 1mM EDTA, 10μg/mL BSA, 1mM

each of dATP, dCTP, dGTP, dTTP, 20U Rnasin ribonuclease inhibitor

(Promega) and 0.4 U ExpandTM Reverse Transcriptase in a total volume of

20μL. The reactions were incubated at 420C for 45 min and quenched

immediately on ice. Aliquots of 2-5μL of cDNA were used in PCR reactions.

2.3.3 Polymerase chain reaction (PCR) 2.3.3.1 Standard PCR

Either Taq DNA polymerase (Perkin Elmer) or Pwo DNA polymerase (Roche

Diagnostics) was used to amplify PCR products (< 2kb). PCR reactions

(50µL final volume) included buffer (20mM Tris-HCl pH 8.2, 2mM MgCl2,

10mM KCl, 10µg/mL BSA, 6mM (NH4)2SO4, 0.15% Triton X-100 for Taq or

10mM Tris-HCl pH 8.85, 50mM KCl, 5mM (NH4)2SO4, 2mM MgSO4 for Pwo),

200μM each of dATP, dCTP, dGTP and dTTP (Li salt), 2.5U of enzyme (Taq

or Pwo) and 30pmol of gene specific primers. Reactions were cycled using a

Perkin Elmer Cetus DNA Thermal Cycler 480 (after the addition of mineral oil

to tubes) or using a Hybaid Omnigene Thermal Cycler (without mineral oil

and with heated lid function). Unless otherwise specified, cycling consisted of

35

an initial denaturation cycle at 940C for 2 min followed by 35 cycles of

denaturation at 940C for 30 sec, annealing at 450C for 30sec and extension

at 720C for 30sec.

2.3.3.2 Long-distance PCR

For amplification of larger PCR products the ExpandTM Long Template PCR

system (Roche Diagnostics) was used. Reactions included 150ng template

DNA, 30pmol of each specific primer and/or 150-300ng of megaprimer/s,

50mM Tris-HCl pH 9.2, 16mM (NH4)2SO4, 2.25mM MgCl2, 2% (v/v) DMSO,

1% (v/v) Tween-20, 500μM each of dATP, dCTP, dGTP, dTTP (sodium salts)

and 2.6U ExpandTM enzyme mix in a final volume of 50μL. Amplification was

carried out in thin-walled reaction tubes (Quantum Scientific) using a Hybaid

Omnigene DNA Thermal Cycler with heated lid function. Unless otherwise

specified, cycling conditions consisted of an initial denaturation step of 2 min

at 940C, followed by 10 cycles of denaturing at 940C for 30 sec, annealing at

620C for 30 sec and extending at 680C for 4 min. This was followed by 20

cycles of denaturing at 940C for 30 sec, annealing at 620C for 30 sec and

extending at 680C for 4 min with a cycle elongation of 20 sec for each cycle

and a final elongation of 4 min at 680C.

2.3.3.3 Overlapping extension long distance PCR (OE-LD-PCR)

ExpandTM Long Template PCR system (Roche Diagnostics) was used for

OE-LD-PCR to generate large PCR products from two separate

products/clones. Approximately 100ng each of gel purified (section 2.4.7)

PCR product and plasmid (section 2.4.2) were amplified in an OE-PCR

reaction mix containing ~200ng each of 3’ and 5’ megaprimers in a long

distance PCR reaction (section 2.3.3.2). PCR was optimised for each newly

purified batch of PCR product or megaprimers Thermal cycling consisted of

an initial denaturation step of 2 min at 940C, followed by 35 cycles of

denaturing at 940C for 1 min, annealing at 50-620C for 1 min and extending

at 720C for 7.5 min. This was followed by a final elongation step at 680C for

36

10 min. Annealing temperature often had to be varied for different batches of

ExpandTM enzyme to maximise yield.

2.4 GENERAL METHODS FOR NUCLEIC ACID ANALYSIS

2.4.1 Small-scale preparation of plasmid DNA using alkaline lysis

Overnight bacterial cultures (5mL) grown in LB containing ampicillin

(100μg/mL) were centrifuged at 3000×g for 5 min at room temperature. The

pellet was resuspended in 100μL GTE buffer (50mM glucose, 25mM Tris-

HCl pH 8.0, 10mM EDTA) and transferred to 1.5 mL microfuge tubes. The

cells were lysed by the addition of 200μL 0.2M NaOH/1% SDS and mixed by

inversion. Chromosomal DNA and proteins were precipitated with 150μL 3M

potassium acetate pH 4.7 and 150μL chloroform and separated by

centrifuging for 5 min at 12,000g at room temperature. The supernatant was

collected and precipitated with 1 mL of 100% ethanol and centrifuged for 5

min at 12,000×g at room temperature. The pellet was washed in 70% ethanol

and dried in vacuo. Pellets were resuspended in 50μL sterile H2O containing

20μg/mL RNase.

2.4.2 Large-scale plasmid preparation

QIAGENR Plasmid Maxi Kit was used for large-scale plasmid purification

from 250mL (high copy number plasmids) or 1-1.5L (low copy number

plasmids) as per the manufacturers’ instructions.

2.4.3 Spectrophotometric determination of nucleic acid concentration

The concentration of plasmid DNA and oligonucleotide primers was

determined by measurement of the absorbance at 260 nm (A260) of 50-100μL

of the nucleic acid in a Beckman DU-68 spectrophotometer. Concentration

was calculated assuming A260= 1 for a 50μg/mL solution of DNA and a

20μg/mL solution of oligonucleotide DNA.

37

2.4.4 Restriction enzyme analysis

Plamid DNA or PCR products were digested with restriction enzymes as per

the manufacturer’s protocol using 1-5U enzyme/μg DNA at 370C unless

otherwise stated.

2.4.5 Agarose gel electrophoresis

Unless stated otherwise, gels were prepared as 1% agarose in either TBE or

TAE buffer containing 1μg/mL ethidium bromide. Gels were electrophoresed

at 80-100V for 1-1.5 h and visualised under UV light. Gels were

photographed onto Mitsubishi high-density thermal paper using a Sony

Syngene digital graphic printer.

2.4.6 DNA sequencing

Plasmid templates for sequencing were prepared by alkaline lysis as

described in section 2.4.1 or large-scale plasmid preparation as described in

section 2.4.2. Sequencing reactions were undertaken using the Applied

Biosystems Big Dye Terminator kit as recommended by the manufacturer

and samples analysed at Australian Genome Research Facility (AGRF),

University of Queensland.

2.4.7 Gel purification of DNA

Gel purified PCR products were obtained from agarose gel using QIAGEN

QIAquickTM Gel extraction kit as recommended by the manufacturer.

38

2.5 GENERAL METHODS IN CLONING

2.5.1 Ligation of PCR products into T-tailed vectors

For cloning, 10-100ng of PCR product with ‘A overhangs’, generated by Taq

DNA polymerase (Perkin Elmer), was ligated into 50ng commercially

prepared T-tailed vector, pGEM-T or pGEM-T easy (Promega), using T4

DNA ligase (Promega) overnight at 40C as recommended by the supplier.

Ligations were heat-inactivated at 650C for 10 min before transformation into

Escherichia coli (E.coli) (section 2.5.3).

2.5.2 Ligation of blunt/sticky end fragments into vectors

For general cloning and subcloning of blunt or sticky end DNA fragments,

DNA fragments was ligated directly or after gel purification with appropriate

vector DNA in a reaction containing 30 mM Tris-Hcl pH 7.5, 10 mM MgCl2,

10 mM DTT and 1 mM ATP and 1U of T4 DNA ligase (Roche Diagnostics) in

a final volume of 10µL at 40C overnight (unless otherwise stated).

2.5.3 Transformation of E.coli

Chemically competent JM83 (supplied by James Miller, QUT), JM109

(Promega) or NM522 (New England Biolabs) were transformed with 50ng-

100ng of ligated plasmid according to the manufacturer’s instructions.

Transformed cells were plated onto LB agar medium containing 100μg/mL

ampicillin, 50μg/mL X-Gal and 1mM IPTG. Plates were incubated at 370C

overnight.

39

CHAPTER 3 GENERATION OF INFECTIOUS CLONES OF PRSV-W AND PRSV-P

3.1 INTRODUCTION

Identification of genome organisation, gene function, replication strategies

and host range determinants of viruses with RNA genomes has been greatly

facilitated by the development of infectious cDNA transcripts (Boyer and

Haenni, 1994). This approach has been particularly useful for the study of

plant viruses (Sanchez et al., 1998; Olsen and Johansen, 2001; Domier et

al., 1989; Riechmann et al., 1990).

Infectious transcripts have been generated using two approaches - in vitro or

in vivo infectious transcripts. The first involves transcription of viral RNA from

a cDNA clone under the control of a bacteriophage T7 or lambda RNA

polymerase promoter and capping of the 5’ terminus in vitro before

inoculation onto the host plant (Weber et al., 1992; Boyer et al., 1993; Viry et

al., 1993; Brugidou et al., 1995; Domier et al., 1989; Riechmann et al., 1990;

Gal-On et al., 1991; Dolja et al., 1992; Flasinski et al., 1996; Puurand et al.,

1996; Jakab et al., 1997). However, infectious transcripts produced in this

way had relatively low infectivity rates. The second more efficient strategy

involves the use of the CaMV 35S plant promoter and terminator sequences

which are respectively incorporated at the 5’ and 3’ terminus of the viral

cDNA to produce in vivo transcripts (Domier et al., 1989; Mori et al., 1991;

Maiss et al., 1992; Gal-On et al., 1995; Fakhfakh et al., 1996; Johansen,

1996; Jakab et al., 1997; Takahashi et al., 1997; Yang et al., 1998b). The

cDNA construct is then inoculated directly onto the plant where the viral RNA

transcripts are synthesized under the control of CaMV 35S promoter.

Infectious RNA transcripts and/or infectious cDNA clones of a range of

different potyviruses have been described including Peanut stripe virus

(PStV) (Flasinski et al., 1996), PVA (Puurand et al., 1996), TEV (Dolja et al.,

1992), TVMV (Domier et al., 1989; Nicolas et al., 1996), ZYMV (Gal-On et

al., 1991; 1995), PPV (Riechmann et al., 1990; Maiss et al., 1992; Lopez-

40

Moya and Garcia, 2000), PSbMV (Johansen, 1996; Olsen and Johansen,

2001), LMV-E (Yang et al., 1998b), Clover yellow vein virus (CIYVV)

(Takahashi et al., 1997), PVY (Jakab et al., 1997) and TuMV (Sanchez et al.,

1998). A cell-free infectious clone of PVY has also been reported (Fakhfakh

et al., 1996; Jakab et al., 1997).

Generation of full-length potyviral clones has proven difficult in a number of

cases due to instability and/or toxicity of some virus sequences in bacteria

(Maiss et al., 1992; Jakab et al., 1997). Alternative methods have been

described to overcome these toxicity-associated problems. These

approaches have included cloning the genome as separate fragments that

are ligated immediately before inoculation (Jakab et al., 1997), use of low

copy number vectors (Payne et al., 1994; Dersch et al., 1994; Gritsun and

Gould, 1998), reduced temperatures (Gritsun and Gould, 1998) and

introduction of introns into the full-length clones (Johansen, 1996; Lopez-

Moya et al., 2000). A special cell-free method was used to generate a

complete infectious cDNA of PVY (Fakhfakh et al., 1996) in which full-length

PCR products of the virus were reverse transcribed and amplified using two

double-stranded megaprimers. The 5’ megaprimer included a CaMV 35S

promoter and the first 665 bases of PVY while the 3’ megaprimer included a

nos terminator, a 100 bp poly (A) region and 19 bases of the PVY 3’UTR.

The final PCR product was bombarded with a helium particle gun into

detached tobacco leaves. After 3-10 days these were used to inoculate

tobacco plants, which led to efficient PVY infection.

Infectious transcripts of two PRSV-P isolates have previously been reported.

In vivo and in vitro clones of a Hawaiian isolate of PRSV-P (HA) and in vitro

transcripts of a Taiwanese isolate of PRSV-P (YK) were generated (Chiang

and Yeh, 1997).

Previously in this laboratory, Henderson (1999) demonstrated infectivity of

full-length infectious PCR products of PRSV-W amplified using megaprimers

from purified viral RNA. The efficiency of amplification of the 11 kb PCR

product was very low and only preliminary results were reported. This

41

chapter describes subsequent strategies used to generate in vivo infectious

transcripts of Australian PRSV-W and PRSV-P isolates.

3.2 METHODS AND MATERIALS

3.2.1 Oligonucleotide primers The sequences of the oligonucleotide primers used to generate and

characterise PRSV-W and PRSV-P infectious clones are given below.

Primers were designed based on previous sequence information for

Australian (Henderson, 1999; Bateson, 1995; Bateson et al., 1994) and

Hawaiian (Gene Bank accession No X67673) (Yeh et al., 1992) PRSV

isolates.

CaMV-5’ 5’TGAGACTTTTCAACAAAGGGTAAT3’

PRSV.P1.SEQ 5’AACCTCCTATCGTACTGAGCTGCTG3’

3’UTR 5’ATACTCGCACTTGTGTGTTTGTCGGG3’

Universal Forward 5’GTAAAACGACGGCCAGT3’

MB104 5’CATACCNAGGAGAGAGTGCAT3’

NIa-1 5’CAATCTCTTGGTGCTGTAAGAGC3’

NIa-2 5’GCTGGAAGCGGAGCTTACACC3’

P3S 5’GGAGAGTTTGATCCAACTACAAACTGC3’

Pisces 5AACCAATTGCGGCTAGTGAG3

Taurus 5AGCTGCTCACATCTTGTCGT3

MB-11 5GGATCCATGTCCAAAAATGAAGCTGTGGATGCT3

MB-12A 5GGATCCGCCCGACAAACACACAAGTGCG3

P3cons 5’CCAGGATTGTTCTAGCAAGCG3’

P1.Int-F 5’GGAAGGTAACAGGTAAGTTTCTGC3’

P1.Int-R 5’GCAGAAACTTACCTGTTACCTTCC3’

Int.P1-F 5’GTTGATGTGCAGGTTTGTCCGTGC3’

Int.P1-R 5’GCACGGACAAACCTGCACATCAAC3’

George 5’GAGACTTTTCAACAAAGGGTAAT3’

George-MluI 5’ACGCGTGAGACTTTTCAACAAAGGGTAAT3’

42

3.2.2 Amplification of 5’ and 3’ Megaprimers Megaprimers, comprising the CaMV 35S transcription signal sequences

(promoter and terminator) and regions overlapping the 5’ and 3’ termini of

PRSV-W, were used to facilitate incorporation of these control signals into

PCR products.

The 479bp 5’megaprimer including the 3’ proximal 343bp of the CaMV 35S

promoter, the 86bp 5’UTR and 50 bp of the P1 gene of PRSV-W, was

amplified from 10ng of plasmid template, pP1CONS.1 (Fig.3.1A) (kindly

supplied by Juliane Henderson, QUT), using 30pmol each of primers CaMV-

5’ and PRSV.P1.SEQ and 2.5U Pwo DNA polymerase (Roche Diagnostics)

as described in section 2.3.3.1. Similarly, the 525bp 3’ megaprimer, which

included the 206bp 3’UTR of PRSV-W, a poly (A) tail of 33 nucleotides and

the 90bp CaMV 35S terminator sequence, was amplified from 100ng of

plasmid template, pCOL123 (Fig.3.1B) using 30pmol each of the 3’UTR and

Universal Forward primers. Gel purified PCR products (section 2.4.7) were

used directly for LD-PCR or cDNA synthesis.

3.2.3 Cloning of full-length PRSV-P and -W genomes in 3 overlapping clones

3.2.3.1 Preparation of PRSV RNA

Genomic RNA was extracted from 0.5-2mg cesium sulfate purified PRSV-W

(kindly supplied by Rod Pudwell, QUT), by incubating with 50 μg/ml

proteinase K and 0.1% SDS at 370C for 30 min. The solution was extracted

once each with phenol and phenol: chloroform (1:1) and the RNA ethanol

precipitated. RNA was resuspended in 50µL of DEPC-H2O. Crude RNA was

extracted from PRSV-P infected papaw tissue as described in section 2.3.1.

43

Figure 3.1 Strategy for the amplification of (A) 5’megaprimer (479bp) using

primers CaMV-5’ and PRSV.P1.SEQ from the plasmid pP1CONS.1 and (B)

3’megaprimer (525bp) using primers 3’UTR and the Universal Forward

primer from the plasmid pCOL123 ( From Henderson, 1999).

44

3.2.3.2 First-strand cDNA synthesis

First-strand cDNA’s were synthesised from PRSV-W genomic RNA and

crude PRSV-P RNA using either the 3’ megaprimer or a specific primer,

P3cons, with the Expand TM Reverse Transcriptase system (Boehringer

Mannheim) as described in section 2.3.2 (Fig.3.2A).

3.2.3.3 PCR amplification of the PRSV genomes in three overlapping fragments

Overlapping LD-PCR products representing the PRSV-W or -P genome were

amplified from 1-5μL of first-strand cDNA with primer pairs as shown in

Figure 3.2B. Megaprimers, which are based on PRSV-W sequence, were

used for generation of both -P and -W clones as previous data (Bateson,

1995; Henderson, 1999) indicated that the 3’ and 5’ UTR’s and the start of

the P1 of Australian isolates are identical. LD-PCR products were generated

using the Expand TM Long Template PCR system (Roche Diagnostics)

(section 2.3.3.2), but with a final elongation step of 5 min at 680C. Products

were analysed by eletrophoresis in 0.8% TAE agarose gels containing

1μg/mL ethidium bromide.

3.2.3.4 Cloning of PRSV-W and PRSV-P overlapping fragments

Before cloning, PCR products were A-tailed by the addition of 100nmoles

dATP and 2.5U Taq polymerase (Perkin Elmer) to each 50μl reaction tube

and incubating at 720C for 15 min. The gel purified PCR products (section

2.4.7) were ligated into pGEM-T as described in section 2.5.1 and

transformed into competent E. coli JM109 cells (section 2.5.3). The resulting

plasmids were checked for orientation of the insert by digestion with

restriction enzymes MluI or NsiI (section 2.4.4). Selected plasmids were

called p3’Triplet-W, p3’Triplet-P, pMiddle Triplet-W, pMiddle Triplet-P,

p5’Triple-W, p5’Triplet-P (Fig.3.2B).

45

Figure 3.2 (A) Strategy for synthesis of PRSV cDNA using 3’ megaprimer

and P3cons. (B) Strategy for amplification and cloning of the full PRSV-W

genome as three overlapping fragments. Primer pairs used for PCR

amplification of the fragments are shown. Arrows indicate direction of DNA

synthesis.

46

VPg NIa NIb

NIaI

CP

3’UTR

33 35S A T

3’megaprimer

P3 CI VPg NIa

P3S NIa-2

P1 HC-Pro P3 35S

5’megaprimer P3cons

B.

6705 bp

6K

6K

5'UTR

35S 5’UTR

P1

HC

P3

p5’Triplet-W

pMiddle Triplet-W7544 bp

P3

CI

NIa

6K

7691 bp

NIa

NIb

CP

3’UTR 33A

35ST

Ligate into pGEM-T

p3’Triplet-W

VPg --- P1 HC-Pro

P3

6K

CI NIa NIb CP ---Poly-A

P3cons

3’megaprimer cDNA 33 35S

A T

3’UTR

cDNA

A. 3'UTR 5'UT

R

PCR

1st strand cDNA

NsiI

NsiI

NsiI

NsiI MluI

MluI

MluI

Ligate into pGEM-T

Ligate into pGEM-T

47

3.2.5 Generation of a full-length PRSV-W clone

3.2.5.1 Insertion of MluI site in p5’Triplet-W The insert from p5’Triplet-W was amplified with primers P3cons and George-

Mlu, which contained an additional MluI site in the George primer sequence,

using ExpandTM Long Template PCR system (section 2.3.3.2). The A-tailed

(section 2.5.1) and gel purified (section 2.4.7) product was ligated into

pGEM-T Easy (section 2.5.1) and transformed into competent E.coli JM109

cells (section 2.5.3). Inserts in the resulting plasmids were fully sequenced.

The selected plasmid was named p5’Triplet-W*.

3.2.5.2 Generation of pTwin-W A partial insert from the clone pMiddle Triplet-W was excised using NsiI

(section 2.4.4) and gel purified (section 2.4.7). The insert was ligated to 50ng

of gel purified NsiI vector fragment from p3’Triplet-W using a vector:insert

ratio of 1:2 as described in section 2.5.2. The DNA was transformed into

competent E. coli JM109 cells (section 2.5.3) (Fig.3.3). Plasmids were

screened by restriction analysis with NsiI to confirm the presence of the

inserted fragment and sequenced across the NsiI site to confirm the correct

orientation of the insert. Plasmid pTwin-W was selected and maxipreped

(section 2.4.2). Plasmid pTwin-P was subsequently generated in the same

way for later applications.

3.2.5.2 Subcloning to generate a full-length clone The insert from clone p5’Triplet-W* was excised using MluI, gel purified

(section 2.4.7) and ligated to 50ng of gel purified MluI vector fragment from

pTwin-W using a vector:insert ratio of 1:5 (section 2.5.2). The DNA was

transformed into competent E. coli JM109 and JM83 (section 2.5.3). Purified

plasmids were screened by restriction analysis with MluI to confirm the

presence of the insert and sequenced across junctions to determine the

correct orientation of the insert (Fig.3.4).

48

Figure 3.3 Strategy for the generation of pTwin-W from plasmids p3’Triplet-W

and pMiddle Triplet-W

pTwin-W10300 bp

7691 bp

NIa

NIb

CP

3’UTR 33A

35ST

p3’Triplet-W pMiddleTriplet -W 7544 bp

P3

CI

NIa 6K

VPg

VPg

NsiI NsiI

NsiI

NsiI

NsiI digest

NsiI digest

P3

CI

6K

NIa

NIb

CP

3’UTR

33A 35ST

VPg

NsiI

NsiI

49

Figure 3.4 Strategy for the generation of a full-length clone of PRSV-W from

plasmids p5’Triplet-W* and pTwin-W.

pTwin-W 10300 bp

p5’Triplet-W* 6705 bp

35S

5’UTR

P1

HC P3

P3

35ST 33 A

3’UTR

CP

NIb

NIa

6K

CI

MluI

MluI

MluI MluI

Full length clone13996bp

NIb NIa VPg

6K

CI

P3

HC

P1

35S

CP

3’UTR 33 A

35S T

MluI

MluI

MluI digest

MluI digest

5’UTR

50

3.2.6 Generation of an intron-containing infectious clone of PRSV-W

3.2.6.1 Insertion of an intron into the P1-coding region of p5’Triplet-W

The St-LS1 IV2 intron (Hanson et al., 1999) was inserted into position 217 of

the P1 coding region of p5’Triplet-W in two steps using Overlapping-

Extension PCR (OE-PCR). Firstly, the intron sequence was fused to the 5’

section of the P1 coding region (Figure 3.5A). A fragment, incorporating the

CaMV 35S promoter, 5’UTR, 217bp of P1 gene and 12bp of intron

sequence, was amplified with Pwo from p5’Triplet-W using primers George

and P1.Int-R (section 2.3.3.1), while a second fragment, comprising a 200bp

intron flanked by 12bp of P1 gene, coding region was amplified using primers

P1.Int-F and Int.P1-R from a clone kindly supplied by N. Gutterson, DNA

Plant Technologies, Oakland (section 2.3.3.1). The gel purified PCR

fragments (approximately 20ng each) were joined by amplification in OE-

PCR in a reaction mix containing Pwo DNA polymerase (Roche Diagnostics)

as described in section 2.3.3.1. To incorporate the remaining P1 coding

region, a PCR fragment, consisting of 12bp of intron sequence, 1425bp,

1370bp and 265bp of P1, HC-Pro and P3 coding regions, respectively, was

amplified from 5’Triplet-W using primers Int.P1-F and P3cons (section

2.3.3.1) (Fig. 3.5B). This fragment was fused to the intron-containing OE-

PCR product by another round of OE-PCR (Figure 3.5B) using approximately

50ng of each gel purified PCR fragments using ExpandTM Long Template

PCR system (Roche Diagnostics) as described in section 2.3.3.2. Thermal

cycling conditions consisted of an initial denaturation step of 2 min at 940C,

followed by 35 cycles of denaturing at 940C for 1 min, annealing at 600C for 1

min and extending at 720C for 4 min with final elongation of 4 min at 720C.

The OE-PCR product was gel purified (section 2.4.7) and ligated into pGEM-

T (section 2.5.1) and transformed into competent E. coli JM109 cells (section

2.5.3). Clones were initially characterised by PCR amplification of the full-

length insert and intron with specific primers to confirm the presence of

correct sequence. A clone, p5’Int.Triplet-W, was fully sequenced.

51

35S 5’

P

HC P3

7691 bp

p5’Triplet-W pSt-Ls1 IV2 3400 bp

George

P1.Int-R

35S 5’UT P1 Intron

35S 5’UTR P1

12

Intron

P1.Int-F

85

PCR (657 bp) PCR (224 bp)

217

35S 5’UT P1 Intron

12

P1 P1 Intron

12 12 200

85 217

George

Int.P1-R

Int.P1-R

P1

P1 P1 Intron

12 12 200

343

343

343 85 217 200 12

OE-PCR

A

Intron

52

Figure 3.5 (A) Strategy for insertion of an intron into the P1 coding region;

(B) Strategy for construction of p5’Int.Triplet-W.

35S 5’UTR P1 P1 Intron

343

85 217 200 12

35S 5’UTR

P1

HC P3

7691 bp

p5’Triplet-W

P3cons

Int.P1-F

12

PCR

P1 HC Int

265

P3

1425 1370

George

P3cons

OE-PCR

35S 5’UTR P1

Intron

343 85 217 200

P1 HC

265

P3

1425 1370

6905 bp

35S

5’UTR

P1 Intron

P1

HC P3

p5’Int.Triplet-W

Ligation into pGEM-T

B

53

3.2.6.2 Construction of an intron-containing full-length PRSV-W Plasmids p5’Int.Triplet-W and pTwin-W were digested with MluI. Gel purified

pTwin-W vector fragment was ligated to the insert fragment from

p5’Int.Triplet-W (Fig. 3.6) in vector:insert ratios of both 1:1 and 1:3 (section

2.5.2). The ligated plasmids were transformed into competent E. coli strains

JM109 and JM83 as described in section 2.5.3. The orientation of the inserts

in the clones was determined by digestion with NsiI and sequencing across

the junctions.

3.2.7 Generation of a full-length PRSV-W in a low copy number vector

The insert from p5’Triplet-W was amplified with primers George and P3cons

using the ExpandTM Long Template PCR system (section 2.3.3.2) and gel

purified (section 2.4.7) (Figure 3.7A). Blunt ends were ensured by incubation

of 1μg of DNA with 2.5U Pwo polymerase (Roche Diagnostics) in Pwo buffer

(10mM Tris-HCl pH 8.85, 50 mM KCl, 5mM (NH4)2SO4, 2mM MgSO4) in a

final reaction volume of 20μL for 30 min at 700C. The reaction was

inactivated by addition of 1μL of 0.5M EDTA. The resultant blunt-ended PCR

product was ligated into 50ng of SmaI digested pACYC177 (New England

Bio Labs) using vector:insert ratios of 1:2 and 1:4 (section 2.5.2.) The

reaction was incubated at 160C overnight and the DNA transformed into

competent E. coli NM52 or JM109 cells (section 2.5.3). Plasmids were

screened by restriction analysis with MluI and BamHI to confirm the

presence and size of the inserted fragment. The entire insert was sequenced

to confirm the presence of correct sequence in the selected plasmids.

Plasmid p5’LC.Triplet-W was selected and maxipreped (section 2.4.2). To

incorporate the remainder of the virus genome into the low copy number

clone, pLC.5’Triplet-W was digested with BamHI (Fig. 3.7B) and blunt ends

generated by filling the 5’ overhang with T4 DNA polymerase (Roche

Diagnostics) in a reaction containing 1X T4 polymerase buffer (Roche

54

Figure 3.6 Strategy for generation of full-length intron containing PRSV-W

clone from plasmids p5’.Int.Triplet-W and pTwin-W.

6905 bp

35S 5’UTR

P1 Intron

P1

HC P3

p5’Int.Triplet-W pTwin-W 10300 bp

P3

CI

6K

NIa

NIb

VPg

CP

3’UTR 33A

35S T

14196 bp

35S

5’UTR P1 Intron

P1

HC

P3

CI

NIa VPg 6K

NIb

CP

3’UTR 33 A

35S T

pFull.Int-W

MluI

MluI

MluI

MluI

MluI MluI

55

6705

35S5’UTR

P1

HC P3

p5’Triplet-P1 HC P3 35S

P3 cons

5'UTR

35S 5’UTR

P1

HC P3

pLC.5’Triplet-W

George

PCR

Ligate into SmaI digested pACYC177

A

pACYC177 3940bp

BamHI (3319)

SmaI (2225)

56

Figure 3.7 Strategy for generation of a full-length low copy number PRSV-W

clone. (A) Generation of pLC.5’Triplet-W. (B) Subcloning the insert of pTwin-

W into pLC.5’Triplet-W to generate full-length low copy number PRSV-W

clone (pFull.LC-W).

35S 5’UTR

P1

HC P3

pLC.5’Triplet-W

MluI

pFull.LC-W

NIb NIa VPg

6K

CI

P3

HC

P1

35S

CP

3’UTR 33 A 35S T

MluI

BamHI (Blunt ended)

pTwin-W10300 bp

P3

35ST 33 A 3’UTR

CP

NIb NIa

6K

CI

MluI

VPg

ApaI ( Blunt ended)

Blunt end

B

57

Diagnostics), 1mM DTT, 1mM rATP, 2mM each of dATP, dCTP, dGTP and

dTTP, 20 µg/mL BSA and 10U of enzyme in a final reaction volume of

100μL. The reaction mix was heated at 370C for 1 hour and then inactivated

by the addition of 1μL of 0.5M EDTA. Plasmid pTwin-W was digested with

ApaI (Fig. 3.6B) and blunt ends generated by removing the 3’ overhang with

Klenow enzyme (Roche Diagnostics) in a reaction containing 10mM Tris-HCl

pH 7.5, 5mM MgCl2, 7.5 mM DTT and 5U of enzyme per 1μg of DNA in a

final reaction volume of 50μL. The reaction was incubated for 15 min at 220C

and then heat inactivated at 750C for 20 min. The resulting blunt-ended

fragments were both digested with MluI and gel purified vector and insert

fragments ligated in 1:1 and 1:3 (vector: insert) ratios (section 2.5.2) (Fig.

3.7B). The ligated plasmids were transformed into competent E. coli NM522,

JM109 and JM83 cells (section 2.5.3). Clones were digested with MluI and

NsiI to confirm the orientation and presence of the insert.

3.2.8 Generation of full-length infectious PCR product of PRSV-W and PRSV-P

A 3.7kb PCR product was amplified from the appropriate 5’ clone, p5’Triplet-

W or p5’Triplet-P, using primers George and P3cons with Pwo polymerase

(Roche Diagnostics) (section 2.3.3.1) (Figure 3.8A). Thermal cycling

consisted of an initial denaturation cycle of 940C for 2 min followed by 35

cycles of denaturation at 940C for 30sec, annealing at 500C for 30sec and

extension for 4 min at 720C. This fragment and the corresponding clone

pTwin-W or P, which overlapped by a region of 265 nucleotides in the P3-

coding region, were amplified by OE-LD-PCR using the ExpandTM Long

Template PCR system to give a full-length PRSV-W or PRSV-P PCR product

(Figure 3.8B). Approximately 100-250ng each of gel purified (section 2.4.7)

PCR product and purified plasmid DNA (section 2.4.2) were amplified in an

OE-LD-PCR reaction containing ~200ng each of 3’ and 5’ megaprimers as

described in section 2.3.3.3. PCR products were analysed by electrophoresis

on 0.8% TBE agarose gels containing 1μg/mL ethidium bromide. Gel purified

PCR product was characterised by restriction enzyme analysis and PCR

58

Figure 3.8 Strategy for generation of a full-length PCR product of PRSV-W

by OE-LD-PCR

PCR

P1 HC 35S 5'UTR

P3 CI VPg NIa NIb CP

3’UTR

OE-PCR

pTwin-W10300 bp

P3

35ST 33 A

3’UTR

CP

NIb NIa

6K

CI

VPg

P1 HC P3 35S

5'UTR

5’megaprimer

3’megaprimer

265bp

6705 bp

35S 5’UTR

P1

HC P3

p5’Triplet-W

P3cons

George A

B

33A 35S T

59

amplification of the P1-coding region with primers Pisces and Taurus, the

NIa coding region with primers NIa-1 and NIa-2, and the CP coding region

with primers MB-11 and MB-12A using PCR product as a template.

3.2.9 Infectivity of full-length PRSV-P and PRSV- W PCR products Microprojectile bombardment of detached squash cotyledons was used to

establish initial infection with full-length PCR products essentially as

described by Henderson (1999).

3.2.9.1 Preparation of PCR products for bombardment PCR products for bombardment were gel purified (section 2.4.7) and the

concentration estimated on a 0.8% TBE agarose gel, aliquoted to give

4μg/tube and then ethanol precipitated using sterile reagents. The dried

pellets were stored at –200C.

3.2.9.2 Bombardment of squash cotyledons with full-length PCR products

Fourteen-day-old in vitro grown squash cotyledons were excised and placed

onto 2% water agar (2 cotyledons per plate). Detached cotyledons were

bombarded as described by Henderson (1999) to deliver a total of 1μg DNA

to each cotyledon. Cotyledons were cultured at 25oC in the light (16hr

photoperiod). The efficiency of the microprojectile bombardment procedure

was initially assessed by GUS expression in a cotyledon shot with control

plasmid, p2K7 (kindly supplied by Rosemarie Lines, QUT), incorporating

both the uidA reporter gene, coding for ß-glucuronidase (GUS), and the

aphA selectable marker gene, coding for neomycin phosphotransferase II,

under the control of the CaMV 35S promoter (Lines., 2002).

60

3.2.9.3 Detection of PRSV infection and mechanical inoculation of squash seedlings

At 10 days post-bombardment, each cotyledon was cut into two halves. One

half of each of the 2 cotyledons for each shot were combined and used to

assay for virus infection in the cotyledons using ELISA (section 2.2.3) and

the other half of each were pooled and used to mechanically inoculate 4

squash seedlings (Henderson, 1999). Extraction buffer only, unshot

cotyledon, healthy squash leaf tissue and PRSV infected squash leaf tissue

controls were included in ELISA tests.

3.2.9.4 Detection of PRSV infection in inoculated squash and papaya plants

PRSV infection in squash plants inoculated from bombarded cotyledons was

assayed using ELISA and RT-PCR to detect viral CP and RNA, respectively.

Leaf tissue (a total of 50mg) was collected and pooled from the two plants

inoculated from each of the shot cotyledons and tested by ELISA (section

2.2.2). Extraction buffer only, healthy squash and PRSV infected squash

controls were also included. Sap from ELISA positive squash plants (pooled

equivalent amounts of tissue from each of the 4 plants representing each

shot) was used to mechanically inoculate 2 papaya plantlets. Plants were

inoculated 3 times at weekly intervals. Inoculated papaya plants were tested

by ELISA (section 2.2.2) and observed for symptoms.

For RT-PCR, crude RNA was extracted from newest leaves (section 2.3.1)

and used for first-strand cDNA synthesis (section 2.3.2) using primer MB-

12A. First- strand cDNA was used as template for amplification of a 900bp

fragment of the CP gene using primers MB-12A and MB-11 (section 2.3.3.1).

61

3.3 RESULTS

The initial and most obvious approach to generating infectious clones of

PRSV-W and PRSV-P was to piece together the genomes from cloned

fragments. Previous work within the laboratory provided a number of tools for

amplification of the genome and incorporation of promoter and terminators

including megaprimers and PCR primers (Henderson, 1999) and preliminary

sequence data for P1 and CP (Henderson, 1999; Bateson, 1995). From this

and previous sequence information for PRSV isolates from Hawaii, a

strategy was designed to clone the PRSV genomes as three overlapping

fragments that could be joined at unique restriction enzyme sites.

3.3.1 Cloning of PRSV-P and PRSV-W genomes in three overlapping clones

Using LD-PCR, three overlapping fragments were generated for both PRSV-

P and PRSV-W. Using the 5’megaprimer and P3cons, a 3705bp fragment

was amplified, which included the CaMV 35S promoter, 5UTR, P1, HC-Pro

and 265bp of P3 sequence (5’ fragment) (Fig. 3.9A). With specific primers

P3S and NIa-2, a 4600bp fragment, including the full P3, CI, 6K, and NIa

(VPg and protease) coding regions was amplified (middle fragment) (Fig.

3.9B). The third fragment of 4398bp, representing the 3’ one-third of the

genome and including 6K, NIa, NIb and CP coding regions as well as the

3UTR, poly(A)33 and the CaMV 35S terminator sequence was amplified with

NIa-1 and the 3’megaprimer (3’ fragment) (Fig. 3.9C).

The fragments for both viruses were cloned into pGEM-T. For further

subcloning, it was essential to have clones in a particular orientation with

respect to restriction enzyme sites in the vector multiple cloning site (MCS).

The size and orientation of the inserts within the plasmids were characterised

by restriction enzyme analysis. Three 5’ fragment clones, five middle

fragment clones and three 3’ fragment clones appeared to have inserts of the

expected size when digested with ApaI. All 5’ and 3’ fragment clones were in

one orientation while middle clones were obtained in both orientations based

62

Figure 3.9 Three overlapping PCR products representing PRSV-W (A)

Lane 1: 3705bp fragment representing 5’ third of genome (B) Lane 1: 4600bp

fragment representing middle third of genome (C) Lane 1: 4398bp fragment

representing 3’ third of genome. M: Molecular weight marker X (Roche

Diagnostics).

C BA

M M M 1 1 1

2036bp

3054bp

2036bp

3054bp 3054bp

2036bp

5090bp 5090bp

5090bp

63

on MluI and NsiI digestion. One clone for each region and for each virus (P

or W), designated p5’Triplet-W or p5’Triplet-P, pMiddle Triplet-W or pMiddle

Triplet-P and p3’Triplet-W or p3’Triplet-P, was selected for generation of

infectious clones (Fig. 3.10A, C, D). The integrity of all virus sequences was

confirmed. These results are presented in chapter 4.

3.3.2 Generation of a full-length PRSV-W infectious clone

Initially, all work was carried out with PRSV-W to test the system. To

facilitate subcloning to make a full-length infectious clone, an MluI site was

required 5’ of the promoter, however all 5’ fragment clones were obtained in

the wrong orientation. Therefore the 5’ fragment was recloned (p5’Triplet-

W*), incorporating an MluI site immediately upstream of the CaMV35S

promoter (Fig 3.10B). Plasmid pTwin-W, incorporating the 3’ two-thirds of the

PRSV-W genome was generated by ligation of a 7222bp NsiI fragment

(including vector and partial insert) from p3’Triplet-W and a 3543bp NsiI

fragment (insert) from pMiddle Triplet-W. The plasmid, with correct insert

size and orientation was selected based on restriction analysis with NsiI

(Fig.3.11) and sequencing across the NsiI site in the NIa gene.

To generate a full-length clone of PRSV-W, a 10486bp MluI fragment

(including vector and insert) from pTwin-W was ligated to a 3606bp MluI

fragment (insert) from p5’Triplet. Only 2 clones of the expected size were

obtained as confirmed by digestion with MluI (Fig.3.12). Sequencing across

the MluI site in the P3 gene showed that in both clones the 5’ fragment had

inserted in the wrong orientation with respect to the remaining genome. This

cloning procedure was repeated several times, however, with the same

result. It was hypothesised that the correct full-length clone could be

expressing a toxic protein within the E.coli host. Subsequently, several

approaches were taken to overcome this.

64

Figure 3.10 Restriction analysis of clones p5’Triplet-W, pMiddleTriplet-W

and p3’Triplet-W. (A) p5’Triplet-W Lane1: Uncut; Lane 2: MluI digested (B)

p5’Triplet-W* Lane1: Uncut; Lane 2: MluI digested, (C) pMiddleTriplet-W

Lanes 1-5: Uncut, Lane 6-10: NsiI digest of plasmids from lanes 1-5; plasmid

in lanes 1 & 6 is incorrect size, plasmids in lanes 2-4 and 7-9 are in one

orientation, plasmid in lane 5 & 10 is in another orientation; (D) p3’Triplet-W

Lane1: uncut; Lane 2: NsiI digested. M: Molecular weight marker X (Roche

Diagnostics).

65

A B

C D

1 2 1 2

1 2 1 2 3 4 5 6 7 8 9 10

M M

M M

1018bp

1018bp

1018bp

3054bp

12216bp

3054bp

3054bp

12216bp

3054bp

1018bp

12216bp 12216bp

66

Figure 3.11 Restriction analysis of pTwin-W. Lane1: Uncut plasmid; Lane 2:

NsiI digested plasmid. M: Molecular weight marker X (Roche Diagnostics)

M 1 2

1018bp

3054bp

12216bp

67

Figure 3.12 Restriction analysis of putative full-length PRSV-W clone.

Lane1: Uncut clone; Lane 2: MluI digested clone. M: Molecular weight

marker X (Roche Diagnostics)

M 1 2

1018bp

3054bp

12216bp

68

3.3.3 Generation of an infectious PRSV-W containing a plant intron

In an attempt to overcome expression of toxic PRSV-W proteins in E.coli, a

plant intron was introduced into the PRSV-W P1-coding region. This would

not be processed in E.coli but should subsequently be spliced upon infection.

Plasmid p5’Int.Triplet-W, incorporating the St-LS1 IV2 intron (200bp) at

position 217 of the P1 coding region, was generated by OE-PCR. Initially, an

857bp fragment (Fig. 3.4A; Fig.3.13.C), consisting of the CaMV 35S

promoter, 5’UTR, PRSV-W P1 coding region (nts 1-217), 200bp intron and

P1 coding region (nts 218-229) was generated by OE-PCR of a 657bp PCR

fragment from p5’Triplet-W (Fig. 3.4A; Fig. 3.13A) and a 224bp PCR

fragment from pSt-LS1 IV2 (Fig. 3.4A; Fig.3.13B). A second fragment of

3072bp (Fig.3.4B; Fig.3.13D), consisting of 12bp of intron sequence, the 3’

1425bp of the P1 coding region and the 5’ 265bp of the P3 coding region,

was amplified from p5’Triplet-W. The two overlapping fragments (875 and

3072bp) were joined by OE-PCR to give a 3905bp fragment (Fig.3.13.E),

which was subsequently cloned. Plasmid p5’Int.Triplet-W (Fig. 3.4B) was

selected from the resulting 3 clones and the sequence confirmed.

Clones containing the full-length PRSV-W genome with an intron

incorporated into the P1-coding region were generated by ligation of a

10486bp MluI fragment (vector) from pW-Twin and 3806bp MluI fragment

(insert) from p5’Int.Triplet-W. Ligation in a ratio of 1:3 vector:insert did

generated some clones. However, the colonies were very small and cultures

inoculated from these colonies were very slow growing and only low

concentration of plasmids could be obtained. Sequence analysis across the

MluI cloning site in P3-coding region confirmed the integrity of and

orientation of the insert in these clones. Unfortunately, attempts to regrow or

scale up the volume of these clones, even at lower temperatures (28oC) was

unsuccessful and after large-scale purification, the concentration of the

plasmids were still very low (Fig. 3.14). Alternative E. coli strains including

JM109, JM83 or NM522 were also unsuccessful.

69

A B

657bp

224bp

M 1 M 1

517bp

1018bp 1018bp

517bp

220bp

1018bp

517bp

857bp

C

70

Figure 3.13 PCR products generated and used for construction of

p5’Int.Triplet-W. (A) Lane 1: 657bp fragment amplified from clone 5’Triplet-

W; (B) Lane 1: 224bp fragment amplified from pSt-Ls1 IV2; (C) Lane 1:

857bp product generated by OE-PCR of 224bp and 657bp products. (D)

Lane 1: 3072bp fragment amplified from clone 5’Triplet-W; (E) 3905bp

product generated by OE-PCR of 3072bp and 857bp products. M: Molecular

weight marker X (Roche Diagnostics).

D E

3072bp

3905bp

M 1

M 1

1018bp

3054bp

1018bp

3054bp 5090bp

5090bp

71

Figure 3.14 Purified intron-containing full-length PRSV-W, pFull.Int-W (Lane

1 and 2). M: Molecular weight marker X (Roche Diagnostics).

M 1 2

1018bp

3054bp

12216bp

72

3.3.4 Construction of full-length PRSV-W in low copy number vector

A second approach to overcoming toxicity in E. coli was to clone the full-

length clone in a low copy number vector to reduce the level of toxic protein

in the host.

The 3705bp insert of p5’Triplet-W was PCR amplified and subcloned into the

low copy number vector, pACYC177. Ligation using a vector:insert ratio of

1:4 resulted in many clones of the expected size, 7645bp. Clones were

digested with MluI and BamHI to confirm the orientation of the insert with

respect to the BamHI site. Clone p5’LC.Triplet-W (Fig.3.7B, Fig.3.15), which

had the P3 sequence adjacent to the BamHI site, was selected and the

integrity of the insert confirmed by sequencing.

The full PRSV-W clone in pACYC177 was subsequently generated by

ligation of the insert from pTwin-W into p5’LC.Triplet-W (Fig.3.7). Both the

7230bp pTwin-W fragment (Fig.3.16A) and the 6450bp p5’LC.Triplet-W

fragment (Fig.3.16B) were generated with one blunt end and one MluI

overhang (sticky end). Ligation of these fragments in 1:3 vector:insert ratio

gave a number of colonies after transformation. These colonies were very

small and initial cultures grew very slowly. Plasmids isolated from these

minipreps were in low concentration (Fig.3.17A) however, PCR amplification

from these clones confirmed that both the p5’LC.Triplet-W and pTwin-W

fragments were present (Fig.3.18). Attempts to regrow these cultures or to

scale-up, including the use of different E. coli strains were consistently

unsuccessful. Using alternative growth temperatures (28oC and 30oC),

different media (Teriffic broth) and chloramphenicol gave better yields in

initial cultures (Fig.3.17B) although this was still low. Each lane in Figure

3.17B represents one fifth of the yield from a 1 litre culture. As well,

restriction enzyme digestion of these plasmids gave only smears on agarose

gels (Fig.3.17C). Because of the difficulties encountered in cloning and/or

maintaining full-length infectious clones, an alternative approach was

eventually

73

Figure 3.15 Restriction analysis with MluI/ BamHI of plasmids resulting from

ligation of the insert of p5’Triplet-W into the low copy number vector

pACYC177. Lane 1-6: plasmids with incorrect insert size and orientation;

Lane 7: Plasmid with correct insert size and orientation (pLC.5’Triplet-W). M:

Molecular weight marker X (Roche Diagnostics).

M 1 2 3 4 5 6 7

517bp

1018bp

3054bp

74

Figure 3.16 Restriction digestion of clones pTwin-W and p5’LC.Triplet-W

during generation of low copy number full-length PRSV-W plasmid, pFull.LC-

W. (A) pTwin-W Lane1: Uncut plasmid; Lane 2: MluI/ApaI digested plasmid.

(B) p5’LC.Triplet-W Lane1: Uncut plasmid; Lane 2 MluI BamHI digested

p5’LC.Triplet-W. M: Molecular weight marker X (Roche Diagnostics).

A B

M 1 2 M 1 2

1018bp

3054bp

12216bp

12216bp

3054bp

1018bp

75

Figure 3.17 Purified low copy number full-length PRSV-W plasmid (pFull.LC-

W). Supercoiled plasmid is indicated by arrow. (A) Lane1: purified from

miniprep; (B) Lane 1: purified after culture in Terrific broth at 280C; Lane 2:

purified after culture in Terrific broth at 300C. (C) Lane1: plasmid following

digestion with MluI. No vector fragment could be observed. M: Molecular

weight marker X (Roche Diagnostics).

A B C

M 1 2 M 1 M 1

3054bp

12216bp 3054bp

3054bp

12216bp

12216bp

76

Figure 3.18 PCR analysis of full-length low copy number PRSV-W plasmid

(pFull.LC-W) showing the presence of P1 and NIa fragments. Lane1: NIa

positive control pTwin-W; Lane2: pFull.LC-W; Lane 3: P1 positive control

pLC.5’Triplet-W; Lane5: pFull.LC-W. M: Molecular weight marker X (Roche

Diagnostics).

M 1 2 3 4

NIa P1

2000bp

900bp

3054bp

1018bp

77

taken. This approach involved generating infectious PCR products using OE-

LD-PCR from two overlapping clones.

3.3.5 Generation of full-length infectious PCR products of PRSV by OE-LD-PCR

Full-length, infectious PRSV products incorporating the CaMV35S promoter

and terminator sequences was generated by OE-LD-PCR of a DNA fragment

representing the 5’ third of the PRSV genome and a plasmid clone

representing the 3’ two-thirds of the genome (Fig 3.8). To generate an

infectious PRSV-W (rPRSV-W), a fragment of 3705bp, consisting of the

CaMV 35S promoter, PRSV-W 5’UTR, P1, HC-Pro and partial P3 coding

regions was amplified from p5’Triplet-W. This fragment had an overlap of

265bp with the P3-coding region in pTwin-W. The fragment was fused to a

7322bp region from pW-Twin by long distance OE-PCR amplification to give

a product of 11027bp (Fig 3.19) incorporating the complete PRSV-W

genome with a short poly (A) tail of 33 nucleotides, flanked by the CaMV35S

promoter and terminator sequences. This product could be consistently

amplified from overlapping clones, although some variation in yield was

found with different batches of Expand enzyme. A low molecular weight band

(~8 kb) of unknown origin was also consistently observed following

amplification (Fig. 3.19). This band was usually in much lower concentration

than the full-length fragment. A similar strategy was also used to generate

full-length infectious PCR product of PRSV-P (rPRSV-P).

3.3.6 Infectivity of full-length PCR products of PRSV-P and PRSV-W

To enable the cloned PRSV genomes to infect plant cells, the DNA must be

delivered to the nucleus for initial transcription from the CaMV 35S promoter.

To maximise this step, the PCR fragments of both rPRSV-P and rPRSV-W

were bombarded into squash cotyledons in vitro to establish infection and

subsequently inoculated onto squash plants in vivo.

78

Figure 3.19 OE-LD-PCR product of full-length PRSV-W (Lane 1).

M: Molecular weight marker X (Roche Diagnostics).

M 1

wells

PCR product (11027bp)

12216bp

3054bp

79

To ensure the bombardment procedure was efficient, cotyledons were

initially bombarded with a control plasmid containing the GUS gene. This

procedure was shown to be relatively efficient with >500 blue foci per cm2.

Infection of rPRSV-W and rPRSV-P was assayed in bombarded squash

cotyledons by ELISA prior to inoculation onto seedlings (Tables 3.1 and.3.2).

One hundred percent of cotyledons bombarded with rPRSV-W (Table 3.1)

and 86.6% of those bombarded with rPRSV-P (Table 3.2) gave ELISA

values > 1.3 which is more than 10 times that observed for the negative

controls. The remaining rPRSV-P inoculated cotyledons gave significantly

lower ELISA values although they were still at least 3 fold above background.

All bombarded cotyledons were inoculated onto squash plants and assayed

15 days later to determine if they were systemically infected with PRSV.

rPRSV-W was successfully transmitted to squash plants from 13 of the 15

positive cotyledons (86.6%) as indicated by high ELISA values in 51/60

squash plants (Table 3.1). Corresponding PRSV symptoms, including severe

mottling, distortion and blistering of leaves, were observed in all ELISA

positive squash plants (Fig.3.20). rPRSV-P was transmitted to squash plants

from all 13 cotyledons that had high ELISA (Table 3.2). The 2 cotyledon

samples with low ELISA values did not establish infections when inoculated

onto squash plants. Typical potyvirus-like particles were observed by

electron microscopy of negatively stained squash tissue infected with both

rPRSV-W and rPRSV-P (Fig. 3.21).

Sap from squash infected with rPRSV-P and rPRSV-W was inoculated onto

papaya to confirm the host range integrity of clones. As expected, none of

the papaya plants inoculated from squash infected with rPRSV-W were

positive in ELISA at 28 dpi and no symptoms were detected up to 45 dpi.

However, a total of 24/26 (92%) papaya plants inoculated from squash

infected with rPRSV-P had high ELISA values at 28dpi (Table 3.2). By 45dpi,

25/26 plants showed symptoms of PRSV-P infection. ELISA results from

positive squash and papaya were confirmed by RT-PCR amplification of

80

~900bp fragments of the P1 and CP- coding regions and 2000bp fragments

of the NIa-coding region of PRSV (Fig 3.22). Table 3.1 Summary of infectivity assays (ELISA and symptoms) on plants

inoculated with full-length PRSV-W PCR product. Cotyledons were assayed by

ELISA 10 days post-bombardment (dpb) and inoculated onto squash plants which

were assayed by ELISA and for symptoms at 15 dpi. Positive squash plants were

inoculated onto papaya and assayed by ELISA and symptoms after 28 days then

symptoms monitored again at 45 dpi. Controls are shaded. NI: not inoculated

Cotyledons

Squash

Papaya

ELISAe

ELISAa,e

Symptomsc

ELISAb,e

Symptomsd

Sample

10 dpb 15 dpi 15 dpi 28 dpi 28 dpi 45 dpi Unshot cotyledon 0.122 Buffer only 0.11 0.013 0.142 Healthy squash 0.102 0.12 Healthy papaya 0.204 PRSV-P/papaya 1.452+0.02 ++ ++ PRSV-W/squash 1.497+0.07 ++++ 0.285+0.04 - - - -

Shot # 1 1.438 1.451+0.10 ++++ 0.211+0.01 - - - - Shot # 2 1.524 1.485+0.03 ++++ 0.271+0.06 - - - - Shot # 3 1.346 0.119+0.02 - - - - NI Shot # 4 1.484 1.452+0.13 ++++ 0.229+0.02 - - - - Shot # 5 1.492 1.449+0.41 ++++ 0.223+0.13 - - - - Shot # 6 1.549 1.484+0.07 ++++ 0.205+0.05 - - - - Shot # 7 1.468 1.176+0.69 ++ - + 0.236+0.08 - - - - Shot # 8 1.537 1.409+0.04 ++++ 0.208+0.004 - - - - Shot # 9 1.397 0.191+0.12 - - - - NI Shot # 10 1.538 1.447+0.04 ++++ 0.228+0.03 - - - - Shot # 11 1.573 1.429+0.03 ++++ 0.266+0.05 - - - - Shot # 12 1.327 1.387+0.04 ++++ 0.308+0.02 - - - - Shot # 13 1.458 1.401+0.03 ++++ 0.301+0.008 - - - - Shot # 14 1.562 1.479+0.08 ++++ 0.287+0.02 - - - - Shot # 15 1.346 1.401+0.04 ++++ 0.3095+0.02 - - - - a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b ELISA values are the average of results from 2 papaya plants inoculated (3 times each)from infected squash c typical symptoms observed (+) or not (-) for each of the 4 squash plants d typical symptoms observed (+) or not (-) for each of the 2 papaya plants e ELISA values represent absorbance at 460 nm

81

Table 3.2 Summary of infectivity assays (ELISA and symptoms) on plants

inoculated with full-length PRSV-P PCR product. Cotyledons were assayed by

ELISA 10 days post-bombardment (dpb) and inoculated onto squash plants which

were assayed by ELISA and for symptoms at 15 dpi. Positive squash plants were

inoculated onto papaya and assayed by ELISA and symptoms after 28 days then

symptoms monitored again at 45 dpi. Controls are shaded. NI: not inoculated

Cotyledons

Squash

Papaya

ELISAe

ELISAa,e

Symptomsc

ELISAb,e

Symptomsd

Sample

10 dpi 15 dpi 15 dpi 28 dpi 28 dpi 45 dpi Unshot cotyledon 0.104 Buffer only 0.094 0.073 0.091 Healthy squash 0.125 0.105 Healthy papaya 0.118 PRSV-P/ papaya 1.436+0.03 ++++ 1.428+0.04 ++ ++ PRSV-W/ squash 1.402+0.05 ++++ 0.12+0.04 -- --

Shot # 1 1.357 2.231+0.04 ++++ 1.47+0.12 ++ ++ Shot # 2 1.476 1.429+0.05 ++++ 1.209+0.40 + - ++ Shot # 3 1.437 1.409+0.05 ++++ 1.43+0.05 + - ++ Shot # 4 1.496 1.416+0.11 ++++ 1.4155+0.07 ++ ++ Shot # 5 0.572 0.2315+0.14 - - - - NI Shot # 6 1.462 1.412+0.02 ++++ 1.461+0.03 ++ ++ Shot # 7 0.327 0.100+0.02 - - - - NI Shot # 8 1.475 1.385+0.03 ++++ 1.407+0.03 + - ++ Shot # 9 1.395 1.327+0.15 ++++ 1.424+0.06 + - ++ Shot # 10 1.492 1.411+0.03 ++++ 1.434+0.004 ++ ++ Shot # 11 1.395 1.275+0.24 +-++ 1.466+0.006 ++ ++ Shot # 12 1.378 1.372+0.05 ++++ 0.79+0.84 - - + - Shot # 13 1.452 1.404+0.43 ++++ 1.4215+0.06 ++ ++ Shot # 14 1.465 1.418+0.05 ++++ 1.371+0.02 ++ ++ Shot # 15 1.369 1.42+0.04 ++++ 1.414+0.03 + - ++ a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b ELISA values are the average of results from 2 papaya plants inoculated (3 times each)from infected squash c typical symptoms observed (+) or not (-) for each of the 4 squash plants d typical symptoms observed (+) or not (-) for each of the 2 papaya plants e ELISA values represent absorbance at 460 nm

82

Figure 3.20 Typical symptoms of PRSV infection, (A) squash infected with

rPRSV-W, (B) papaya infected with rPRSV-P.

A

B

83

Figure 3.21 Electron micrographs of typical PRSV virions identified in

negatively stained leaf dips following inoculation with (A) rPRSV-W (B)

rPRSV-P.

200nm 200nm

A B

84

Figure 3.22 RT-PCR analysis of plants inoculated with rPRSV-W to detect

the P1, NIa and CP-coding regions. (A). Lane 1: Detection of P1-coding

region in positive control p5’Triplet-W; Lane 2: Detection of P1-coding region

in squash infected with rPRSV-W. (B) Lane1: Detection of NIa in positive

control p3’Triplet-W; Lane 2: Detection of NIa in rPRSV-W infected squash;

Lane 3: Detection of CP in positive control p3’Triplet-W; Lane 4: Detection of

CP in rPRSV-W infected squash.

A B

M 1 2 M 1 2 3 4

517bp

1018bp

2036bp 2036bp

1018bp

517bp

85

3.4 Discussion

Full-length infectious PCR products of Australian PRSV-W and –P isolates

were generated as in vivo constructs incorporating a CaMV 35S promoter

and terminator. The ~11kb PCR products were amplified reproducibly by LD-

OE-PCR from overlapping clones. The decision to use this approach resulted

from a number of unsuccessful attempts using different strategies to

generate full-length clones in E. coli.

The decision to use in vivo transcripts for generation of rPRSVs was

originally made by Henderson (1999) as it circumvents a number of

difficulties found when producing infectious transcripts in vitro. In vivo

transcripts eliminate the need for transcription enzymes and a cap analogue

for enhancement of translation initiation or transcript stability (Domier et al.,

1989; Riechmann et al., 1990). In vivo transcription also shows a greater

tolerance for the presence of non-viral nucleotides at the 5’ terminus

(Commandeur et al., 1991). As well, previous studies demonstrated a high

efficiency of infection (90%) of tobacco leaves inoculated with a full-length

PVY PCR product incorporating a CaMV 35S promoter at the 5’ end and

nopaline synthase (NOS) polyadenylation signal at the 3’end when delivered

by microprojectile bombardment (Fakhfakh et al., 1996). In that study, a full-

length PVY PCR product was amplified after reverse transcription from

purified viral RNA. A similar approach was initially used in this study (results

not shown), however, several attempt to clone this product were

unsuccessful. Since cloning was essential for subsequent recombination

experiments, the genomes were cloned in three overlapping parts for

subsequent assembly into full-length genomes.

The basis of in vivo constructs is the inclusion of a plant promoter (and

usually a terminator), which is engineered to drive transcription of an intact

virus sequence when introduced into a plant cell. There is different, and

sometimes conflicting, evidence as to the affect of having additional

nucleotides present at the 5’ and 3’ ends of the viral RNA (either in vivo or in

vitro). Reports of reduced infectivity have been attributed to non-viral bases

86

incorporated at the 5’ or 3’ termini of the transcript (Boyer et al., 1993).

However in several cases, extra non-viral bases had no effect or actually

increased infectivity (Viry et al., 1993; Holy and Aboul-Haidar, 1993). ZYMV

and Beet necrotic yellow vein virus (BNYVV) constructs containing 127 and

40 nucleotides, respectively, at the 5’ end of the viral genome were found to

be infectious (Gal-On et al., 1995; Commandeur et al., 1991). In previous

reports of PRSV-P (Chiang and Yeh, 1997), the significance of minimising

the addition of non-viral nucleotides was demonstrated. Capped in vitro RNA

transcripts of PRSV-P (HA) had one extra guanosine residue at the 5’

terminus and 12 non-viral nucleotides at the 3’ terminus and were infectious

(Chiang and Yeh, 1997). In vivo transcripts of PRSV-P (HA), under the

control of a CaMV 35S promoter and Nos terminator and with 10 non-viral

nucleotides at the 3’ end were infectious whereas transcripts with 33

extraneous nucleotides at the 5’ end and 64 non-viral nucleotides at the 3’

end were not infectious (Chiang and Yeh, 1997).

To ensure that the presence of nonviral nucleotides, particularly at the 5’ end

of the genome, did not influence infectivity, Henderson (1999) engineered

the first nucleotide of the PRSV-W genome immediately adjacent to the

transcription start site of the CaMV 35S promoter. To minimize the size of

megaprimers incorporating the promoter, Henderson (1999) used the

minimal CaMV 35S promoter (343 bp).

The 3’ megaprimer designed by Henderson (1999) included the CaMV 35S

terminator sequence in addition to 33 A residues immediately downstream

from the 3’UTR. The same construct was used in this study, however, the

necessity for including a terminator or poly(A) tail in the construct is

debatable. Poly(A) deficient full-length cDNA clones of CIYVV were found to

be infectious when expressed from the CaMV 35S promoter without a

terminator sequence (Tacahashi and Uyeda, 1999; Takahashi et al., 1997).

In those experiments, the poly (A) tail was replaced with different short

sequences and the infectivity of the cDNA constructs examined. Although the

87

infectivity of the plasmids varied depending on the sequences introduced, all

the constructs were infectious. In all cases, progeny viral RNAs from the

cDNA clones had an authentic viral sequence at their 3’ ends with poly(A)

tails and the downstream nonviral sequences were completely lost. Full-

length cDNA clones of CIYVV, TuMV and ZYMV, placed under the control of

CaMV 35S promoter without a termination sequence, were shown to be

infectious (Takahashi et al, 1997; Sanchez et al 1998; Gal-On et al., 1995),

suggesting again that additional terminator signals are not necessary for

infectivity. It was suggested that the poly(A) tail is extended by either RNA

polymerase slippage or by a host poly(A) polymerase and that a

polyadenylation signal exists at the 3’end of the potyviral genome. As

infectivity of rPRSVs generated in this study was similar to wild type virus,

they were not analysed for nonviral sequences at the 3’ end of the genome.

Using the PCR strategy developed here, the need for a terminator would be

easy to test by generating full-length PCR products using primers to

eliminate terminator and/or poly (A) tail.

Since infectious clones of Hawaiian and Taiwanese isolates of PRSV-P have

previously been reported using both in vivo and in vitro approaches (Chiang

and Yeh, 1997), it was expected that cloning of Australian isolates would be

relatively straightforward. Interestingly, while intermediate cloning steps were

relatively efficient, a full-length clone was not achieved. Insertion of the 5’

fragment (which included the CaMV 35S promoter, 5’UTR, P1, HC-Pro and

partial P3) into the rest of the genome only produced clones with the insert in

the wrong orientation. The same result was obtained several times,

suggesting that the full-length cDNA of Australian PRSV isolates may be

toxic to E. coli cells. Use of different E. coli strains also gave the same

result. A similar result was reported by Johansen (1996) who was unable to

obtain a clone representing part of the genome of PSbMV pathotype 1 (P1)

including the HC-Pro to VPg. Clones covering the HC-Pro and partial P3 or

partial P3 to VPg could be cloned separately but were lethal in E.coli when

joined.

88

Toxicity and/or instability of potyviral clones (Maiss et al., 1992; Jakab et al.,

1997) as well as clones of other RNA viruses (Yamaya et al., 1988; Quillet et

al., 1989; Fakhfakh et al., 1996; Johansen et al., 1996) in bacteria is widely

reported. It has been proposed that the toxic viral products could be derived

from transcriptional expression of viral sequence driven by an upstream

bacterial promoter such as the “LAC” promoter (Yamaya et al., 1988;

Johansen, 1996) or by adventitious prokaryotic promoter activity in the viral

genome (Quillet et al, 1989; Fakhfakh et al., 1996). It is interesting that other

PRSV infectious clones (Chiang and Yeh, 1997) were not toxic. This is

further discussed in chapter 6.

Numerous strategies have been developed in past years to avoid toxicity –

associated problems and several of these approaches were used in this

study. Using low copy number vectors (Payne et al., 1994; Dersch et al.,

1994; Gritsun and Gould, 1998) and reducing the incubation temperature

from 370C to 280C Gritsun and Gould, 1998) has previously been shown to

stabilise full-length cDNA clones in E. coli. In this study, the PRSV-W

genome was cloned into the low copy number vector, PACYC177. Unlike

initial cloning into high copy number plasmids, some colonies were obtained

and plasmids were isolated which were shown to contain the full-length

PRSV-W genome. However, the colonies were very tiny and died after

several hours of incubation in liquid growth media, a feature previously

associated with toxicity of viral sequences (Quillet et al., 1989; Rice et al.,

1989; Lai et al., 1991; Johansen, 1996). Reducing the incubation

temperature to 28-30oC had a small positive effect on the growth rate of the

cells and resulted in a slight increase in plasmid yield, however, the yield was

still not sufficient for infectivity experiments. Interestingly, although the P1

and CP-coding regions could be amplified, confirming the presence of the N

and C termini of PRSV in the plasmid, these clones did not digest well with

restriction enzymes, giving only a smear on agarose. This posed significant

problems for the generation of recombinant clones. Therefore alternative

strategies were investigated.

89

The insertion of introns with multiple stop codons into cDNA clones of plant

viruses has previously been reported to facilitate the generation of full-length

viruses in E. coli (Johansen, 1996; Olsen and Johansen, 2001; Lopez-Moya

et al., 2000). The introns, which are not processed in prokaryotes and

therefore prevent expression in bacteria, are subsequently processed in the

eukaryotic plant cell to produce a normal virus transcript. Johansen (1996)

used introns to overcome toxicity of PSbMV P1 potyviral clones, where

toxicity was associated with joining of the HC-Pro/P3 to the genome region

incorporating P3-VPg. In that case insertion of an intron into the P3 coding

region overcame toxicity enabling normal cloning and amplification in E. coli.

As well, it was demonstrated that up to 3 different introns, inserted up to 4

times in positions between the P1 and VPg could be processed to generate

infectious virus. Introns have also been inserted into the P3 coding region of

infectious clones of LMV (Yang et al., 1998) and PPV (Lopez-Moya et al.,

2000). Although wild type virus could be cloned in these cases, intron-

containing clones of PPV resulted in a more stable, faster growing bacteria

and higher plasmid yield. In this study the St-LS1 IV2 intron (one of those

used by Johansen (1996) was inserted into the P1 coding region of the

PRSV-W genome. This intron has also been used to inhibit Barnase

expression (Hanson et al., 1999) a potent RNase and so was assumed to be

highly functional at inhibiting expression. The P1 was chosen as the site of

insertion on the presumption that viral sequences were being expressed

within the bacteria and were toxic and so insertion into the P1 should prevent

translation of the whole ORF. This strategy however only reduced toxicity

very slightly and was simlar to results obtained after cloning into a low copy

number plasmid i.e. small colonies and very low plasmid yield. Failure of an

intron in the P1-coding region to overcome toxicity suggests that it is likely

that there may be cryptic prokaryotic promoter sequences within the 5’

fragment but downstream of the insertion site in the P1-coding region.

Insertion of introns in several places in the genome may be required to

localise the putative toxic sequence and stabilise the clone in E. coli, since

positions of the promoter elements are accidental and can be different in

various potyvirus species, strains and isolates (Jakab et al., 1997). This was

supported by a report that while a full-length clone of a third PSbMV isolate,

90

PSbMV-L1, with four intron insertions (P1, P3, CI and VPg) was unstable in

E.coli, a clone made with an additional intron in the 6K2 coding region was

stable and less toxic to E.coli resulting in higher plasmid yield (Olsen and

Johansen, 2001).

Although the intron did not prevent toxicity in E.coli in this study, in later

experiments the 5’ fragment clone containing the intron was used to

generate full-length PCR product which was subsequently shown to be

infectious (90%), confirming that the intron was correctly engineered and

spliced (results not shown). It is possible then that insertion of the intron into

the genome of Australian PRSV–W at the P3, considering it was at this point

that clones became toxic, could overcome the problem in future.

However, in an attempt to speed up the project, and since all of the tools

(clone, primers etc) were already available, an alternative approach using

OE-LD-PCR was used. The advantage of overlapping PCR meant that the

genome could be cloned in two fragments to overcome toxicity and then

joined for inoculation. Jakab et al. (1997) reported a similar approach to

avoiding difficulties in making full-length infectious clones of PVY-N605, by

cloning the full-length PVY genome as two overlapping clones which were

ligated prior to inoculation. Using that approach, cDNA and RNA transcripts

were infectious using both mechanical and biolistic inoculation methods.

Advantages of PCR over more traditional cloning and sub-cloning techniques

include the relative ease and the reduction in time involved (Gritsun and

Gould, 1995). Long distance PCR has been successfully used for

amplification of large DNA fragments of up to 35kb from bacteriophage

lamda and up to 42kb from human genomic DNA (Barnes, 1994; Cheng et

al., 1994). This technique has also been used for generation of full-length

infectious cDNA transcripts of numerous viruses (Hayes and Buck, 1990;

Boyer et al., 1993; Pogany et al., 1994; Fakhfakh et al., 1996; Tellier et al.,

1996; Perrin and Hull, 1999; Lopez-Moya and Garcia, 2000; Saldarelli et al.,

2000).

91

Using this approach it was possible to generate full-length infectious PCR

product of PRSV-P and -W, derived from cloned genome components, which

had the potential to be manipulated for future recombination experiments,

overcoming the problems of toxicity in E.coli. Although slightly more complex

than a single full-length infectious clone, this approach can achieve a similar

outcome and is easier to manipulate in subsequent mutation and

recombination studies as clones are smaller.

Products obtained from OE-LD-PCR were generally low in concentration

compared to a standard PCR reaction. The success of the reaction and yield

varied with batches of enzyme, and thermocycles were highly dependent on

the concentration of template DNAs. The presence of the low molecular

weight band meant that the correct size PCR product had to be gel purified,

further reducing the concentration and so the OE-LD-PCR step had to be

repeated several times to obtained sufficient DNA for microprojectile

bombardment. Megaprimers were originally used to incorporate the

promoter and terminator sequences into a full-length PCR product amplified

directly from viral RNA (Fakhfah, 1996; Henderson, 1999). In this study,

since the viral fragments, as well as the promoter and terminator, were

cloned it was not essential to use megaprimers for OE-LD-PCR. However, it

was thought that the longer overlap (5’ megaprimer with 135bp overlap and

3’ megaprimer with 206bp overlap) afforded by the megaprimers would

increase specificity of amplification. Using megaprimers worked well,

however, in future, smaller specific primers could be designed and tested to

see if this increases efficiency of amplification.

The use of overlapping PCR to generate infectious PRSV transcripts has

both advantages (as mentioned above) and disadvantages. The limitations

of PCR itself are well documented (Meyerhans et al., 1990; Higuchi et al.,

1988; Fang et al., 1998) and although the virus genome was cloned, there

was potential to generate errors during the final overlapping-PCR step. The

chance of this was minimised by using enzymes with high-proof reading

ability. The Expand Long Template PCR system used in this experiment is a

92

unique enzyme mix containing Taq DNA polymerase and Pwo DNA

polymerase, a thermostable polymerase with proof reading activity. As well,

because the chance of exactly the same error occurring in more than one

PCR reaction is very low, pooling of PCR products (often as many as 30-50

different PCR reactions) serves to dilute out any potential mutant, perhaps

mimicking a natural population.

Infectivity rates of cDNA clones can vary depending on the inoculation

method used. The efficiency of delivery is especially important for in vivo

transcribed clones which must enter the cell nucleus to replicate (Lopez-

Moya and Garcia, 2000). Particle bombardment is reportedly a more

effective way to introduce DNA directly into the plant cell nucleus compared

to mechanical inoculation of clones (Gal-On et al., 1995). The first report of

successful infection by a full-length PCR product derived from an RNA virus

using particle bombardment was for PVY (Fakhfakh et al., 1996). Lopez-

Moya and Garcia (2000) compared both particle bombardment and

mechanical inoculation methods to inoculate PPV infectious clones. They

reported that only 0.1ng of DNA per plant was required to achieve 100%

infection by biolistic inoculation while 5μg DNA per plant were required to

obtain 100% infection by mechanical inoculation i.e. biolastic inoculation was

105 fold more efficient. They also found mechanical inoculation much more

variable compared to biolistic inoculation, possibly due to differences in the

level of damage caused to plants in each inoculation by hand. Similar results

were found when infectivity of ZYMV infectious clones by mechanical and

biolistic inoculation were compared (Gal-On et al., 1997). In this study, in

vitro bombardment onto squash cotyledons prior to mechanical inoculation

was effective with 86.6% of squash plants becoming infected with PRSV-W

(based on ELISA at 15 dpi) and 86.6% of papaya becoming infected with

PRSV-P (based on ELISA at 28 dpi). This is a similar rate of infectivity as

that reported for PVY infectious full-length PCR product amplified using LD-

PCR incorporating CaMV 35S promoter and NOS terminator and inoculated

initially in vitro to tobacco leaf (Fakhfakh et al., 1996). Fakhfakh et al. (1996)

found that increasing the amount of DNA bombarded from 0.2µg to 0.5µg

93

increased the efficiency of infection to 90%. In this study, cotyledons were

each bombarded with approximately 1 μg of purified PCR product to ensure

maximum efficiency. Nevertheless, even at this concentration infectivity of

cotyledons was not 100%, however, this could be due to other factors such

as quality of cotyledons or variability in bombardment.

rPRSVs behaved like wild-type virus in all aspects. Symptoms were

indistinguishable from wild type virus on both squash and papaya and

electron microscopy confirmed the presence of normal potyvirus-like

particles in leaf dips from infected sap. As well the host range integrity of the

clones was maintained. Some studies have reported delays in symptom

development using infectious clones. Symptom development for PSbMV and

ZYMV transcripts was delayed approximately one week and 10 days,

respectively, when plasmids were used as inoculum instead of purified virus

(Domier et al., 1989; Riechmann et al., 1990; Gal-On et al., 1991; Olsen and

Johansen, 2001). In this study, there was essentially no difference in onset

of symptoms between rPRSVs and wild type controls. This is likely a result of

the inoculation method, as infectivity is initially established in cotyledons in

vitro.

This strategy generated infectious clones of PRSV-P and -W, overcoming

problems of toxicity in E.coli. As well, the availability of the genomes as 3

overlapping clones is an ideal tool for subsequent recombination

experiments, described in Chapter 5.

94

CHAPTER 4 SEQUENCE ANALYSIS OF THE COMPLETE GENOMES

OF AUSTRALIAN ISOLATES OF PRSV

4.1 INTRODUCTION

For RNA viruses, including potyviruses, differences in replication,

pathogenicity and host range can be determined by several or even a single

amino acid change (Gal-On and Raccah, 2000; Skaf et al., 2000; Rajamaki

and Valkonen, 1999; Masuta et al., 1999; Saenz et al., 2000). Identification

of specific mutations associated with a particular phenotype by sequence

analysis and comparison of virus genomes can be difficult because of the

extensive variation in RNA viruses (Domingo et al., 1985). However, this is

more feasible where there are large numbers of sequences available and/or

the sequences are closely related and recently diverged. The latter is true

for Australian PRSV-P and -W isolates. It is believed that PRSV-P arose

relatively recently from PRSV-W in Australia (Bateson et al., 1994; Bateson

et al., 2002) and sequence data has already demonstrated the high level of

nucleotide sequence similarity for the CP (98.8%; Bateson et al., 1994) and

P1 (96.9%; Henderson, 1999) coding regions and 5’UTR (100%; Henderson,

1999) and 3’UTRs (100%; Bateson, 1995). Additionally, there are 5 full-

length PRSV sequences available including PRSV-P from Hawaii (Yeh et

al.,1992; GenBank Accession No. X67673), Taiwan (Wang and Yeh, 1997;

GenBank Accession No. X97251) and Thailand (GenBank Accession No.

AY162218), as well as PRSV-W sequences from Taiwan (GenBank

Accession No. AY027810) and Thailand (Attasart et al., 2002; GenBank

Accession No. AY010722).

While identification of the sequences involved in host range will ultimately

require recombination and mutagenesis studies, comparison of whole

genome sequences can provide valuable information by identifying putative

host range determinants and therefore targets for further studies. In this

chapter, the full genome sequences of the Australia PRSV-P and -W isolates

95

are compared to each other and overseas isolates and the sequences

analysed to identify putative host range determinants.

4.2 METHODS AND MATERIALS

4.2.1 Oligonucleotide primers

The sequences of NIa-1, NIa-2, MB-12A, MB-11, P3cons and Universal

Forward primers are given in Chapter 3 (section 3.2.1.). The sequences of

remaining oligonucleotides used for cloning of the 5’ and 3’ UTRs and for

sequencing of full-length PRSV-P and PRSV-W genomes are given in Table

4.1

4.2.2 Source of PRSV clones

The full-length genomes of PRSV-P and PRSV-W isolates from Australia

were previously cloned in 3 overlapping clones, namely p5’Triplet-P or W,

pMiddle Triplet-W or P and p3’Triplet-P or W (Chapter 3). Since

megaprimers (incorporating the 5’ and 3’UTR’s of PRSV-W) were used in the

generation of these clones and although previous data suggested that these

UTRs are identical between isolates (Bateson, 1995; Henderson, 1999), the

5’ and 3’ UTRs were cloned separately to confirm the sequence. Fragments

representing the 5’UTR and partial P1 (1490bp) and the 3’UTR and CP

(1070bp) were amplified from PRSV-P infected papaya and PRSV-W

infected squash. RNA was extracted using a QIAGEN RNeasyR Plant Mini

Kit. First-strand cDNA’s were synthesised from extracted RNA using primer

Taurus (5’ terminus) and degenerate oligo dT primer (3’ terminus) with the

ExpandTM Reverse Transcriptase system (Roche Diagnostics) as described

in section 2.3.2. PCR products representing 5’UTR and partial P1 (1490bp)

and 3’UTR and CP (1070bp) of both strains were amplified from 1-5 μl of

first-strand cDNA using

96

Table 4.1 Sequence of oligonucleotides used in cloning and sequencing of PRSV-P and W genomes

Name Sequence 5’ – 3’ Reference Name Sequence 5’ – 3’ Reference

1A GGTTTAAAATAAAACATCTCAACACAAC Henderson, 1999 Capricorn ACTATGGTTGGTCGTCTAGG Henderson, 1999

CI-M CACGGAGTAATGCAGCCA This study CI-b CGTGCAGACATATAAGCGTGA This study

CIR-F GTGGATCAACTAAGTAAG This study CI-a GCTTGCTCAAAAACTGCACTG This study

CIQ-R GGGTGCACTGTTCCATCGAAG This study CIM-R TGGCTGCATTACTCCGTG This study

CI-1 ACTCTCGCTTTATGTGC This study CI-R CTTACTTAGTTGATCCAC This study

CP-1 CATGCTACTCCGACATTT This study CP-2 CACCTTATAGTACTATAT This study

Oligo dT TTTTTTTTTTTTTTTTTTTTT(G/A/C) Bateson, 1995 Gemini GGCGATGCAAGAGAAGAATT Henderson, 1999

HC2-R CGTGGTATTGCCTTTCGCCCC This study HC3-R TGTTGCAAGTTATCTTGTGGC This study

HC1-R TGCGTTGGCCGCGTCAGGATG This study MB-14A GGCTTGATTGGATAATCA This study

MB-16A TTTCCGTCACTAGCATCG This study NIaM-R AGCTCTGCTATGGAATGGAGG This study

NIaL1-R AACTGATTTCGAGGGTGGTGG This study NIb-s GGTACCATGAGTGGTGGTCGTTGGCTCTTTG Bateson, 1995

NIa-MF GAAGAGAAGGTTCTGAGG This study NIb-R1 TTGCGCAACACTATCCTC This study

NIb-M GTGATGCGGATGGCTCTC Bateson, 1995 NIa-R2 GACAACAAACTTACCGTG This study

NIa-R AGCCTGCTTGTCGAAGC This study NIa-5 CCATTGCAGGATTTCCTGACAGG This study

NIb-1 GGAGCCAAAGTCTGCGTT This study P3-M GGCTGTGCTTACATTTTC This study

97

Table 4.1 continued/

Name Sequence 5’ – 3’ Reference Name Sequence 5’ – 3’ Reference

P1C-R CAACCTCCTATCGTACTGAGC This study P1B-R GTCAGAAGTGTTACCGCAATC This study

Pisces AACCAATTGCGGCTAGTGAG Henderson, 1999 P3S GGAGAGTTTGACCCAACTACAAACTGC This study

P3M-1 CCTACGCCACCCTATTGAAGG This study P3M-R GAAAATGTAAGCACAGCC This study

P1A-R CCAACTTCGAGTGCCAGGTGC This study Prot-3 CCCACAAACTGACATCTCAATGG This study

RLS-6 AAGTACGTTGACCTGCCGACTC Stokoe, 1996 RLS-3 GGAGGGTCATTCGGACATGTCTC Stokoe, 1996

Rep-1 TTGGCGTGTAAGTGATTTCCCC Bateson, 1995 Rep-2 GTATCGCCATTCACCCGGATCATG Bateson, 1995

RLS-4 TCGCGGCAATTCTGCGTTGGCCGCG Stokoe, 1996 RLS-5 CTTATGGGGCGAAAGGCAATACC Stokoe, 1996

Taurus AGCTGCTCACATCTTGTCGT Henderson, 1999 Universal

Reverse

AACAGCTATGACCATG

98

Expand TM Long Template PCR system (section 2.3.3.2) with primer pairs 1A

/Taurus and MB-11/degenerate oligo dT, respectively. Gel purified (section

2.4.7) products were ligated into pGEM-T (section 2.5.1) and transformed

into competent E.coli JM109 (section 2.5.3).

4.2.3 Sequencing of PRSV-P and PRSV-W genomes

For both PRSV-P and -W, the 3 overlapping clones used to generate

infectious clones were sequenced as shown in Figures 4.1- 4.4. For each of

these regions, at least one other clone was also sequenced. Two clones

each of 5’UTR/P1 and 3’UTR/CP clones were also sequenced using

Universal Forward and Reverse primers and Pisces and Taurus. Clones

were sequenced as described in section 2.4.6.

Contiguous sequences obtained from individual clones were assembled in

SeqManTMII (DNASTAR). The sequences of clones used to generate

infectious transcripts were used for subsequent analysis. The sequence of

the Australian PRSV-P and -W isolates were aligned with the sequences of

PRSV-P from Hawaii (HA isolate; GenBank Accession No. X67673),

Thailand (GenBank Accesion No. AY162218) and Taiwan (YK isolate;

GenBank Accession No. X97251) and PRSV-W from Taiwan (CI isolate;

GenBank Accession No. AY27810) and Thailand (GenBank Accession No.

AY010722). Sequences were prepared using EditSeqTM and MegAlignTM

within the DNASTAR suite of programs and then aligned in ClustalX (version

1.81) (Thompson et al., 1997) using default parameters. Neighbor-joining

trees were generated and bootstrapped (1000 resamplings) in ClustalX and

viewed using TreeView (Page, 1996). Distances (% divergence) were

calculated in MegAlign after aligning using the Jotun Hein algorithm.

99

Figure 4.1 Representation of the five overlapping clones used to generate

full-length PRSV genome sequences.

VPg --- P1 HC P36K

CI NIa NIb CP

VPg NIa NIb

NIa-I

CP

3’UTR 33 A 35ST

P3 CI VPg NIa

P3S NIa-2

P1 HC 35S

5’megaprimer P3cons

3'UTR5'UTR

6K

6K

5'UTR

CP

3’UTR

P1

5'UTR

Taurus 1A

MB-11 Degenerate dT

3’megaprimer

100

Figure 4.2 Location of primers used in cDNA synthesis, PCR amplification

and sequencing of p5’Triplet of PRSV-P and -W

P1 HC-Pro P3 35S

5'UTR

Forward

1A Capricorn

Pisces

Gemini RLS-3

RLS-5

RLS-6 P3S

P1C-R P1B-R

P1A-RTaurus

HC3-R HC2-R

HC1-R

RLS-4

Reverse

101

Fig 4.3 Location of primers used in cDNA synthesis, PCR amplification and

sequencing of pMiddle Triplet -P and –W.

P3 CI VPg NIa 6K

Universal Forward

P3S

P3M-1

P3-M

CI-M

CIR-F

CI-a

NIa1

NIa-MF

Universal Reverse

P3M-R

CI-MR

CI-R

CIQ-R

CI-1

NIa-R

NIaL1-R

NIa-R2

NIaM-R

Prot 3

NIa-5

CI-b

102

Figure 4.4 Location of primers used in cDNA synthesis, PCR amplification and

sequencing of p3’Triplet -P and -W

NIb CP 33 35S A T

VPg NIa 6K 3’UTR

Prot-3 NIa-5

NIa-MF

NIb-1

NIb-S

NIb-M

Rep-2

MB-11

CP-1

CP-2 Universal Reverse

MB-12A

MB-14A

MB-16A

NIb-R2

Rep-1

NIb-R1

NIa-2

NIaM-R

NIaL1-R

NIa-R

NIa-R2

Universal Forward

103

RESULTS 4.3.1 The Australian PRSV- P and -W genomes

The sequences of the full-length genomes of Australian PRSV-P and -W

isolates were determined. At least 2 clones of each genome region were

sequenced. There were only 3 nucleotide changes over the whole genome

between clones of each isolate and none resulted in amino acid changes.

The nucleotide sequences are presented in Appendix 1 and represent the

genomes of PRSV-P and -W contained in the clones used to generate

infectious transcripts, rPRSV-P and rPRSV-W. The genomes of Australian

P and W isolates were both 10,327nt in length and encoded a 5’UTR (85nt),

a single open reading frame (10,038nt), and a 3’UTR (206nt). The genomes

differed from each other by only 2.2% at the nucleotide level over the whole

genome and only 2.6% at the amino acid level in the open reading frame

(Table 4.2). The 5’UTR and 3’ UTR of the Australian PRSV-P and -W

isolates were confirmed to be identical.

The size and organization of the two genomes was typical of other PRSV

isolates. The open reading frame (nts 86-10118) encoded a single

polyprotein with the same putative proteins as previously reported for other

PRSV isolates (Fig.1.1). A number of amino acid motifs implicated in

different potyvirus functions and previously shown to be conserved in

Hawaiian and Taiwanese PRSV isolates (Yeh et al., 1992; Yeh, 1994; Wang

and Yeh, 1997) were also conserved in the Australian isolates (Fig.4.5).

104

Table 4.2. Percent divergence between the genomes of PRSV isolates. Nucleotide

divergence of the complete genome is shown in the upper triangle; amino acid

divergence of the open reading frame is shown in the lower (shaded) triangle.

AUS-W AUS-P HAW-P TAIW-W TAIW-P THAI-W THAI-P

AUS-W *** 2.2 7.5 19.0 19.2 18.9 19.8

AUS-P 2.6 *** 7.8 19.3 19.3 19.3 20.0

HAW-P 5.4 5.7 *** 19.3 19.3 19.2 19.7

TAIW-W 9.4 9.9 10.1 *** 5.0 12.6 11.5

TAIW-P 9.6 10.1 10.1 3.3 *** 12.2 11.2

THAI-W 9.1 9.6 9.3 5.9 6.3 *** 12.9

THAI-P 9.9 10.3 10.1 6.6 7.1 6.1 ***

105

AUS-W MSSLYTLRPA AQYDRRLESK KGSGWIEHKL ERKGDRGNTH YCSEFDISKG AKILQLVQIG NAEVGRTFLE GNRFVRANIF EIIRKTMVGR LGYDFESELW VCHDCGNTSD KYFKKCDCGE AUS-P ---------- ---------- ---------- ---------- F--------- ---------- ---------- ---------- ---------- ---------- ---E-S---- ---------- HAW-P --------A- ---------- -----V---- ----E----- ---------- ---------- -T-------- ---------- ---------- ---------- --RN-DK--E ---------- TAIW-P -----Q-Q-I -LK--L-SHE R-K------- ----E----R -VG--V--E- ---------- -T----A--- ---RI--D-- --VK------ ---------- C--S-D---A ---------- TAIW-W -----Q-Q-I -LK--L-SH- R-K--Y---- ----E---SR HVG--V--E- -R----I--- ------A--- ---RT--D-- --VK------ ---------- C--S-D---A ---------- THAI-W -----Q-Q-I -LK--L-SH- R-K------- ----E----R HVG--V--E- ---------- ---I------ -D-RTQ-D-- ---K-----H ------CG-- C--S-D---- ---------- THAI-P -----Q-Q-I -LK--L-AHE R-K------- ---------R HVG--VV-E- ------I--- ------A--- -D-KT--D-- --VK-----H ------C--- C--S-DK--A ---------- AUS-W KYYYSERNLM KTIQDLMYQF DMTPSEINSV DFDYLADAVD YAERSVKGSQ VPEPVELAMM EPIAASEKGT LVVSELKVVP VTTKVEEAWT IQIGEIPVPL VVIKETPVIS GVNGTLNSTG AUS-P ---------- R--------- ---------- ---------- ---------- ---------- -------E-- ---------- ------K--- ---------- ----K----- S--------- HAW-P T--------- R-MN------ ---------- -LE---N--- ---QL--R-- ---------- ---V--GE-I -M---PE-M- ---------- ---------- ---------- --E------- TAIW-P ------G--I -SMR------ ---T---EQ- GY----E--- F--Q-GVKFK A-A-E-PEI- -TS-S--G-L --A--PEI-- I---A----- ------S--- ---------- -MSR--S--- TAIW-W ------G--I -SMH------ --ST---EQ- GY----E--N F--L--VE-K T-A-E-PEIV NTG-SI-G-L --A--PEI-S I--------- ------S--- ---------- -MSK--S--- THAI-W ---------I -SMH------ ---AA--DQ- GL----E--- ---Q---K-K --V-D-PEFV -VL----ESH ---P-PE--S ---RA----- ---------- ---R------ ----M-S--- THAI-P ---------I -SMH------ N--A---DQ- EYN---E--N F--Q--IK-K --VS--PDFV K--V---ESL ---P-PEI-- ---------- ---------- I--------- ------E--- AUS-W FSLEADVTKM VEKEVPQEEV KEAVHLALEV GNEIAEKKPE LNLTPYWSAS LELHKRVRKH KEHAKIAAIQ VQKEQEENQK IFSTMELRLD LKSRRRNQTV VCDKRGTLKW ETRQGCKKSR AUS-P ------I--- -K-------- ---------- ---F------ ---------- ---------- ---------- -L----D--- ----L--K-- ---------- ---------- K----H---- HAW-P ------I--L ----IL---- ---------- ---------- -K-I------ ------I--- ---------- ----R-KD-- V--AL----N --------A- ---------- --QR-H---K TAIW-P -----EIA-P ATST---S-I E--AY----- ---------- -K-------- ---------- ------E--R -R--K-RD-R --AAL-AK-N -GT--KG-I- ---------- -KC-QR---K TAIW-W -----E-A-P ATST---N-I ---------- ---------- -K------V- ---------- ------E--R -R--K-RD-R --AAL-AK-N -GT--KG-I- ---------- KKY-KR---K THAI-W -----EIA-P AKST---D-- ---------- ---------- -K-A------ ---------- -----SE-LR -RR-K-RDHR --AAL-AK-N --A--QG-V- ------I--- KK--QR-RNK THAI-P -----EI-DS -KSTAL-N-I ---------- ---------- -K-------- ---Y------ -----TE--R ----K-M-KR --AAL-GE-N --A--QGKVI ---------- KK--Q--R-K AUS-W LMQQVSDSVV TQIHRDFGCE PQYFEPQLPG IKRATSKKIC RSRKYSRIVG SNKINYVMKN LCDIIIERSI PVELVTRRCK RRIIQKEGRS YVQLRHMGGI RTRQDVSSSP EMEQLFTQFC AUS-P --------A- ---YH----- ---------- ---------- ---------- N--------- ---------- ---------E ---------- -------S-- ---------- ---------- HAW-P ----A--F-- ----C----K T--S--HI-- --QS------ KP--H----- NS----I--- ---T----G- ------K--- ---L------ -------N-- -A-------- D--L------ TAIW-P VVA------- -K--GN-E-- TRDLDVAI-- --C-----MW KKQ-S-KLR- ---------- --E--VD-NV ----I-K--R -S-FR-D-KN -------S-G NAPR------ ---K---R-- TAIW-W VIA------- -K--SN-E-- TRDLDVAI-- --C-----MW KKQ-S-K-M- ---------- --E--VD-N- ----I-K--R ---FR-D-KN --R----S-G NAP------- ---R---R-- THAI-W MVA-L----- -K--AN-E-R TPNLDVET-- --C----VTR KKQTQPK-F- ---V------ ------D-N- ----I-K--- ---FRMD-KN --H----D-N NAPR-----S D--K---R-- THAI-P VIA------- -K--SN-E-- TRNIDVAI-- V-C-----LQ KEQ-QF-L-- ---V------ -----VD-N- -I--I-K--- ---FR-D-KN -------D-- NAPR------ ---E--VRL- AUS-W KFLVGHKPFK SENLTFGSSG LIFKPKFADN VGRYFGDYFI VRGRLGGRLF DGRSKLARSI YAKMDQYNDV AEKFWLGFNR AFLRHRKPTD HTCTSDMDVT MCGEVAALAT IILFPCHKIT AUS-P --------L- ---------- ---R---T-- ---------V ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P --------L- -K-------- ---------- ---------V -------K-- ---------V ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---IRRQSV- AAR--H---- ---R-----R I-----E--- T---YA-K-- ---------V RMN-E----I ---------- ---------- -V-------- ---------- ---------- TAIW-W ---IRRQSV- AAR--H---- ---------R I-----E--- T---YA-K-- -------K-V RM--E----- ---------- T-------A- -V-------- ---------- ---------- THAI-W ---IRKQSIN AA---H---- ---------R T-----E--- T---CE-K-- -------K-V RMR-E----- ---------- ---------- -V-------- ---------- ---------- THAI-P ----RRQSV- ASC--H---- ---------R ------E--- T---CE-K-- -------K-V RMR-E----- ---------- ---------- -V-------- ---------- ---------- AUS-W CNTCMIKVKG RVIDEVGEDL NCELERLRET PSSYGGSFGH VSTLLDQLNR VLNARNMNDG AFKEIAKRID AKKESPWTHM TAINNTLIKG SLATGYEFER ASDSLLEIVR WHLKRTESIK AUS-P ---------- ---------- ------Q--- L---E----- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P -----S---- ---------- ---------- L-A------- ---------- ---------- -------K-- E--------- -T-----Y-- ---------- --N--R---- ---------- TAIW-P -----N---- ---------- ---------- L--------- ---------- ---------- ----V--K-- G--------L ---------- -----N--GK -----R---- ---------- TAIW-W -----N---- ---------- ---------- L--------- ---------- ---------- ----V--K-- E--------L ---------- -----N--GK -----R---- ---------- THAI-W -----N---- ---------- ---------- L--------R ---------- ---------- -------K-- E------I-- ---------- ---------- -----R-V-- ---------- THAI-P -----N---- ---------- ---------- L--------- ---------- ---------- -------K-- E--------- ---------- -----N---K ---N-R---- ----------

P1 120

240

360

480

KITC conserved motif for aphid transmission

▼ Cysteine cluster/ zinc finger

▼ ▼ ▼ 600

720

HC-Pro

▼ ▼

■ conserved amino acids involved in protease activity

106

AUS-W AGSVESFRNK RSGKAHFNPA LTCDNQLDKN GNFLWGERQY HAKRFFANYF EKIDHSKGYE YYSQRQNPNG IRKIAIGNLV FSTNLERFRQ QMVEHHIDQG PITRECIALR NNNYVHVCSC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- --I------- ---------- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- ---------- --------R- ---------- ---------- ---------- ---------- ---V-----I ---------- ---------- ---------- ---------- TAIW-W ---------- ---------- --------R- ---------- ---------- ---------- ---------- ---V-----I ---------- -----Y---- ---------- ---------- THAI-W ---------- ---------- --------R- ---------- ---------- ---------- ---------- ---------I ---------- ---------- ---------- ---------- THAI-P ---------- ---------- --------R- ---------- ---------- ---------- --C------- ---------I ---------- ---------- ---------- ---------- AUS-W VTLDDGTPAT SELKTPTKNH IVLGNSGDPK YVDLPTLESD SMYIAKKGYC YMNIFLAMLI NIPENEAKDF TKRVRDLVGS KLGEWPTMLD VATCANQLII FHPDAANAEL PRILVDHRQK AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- P--------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- --------VV ---------- -Q-------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- ------R--- ---------- ---------- ---------- ---------- --------V- ---------- ---------- THAI-P ---------- ---------- ---------- ---------- ------R--- ---------- ---------- ---------- ---------- ---------- ---------- ---------- AUS-W TMHVIDSFGS VDSGYHVLKA NTVNQLIQFA REPLDSEMKH YIVGGEFDPT TNCLHQLIRV IYKPHELRNL LRNEPYLIVI ALMSPSVLLT LFNSGAIEHA LNYWIKRDQD VVEVIILVEQ AUS-P ---------- ------I--- ---------- -D-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -----V---- HAW-P ---------- ------I--- ---------- -D-------- ---------- ---------- --------S- ---------- ---------- ------V--- ---------- -----V---- TAIW-P ---------- ------I--- ---------- ---------- ---------- -S-------- ---------- ---------- ---------- ---------- ---------- -----V---- TAIW-W ---------- ------I--- ---------- ---------- ---------- -S-------- ---------- ---------- ---------- ---------- ---------- -----V---- THAI-W ---------- ------I-N- ---------- ---------- ---------- -S-------- ---------- -------V-- ---------- ---------- ---------- -----V---- THAI-P ---------- ------I--- ---------- ---------- ---------- -S-------- ---------- ---------- ---------- ---------- -S-------- -----V---- AUS-W LCRKVTLART ILEQFNEIRQ NARDIHELMD RNNKPWISYD RSLELLSVYA NSQLTDEGLF KQGFSTLDPK LREAVEKTYA TLLKEEWRAL SLFQKLHLRY FAFKSQPSFS EYLKPKGRAD AUS-P ---------- ---------- ---------- ---------- ---------- ---------L ---------- ---------- ---Q------ ---------- ---------- ---------- HAW-P ---------- ---------- ----L----- ---------- ---------- ---------L ---------R ---------- ---Q------ ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------L ---------R ---------- A--Q------ ---------- ---------- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------L ---------R ---------- A--Q------ ---------- ---------- ---------- THAI-W ---------I ---------- ---------- ---------- ---------- ---------L ---------R ---------- A--Q------ ---------- ---------- ---------- THAI-P ---------- ---------- ---------- ---------- ---------- ---------L ---------R ---------- V--Q------ ---------- ---------- -------C-- AUS-W LKIVYDFSPK YCVHEVGKAL LQPVKAGAEF TSRIINGCGT FIRKSAARGC AYIFKDLFQF VHVVLVLSIL LQIFRSVQGI ATEHIQLKQA KAEMEKQEDF DRLEALYAEL CVKIGEQPTA AUS-P ---------- ---------- ---------- ------S--- -V-------- ----R----- ---------- -----N---- V--------- -------K-- N--------- -I-------- HAW-P ---------- ---------F -L------KI A--------A -------K-- ---------- ---------- ------A--- ----L----- ---V-R-K-- ---------- ---S-----T TAIW-P ---------- --------T- ---I----KI --HL------ -----V---- ---------- ---------- ------A--- ---------- ---V---R-- ---------- ---S-----F TAIW-W --VA------ --------T- ---I-V--KI ---L------ ---------- ---------- ---------- ------A--- ---------- ---V---K-- ---------- ---S-----V THAI-W ---------- ---------- ---I-----I ---LL----- ---------- ---------- ---------- ------A--- -M-------- ---A---K-Y ---------- ---N-D---T THAI-P ---------- ---------- -R-IE---KI ---FMS---- ---R------ ---------- ---------- ------A--- ---------- ---V-R-K-- ---------- ---G------ AUS-W EEFLDFVMER EPRLKDQAYS LIHIPVIHQA KSDNEKKLEQ VIAFITLILM MVDVDKSDCV YRILNKFKGV INSCNTNVYH QSLDDIKDFY EDKQLTIDFD ITGENQINRG PIDVTFEKWW AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------N --Y------- ---------- ---------- -I-------- ---------- ---S------ ------R--- ---------- ---------- ---------- TAIW-P ---------- -------V-- ---------- ---------- ---------- -I-------- ---------- -K---SD--- ------R--- ---------- ---------- -V-------- TAIW-W ---------- -------V-- ---------- ---------- ---------- -I-------- ---------- ---------- ------R--- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- -I-------- ---------- ---------- ------R--- ---------- ---------- ---------- THAI-P ---I------ ---------- ---------- ---------- ---------- -I-------- ---------- -K--D----- ------R--- ---------- ---------- ----------

840

960*** ***** conserved amino acids involved in protease activity

P3

*1080

Mlu1 ▼

1200

1320

CI 1440 6K1

107

AUS-W DNQLSNNNTV GHYRIGGMFV EFSRSNAATV ASEIAHSPER EFLVRGAVGS GKSTNLPFLL SKHGSVLLIE PTRPLCENVC KQLRGDPFHC NPTIRMRGLT AFGSTNITIM TSGFALHYYA AUS-P ---------- -------T-I -----T---- ---------- ---------- ---------- ---S------ ---------- ---------- ---------- ---------- ---------- HAW-P ---------I -------T-- ----V----- ---------- ---------- ---------- ---------- ---------- -----E---- ---------- ---------- ---------- TAIW-P ---------I -------T-- ---------- ---------- ---------- ---------- ----N----- ---------- ----SE---- ---------- --D------- ---------- TAIW-W ---------I -------T-- ---------- ---------- ---------- ---------- ----N----- ---------- -----E---- ---------- ---------- ---------- THAI-W ---------I -------T-- ---------- ---------- ---------- ---------- ---------- ---------- -----E---- ---------- ---------- ---------- THAI-P ---------I -------A-- ----V----- --------D- ---------- ---------- ----N----- ---------- -----E---- ---------- ---------- ---------- AUS-W HNIQQLRLFD FIIFDECHVI DSQAMAFYCL MEGNAVEKKI LKVSATPPGR EVEFSTQFPT KIVTEQSISF KQLVDNFGTG ANSDVTAFAD NILVYVASYN EVDQLSKLLS DKGYLVTKID AUS-P ---------- ---------- ---------- -----I---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- -----I---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- -----I---- ---------- ---------- ---------- ---------- ---------- -V-------- ---------- ---------- TAIW-W ---P------ ---------- ---------- -----I---- ---------- -------Y-- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W --L------- ---------- ---------- -----I---V ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-P --L------- ---------- ---------- -----I---V ---------- ---------I R--------- ---------- ------I--- ---------- ---------- ---------- AUS-W GRTMKVGKTE ISTSGTKSKK HFIVATNIIE NGVTLDIEAV IDFGMKVVPE MDSDNRMIRY SKQAISFGER IQRLGRVGRH KEGIALRIGH TEKGIQEIPE MAATEAAFLS FTYGLPVMTH AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- -------F-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- ----V----- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- -----M---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-P -------R-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- AUS-W NVGLSLLKNC TVRQARTMQQ YELSPFFTQN LVNFDGTVHP KIDVLLRPYK LRDCEIRLSE AAIPHGVQSI WMSAREYEAV GSRLCLEGDV RIPFLIKDVP ERLYKELWDI VQTYKRDFTF AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------- ---------- -----V---- ---------- -L---D---- -G-------- ---------- ---------- ---------- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-----S-- ---------- ----R----- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-----S-- ---------- ----R----- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- -----V---- ---------- ---------- -G-------- ---------- ---------- ---------- THAI-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -G-------- ---------- ---------- -------Y-- AUS-W GRINSVSAGK IAYTLRTDVY SIPRTLITID KLIESENMKH AHFKAMTSCT GLNSSFSLLG IINTIQSRYL VDHSVENIRK LQLAKAQIQQ LEAHVQENNV ENLIQSLGAV RAVYHQGVDG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ------S--- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ----M----- ---------- ------S--- TAIW-P ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------I ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------- ------S--- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------- G-----S--- THAI-P ---------- ---------- ---------- ---------- ---------- ---------- V--------- ---------- ---------- ---------- ---------- ------S--- AUS-W VKHIKRELGL KGIWDGSLMI KDAIICGFTM VGGAMLLYQH FRDKLINVHV FHQGFSARQR QKLRFKSAAN AKLGREVYGD DGTIEHYFGE AYTKKGNKKG KMHGMGVKTR KFVATYGFKP AUS-P ---------- --L------- ---------- A--------- -----T---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P F--------- --V------- ----V----- A--------- ----FT---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-P ---------- --V------- ---LV----- A--------- -----TS--- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- --V------- ---L------ A--------- -----T--Y- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- --V------- ----V----- A--------- -----T-I-- ---------- ---------- ---------- ---------- ---------- R--------- ---------- THAI-P I--------- --V------- ----V----- A--------- -----T---- ---------- -----R---- ------I--- ---------- ---------- R--------- ----------

***** **** 1560

**** conserved nucleotide binding motif

1680

1800

1920

6K22040

NIa ▼

▼ forms covalent bond with viral RNA

2160 Nsi1 ▼

108

AUS-W EDYSYVRYLD PLTGETLDES PQTDISMVQE HFGDIRSKYM DSDSFDKQAL IANNTIKAYY VRNSAKTALE VDLTPHNPLK VCDNKLTIAG FPDREAELRQ TGPPRTIQFD QVPPPSKSVH AUS-P ---------- ---------- ---------- ---------- --------V- ---------- ---------- ---------- ---------- ---------- --------V- ---------- HAW-P ---------- ---------- ---------D --S---R--- ------R--- ---------- ------A--- ---------- ---------- ---------- --------V- ---------- TAIW-P ---------- ---------N ---------- ------N--- E-----R-S- ----V----- ---------- ---------- ---T------ ---------- ----K--LV- -----T---- TAIW-W ---------- ---------- ---------- ------N--- E-----R-S- ----V----- I--------- ---------- ---T------ ---------- ----K--LA- -----T---- THAI-W ---------- ---------- ---------- ------N--- G-----R--- ----V----- ---------- ---------- ---T------ ---------- -------LA- -----T---- THAI-P ---------- ---------- ---------- ------N--- E-----R-S- ----V----- ---------- ---------- ---------- -----S---- -------LAN -----T---- AUS-W HEGKSLCQGM RNYNGIASVV CHLKNTSGDG RSLFGIGYNS FIITNRHLFK ENNGELIVQS QHGKFVVKNT TTLRIAPVGK TDLLIIRMPK DFPPFHSRAR FRAMKAGDKV CMIGVDYQDN AUS-P ---------- ---------- ---------- K--------- ---------- K--------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- --------K- K--------- ---------- --------K- -----I---- ---Q------ ---------- ---------- ---------- --------E- TAIW-P ---------- ---------- --------K- -----V---- ---------- --------K- ---------- ----L----- ---------- ---------- ---------- --------E- TAIW-W ---------- ---------- ---------- -----V---- ---------- --------K- ---------- A---L----- ---------N ---------K ---------- --------E- THAI-W ---------- ---------- ---------- -----V---- ---------- --------K- ---------- S------I-- ---------- ----S----- --T------- --------E- THAI-P ---------- ---------- --------K- -----V---- ---------- --------K- ---------- ---------- ---------- ---------- ---------- --------E- AUS-W HIASKVSETS IISEGTGEFG CHWISTNDGD CGNPLVSVSD GFIVGLHSLS TSTGDQNFFA KIPAQFEEKV LRKIDDLTWS KHWSYNVNEL SWGALKVWES RPEAIFNAQK EVNQLNVFEQ AUS-P ---------- -----M---- ---------- ---------- ---------- ---------- --------NI ---------- ---------- ---------- ---------- ---R------ HAW-P ---------- -------D-- ---------- ---------- ---------- ---------- ---------- ---------- ------I--- ---------- ---------- ---------- TAIW-P ---------- -----M---- S--------- ---------- -Y-------- ---------- ----F----- --R------- ------I--- ---------- ---------- -I-------- TAIW-W ---------- ---------- ---------- ---------- -Y-------- ---------- ----F----- --R------- ---------- ---------- ---------- -I-------- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- ----F----- --R------- ---------- ---------- ---------- -ID------- THAI-P ---------- ---D-S---- ---------- ---------- ---------- ---------- ----L----I --Q------- ------I--- ---------- ---------- -ID------- AUS-W SGSRWLFDKL HGNLKGVSSA SSNLVTKHVV KGICPLFRNY LECNEEAKVF FIPLMGHYMK SVLSKEAYTK DLLKYSSDIV VGEVNHDVFE DSVAQVIELL NDYECPELEY ITDSEVIIQA AUS-P ---H------ ---------- ---------- ---------- ---D------ -N-------- --------I- ---------- ---------- ------V--- --H------- ---------- HAW-P --G------- ---------- P--------- ---------- ---D----A- -S-------- --------I- ---------- ---------- ---------- --H------- ---------- TAIW-P ---------- ---------- ---------- --------S- --------T- -N-------- --------V- --M------I ----D----- E-----V--- --H------- ---------- TAIW-W ---------- ---------- ---------- ---------- --------T- -S-------- --------V- ---------I ----D----- E-----V--- --H------- ---------- THAI-W ---------- ---------- P--------- --V-----S- ---D----A- -S-------- --------V- ---------I ----D----- ---------- --H------- V--------- THAI-P ---------- --S---I--- ---------- ---------- ---D----A- -S-------- --------V- ---------I ----D----- E-----V--- --H------- ---------- AUS-W LNMDAAVGAL YTGKKRKYFE GSTVEHRQAL VRKSCERLYE GKMGVWNGSL KAELRPAEKV LAKKTRSFTA APLDTLLGAK VCVDDFNNWF YSKNMECPWT VGMTKFYKGW DEFLRKFPDG AUS-P -------V-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------- -R-------- ---------- ---------- ---------- ---------- ---------- ---------- ----K----- TAIW-P ---------- ---------- ---------- ---------G -Q-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- TAIW-W ---------- -K-------- -------HT- ---------- -R-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-W ---------- ---------- ---------- ---------- -R-------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- THAI-P ---------- ---------- ----D----- ---------- -R--I----- ---------- ---------- ---------- ---------- ---------- ---------- ---------- AUS-W WVYCDADGSQ FDSSLTPYLL NAVLSIRLWA MEDWDIGEQM LKNLYGEITY TPILTPDGTI VKKFKGNNSG QPSTVVDNTL MVLITMYYAL RKAGYDTKAQ EDMCVFYING DDLCTAIHPD AUS-P ---------- -----I---- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ------A-T- K--------- ----I----- HAW-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- --------T- ---------- ----I----- TAIW-P ---------- ---------- ---------- -------S-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----I----- TAIW-W ---------- ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----I----N THAI-W ----G----- ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----I----- THAI-P ---------- ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- -------E-- KEL------- ----I-----

2280

# #

### (HDC) catalytic triad of protease domain

2400 protease VPg

# 2520

2640 NIb

2760

******* ***** ********* *** ** ******* consensus involved in RNA polymerase function

2880

109

AUS-W HEHVLDSFSS SFAELGLKYD FTQRHRNKQD LWFMSHRGIL IDDIYIPKLE PERIVAILEW DKSKLPEHRL EAITAAMIES WGYGELTQQI RRFYQWVLEQ APFNELAKQG RAPYVSEVGL AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -------H-- ---------- ---------- ---------- HAW-P ---------- ---------- -A-------N ---------- ---------- ---------- ---------- ---------- ----D--H-- ---------- ---------- ---------- TAIW-P ---------- ---------- -N-------- ---------- ---------- ---------- ---------- ---------- ---E---H-- ---------- ---------- ---------- TAIW-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---E---H-- ---------- --Y------- ---------- THAI-W ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -------H-- ---------- ---------- ---------- THAI-P -----V---- ---------- ---------- ---------- -G-T------ ---------- ---------- ---------- -------H-- ---------- ---------- ---------- AUS-W RRLYTSERGS MDELEAYIDK YFERERGDSP ELLVYHESRS VDDYQLVCSN NTHVFHQSKN EAVDAGLNEK LKEKE..KQK EKEKEKQKEK EKDDASDGND VSTSTKTGER DRDVNVGTSG AUS-P ------K--- ---------- ---------- ---------- A--------- ---------- ---------- -R-------- ---------- ---------- ---------- ---------- HAW-P ---------- ---------- ---------- ---------G T--------- ---------- ---------- ---------- ---------- ---G------ ---------- ---------- TAIW-P ------K--- ---------- ---------- ---------- T-NH--TRGS ---------- ----T----- ---------- ----D--QD- DN-G------ ---------- -----A---- TAIW-W ---S------ ---------- ---------- ---------- A--H--A-GS ---------- ---------- -----KE--- ----DE--D- DN-G------ ---------- -----A---- THAI-W ---------- ---------- ---------- ---------- T-------GE S--------- ---------- F--------- -.--D---D- NN-G------ ---------- -----A---- THAI-P ---------- -----V---- ---------- D--------- A--HHF--G- D--------- ---------- ---------R -.--D---G- DNNG------ ---------- -----A---- AUS-W TFTVPRIKSF TDKMILPRIK GKTVLNLNHL LQYNPQQIDI SNTRATQSQF EKWYEGVRNG YGLNDNEMQV MLNGLMVWCI ENGTSPDVSG VWVMMDGETQ VDYPIKPLIE HATPTFRQIM AUS-P ---------- ---------- --P------- ---------- ---------- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- HAW-P ---------- ----V----- ---------- ---------- ------H--- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- TAIW-P ---------- ---------- ---------- -----K-V-- ---------- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- TAIW-W ---------- ---------- ---------- ---------- ---------- --------DD ---------- ---------- -------I-- --------N- ---------- ----S----- THAI-W ---------- ---------- ---------- ---------- ---------- ---------D ---------- ---------- -------I-- ---------- ---------- ----S----- THAI-P ---------- -------K-- ---------- ---------- ---------- ---------D ---------L ---------- -------I-- ---------- AE-------- ----S----- AUS-W VHFSNAAEAY IAKRNATERY MPRYGIKRNL TDISLARYAF DFYEVNSKTP DRAREAHMQM KAAALRNTSR RMFGMDGSVS NKEENTERHT VGDVNRDMHS LLGMRN AUS-P A--------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -E-------- ------ HAW-P A--------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- -E-------- ------ TAIW-P A--------- --------K- ---------- ---------- ---------- ---------- --------N- K--------- ---------- -E-------- ------ TAIW-W A--------- ---------- ---------- ---------- ---------- ---------- --------N- ---------- ---------- -E-------- ------ THAI-W A--------- ---------- ---------- ---------- ---------- ---------- --------G- ---------- ---------- -E---K---- ------ THAI-P A--------- ---------- ---------- ---------- ---------- ---------- -------A-- ---------- ---------- -E-------- ------

Figure 4.5. Alignment of the complete polyprotein of Australian isolates of PRSV-W (AUS-W) and PRSV-P (AUS-P) with

PRSV-P isolates from Hawaii (HAW-P), Taiwan (TAIW-P) and Thailand (THAI-P) and PRSV-W isolates from Taiwan

(TAIW-W) and Thailand (THAI-W). The start of each protein, based on the predicted protease cleavage site, is indicated

with arrows above the alignment. Previously described conserved regions (Yeh et al., 1992) are indicated on the right hand

side.

* 3000

CP (1) CP (2) 3120

3240

3344

x x x xxx DAG Motif involved in aphid transmission

110

4.3.2 Comparison of Australian isolates to other full-length PRSV sequences

The nucleotide and amino acid sequence of the genomes of the two

Australian isolates, AUS-P and AUS-W, were compared to the genome

sequences of PRSV-P isolates from Hawaii (HAW-P), Taiwan (TAIW-P) and

Thailand (THAI-P) and PRSV-W isolates from Taiwan (TAIW-W) and

Thailand (THAI-W) and the divergence calculated for the whole genome

(Table 4.2). The greatest divergence over the whole genome was between

the Australian and Thai PRSV-P isolates (20% nucleotide, 10.3% amino

acid). Variability was associated with geographical origin rather than host

range since AUS-P and AUS-W isolates were closer to each other than to

any of the other isolates and most divergent from the Asian P and W

isolates. Taiwanese P and W isolates were also very close (3% nucleotide,

5.5% amino acid). This very close relationship was not seen with the Thai P

and W isolates which were 12.9% divergent at the nucleotide level. When

phylogenetic trees were generated from the complete genome sequences

(Fig.4.6A.B), the Australian isolates clustered together closely, as did the

Taiwanese isolates. Although more distant, the Thai isolates did diverge from

the same node in the amino acid tree (Fig.4.6B). The Asian isolates were

more closely related to each other and as has previously been demonstrated

in the coat protein, the Hawaiian isolate clustered closely with the Australian

isolates. With the exception of the relationship between the Thai isolates at

the amino acid level, all relationships were supported by high bootstrap

values.

When all isolates were compared to the Australian PRSV-W isolate (Table

4.3), the greatest divergence was seen in the 5’UTR, with maximum

divergence between Taiwanese and Australian isolates (50.7%). In contrast,

the 3’UTR sequences were highly conserved with a maximum of only 6%

divergence (Table 4.3). Interestingly, highest divergence in the 3’UTR was

111

Figure 4.6. Nucleotide (A) and amino acid (B) sequence divergence of full-

length PRSV genomes presented as unrooted phylogenetic trees. The

number of bootstrap trees (/1000) in which particular nodes were found is

shown.

10%

THAI-W

THAI-P

TAIW-W

TAIW -P 10001000

HAW -PAUS-W

AUS-P 1000

1000

1%

THAI-W

THAI-P

447

TAIW-P

TAIW-W

1000

HAW-P

AUS-W

AUS-P

1000

1000

A.

B.

112

TABLE 4.3. Percent divergence between coding regions and corresponding proteins of PRSV isolates compared to AUS-W.

5’UTR P1 HC-Pro

P3 6K1 CI 6K2 VPg NIa-Pro NIb CP 3’UTR

nt 0 3.4 1.8 2.3 0.6 1.7 2.4 2.0 2.0 2.6 2.3 0 AUST-P aa - 5.1 1.5 3.3 0 0.9 7.2 1.1 2.6 2.8 2.6 -

nt 8.9 11.7 7.0 6.2 9.0 7.3 6.1 6.5 6.8 7.5 4.2 6.0 HAW-P

aa - 15.4 3.1 7.0 4.0 2.1 13.2 3.2 3.4 3.0 3.3 -

nt 48.5 37.8 15.7 15.0 12.1 14.9 16.1 22.8 18.5 18.1 11.5 5.0 TAIW-W

aa - 41.5 4.0 6.0 1.9 2.1 11.2 6.0 4.8 3.8 6.8 -

nt 50.7 38.5 15.5 14.6 15.2 14.6 13.8 21.3 18.8 18.9 12.9 3.9 TAIW-P

aa - 41.5 3.6 5.7 8.1 2.6 11.2 6.0 5.2 3.6 8.6 -

nt 39.5 37.5 16.4 15.6 11.2 14.4 13.7 19.8 19.0 18.4 11.0 2.9 THAI-W

aa - 42.5 3.4 6.0 1.9 1.8 11.2 4.9 4.8 3.2 6.1 -

nt 48.1 38.8 15.3 16.4 14.5 16.2 16.1 18.9 19.6 20.0 12.8 2.9 THAI-P

aa - 40.6 3.1 7.0 6.0 2.7 11.2 7.2 5.2 5.2 8.3 -

113

seen in the Hawaiian isolate, which is closest to the Australian isolate in all

other genome regions.

In the coding regions the Asian isolates were most divergent from AUS-W

and for most of the coding regions, variability at the nucleotide level was not

observed in the corresponding amino acid sequences, reflecting functional

constraints on these proteins. The two exceptions to this were the P1 and

6K2 coding regions (Table 4.3). Nucleotide sequence variation in the P1

(compared to AUS-W) was as high as 38.8% (THAI-P/AUS-W) while amino

acid variation was up to 42.5% (THAI-W/AUS-W) indicating a significant

number of nucleotide changes resulted in amino acid changes. This was also

seen in the smaller 6K2. Interestingly the greatest ratio of nucleotide to amino

acid changes in the 6K2 was seen in the Australian and Hawaiian isolates,

those that were phylogenetically closest to the AUS-W.

The most highly conserved coding region was the CI (0.9-2.7% amino acid

divergence) (Table 4.3) and then the order from most to least conserved was

CI < HC-Pro < NIa-pro/NIb < VPg < CP < P3 < 6K1 < 6K2 < P1. 4.3.4 Search for putative host range determinants

The close relationship between the Australian P and W isolate over the whole

genome compared to other isolates is consistent with the theory that PRSV-P

arose from PRSV-W in Australia. Based on studies with other potyviruses

and the high level of similarity between the Australian isolates it is likely that

host range is determined by one or more amino acid changes. Therefore, all

sites in the aligned polyproteins where Australian PRSV-P and -W isolates

differed (Fig. 4.5) were scanned to identify amino acid variation that could

potentially be linked to the ability of PRSV-P to infect papaya. There were a

total of 84 amino acid differences between AUS-P and W spread over the

whole polyprotein (with the exception of the 6K1), however, no site/s were

found where there was a specific amino acid occurring in all P isolates but

not W. This suggests that amino acids associated with host range may be

114

different between the different isolates. Sequences were then analysed to

look for any site where the W isolates were different from the P isolates, even

if the changes were not consistent. (i.e. any site where one P and W were the

same was eliminated). Again, no such site was identified. This suggests that

the actual site/s of mutation may be different between different geographical

pairs. Further experiments including recombination and mutagenesis will be

necessary to determine the site in the Australian isolates.

4.4 Discussion

In this study the genomes of Australian isolates of PRSV-P and -W were

sequenced. The very close relationship between these isolates supports the

theory that PRSV-P arose from PRSV-W (Bateson et al., 1994) although

comparison of these sequences with other full-length PRSV genomes could

not identify the host range determinant/s. The phylogenetic relationship

between Taiwanese and Thai PRSV-P and -W pairs also supports a similar

scenario, although the relationship between the Thai isolates is not as clear-

cut. There is considerable variation in PRSV in Thailand (Chaleeprom, 1997;

Bateson et al., 2002) and it is possible that these two particular isolates have

had considerable time to diverge.

As previously reported, both 5’ and 3’ UTRs were completely conserved in

the Australian isolates (Henderson, 1999; Bateson, 1995), as was the 6K1

protein, eliminating these as potential sites of HRDs. Interestingly, the 5’UTR

was the most variable region between isolates, although the first 23

nucleotides were completely conserved in all PRSV sequences as has

previously been reported for other potyviruses (Shukla et al., 1994). Although

the remaining 5’UTR sequence was highly variable, all isolates retained a

high number (7-10 copies) of the tripeptide repeat (CAA) in this region. The

presence of these repeats was previously noted in Hawaiian and Taiwanese

PRSV isolates (Wang and Yeh, 1997) and suggested to be involved in

efficiency of translation as reported for the omega sequence of TMV.

Variation between PRSV isolates in the 3’UTR was predominantly in the first

115

half of the region with the 3’ terminal half highly conserved in all sequences,

reflecting its putative involvement in specific replicase recognition for minus-

strand synthesis (Shukla et al., 1994).

Of the other coding regions, the CP, previously implicated in virus cell-to-cell

and systemic movement (Dolja et al., 1994; 1995; Lopez-Moya and Pirone,

1998), is unlikely to be a HRD for infectivity in papaya. Since the Australian

mutation appears to be relatively recent (Bateson et al., 1994; Bateson et al.,

2002), and is likely to have occurred only once, it would be expected to be

consistent, at least in Australian P isolates. However, previous studies of

variability in the CP of Australian P and W isolates (Bateson et al., 1994) do

not support this. Interestingly, the variability seen in the coat protein between

these two Australian isolates is slightly higher (2.3% nucleotide, 2.6% amino

acid) than previously reported for Australian isolates (<2%) (Bateson et al.,

1994). Both isolates used in this (and a previous) study were field isolates

and so some natural variation would be expected. As well, the PRSV-P

isolate was collected from the same site as the original PRSV BD isolate

although almost 5 years later. Therefore, the increase in variation in the CP is

most likely natural variation over time.

Of the remaining coding regions, the HC-Pro, P3, CI, NIa (VPg and protease)

and NIb are all relatively conserved at the amino acid level, irrespective of

the variablility at the nucleotide level. There were multiple amino acid

differences between AUS-P and AUS-W in all of these regions, making

identification of putative determinants impossible without further studies. All

of these regions have previously been implicated in movement or

pathogenicity (reviewed in chapter 1) and could potentially be determinants

of host range. Interestingly, the P1 and 6K2 had a high ratio of nucleotide to

amino acid changes. Unlike other coding regions, the P1 and 6K2 regions did

not appear to be restricted by functional constraints. With the exception of

the C-terminal protease activity of the P1, the function of these coding

regions is not well defined. There is no definitive evidence that the P1 is a

host range determinant. Interestingly, although the P1 is highly variable at the

amino acid level there are several blocks of conserved amino acids e.g.

116

amino acids 111-120 are totally conserved in all isolates while in other

conserved blocks amino acid substitutions are conservative. Blocks of

conserved amino acids are also seen in the P1 of other potyviruses such as

Yam mosaic virus (YMV) (Aleman-Verdaguer et al., 1997). The significance

of this is not known. The 6K2 peptide has been implicated in genome

amplification and anchoring of the replication apparatus to ER-like

membranes (these proteins are reviewed in chapter 1). The 6K2 has been

implicated in pathogenicity in PVA (Rajamaki and Valkonen, 1999).

It was interesting to note that the ratio of nucleotide to amino acid changes

(not given) for each coding region was consistently higher in AUS-P and

HAW-P and lower in Asian isolates. The AUS-P and HAW-P mutations are

thought to be relatively recent and this high ratio most likely reflects

continuing adaptation to the new host. This pattern of variation was not

consistent in the 6K1 region. Variation at the nucleotide level increased as

seen for other coding regions with AUS-P the least variable (0.6%), HAW-P

next (9.0%) and then Asian isolates (11.2-15.2%). However at the amino acid

level, with the exception of AUS-P, there was higher amino acid variation in

the P isolates (HAW-P 4%, TAIW-P 8.1%, THAI-P 6%) than the W isolates

(both TAIW-W and THAI-W 1.9%). The absence of differences between

AUS-W and AUS-P in this region eliminates it as a putative HRD, however, it

is possible that increased amino acid mutations in this region reflect

differences in adaptation to host. It has been found that after considerable

time in papaya, PRSV-P is no longer able to infect cucurbits. The Australian

P isolate, a recent mutation, can still be efficiently inoculated to both papaw

and cucurbits (Persley, 1997) and interestingly is very similar to the

Australian W isolate in the 6K1. The 6K1 protein has been implicated with

the P3 in pathogenicity in different hosts (Dallot et al., 2001; Johansen et al.,

2001; Saenz et al., 2001). Amino acid changes in PRSV-P might positively

influence interaction with a host factor in papaya or alternatively might

represent changes resulting from absence of selection as a result of no

interaction. High conservation in the W isolates suggests a potentially

important function in cucurbits. A survey of variation in the 6K1 of current

field isolates of PRSV-P and -W from Australia would be interesting.

117

In conclusion, sequence analysis alone is not sufficient to identify PRSV

HRDs for infection of papaya. In fact, it is possible that each mutation from

PRSV-W to PRSV-P in different geographic locations has involved a different

amino acid and possibly a different genome position, although it is still

possible that changes are occurring in the same general region.

118

CHAPTER 5 LOCALISATION OF PRSV-P AND PRSV-W HOST RANGE DETERMINANTS BY GENERATION OF RECOMBINANT HYBRID PRSV TRANSCRIPTS

5.1 INTRODUCTION

The determinants of plant viral pathogenesis and host range vary

considerably both within and between families and there are a number of

potential stages at which either the virus or the host may block systemic

infection causing these differences (Matthews, 1991). Current advances in

recombinant DNA technology have facilitated the manipulation of infectious

viral clones of many viruses, including potyviruses, using recombination and

mutagenesis to unravel the basis of virus pathogenicity and host range

(Revers et al., 1999; Nicolas et al., 1997; Schaad et al., 1997; Andersen and

Johansen, 1998; Saenz et al. 2000). As a result of this technology, over the

past 5 years, our knowledge of the molecular determinants of host range in

potyviruses has increased dramatically (reviewed in Chapter 1). However,

compared to other virus families the host range determinants and the genes

responsible for replication and movement in potyviruses are still poorly

understood

There is significant circumstantial evidence that PRSV-P arises by mutation

from PRSV-W, at least in Australia (Bateson et al., 1994; Bateson et al.,

2002). The similarity in the genome sequence of these biotypes suggests

that the ability of PRSV-P to infect papaya is the result of a change in one or

more amino acids within the PRSV-W genome (Chapter 4). However,

comparison of Australian isolates of PRSV-P and W with five other full-length

sequences failed to identify one consistent amino acid difference between

PRSV-P and -W that could be attributed to the ability to infect the different

hosts (Chapter 4). Therefore, to identify the molecular host range

determinants, they must first be localised to a particular region of the genome

using recombination of infectious clones and then specific amino acids

implicated by site-directed mutagenesis.

119

This chapter reports the generation of recombinant, hybrid PRSV P/ W

clones and localisation of the molecular host range determinants of PRSV-P

infection of papaya within the PRSV genome.

5.2 METHODS AND MATERIALS

5.2.1 Generation of recombinant PCR products of PRSV-P and PRSV-W

Five different recombinant full-length PCR products made by exchanging

genomic regions between the two Australian isolates of PRSV-P and PRSV-

W, were generated by OE-LD-PCR from recombinant clones p5’Triplet-W,

p5’Triplet-P, pMiddleTriplet-W, pMiddleTriplet-P, p3’Triplet-W, p3’Triplet-P,

pTwin-W and pTwin-P (generated in chapter 3).

5.2.2.1 Construction of pTwin-W+P and pTwin-P+W clones

In order to generate the recombinant PCR products, two additional

recombinant clones were constructed to use as templates in OE-LD-PCR.

Both pTwin-W+P and pTwin-P+W clones were constructed essentially as

previously described for pTwin-P and pTwin–W (section 4.2.7). Plasmid

pTwin-W+P and pTwin-P+W were generated by swapping the insert and

vector fragments from NsiI digested pTwin-W and NsiI digested pTwin-P

(Figure 5.1). Plasmids were screened by digestion with NsiI to confirm the

presence of the inserted fragment and sequenced analysis to confirm the

orientation and integrity of the recombinant clones.

120

Figure 5.1 Strategy for generation of pTwin-W+P from p3’Triplet-P

and pMiddle Triplet-W

7691 bp

NIa

NIb

CP

3’UTR 33A

35ST

p3’Triplet-P pMiddle Triplet-W 7544 bp

P3

CI

NIa 6

VPg

VPg

NsiI NsiI

NsiI

NsiI

NsiI digest & purify insert fragment

NsiI digest & purify vector fragment

insert vector

ligate

pTwin-W+P 10300 bp

P3

CI

6K

NIa

NIb

CP

3’UTR 33A

35ST

NsiI

NsiI VPg

121

5.2.2.2 Amplification of recombinant PCR products by OE-LD-PCR

The five recombinant hybrid full-length PCR products (Fig.5.2) were

generated using various combinations of clones as templates in OE-LD-PCR

(Table 5.1) as previously described for amplification of full-length infectious

PCR products of PRSV-P and PRSV-W (section 4.2.10).

Table 5.1 Summary of clones use to make recombinant infectious PCR

products of PRSV

Recombinant PCR

Product

3’ clone used in OE-LD-PCR

5’ clone used in OE-LD-

PCR

rhPRSV1 (WWP)a pTwin W+P p5'Triplet-W

rhPRSV2 (PWW) pTwin W p5'Triplet-P

rhPRSV3 (PPW) pTwin P+W p5'Triplet-P

rhPRSV4 (WPP) pTwin-P P5'Triplet-W

rhPRSV5 (PWP) pTwin W+P p5'Triplet-P asource of PRSV for 5’, middle, 3’ regions of recombinant product is shown in

brackets

5.2.3 Infectivity of recombinant PCR products The recombinant PCR products and controls (rPRSV-P and rPRSV-W) were

inoculated onto squash cotyledons by microprojectile bombardment (section

3.2.9.1-2) and subsequently onto squash as previously described for rPRSV-

W (section 3.2.9.3). Infectivity was assessed by symptom development,

ELISA and RT-PCR (section 3.2.9.3). Tissue from ELISA positive squash

plants for each rhPRSV and rPRSV-P and W was collected and the tissue

from similar lines pooled and stored at -80oC. This tissue was used to

inoculate papaya.

122

FIGURE 5.2 Recombinant hybrid PCR products of PRSV. Regions derived from PRSV-W are shown in green and

regions derived from PRSV-P are shown in yellow .

P3 CI NIa NIb CP

3’ UTR

33 35S A T P1 HC-Pro 35S 5'

UTR 6K rhPRSV2 (PWW)

P3 CI NIa NIb CP

3’ UTR

33 35S A T P1 HC-Pro

35S 5'

UTR rhPRSV3 (PPW) 6K

CI NIa NIb CP 33 35S A T P1 HC-Pro 5'

UTR 6K 35S rhPRSV4 (WPP) P3 3' UTR

CI NIa NIb CP 6K 33 35S A T P1 HC-Pro 35S

5’ UTR rhPRSV5 (PWP) P3 3'

UTR

rhPRSV1 (WWP) CI NIa NIb CP

3’UTR 33 35S A T P1 HC-Pro 5'

UTR 6K 35S P3

123

Papaya (8 replicates each) was inoculated with infected squash tissue (0.5g

randomly selected from pooled material) 3 times at weekly intervals.

Infectivity in papaya was assessed by symptom development, ELISA and

RT-PCR.

Integrity of the recombinants in vivo was confirmed by RT-PCR of part of the

P3 and NIa-coding regions that overlap the junctions used to generate

recombinant hybrids. RNA was extracted from infected squash and papaya

using a QIAGEN RNeasyR Plant Mini Kit (Roche Diagnostics). First strand

cDNAs were synthesised from extracted RNA using primers NIa-2 and P3M-

R as described in section 2.3.2 and used in a standard PCR reaction (section

2.3.3.2) with primers NIa-1/ NIa-2 or RLS-6/ P3M-R, respectively. PCR

products were gel purified and used directly for sequencing with either NIa-5

or P3S.

5.3 RESULTS 5.3.1 Generation of recombinant PRSV PCR products

As an initial approach to identify the region of the PRSV genome that

incorporated the mutation enabling PRSV-P to infect papaya, a series of

recombinant genomes was assembled that included different combinations

of PRSV-P and W 5’, middle and 3’ regions (Fig.5.1). The regions included

in recombinants were based on the three original clones generated

previously (chapter 3).

Initially, two new P/W hybrid constructs, pTwin-W+P and pTwin-P+W, were

generated, incorporating the middle one third of PRSV-W fused to the 3’ one

third of PRSV-P and the middle one third of PRSV-P fused to the 3’ one third

of PRSV-W, respectively. Plasmid pTwin-W+P was derived from ligation of

the NsiI fragment from pMiddle Triplet-W into the NsiI site of p3’Triplet-P.

The W fragment included bases that encode the P3, CI, 6K and N-terminal

124

49 amino acids of the VPg. This 49 amino acid region of the VPg is identical

between PRSV-P and -W. Similarly, to generate pTwin-P+W, the NsiI

fragment from pMiddle Triplet-P was inserted into p3’Triplet-W. Restriction

digestion with NsiI confirmed the presence and correct size of the insert in

each case. Sequencing across the junction between the two fragments within

the pTwin plasmids confirmed the correct orientation and origin of the PRSV-

P and PRSV-W fragments (Fig.5.3).

Subsequently, five different recombinant hybrid full-length PCR products

(rhPRSV1-5) (Fig.5.1) were generated by LD-OE-PCR. This was achieved

using either pTwin-P+W or pTwin-W+P, in combination with either p5’Triplet-

W or p5’Triplet-P. Since the region overlapping the PRSV-P and -W 5’ and

Twin clones was identical at the amino acid level, it was not necessary to

make a hybrid 5’ clone. Recombinant hybrid PCR products, each 11027 bp

in length were amplified (Fig.5.4).

5.3.2 Infectivity of hybrid PCR products in squash

The integrity of the recombinant hybrid PCR products (rhPRSV1-5) was

assayed initially in squash as all hybrids were expected to be able to infect

squash. Infectivity was initially assessed by ELISA in bombarded squash

cotyledons at 10 days post-bombardment (Tables 5.2 - 5.6). The control

rPRSV-W consistently gave ELISA values of >1.3 in bombarded cotyledons.

Infectivity of cotyledons following bombardment with recombinant hybrid

PRSVs 1-5 was very efficient with 86%, 86%, 94%, 86%, and 93% of

cotyledons, respectively, giving ELISA values >1.3.

Cotyledons were subsequently used to inoculate squash plants and were

assessed for infection at 15 dpi by ELISA and the presence of typical PRSV

symptoms (Tables 5.2 - 5.6).

125

Figure 5.3 Restriction analysis of pTwin-P+W. Lane1: Uncut plasmid; Lane2-4:

NsiI digested plasmid. M: Molecular weight marker X (Roche Diagnostics)

M 1 2 3 4

12216bp

3054bp

126

Figure 5.4 Agarose gel showing 11027bp PCR product representing full-

length recombinant hybrid PRSV amplified by OE-LD-PCR (Lane 1). M:

Molecular weight marker X (Roche Diagnostics).

M 1

11027bp 12216bp

3054bp

127

Table 5.2. Assessment of infectivity of recombinant hybrid PRSV PCR

product, rhPRSV1 (WWP), in squash. Cotyledons were assayed by ELISA

10 days post-bombardment (dpb) and inoculated onto squash plants.

Squash were assayed by ELISA and for symptoms at 15 dpi.

Cotyledons Squash

ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi

Unshot cotyledon 0.125 Buffer only 0.174 0.148 PRSV-W/squashc 1.432 1.382 Healthy squashc 0.182 0.155 rPRSV-W 1.365 1.372+0.05 ++++ Shot # 1 1.394 1.371+0.070 ++++ Shot # 2 1.426 1.296+0.19 -+++ Shot # 3 1.354 1.404+0.04 ++++ Shot # 4 0.218 0.197+0.04 ---- Shot # 5 0.290 0.192+0.02 ---- Shot # 6 1.396 1.389+0.04 ++++ Shot # 7 1.420 1.402+0.04 ++++ Shot # 8 1.368 1.114+0.56 +-++ Shot # 9 1.386 1.365+0.06 ++++ Shot # 10 1.409 1.404+0.02 ++++ Shot # 11 1.362 1.121+0.54 +-++ Shot # 12 1.294 0.215+0.04 ---- Shot # 13 1.428 1.406+0.03 ++++ Shot # 14 1.382 1.396+0.05 ++++ Shot # 15 1.396 1.357+0.07 ++++

a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or no symptoms (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm

128

Table 5.3. Assessment of infectivity of recombinant hybrid PRSV

PCR product, rhPRSV2 (PWW), in squash. Cotyledons were assayed

by ELISA 10 days post-bombardment (dpb) and inoculated onto

squash plants. Squash were assayed by ELISA and for symptoms at

15 dpi.

Cotyledons Squash

ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi

Unshot cotyledon 0.185 Buffer only 0.115 0.143 PRSV-W/squashc 1.433 1.386 Healthy squashc 0.212 0.293 rPRSV-W 1.358 1.405+0.05 ++++ Shot # 1 1.465 1.393+0.03 ++++ Shot # 2 1.438 1.292+0.19 ++-+ Shot # 3 0.241 0.2455+0.07 ---- Shot # 4 1.378 1.413+0.02 ++++ Shot # 5 1.372 1.413+0.02 ++++ Shot # 6 1.437 1.377+0.06 ++++ Shot # 7 1.479 1.420+0.04 ++++ Shot # 8 1.388 1.373+0.04 ++++ Shot # 9 1.388 1.475+0.18 ++++ Shot # 10 1.422 1.411+0.03 ++++ Shot # 11 0.213 0.257+0.06 ---- Shot # 12 1.385 1.424+0.03 ++++ Shot # 13 1.394 1.338+0.07 ++++ Shot # 14 1.437 1.319+0.14 ++++ Shot # 15 1.382 1.39+0.06 ++++

a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm

129

Table 5.4. Assessment of infectivity of recombinant hybrid PRSV PCR

product, rhPRSV3 (PPW), in squash. Cotyledons were assayed by ELISA 10

days post-bombardment (dpb) and inoculated onto squash plants. Squash

were assayed by ELISA and for symptoms at 15 dpi.

Cotyledons Squash

ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi

Unshot cotyledon 0.142 Buffer only 0.193 0.182 PRSV-W/squashc 1.432 1.378 Healthy squashc 0.202 0.193 rPRSV-W 1.458 1.131+0.6 ++-+ Shot # 1 1.389 1.417+0.03 ++++ Shot # 2 0.358 0.269+0.08 ---- Shot # 3 1.395 1.447+0.04 ++++ Shot # 4 1.363 1.387+0.06 ++++ Shot # 5 1.442 1.421+0.06 ++++ Shot # 6 1.386 0.238+0.03 ---- Shot # 7 1.379 1.425+0.07 ++++ Shot # 8 1.466 1.41+0.05 ++++ Shot # 9 1.439 1.417+0.05 ++++ Shot # 10 1.395 1.440+0.05 ++++ Shot # 11 1.379 1.361+0.06 ++++ Shot # 12 1.436 1.423+0.04 ++++ Shot # 13 1.373 1.394+0.04 ++++ Shot # 14 1.366 1.408+0.06 ++++ Shot # 15 1.495 1.459+0.06 ++++ Shot # 16 1.365 1.437+0.04 ++++

a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm

130

Table 5.5. Assessment of infectivity of recombinant hybrid PRSV PCR

product, rhPRSV4 (WPP), in squash. Cotyledons were assayed by ELISA 10

days post-bombardment (dpb) and inoculated onto squash plants. Squash

were assayed by ELISA and for symptoms at 15 dpi.

Cotyledons Squash

ELISAd ELISAa, d Symptomsb Sample 10 dpb 15 dpi 15 dpi

Unshot cotyledon 0.109 Buffer only 0.192 0.138 PRSV-W/squashc 1.374 1.366 Healthy squashc 0.201 0.195 rPRSV-W 1.379 1.385+0.03 ++++ Shot # 1 1.426 1.386+0.03 ++++ Shot # 2 1.375 1.465+0.02 ++++ Shot # 3 1.373 1.395+0.05 ++++ Shot # 4 1.437 1.423+0.05 ++++ Shot # 5 1.427 1.421+0.06 ++++ Shot # 6 1.395 1.410+0.03 ++++ Shot # 7 1.379 1.434+0.04 ++++ Shot # 8 1.329 1.456+0.05 ++++ Shot # 9 1.452 1.385+0.04 ++++ Shot # 10 0.285 0.256+0.04 ---- Shot # 11 1.395 1.409+0.03 ++++ Shot # 12 1.369 1.390+0.06 ++++ Shot # 13 1.395 1.389+0.05 ++++ Shot # 14 0.352 0.231+0.05 ---- Shot # 15 1.427 1.407+0.03 ++++

a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm

131

Table 5.6. Assessment of infectivity of recombinant hybrid PRSV PCR

product, rhPRSV5 (PWP), in squash. Cotyledons were assayed by ELISA 10

days post-bombardment (dpb) and inoculated onto squash plants. Squash

were assayed by ELISA and for symptoms at 15 dpi.

Cotyledons Squash

ELISAd ELISAa, d Symptomsb

Sample 10 dpb 15 dpi 15 dpi

Unshot cotyledon 0.167 Buffer only 0.103 0.095 PRSV-W/squashc 1.364 1.433 Healthy squashc 0.236 0.323 rPRSV-W 1.394 1.423+0.05 ++++ Shot # 1 1.357 1.452+0.03 ++++ Shot # 2 1.386 1.434+0.04 ++++ Shot # 3 1.432 1.334+0.13 +++- Shot # 4 1.428 1.203+0.46 ++-+ Shot # 5 1.385 0.205+0.05 ---- Shot # 6 1.390 1.382+0.06 ++++ Shot # 7 1.375 1.447+0.04 ++++ Shot # 8 1.428 1.414+0.05 ++++ Shot # 9 1.442 1.399+0.06 ++++ Shot # 10 1.394 1.405+0.04 ++++ Shot # 11 1.481 1.383+0.04 ++++ Shot # 12 1.453 1.409+0.03 ++++ Shot # 13 0.251 0.207+0.03 ---- Shot # 14 1.439 1.431+0.03 ++++ Shot # 15 1.390 1.299+0.05 ++-+

a ELISA values are the average of results from 4 squash plants inoculated from infected cotyledons + standard deviation b typical symptoms observed (+) or not (-) for each of the 4 squash plants c ELISA control – frozen tissue dELISA values represent absorbance at 460nm

132

All squash plants inoculated from cotyledons infected with the control

rPRSV-W, with the exception of one plant (see Table 5.4), gave average

ELISA values of >1.1 and showed strong symptoms including severe

mottling distortion and blistering. Of the recombinant hybrids, 45/60 plants of

rhPRSV1, 51/60 plants of rhPRSV2, 56/64 plants of rhPRSV3, 52/60 plants

of rhPRSV4 and 49/60 plants of rhPRSV5 showed typical symptoms of

PRSV infection at 15 dpi. Cotyledons that were negative by ELISA did not

produce symptoms or positive ELISA in squash. Only 4 cotyledons with high

ELISA values failed to produce symptoms or positive ELISA values on any of

the 4 plants inoculated with each cotyledon. Remaining cotyledons that had

positive ELISA values consistently showed symptoms on at least 3 out of 4

inoculated squash plants and had average ELISA values > 1.1 (Tables 5.2-

6). The presence of virus in ELISA positive squash was also confirmed by

RT-PCR using primers to amplify ~900 bp fragments from the P1 and CP-

coding regions (Fig.5.5).

5.3.3 Infectivity of recombinant hybrid PRSVs in papaya

To determine which region of the PRSV-P genome (5’, middle or 3’) was

sufficient to enable infectivity in papaya, squash plants infected with the five

rhPRSVs were inoculated onto papaya plants. Controls included squash

infected with PRSV-P, PRSV-W, rPRSV-P and rPRSV-W. For each rhPRSV,

8 papaya plants were inoculated 3 times each. Plants were assessed by

ELISA and for symptoms at 28 and 45 days after inoculation (Table 5.7). As

expected, no papaya plants inoculated with PRSV-W and rPRSV-W

developed symptoms and all had ELISA values equivalent to background

after 45 days. All papaya plants inoculated with native PRSV-P showed

symptoms that included mottling, distortion and blistering of the plants after

28 days and were positive by ELISA. Plants inoculated with rPRSV-P were

slower to develop symptoms. Only 50% showed some symptoms after 28

days although this increased to 87.5% (7/8 plants) by 45 dpi. However, virus

was detectable by ELISA in all 7 plants at 28 dpi.

133

Figure 5.5 RT-PCR amplification of the P1 and CP coding regions from

rhPRSVs in squash plants that were positive for PRSV by ELISA. Lane 1:

Healthy squash control; Lanes 2, 10: PRSV-W infected squash control; Lane

3: p5’Triplet-W plasmid control; Lanes 4, 12: rPRSV-W infected squash

control; Lanes 5-9: squash infected with rhPRSV1-5; Lane 11: pTwin-W

plasmid control; Lanes 13-17: squash infected with rhPRSV1-5. M: Molecular

weight marker X (Roche Diagnostics).

P1 coding region CP coding region

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M

- 900bp

134

Table 5.7 Assessment of infectivity of rhPRSVs in papaya plants

mechanically inoculated with rhPRSV infected squash. All plants were

inoculated 3 times each at weekly intervals. Symptoms were assessed

at 28 and 45 dpi. Controls are shaded.

ELISAa,c Symptoms ELISAa,c Symptoms Sample 28 dpi 28 dpi 45 dpi 45 dpi

% Infected after 45 daysb

Buffer only 0.093 0.082

Healthy papaya 0.216 0.221

PRSV-W 0.208+0.02 -------- 0.206+0.03 -------- 0%

PRSV-P 1.426+0.04 ++++++++ 1.428+0.04 ++++++++ 100%

rPRSV-W 0.212+0.05 -------- 0.225+0.04 -------- 0%

rPRSV-P 1.198+0.37 ++---+-+ 1.258+0.40 ++++-+++ 87.5%

rhPRSV1 (WWP) 0.881+0.44 -----+-+ 1.056+0.50 -+-+-+++ 75%

rhPRSV2 (PWW) 0.23+0.05 -------- 0.238+0.05 -------- 0%

rhPRSV3 (PPW) 0.216+0.03 -------- 0.219+0.03 --------- 0%

rhPRSV4 (WPP) 1.107+0.43 ++----++ 1.266+0.40 +++++-++ 88%

rhPRSV5 (PWP) 0.96+0.5 -++----+ 1.109+0.60 +++-++-+ 75% a ELISA values are average of 8 plants + std deviation b % plants infected based on ELISA values at 45 dpi c ELISA values represent absorbance at 460nm

135

At least 75% of papaya inoculated with rhPRSV1 (WWP), rhPRSV4 (WPP)

and rhPRSV5 (PWP) developed typical PRSV-P symptoms by 45 dpi. All

plants with symptoms had positive ELISA values at both 28 dpi and 45 dpi

(Table 5.7). One plant inoculated with rhPRSV1 (WWP) was ELISA positive

at 28 and 45 dpi but was not recorded as showing symptoms after 45 days.

No papaya plants inoculated with rhPRSV2 (PWW) or rhPRSV3 (PPW) had

developed symptoms by 45 days or had ELISA values above background

(Table 5.7). The presence/absence of virus in plants infected with rhPRSV1-

5 was confirmed by RT-PCR of the P1 and CP-coding regions (Fig.5.6). PCR

products of ~900 bp were amplified from rhPRSV1, 4 and 5 but no products

were detected from plants inoculated with rhPRSV2 and 3. Based on these

results, it can be deduced that the host range determinant/s enabling PRSV

to infect papaya are located in the 3’ one third of the genome that includes

the NIa (VPg/ NIa-pro), NIb, or CP. 5.3.4 Confirmation of the integrity of rhPRSVs in vivo

To confirm that infection attributed to rhPRSVs, particularly in papaya, was

not a result of reversion to wild-type or contamination, RT-PCR was used to

generate PCR products that spanned both the NsiI site in the VPg and the

MluI site in the P3. These sites delineated the junction between PRSV-P and

PRSV-W sequences in the recombinants. The regions on both sides of the

junctions were sequenced and confirmed the presence of nucleotides/amino

acids definitive of PRSV-P or -W in recombinants.

136

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M

P1 coding region CP coding region

Figure 5.6 RT-PCR analysis of P1 and CP coding regions of rhPRSVs in

inoculated papaya plants. Lane 1: Healthy papaya control; Lane 2, 10: PRSV-P

infected papaya control; Lane 3: p5’Triplet-P plasmid control; Lane 4, 12:

rPRSV-P infected papaya control, Lane 5-9: papaya inoculated with rhPRSV1-

5, Lane11: pTwin-P plasmid control, Lane 13-17: papaya inoculated with

rhPRSV1-5. M: Molecular weight marker X (Roche Diagnostics).

- 900bp

137

5.4 Discussion

In this study, the OE-LD-PCR system for generating infectious rPRSVs has

proven effective for development and testing of recombinant hybrids of

Australian PRSV-P and -W isolates and has targeted the PRSV HRDs to the

3’ region of the genome.

Five full-length recombinant hybrid PRSVs were generated by exchanging

regions of PRSV-P and –W genomes. The overlapping PCR strategy

facilitated the generation of these hybrids as only two new clones had to be

generated (pTwin-P+W and pTwin–W+P). It was important to ensure that the

region of overlap was completely conserved (at the amino acid level) when

generating recombinant hybrids otherwise the resulting PCR clones would be

a mixed population in the overlapping regions. The region of the P3 that

overlapped between the p5’Triplet clones and the pTwin clones was

conserved between Australian PRSV-P and -W isolates. All five recombinant

hybrids infected at least 86% of squash cotyledons and at least 75% were

successfully mechanically inoculated onto squash plants. Recombinants that

did not include the 3’ end of PRSV-P genome (rhPRSV2, 3) did not infect

papaya. Efficiency of infection of recombinant hybrids that were infectious in

papaya (rhPRSV1, 4, 5) was generally lower (75-88%) than wild type PRSV-

P (100%) after 45 days. However, the rPRSV-P control was also less

efficient than wild type i.e. at 45dpi 87.5% of papaya was infected. This was

clearer at 28dpi when all wild type inoculated plants were doubled in

symptoms but only 50% of those inoculated with rPRSV-P. This difference in

efficiency is not likely to be due to the inoculation method since all infections

were first established in squash and only ELISA positive squash were used

for inoculation. In initial studies (Chapter 3) the efficiency of infectivity of

rPRSV-P was 100% at 45dpi (with the exception of 3 plants from 2 shots)

although at 28dpi it ranged from 50-100%, again slower than wild type.

Although it was demonstrated that rPRSVs produced typical virions and

symptoms, it is possible that either the sequence cloned represents a less

efficient variant or the construct itself renders the virions less efficient. As

previously discussed in chapter 3 the composition of the 3’ end of the clone

138

can influence its infectivity. In these constructs, there is a short poly A tail (33

nucleotides) followed by a nos terminator. It is not known if extra nucleotides

will be present on the RNA transcript as a result of the terminator or if native

signals in the 3’UTR will generate a wild type transcript. Interestingly,

rhPRSV4 & 5, each containing approximately 70% of the PRSV-P genome

were slightly more efficient than rhPRSV1 with only 30% of the PRSV-P

genome. These experiments need to be repeated several times before any

significance can be attributed to this observation.

In this study, the NIa, NIb and CP coding regions and 3’ UTR were

implicated as sites that may endode PRSV HRDs for infectivity in papaya.

The 3’UTRs can be eliminated as they are identical between Australian

PRSV-P and -W isolates. In other potyviruses, the CP-coding region has

been implicated in virus cell-to-cell and systemic movement (Dolja et al.,

1994; 1995; Lopez-Moya and Pirone, 1998) (reviewed in chapter 1). A single

amino acid change in the CP was able to alter movement of two PSbMV

isolates in Chenopodium quinoa (Anderson and Johansen, 1998), although

this amino acid did not govern movement in all PSbMV isolates, suggesting

involvement of other regions/amino acids. In this case, the ability of different

isolates to infect a particular host appeared to relate to their ability to move in

the host. While it is clear that PRSV-W does not infect papaya systemically, it

is not known if it can replicate in papaya cells or move locally in inoculated

leaves. This could be investigated further in the future. It is unlikely,

however, that the CP-coding region is responsible for determining PRSV

host range in papaya. Earlier studies that compared the sequence of the CP-

coding region of 6 isolates of PRSV-P and -W from Australia (Bateson et al.,

1994) did not identify any amino acid changes that correlated with biotype.

As it is likely that the Australian P population only recently diverged and most

likely has only mutated once, we would expect the HRD to be consistent at

least in Australian isolates. As well, a study by Henderson (1999) determined

that PRSV-P could not complement PRSV-W in trans when co-inoculated

onto papaya. In other studies, mutations in the CP core that affected

assembly with RNA, cell-to-cell and systemic movement were rescued in

trans by transgenic CP (Dolja et al., 1994; 1995). The CP has also been

139

eliminated as the site of HRDs in Taiwanese isolates when the PRSV-W CP-

coding region was engineered to replace the PRSV-P CP-coding region in a

Taiwanese PRSV-P infectious clone. The recombinant clone was still able to

infect papaya (Yeh et al., 1997)

The NIb is the potyviral RdRp or replicase and has not been directly

implicated as a host range determinant, although it was recently

demonstrated that the NIb replicase of a strain of PVY (PVY MSNR) was the

elicitor of a hypersensitive response in root knot nematode resistant tobacco

i.e. functioned as an avirulence factor (Fellers et al., 2002). The authors

noted that in other examples of potyvirus virulence, the proteins did not

induce a hypersensitive response. PRSV-W does not induce a HS response

on papaya. There is considerable evidence that host factors are required for

template specific RNA-dependent RNA synthesis of plus-strand viruses

(reviewed in Lai, 1998). RdRP preparations purified from virus infected cells

usually contain cellular proteins which, when removed, result in loss of

replicase activity or specificity (Lai, 1998). In TMV and BMV the eukaryotic

translation initiation factor eIF-3 was shown to be associated with the viral

RdRP (Quadt et al., 1993; Osman and Buck, 1997). More recently, the NIb

of ZYMV was reported to bind to a host poly-(A) binding protein (Wang et al.,

2000). These demonstrated associations with host factors open up the

possibility for the involvement of the NIb as a determinant of pathogenicity.

Interestingly, approximately half (14/29) of the amino acid differences

between the Australian P and W isolates in the region identified in this

chapter were in the NIb.

The remaining coding region, the NIa, comprises the VPg domain and

protease domain. There were six (out of 29) changes in this region between

Australian -P and –W isolates. The protease domain of the NIa is involved in

cleavage of the 3’ two thirds of the potyviral genome. While the activity of this

domain is essential for infectivity, there is no evidence to date that the

protease domain interacts with any host factors and as such has not been

implicated in host range.

140

On the other hand, the VPg domain has been implicated in pathogenicity in a

number of different potyviruses including PVY (Masuta et al., 1999),TVMV

(Nicolas et al., 1997), PSbMV (Keller et al., 1998; Borgstrom and Johansen,

2001) and PVA (Rajamaki and Valkonen, 1999; Rajamaki and Valkonen,

2002). There is evidence for the involvement of the VPg in host range at the

level of both movement and replication. In several examples where amino

acid changes in the VPg were able to break resistance, resistant isolates

were able to infect inoculated leaves but not move systemically. Changes in

the VPg enabled vascular movement. This was the case with PVY (Masuta

et al., 1999) and TVMV (Nicolas et al., 1997) infection of tobacco carrying the

va resistance gene, and PVA infection of Nicandra physaloides (Rajamaki

and Valkonen, 1999) and Solanum commensonii (Rajamaki and Valkonen,

2002). In contrast, where the VPg of PSbMV pathotypes was implicated in

overcoming resistance in Pisum sativum, no replication of non-resistance

breaking pathotypes of PSbMV could be detected in protoplasts from

resistant P.sativum lines (Keller et al., 1998), suggesting that replication,

rather than movement, was being affected. As previously mentioned, it is not

known if PRSV-W can replicate or move in inoculated leaves.

In all of the above examples, the amino acid changes that were implicated as

HRDs predominantly occurred in a 30 amino acid region of the VPg

approximately 100 amino acids from the N terminus of the VPg. In some

cases a single mutation e.g. a K/R105E change in PVY (Masuta et al., 1999),

a V116M in PVA (Rajamaki and Valkonen, 1999) or a H118Y in PVA

(Rajamaki and Valkonen, 2002) was sufficient to overcome resistance. In

other cases, multiple mutations within this region were shown to be

necessary e.g. four amino acid changes (SP..RN ->CS..KS) in TVMV

(Nicolas et al., 1997) and three changes (FVT->VRS) in PSbMV (Borgstrom

and Johansen, 2001) were identified. Interestingly, in PVA, while a V116M

change could break resistance, a second change L185S, just up from the

VPg/pro cleavage site also enabled the virus to overcome resistance

although systemic infection was much slower (Rajamaki and Valkonen,

1999). In Australian PRSV isolates there are only two amino acid differences

in the VPg (Figure 4.5). The first A116V is in the same variable region of the

141

VPg implicated in other potyviruses (discussed above). The second amino

acid difference F176V, occurs slightly upsteam (~ 9 amino acids) of the

L185S change, which was implicated in breaking resistance in PVA

(Rajamaki and Valkonen, 1999). It is possible that one or perhaps both of

these changes is responsible for PRSV-P being able to infect papaya.

In none of the studies where complementation was tested, was the action of

the VPg of the one isolate able to be complemented by the resistance

breaking isolate (Nicolas et al., 1997; Rajamaki and Valkonen, 1999;

Borgstrom and Johansen, 2001). This is similar to results reported by

Henderson (1999) who demonstrated that PRSV-P could not complement

PRSV-W and support infection of papaya. Borgstrom and Johansen (2001)

demonstrated that expression of complementing VPg from elsewhere in the

genome was not sufficient to complement and hypothesised that the activity

of the VPg is in cis rather than trans and requires expression from it’s normal

genome position.

The mechanism of action of the VPg in determining host range in the

previous examples is not completely understood. Evidence suggests the VPg

is not eliciting a defence response in the plant that is preventing infection

(Borgstrom and Johansen, 2001). It has been suggested that because the

resistance that is overcome by mutations in the VPg is recessive, e.g. the va

gene in tobacco (Nicolas et al., 1997; Masuta et al., 1998) and sbm-1 gene in

P. sativum (Keller et al., 1998), this reflects the absence of a host factor to

interact with the virus i.e. the dominant form of these genes encode a host

factor that interacts with the virus to enable infection (Borgstrom and

Johansen, 2001). The only host factors so far demonstrated to interact with

the VPg are the eukaryotic translation initiation factors eIF4E (Schaad et al.,

2000; Ruffel et al., 2002) and eIF(iso)4E (Wittman et al., 1997) (reviewed in

chapter 1). An eIF(iso)4E-binding domain of 35 amino acids (amino acids 59-

93) that is highly conserved among potyviruses, was identified in the N

terminus of the TuMV VPg (Leonard et al., 2000). Mutation of D77, even with

related amino acids, prevented interaction of the VPg and eIF(iso)4E and

prevent the virus from infecting. It has been shown that this/these factors are

142

essential for virus replication but nonessential for plant function (Duprat et

al., 2002). In PRSV, the region in the VPg corresponding to the binding

domain comprises amino acids 2152 to 2186 (Figure 4.5). With the exception

of an S2180N mutation in TAIW-P, this region is completely conserved. This

region does not correspond to the region of the VPg implicated in most other

potyviruses. Therefore, if it is the VPg determining host range in PRSV, it is

unlikely due to interaction with eIF4E or eIF(iso)4E. Alternatively, some other

as yet unknown host factor that interacts with the centre and/or C terminus of

the VPg is implicated.

143

CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS

As a family, the Potyviridae have a wide host range although it is much

narrower at the level of genera. Although substantial advances have been

made in recent years in understanding the molecular biology of the

interactions between potyviruses and their hosts, potyvirus molecular host

range determinants are still not well characterised. The more we understand

about the molecular basis for the host range of the viruses, the greater the

chance to develop effective control methods to limit virus spread.

It is generally accepted that plant viruses spread intercellularly by an active

process involving the interplay of specific viral and host factors. The nature of

the host factors required for virus movement is poorly understood, but for

most plant viruses the movement process involves one or more specialized

virus encoded movement proteins (MPs) Jansen et al., 1998; Citovsky et al.,

1990; Waigmann et al., 1994; Ding et al., 1995). Although the potyviral

genome does not encode a dedicated MP, movement functions have been

allocated to several multifunctional proteins making the process of identifying

host range determinants more complex.

PRSV is an important virus of cucurbits and papaya and has caused

devastation in many countries, particularly in papaya. Control of PRSV has

been very difficult using traditional methods. Approaches have included

generation of interspecific hybrids between Carica papaya and wild Carica

species (Manshardt, 1992; Magdalita et al., 1997) and mild strain cross

protection (Yeh and Gonsalves, 1984; Rezende and Pacheco, 1998; Wang et

al., 1987) although in general these methods have had limited success.

More recently, genetically engineered PRSV resistant transgenic papaya

have been used with success to control PRSV in Hawaii (reviewed in

Gonsalves, 1998) and are being developed for other countries including

Thailand (Chowpongpang, 2002) and Australia (Lines et al., 2002).

Interestingly, this resistance is strain specific and although plants are

immune to local isolates, resistance can be overcome by as little as 4%

144

difference (Tennant et al., 1994). Studies of PRSV has demonstrated high

levels of variation within and between different countries (Bateson et al.,

2002) and much of this has arisen from movement of plants between

countries, particularly in Asia (Bateson et al., 2002). As a result, methods to

restrict introduction of papaya from other geographic regions is still important

in association with transgenic resistance. As well, there is evidence that

mutation also occurs and contributes to variability (Bateson et al., 2002)

although the frequency of occurrence or complexity of this mutation is not

known. Therefore, the significance of cucurbits in the spread of PRSV-P is

unknown. Understanding the nature of the mutation will enable us to better

map the molecular epidemiology of PRSV and to understand the significance

of movement from cucurbits to papaya in the spread of PRSV around the

world.

In this study, full-length infectious PCR products of PRSV-P and –W and five

different recombinant hybrids of PRSV-P and –W were generated to identify

the sequence(s) coding for the host range difference between PRSV-P and –

W. Although the results of this thesis did not identify the specific amino acid

changes for this host range difference it was concluded that: (1) there were

no major differences between the two genomes of Australian PRSV isolates

that could account for the different host range suggesting molecular host

range determinants are likely to be amino acid changes rather than

insertions/ deletions; (2) in the entire seven full-length genomes of PRSV–P

and –W analysed, there were no consistent amino acid change/s found that

can account for the host range difference and therefore the specific

mutation/s may be different in each geographic pair; (3) the molecular host

range determinants enabling PRSV to infect papaya are found in the 3’

region of the genome that encodes the VPg, NIa protease, NIb and CP.

The most challenging part of this project was the generation of infectious

clones. Although PRSV-P of Hawaiian and Taiwanese isolates have been

successfully cloned and multiplied in E.coli (Chiang and Yeh, 1997), it was

not possible to clone the full-length genome of the Australian isolates,

145

reflecting the sequence variation between these isolates and those for

Hawaii and Taiwan. The genome was able to be cloned in two parts, but,

addition of the 5’ clone appeared to make the clone toxic, even at low copy

number. This is very similar to that reported for PSbMV P1 and P4

(Johansen, 1996). Attempts to generate infectious clones of many viruses

including some potyviruses, have reportedly had toxicity-associated

problems where they cannot be propagated efficiently in E.coli (Gritsun and

Gould, 1995; Herchenroder et al., 1995; Yang et al., 1998b; Fakhfakh et al.,

1996; Tellier et al., 1996; Lopez-Moya et al., 2000; Yamshchikov et al.,

2001). To circumvent this problem, alternative strategies were developed.

Insertion of an intron was investigated as it has been successful for other

potyviruses, as introns will not be spliced in bacteria and so disrupts the toxic

sequence (Yamshchikov et al, 2001). Introns must place in the correct

position in the genome where they can interrupt the sequences generating

toxic products (Johansen, 1996; Lopez-Moya and Garcia, 2000). In this

study, insertion of an intron into the P1 coding region of the full-length PRSV-

W clone did not stabilise the clone in E.coli. It was hoped to stop expression

of viral sequences from upstream promoters e.g. CaMV35S, LacZ etc. The

intron used (St-LS1 IV2 intron) was the same as that used by Johansen

(1996) for PSBMV and has also been used to prevent expression of barnase

(Hanson et al., 1999) which is extremely toxic. Since it was subsequently

shown using the OL-LD-PCR system that the intron is correctly processed to

produce infectious virus, it is likely that the intron was not placed in a suitable

position in the genome to interrupt the generation of toxic products in

bacteria. It is likely that these toxic sequences are being transcribed from

cryptic sites within the P1, HC-Pro or P3 of the PRSV genome and that these

sites are not present in Taiwanese and Hawaiian sequences. Johansen

(1996) demonstrated that, although PSbMV pathotypes P1 and P4 are

closely related viruses, regions of P4 were toxic in E.coli while P1 could be

cloned. By placing introns in a number of positions, including the P3, it was

possible to overcome the toxicity. Therefore, in future, manipulation of

infectious PRSV clones to incorporate introns in alternative and possibly

multiple regions could be investigated.

146

Full-length PCR products incorporating the CaMV 35S promoter and

terminator have previously been use for infectivity studies using particle

bombardment without cloning to overcome toxicity-associated problems

(Fakhfakh, 1996). Using the same theory, full-length infectious PCR products

of PRSV-P and –W, incorporating a CaMV 35S promoter and terminator

were generated using OE-LD-PCR, overcoming the problem of assembling a

full-length PRSV-W in one single clone in E.coli. Overlapping PCR has

previously been used to generate full-length viral PCR products to overcome

the same problem, including Hepatitis C (Wang et al., 1997) and Tick-borne

encephalitis virus (Gritsun and Gould, 1995). Long-distance PCR using a

mixture of thermostable DNA polymerases, one which has high processivity

and the other with a 3’-5’ exonuclease activity, allows amplification of much

longer templates with minimal sequence alterations, as the proof reading

enzyme removes pairing mismatches (Barnes, 1994). Non-specific

amplification is a major weakness of long-distance PCR, and could not be

generated in standard PCR, as the annealing sites would be too far apart

(Wang et al., 1997). Using OE-LD-PCR to generate infectious recombinant

hybrids of PRSV (exchanging the different regions of two strains) was easier

and quicker without the need for a final cloning step.

Infectivity experiments of five different hybrids of PRSV localised the host

range determinants of PRSV to the 3’ end of the genome. Based on previous

literature, it was concluded that the most likely candidate for the HRD is the

VPg (Chapter 5). Recently Chen et al. (2003) reported that recombination of

infectious clones of PRSV-P and W from Taiwan had localised the HRD for

infectivity of papaya to the NIa. This supports the studies undertaken here as

well as the hypothesis that the HRD are in the VPg.

As there is no consistent change between PRSV-P and -W sequences when

all seven are aligned it will be interesting to see which HRD are significant for

the overseas isolates. In Australian isolates there are only two amino acid

differences in the VPg (A->V and F->V) and these changes occur in regions

of the VPg previously implicated in pathogenicity in potyviruses (Fig. 6.1). At

the position of the A->V change there is an A->S change in Thai isolates but

147

no corresponding change in Taiwanese isolates. However, there is an S->N

change just upstream (towards the highly conserved N terminus) and an I->V

change just downstream of this region. At the position of the F->V mutation

in Australian isolates there is an A->V change in Taiwanese isolates but the

Thai sequences are identical (A). However, there is a D->N change in the

next position. If, as evidence suggests, the VPg is the site of the HRDs, it

may be that multiple changes are necessary as all pairs of isolates have at

least two amino acid differences in comparable regions. This could cause a

conformational change so that the PRSV-P VPg is then able to interact with

the papaya host factor. However, since PRSV-P can still infect cucurbits it

must still be able to interact with the cucurbit host factor. Although the

regions incorporating the changes do not correspond to the eIF4 binding

region, it is likely that the VPg interacts with many host proteins involved in

transcription, translation and movement. At least 10 different tomato proteins

were identified in yeast two-hybrid studies as interacting with the VPg of TEV

(Schaad et al., 2000).

As discussed in Chapter 1 and 5, the VPg has been implicated in host range

in a number of studies. There is evidence for a role both in movement and

replication of potyviruses (Nicolas et al., 1997; Schaad et al., 1997; Rajamaki

and Valkonen, 1999; Hamalainen et al., 2000, Keller et al., 1998). It is not

known at what level that resistance to PRSV-W in papaya is occurring.

PRSV-W does not produce any symptoms (lesions etc) on papaya and so

resistance could be acting at the level of replication. In future, it would be

useful to investigate replication of these infectious PCR products in papaya

protoplasts.

148

S-N I-V A-V

D-N A-S G-E T-N A-S

A-V F-V

K-R V-I

eIF4 binding domain

Central region linked to pathogenicity

C-terminal region linked to pathogenicity

Aus P/W

Taiw P/W

Thai P/W

Figure 6.1.Diagramatic representation of VPg of PRSV-P & W showing amino acid differences (below lines)

between pairs of geographic isolates.

149

Even if the determinants are identified, the mechanism by which this occurs

still needs to be defined

Interestingly, cucurbits (Cucurbitaceae) and papaya (Caricaceae) are

reasonably closely related (Hutchinson, 1969). PRSV-W resistance genes

have been identified in cucurbits (Wai and Grummet, 1995; Wai et al. 1997)

and this resistance has been linked to resistance to other potyviruses such

as ZYMV. There is also resistance to PRSV-P in some wild Carica species

(Horovitz and Jimenez, 1967). Since a natural recessive resistance gene

(pvr2) that confers resistance to PVY in pepper has been shown to

correspond to an eIF4E gene (Ruffel et al., 2002), it will be interesting in

future to see if inability of PRSV-P to infect other Carica sp. is due to the

same mechanism as the resistance to PRSV-W in Carica papaya.

Although the changes in the host range of PRSV VPg in Australia were only

V-A mutations, a recent report for Pepper mild mottle virus (Hagiwara et al.,

2002) suggests a V-A change in the viral replicase was able to influence viral

accumulation, indicating that if occurring in the appropriate position, this

change can be significant.

In conclusion, in this project an effective system was developed for

generation of recombinant infectious PRSV that overcame problems with

toxicity. Sequence analysis of the full genomes confirmed the close

relationship of PRSV-P and -W in Australia and supported the hypothesis

that PRSV-P arose by mutation from PRSV-W. Using this system of

recombinant clones and sequence data, the HRD of PRSV has been

localised to the 3’ end of the genome and it appears likely that the host range

differences are mediated by one or two V-A changes in the VPg. Further

recombination and site-directed mutagenesis experiments are now required

to confirm the involvement of these changes and accurately identify the

HRDs of PRSV in Australia.

150

REFERENCES

Aleman-Verdaguer, M.E., Goudou-Urbino, C., Dubern, J., Beachy, R.N. and

Fauquet, C. (1997). Analysis of the sequence diversity of the P1, HC, P3,

NIb and CP genomic regions of several Yam mosaic potyvirus isolates:

implications for the intraspecies molecular diversity of potyviruses. Journal of

General Virology 78, 1253-1264.

Anandalakshimi, R., Pruss, G.J., Ge, X., Marathe, R., Mallory, A.C., Smith,

T.H. and Vance, V.B. (1998). A viral suppressor of gene silencing in plants.

Proceedings of the National Academy of Sciences of the United States of

America 93, 13079-13084.

Andersen, K. and Johansen, I.E. (1998). A single conserved amino acid in

the coat protein gene of Pea seed-borne mosaic potyvirus modulates the

ability of the virus to move systemically in Chenopodium quinoa. Virology

241, 304-311.

Andrejeva, J., Puurand, U., Merits, A., Rabenstein, F., Jarvekulg, L. and

Valkonen, J.P.T. (1999). Potyvirus helper component-proteinase and coat

protein (CP) have coordinated functions in virus-host interactions and the

same CP motif affects virus transmission and accumulation. Journal of

General Virology 80, 1133-1139.

Arbatova, J., Lehto, K., Pehu, E. and Pehu, T. (1998). Localization of the P1

protein of Potato Y potyvirus in association with cytoplasmic inclusion bodies

and in the cytoplasm of infected cells. Journal of General Virology 79, 2319-

2323.

Atabekov, J.G. and Dorokhov, Y.L. (1984). Plant virus-specific transport

function and resistance of plants to viruses. Advances in Virus Research 29,

313-364.

151

Atreya, C.D., Atreya, P.L., Thornbury, D.W. and Pirone, T.P. (1992). Site-

directed mutations in the potyvirus HC-Pro gene affect helper component

activity, virus accumulation and symptom expression in infected tobacco

plants. Virology 191, 106-111.

Atreya, C.D. and Pirone, T.P. (1993). Mutational analysis of the helper

component-proteinase gene of a potyvirus: effects of amino acid

substitutions, deletions and gene replacement on virulence and aphid

transmissibility. Proceedings of the National Academy of Sciences of the

United States of America 90, 11919-11923.

Atreya, P.L., Lopez-Moya, J.J., Chu, M., Atreya, C.D. and Pirone, T.P.

(1995). Mutational analysis of the coat protein N-terminal amino acids

involved in potyviral transmission by aphids. Journal of General Virology 76,

265-270.

Attasart, P., Charoensilp, G., Kertbundit, S., Panyim, S. and Juricek, M.

(2002). Nucleotide sequence of a Thai isolate of Papaya ringspot virus type

W. Acta Virologica 46, 241-246.

Barnes, W.M. (1994). PCR amplification of up to 35kb DNA with high fidelity

and high yield from bacteriophage templates. Proceedings of the National

Academy of Sciences of the United States of America 91, 2216-2220.

Bateson, M.F. (1995). Developing transgenic resistance for potyviruses. PhD

Thesis, Queensland University of Technology, Australia.

Bateson, M. and Dale, J. (1992). The nucleotide sequence of the coat protein

gene and 3' untranslated region of Papaya ringspot virus type W (Aust).

Archives of Virology 123, 101-109.

Bateson, M.F., Henderson, J., Chaleeprom, W., Gibbs, A.J. and Dale, J.L.

(1994). Papaya ringspot potyvirus: isolate variability and the origin of PRSV-

P (Aust). Journal of General Virology 75, 3547-3553.

152

Bateson, M.F., Lines, R.E., Revill, P., Chaleeprom, W., Ha, C.V., Gibbs, A.J.

and Dale, J.L. (2002). On the evolution and molecular epidemiology of the

potyvirus Papaya ringspot virus. Journal of General Virology 83, 2575-2585.

Bayot, R.G., Villegas, V.N., Magdalita, P.M., Jovellana, M.D., Espino, T.M.

and Exconde, S.B. (1990). Seed transmissibility of Papaya ringspot virus.

Philippine Journal of Crop Science 15, 107-111.

Blanc, S., Ammar, E.D., Garcia-Lampasona, S., Dolja, V.V., Llave, C., Baker,

J. and Pirone, T.P. (1998). Mutations in the potyvirus helper component

protein: effects on interaction with virions and aphid stylets. Journal of

General Virology 79, 3119-3122.

Blanc, S., Lopez-Moya, J., Wang, R., Gracia-Lampasona, S., Thornbury,

W.D. and Pirone, T.P. (1997). A specific interaction between coat protein and

helper component correlates with aphid transmission of a potyvirus. Virology

231, 141-147.

Borgstrom, B. and Johansen, I.E. (2001). Mutations in Pea seed borne

mosaic virus genome-linked protein VPg alter pathotype-specific virulence in

Pisum sativum. Molecular Plant Microbe Interactions 14, 707-714.

Boyer, J.C. and Haenni, A.L. (1994). Infectious transcripts and cDNA clones

of RNA viruses. Virology 198, 415-426.

Boyer, J.C., Drugeon, G., Seron, K., Morch-Devignes, M.D., Agnes, F. and

Haenni, A.L. (1993). In vitro transcripts of Turnip yellow mosaic virus

encompassing a long 3' extension or produced from a full-length cDNA clone

harbouring a 2kb-long PCR amplified segment are infectious. Research in

Virology 144, 339-348.

153

Brantley, J.D. and Hunt, A.G. (1993). The N-terminal protein of the

polyprotein encoded by the potyvirus Tobacco vein mottle virus is an RNA-

binding protein. Journal of General Virology 74, 1157-1162.

Brigneti, G., Voinnet, O., Li, W.X., Ji, L.H., Ding, S.W. and Baulcombe, D.C.

(1998). Viral pathogenicity determinants are suppressors of transgene

silencing in Nicotiana benthamiana. EMBO Journal 17, 6739-6746.

Brugidou, C., Holt, C., Yassi, M.N., Zhang, S., Beachy, R. and Fauquet, C.

(1995). Synthesis of an infectious full-length cDNA clone of Rice yellow

mottle virus and mutagenesis of the coat protein gene. Virology 206, 108-

155.

Carrington, J.C. and Dougherty, W.G. (1987). Processing of the Tobacco

etch virus 49K protease requires autoproteolysis. Virology 160, 355-362.

Carrington, J.C. and Freed, D.D. (1990). Cap-independent enhancement of

translation by a plant potyvirus 5' nontranslated region. Journal of Virology

64, 1590-1597.

Carrington, J.C. and Herndon, K.L. (1992). Characterization of the potyviral

HC-Pro autoproteolytic cleavage site. Virology 187, 308-315.

Carrington, J.C., Cary, S.M. and Dougherty, W.G. (1988). Mutational

analysis of Tobacco etch virus polyprotein processing: cis and trans

proteolytic activities of polyproteins containing the 49-kilodalton proteinase.

Journal of Virology 62, 2313-2320.

Carrington, J.C., Cary, S.M., Parks, T.D. and Dougherty, G. (1989). A

second proteinase encoded by a plant potyvirus genome. EMBO Journal 8,

365-370.

154

Carrington, J.C., Haldeman, R., Dolja, V.V. and Restrepo-Hartwig, M.A.

(1993). Internal clevage and trans-proteolytic activities of the VPg-proteinase

(NIa) of Tobacco etch potyvirus in vivo. Journal of Virology 67, 6995-7000.

Carrington, J.C., Jensen, P.E. and Schaad, M.C. (1998). Genetic evidence

for an essential role for potyvirus CI protein in cell-to-cell movement. Plant

Journal 14, 393-400.

Chaleeprom, W.S. (1996). Genome analysis of Papaya ringspot potyvirus

and a related virus. PhD Thesis, Queensland University of Technology,

Australia.

Chen, S., Das, P. and Hari, V. (1994). In situ localization of ATPase activity

in cells of plants infected by maize dwarf mosaic potyvirus. Archives of

Virology 134, 433-439.

Chen, K.C., Wang, C.H., Liu, F.L., Su, W.C. and Yeh, S.D. (2003). The NIa

gene of Papaya Ringspot Virus is the host determinant for papaya infection.

7th International Congress of Plant Molecular Biology, Barcelona (Abstract).

Cheng, S., Fockler, C., Barnes, W.M. and Higuchi, R. (1994). Effective

amplification of long targets from cloned inserts and human genomic DNA.

Proceedings of the National Academy of Sciences of the United States of

America 91, 5695-5699.

Chiang, C.H. and Yeh, S.D. (1997). Infectivity assays of in vitro and in vivo

transcripts of papaya ringspot potyvirus. Botanical Bulletin of Academia

Sinica 38, 153-163.

Choi, I, Horken, K.M., Stenger, D.C. and French, R. (2002). Mapping of the

P1 proteinase cleavage site in the polyprotein of Wheat streak mosaic virus

(genus Tritimovirus). Journal of General Virology 83, 443-450.

155

Chowpongpang, S. (2002). Development of genetically engineered

resistance to Papaya Ringspot Potyvirus (PRSV) in Thailand. PhD Thesis,

Queensland Univesity of Technology, Australia.

Citovsky, V., Knorr, D., Schuster, G. and Zambryski, P. (1990). The P30

movement protein of tobacco mosaic virus is a single-strand nucleic acid

binding protein. Cell 60, 637-647.

Commandeur, U., Jarausch, W., Li, Y., Koenig, R. and Burgermeister, W.

(1991). cDNAs of beet necrotic yellow vein virus RNAs 3 and 4 are rendered

biologically active in a plasmid containing the cauliflower mosaic virus

35Spromoter. Virology 185, 493-495.

Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M.C. and Carrington,

J.C. (1995). Long-distance movement factor: a transport function of the

potyvirus helper component proteinase. Plant Cell 7, 549-559.

Dallot, S., Douine, L.Q., Saenz, P., Cervera, M.T., Garcia, J.A. and Quiot,

J.B. (2001). Identification of plum pox virus determinants implicated in

specific interactions with different Prunus spp. Phytopathology 91, 159-164.

Daròs, J.A. and Carrington, J.C. (1997). RNA binding activity of NIa

proteinase of tobacco etch potyvirus. Virology 237, 327-336.

Daròs, J.A., Schaad, M.C. and Carrington, J.C. (1999). Functional analysis of

the interaction between VPg-proteinase (NIa) and RNA polymerase (NIb) of

tobacco etch potyvirus, using conditional and suppressor mutants. Journal of

Virology 73, 8732-8740.

De La Rosa, M. and Lastra, R. (1983). Purification and partial

characterization of Papaya ringspot virus. Phytopathologische Zeitschrift

106, 329-336.

156

Derrick, P.M., Barker, H. and Oparka, K.J. (1992). Increase in

plasmodesmatal permeability during cell-to-cell spread of Tobacco rattle

virus from individually inoculated cells. Plant Cell 4, 1405-1412.

Dersch, P., Fsihi, H. and Bremer, E. (1994). Low-copy-number T7 vectors for

selective gene expression and efficient protein overproduction in Escherichia

coli. FEMS Microbiology Letters 123, 19-26.

Dickinson, V.J. (1996). The product of maize streak virus ORF V1 is

associated with secondary plasmodesmata and is first detected with the

onset of viral lesions. Virology 220, 51-59.

Ding, B. (1998). Intercellular protein trafficking through plasmodesmata.

Plant Molecular Biology 38, 279-310.

Ding, S.W., Li, W.X. and Symons, R.H. (1995). A novel naturally occurring

hybrid gene encoded by a plant RNA virus facilitates long distance virus

movement. EMBO Journal 14, 5762-5772.

Dolja, V.V., Haldeman-Cahill, R., Montgomery, A.E., Vandenbosch, K.A. and

Carrington, J.C. (1995). Capsid protein determinants involved in the cell-to-

cell and long-distance movement of tobacco etch potyvirus. Virology 206,

1007-1016.

Dolja, V.V., Haldeman, R., Robertson, N.L., Dougherty, G.W. and Carrington,

J.C. (1994). Distinct functions of capsid protein in assembly and movement

of tobacco etch potyvirus in plants. EMBO Journal 13, 1482-1491.

Dolja, V.V., McBride, H.J. and Carrington, J.C. (1992). Tagging of plant

potyvirus replication and movement by insertion of �-glucuronidase into the

viral polyprotein. Proceedings of the National Academy of Sciences of the

United States of America 89, 10208-10212.

157

Domier, L.L., Franklin, K.M., Hunt, A.G., Rhoads, R.E. and Shaw, J.G.

(1989). Infectious in vitro transcripts from cloned cDNA of potyvirus, tobacco

vein mottling virus. Proceedings of the National Academy of Sciences of the

United States of America 86, 3509-3513.

Domingo, E., Martinez-Salas, E., Sobrino, F., De la Torre, J.C., Portela, A.,

Ortin, J., Lopez-Galindez, C., Perez-Brena, P., Villaneuva, N., Najera, R.,

Vandepol, S. and Steinhauer, D., De Polo, N., Holland, J. (1985). The

quasispecies (extremely heterogenous) nature of viral RNA genome

populations: biological relevance. A review. Gene 40, 1-8.

Dougherty, W.G. and Carrington, J.C. (1988). Expression and function of

potyviral gene products. Annual Review of Phytopathology 26, 123-143.

Dougherty, W.G. and Hiebert, E. (1980). Translation of potyvirus RNA in

rabbit reticulocyte lysate: reaction conditions and identification of capsid

protein as one of the products of in vitro translation of tobbaco etch and

pepper mottle viral RNAs. Virology 10, 466-474.

Dougherty, W.G. and Parks, T.D. (1991). Post-translational processing of the

tobacco etch virus 49-kDa small nuclear inclusion polyprotein: identification

of an internal cleavage site and delimitation of VPg and proteinase domains.

Virology 183, 449-456.

Dougherty, W.G., Parks, T.D., Cary, S.M., Bazan, J.F. and Fletterick, R.J.

(1989). Characterization of the catalytic residues of the tobacco etch virus

49-kDa proteinase. Virology 172, 302-310.

Duprat, A., Caranta, C., Revers, F., Menand, B., Browning, K.S. and

Robaglia, C. (2002). The Arabidopsis eukaryotic initiation factor (iso)4E is

dispensable for plant growth but required for susceptibility to potyviruses.

The Plant Journal 32, 927-934.

158

Edwardson, J.R. and Christie, R.G. (1986). Viruses infecting forage legumes.

Florida Agriculture Experiment Station Monograph series 4.

Edwardson, J. R. and Christie, R.G. (1991). The potyvirus group. Volumes I-

IV, Florida Agricultural Experiment Station Monograph series 16.

Fang, G., Zhu, G., Burger, H., Keithly, J.S. and Weiser, B. (1998). Minimizing

DNA recombination during long RT-PCR. Journal of General Virology 76,

139-148.

Fakhfakh, H., Vilaine, F., Makni, M. and Robaglia, C. (1996). Cell-free

cloning and biolistic inoculation of an infectious cDNA of potato virus Y.

Journal of General Virology 77, 519-523.

Fedorkin, O.N., Merits, A., Lucchesi, J., Solovyev, A.G., Saarma, M.,

Morozov, S.Yu. and Makinen, K. (2000). Complementation of the movement-

deficient mutations in potato virus X: potyvirus coat protein mediates cell-to-

cell trafficking of C-terminal truncation but not deletion mutant of potexvirus

coat protein. Virology 270, 31-42.

Fellers, J. P., Tremblay, D., Handest, M.F. and Lommel, S.A. (2002). The

Potato virus Y MSNR NIb-replicase is the elicitor of a veinal necrosis-

hypersensitive response in root knot nematode resistant tobacco. Molecular

Plant Pathology 3, 145-152.

Fellers, J., Wan, J., Hong, Y., Collins, G.B. and Hunt, A.G. (1998). In vitro

interactions between a potyvirus-encoded, genome-linked protein and RNA-

dependent RNA polymerase. Journal of General Virology 79, 2043-2049.

Fernandez, A. and Garcia, J.A. (1996). The RNA helicase CI from plum pox

potyvirus has two regions involved in binding to RNA. FEBS Letters 338,

206-210.

159

Fernandez, A., Lain, S. and Garcia, J.A. (1995). RNA helicase activity of the

plum pox potyvirus CI protein expressed in Escherichia coli. Mapping of an

RNA binding domain. Nucleic Acids Research. 23, 1327-1332.

Flasinski, S., Gunasinghe, U.B., Gonzales, R.A. and Cassidy, B.G. (1996).

The cDNA sequence and infectious transcripts of peanut stripe virus. Gene

171, 299-300.

Frenkel, M.J., Jilka, J.M., McKern, N.M., Strike, P.M., Clark, J.M., Shukla,

D.D. and Ward, C.W. (1991). Unexpected sequence diversity in the amino

terminal ends of the coat proteins of strains of sugarcane mosaic virus.

Journal of General Virology 72, 237-247.

Fujiwara, T., Giesman-Cookmeyer, D., Ding, B., Lommel, S. and Lucas, W.J.

(1993). Cell-to-cell trafficking of macromolecules through plasmodesmata

potentiated by the Red clover necrotic mosaic virus movement protein. Plant

Cell 5,1783-1794.

Gallie, D.R., Sleat, D.E., Watts, J.W., Turner, P.C. and Wilson, T.M.A.

(1987). A comparison of eukaryotic viral 5'-leader sequences as enhancers

of mRNA expression in vivo. Nucleic Acids Research 15, 8693-8711.

Gal-On, A. and Raccah, B. (2000). A point mutation in the FRANK motif of

the potyvirus helper component-protease gene alters symptom expression in

cucurbits and elicits protection against the severe homologous virus.

Phytopathology 90, 467-473.

Gal-On, A., Antignus, Y., Rosner, A. and Raccah, B. (1991). Infectious in

vitro RNA transcripts derived from cloned cDNA of the cucurbit potyvirus,

Zucchini yellow mosaic virus. Journal of General Virology 72, 2639-2643.

160

Gal-On, A., Meiri, E., Elman, C., Gray, D.J. and Gaba, V. (1997). Simple

hand-held devices for the efficient infection of plants with viral-encoding

constructs by particle bombardment. Journal of General Virology 64, 103-

110.

Gal-On, A., Meiri, E., Huet, H., Hua, J. W., Raccah, B. and Gaba, V. (1995).

Particle bombardment drastically increases the infectivity of cloned DNA of

zucchini yellow mosaic potyvirus. Journal of General Virology 76, 3223-3227.

German-Retana, S., Candresse, T., Alias, E., Delbos, R. and Le, G,O (2000).

Effects of green fluorescent protein or ß-glucuronidase tagging on the

accumulation and pathogenicity of a resistance-breaking Lettuce mosaic

virus isolate in susceptible and resistant lettuce cultivars. Molecular Plant

Microbe Interactions 13, 316-324.

Gonsalves, D. (1998). Control of papaya ringspot virus in papaya: a case

study. Annual Review of Phytopathology 36, 415-437.

Gonsalves, D. and Ishii, M. (1980). Purification and serology of papaya

ringspot virus. Phytopathology 70, 1028-1032.

Govier, D.A. and Kassanis, B. (1974). A virus-induced component of plant

sap needed when aphids acquire potato virus Y from purified preparations.

Virology 61, 420-426.

Govier, D.A., Kassanis, B. and Pirone, T.P. (1977). Partial purification and

characterization of the potato virus Y helper component. Virology 78, 306-

314.

Greber, R.S. (1978). Watermelon mosaic virus I & II in Queensland cucurbit

crops. Australian Journal of Agricultural Research 29, 235-1245.

Gritsun, T.S. and Gould, E.A. (1995). Infectious transcripts of tick-borne

encephalitis virus, generated in days by RT-PCR. Virology 214, 611-618.

161

Gritsun, T.S. and Gould, E.A. (1998). Development and analysis of a tick-

borne encephalitis virus infectious clone using a novel and rapid strategy.

Journal of Virological Methods 76, 109-120.

Guo, D., Merits, A. and Saarma, M. (1999). Self-association and mapping of

interaction domains of helper component-proteinase of potato A potyvirus.

Journal of General Virology 80, 1127-1131.

Guo, D., Rajamäki, M.L., Saarma, M. and Valkonen, J.P. (2001). Towards a

protein interaction map of potyviruses: protein interaction matrixes of two

potyviruses based on the yeast two-hybrid system. Journal of General

Virology 82, 935-939.

Hall, J.S., Adams, B., Parsons, T.J., French, R., Lane, L.C. and Jensen, S.G.

(1998). Molecular cloning, sequencing, and phylogenetic relationship of a

new potyvirus: Sugarcane mosaic virus, and a reevaluation of the

classification of the potyviridae. Molecular Phylogenetics and Evolution 10,

323-332.

Hanson, B., Engler, D., Moy, Y., Newman, B., Ralston, E. and Gutterson, N.

(1999). A simple method to enrich an Agrobacterium-transformed population

for plants containing only T-DNA sequences. Plant Journal 19, 727-734.

Harrison, B.D. and Robinson, D.J. (1988). Molecular variation in vector-borne

plant viruses: epidmiological significance. Philosophical Transactions of the

Royal Society of London. Series B: Biological Sciences 321, 447-462.

Hayes, R.J. and Buck, K.W. (1990). Infectious cucumber mosaic virus RNA

transcribed in vitro from clones obtained from cDNA amplified using the

polymerase chain reaction. Journal of General Virology 71, 2503-2508.

162

Hagiwara, K., Ichiki, T.U., Ogawa, Y., Omura, T. and Tsuda, S. (2002). A single amino acid substitution in 126-kDa protein of Pepper mild mottle virus

associates with symptom attenuation in pepper; the complete nucleotide

sequence of an attenuated strain, C-1421. Archives of Virology 147, 833-

840.

Hämäläinen, J.H., Kekarainen, T., Gebhardt, C., Watanabe, K.N. and

Valkonen, J.P. (2000). Recessive and dominant genes interfere with the

vascular transport of Potato virus A in diploid potatoes. Molecular Plant-

Microbe Interactions 13, 402-412.

Henderson, J. (1999). Towards identification of host range determinants of

Papaya ringspot potyvirus. PhD Thesis. Queensland University of

Technology, Australia

Herchenroder, O., Turek, R., Neumann-Haefelin, D., Rethwilm, A. and

Schneider, J. (1995). Infectious proviral clones of chimpanzee foamy virus

(SFVcpz) generated by long PCR reveal close functional relatedness to

human foamy virus. Virology 214, 685-689.

Higuchi, R., Krummel, B. and Saiki, R.K. (1998). A general method of in vitro

preparation and specific mutagenesis of DNA fragments: study of protein and

DNA interactions. Nucleic Acids Research 16, 7351-7367.

Hjulsager, C.K., Lund, O.S. and Johansen, I. E. (2002). A new pathotype of

Pea seed-borne mosaic viruse explained by properties of the P3-6K1- and

viral genome-linked protein (VPg)-coding regions. Molecular Plant-Microbe

Interactions 15, 169-171.

Hollings, M. and Brunt, A.A. (1981). Potyviruses. In:Handbook of plant virus

infections and comparative diagnosis. Kurstak E. (ED) Elsevier/north-Holland

Biomedical Press, Amsterdam, Netherlands.

163

Holy, S. and Aboul-Haidar, M.G. (1993). Production of infectious in vitro

transcripts from a full-length clover yellow mosaic virus cDNA clone. Journal

of General Virology 74, 718-784.

Hong, Y. and Hunt, A.G. (1996). RNA polymerase activity catalyzed by a

potyvirus-encoded RNA-dependent RNA polymerase. Virology 226, 146-151.

Hong, Y., Levay, K., Murphy, J.F.,Klein, P.G., Shaw, J.G. and Hunt, A.G.

(1995). A potyvirus polymerase interacts with the viral coat protein and VPg

in yeast cells. Virology 214, 159-166.

Horovitz, S and Jimenenz, H. (1967). Cruzamientos interspecificos e

intergenéricos en Caricaceas y sus implicaciones fitotécnicas. Agron. Trop.

(Maracay) 17, 323-343.

Hutchinson, J. (1969). Evolution and phylogeny of flowering plants.

Academic Press.

Jagadish, M.N., Huang, D. and Ward, C.W. (1993). Site-directed

mutagenesis of a potyvirus coat protein and its assembly in Escherichia coli.

Journal of General Virology 74, 893-896.

Jakab, G., Droz, E., Brigneti, G., Baulcombe, D. and Malnoe, P. (1997).

Infectious in vivo and in vitro transcripts from a full-length cDNA clone of

PVY-N605, a Swiss necrotic isolate of potato virus Y. Journal of General

Virology 78, 3141-3145.

Jansen, K.A., Wolfs, C.J., Lohuis, H., Goldbach, R.W. and Verduin, B.J.

(1998). Characterization of the brome mosaic virus movement protein

expressed in E. coli. Virology 242, 387-394.

164

Jenner, C.E., Tomimura, K., Ohshima, K., Hughes, S.L. and Walsh, J.A.

(2002). Mutations in Turnip mosaic virus P3 and cylindrical inclusion proteins

are separately required to overcome two Brassica napus resistance genes.

Virology 300, 50-59.

Jensen, D.D. (1949). Papaya virus diseases with special reference to papaya

ringspot. Phytopathology 39, 191-211.

Johansen, I.E. (1996). Intron insertion facilitates amplification of cloned virus

cDNA in Escherichia coli while biological activity is reestablished after

transcription in vivo. Proceedings of the National Academy of Sciences of the

United States of America 93, 12400-12405.

Johansen, I.E., Keller, K.E., Dougherty, W.G. and Hampton, R.O. (1996).

Biological and molecular properties of a pathotype P-1 and a pathotype P-4

isolate of pea seed-borne mosaic virus. Journal of General Virology 77, 1329-1333.

Johansen, I.E., Lund, O.S., Hjulsager, C.K. and Laursen, J. (2001).

Recessive resistance in Pisum sativum and potyvirus pathotype resolved in a

gene-for-cistron correspondence between host and virus. Journal of Virology

75, 6609-6614.

Kadare, G. and Haenni, A.L. (1997). Virus-encoded RNA helicases. Journal

of Virology 71, 2583-2590.

Kasschau, K.D. and Carrington, J.C. (1995). Requirement for HC-Pro

processing during genome amplification of tobacco etch potyvirus. Virology

209, 268-273.

Kasschau, K.D. and Carrington, J.C. (1998). A counter defensive strategy of

plant viruses: suppression of post-transcriptional gene silencing. Cell 95,

461-470.

165

Kasschau, K.D. and Carrington, J.C. (2001). Long-distance movement and

replication maintenance functions correlate with silencing suppression

activity of potyviral HC-Pro. Virology 285, 71-81.

Kasschau, K.D., Cronin, S. and Carrington, J.C. (1997). Genome

amplification and long-distance movement functions associated with the

central domain of tobacco etch potyvirus helper component-proteinase.

Virology 228, 251-262.

Keller, K.E., Johansen, E.I., Martin, R.R. and Hampton, R.O. (1998).

Potyvirus genome-linked protein (VPg) determines pea seed-borne mosaic

virus pathotype-specific virulence in Pisum sativum. Molecular Plant-Microbe

Interactions 11, 124-130.

Kim, D., Han, J.S., Lew, J., Kim, S.S., Kang, B.H., Hwang, D.C., Jang, D.S.,

Kim, W., Song, B.D. and Choi, K.Y. (1998). Effects of mutations in the C-

terminal region of NIa protease on cis-cleavage between NIa and NIb.

Virology 241, 94-100.

Kim, D.H., Park, Y.S., Kim, S.S., Lew, J., Nam, H.G. and Choi, K.Y. (1995).

Expression, purification and identification of a novel self-cleavage site of the

NIa C-terminal 27-kDa protease of turnip mosaic potyvirus C5. Virology 213,

517-525.

Klein, P.G., Klein, R.R., Cerezo, E.R., Hunt, A.G. and Shaw, J.G. (1994).

Mutational analysis of the tobacco vein mottling virus genome. Virology 204,

759-769.

Koonin, E.V. (1991). The phylogeny of RNA-dependent RNA polymerases of

positive-strand RNA viruses. Journal of General Virology 72, 2197-2206.

Lai, M.M.C. (1998). Cellular factors in the transcription and replication of viral

RNA genomes: a parallel to DNA-dependent RNA transcription. Virology

244, 1-12.

166

Lai, C.J., Zhao, B., Hori, H. and Bray, M. (1991). Infectious RNA transcribed

from stably cloned full-length cDNA of dengue type 4 virus. Proceedings of

the National Academy of Sciences of the United States of America 88, 5139-

5143.

Lain, S., Martin, M.T., Riechmann, J.L. and Garcia, J.A. (1991). Noval

catalytic activity associated with positive-strand RNA virus infection: nucleic

acid-stimulated ATPase activity of the plum pox potyvirus helicaselike

protein. Journal of Virology 65, 1-6.

Lain, S., Riechmann, J.L. and Garcia, J.A. (1990). RNA helicase: a noval

activity associated with a protein encoded by a positive strand RNA virus.

Nucleic Acids Research 18, 7003-7006.

Langenberg, W.G. and Zhang, L. (1997). Immunocytology shows the

presence of tobacco etch virus P3 protein in nuclear inclusions. Journal of

Structural Biology 118, 243-247.

Lecoq, H., Dafalla, G., Desbiez, C., Wipf-Scheibel, C., Delecolle, B., Lanina,

T., Ullah, Z. and Grumet, R. (2000). Biological and molecular

characterization of Moroccan watermelon mosaic virus and potyvirus isolate

from Eastern Sudan. Plant Disease 85, 547-552.

Leonard, S., Plante, D., Wittmann, S., Daigneault, N., Fortin, M.G. and

Laliberte, J.F. (2000). Complex formation between potyvirus VPg and

translation eukaryotic initiation factor 4E correlates with virus infectivity.

Journal of Virology 74, 7730-7737.

Li, X.H. and Carrington, J.C. (1993). Nuclear transport of tobacco etch

potyviral RNA-dependent RNA polymerase is highly sensitive to sequence

alterations. Virology 193, 951-958.

167

Li, X.H., Valdez, P., Olvera, R.E. and Carrington, J.C. (1997). Function of the

tobacco etch virus RNA polymerase (NIb): subcellular transport and protein-

protein interaction with VPg/ proteinase (NIa). Journal of Virology 71, 1598-

1607.

Lines, R.E. (2002). Development of virus resistant papaya in Australia and

Vietnam. PhD Thesis. Queensland University of Technology, Australia.

Lines, R.,E., Persley, D., Dale, J.L., Drew, R. and Bateson, M.F. (2002).

Genetically engineered immunity to Papaya ringspot virus in Australian

papaya cultivars. Molecular Breeding 10, 1119-129.

Lopez-Moya, J.J. and Garcia, A.J. (2000). Construction of a stable and highly

infectious intron-containing cDNA clone of plum pox potyvirus and its use to

infect plants by particle bombardment. Virus Research 68, 99-107.

Lopez-Moya, J. and Pirone, T.P. (1998). Charge changes near the N-

terminus of the coat protein of two potyviruses affect virus movement.

Journal of General Virology 79, 161-165.

Lopez-Moya, J.J., Fernandez-Fernandez, M.R., Cambra, M. and Garcia, J.A.

(2000). Biotechnological aspects of Plum pox virus. Journal of

Biotechnology. 76, 121-136.

Lopez-Moya, J.J., Wang, R.Y. and Pirone, T.P. (1999). Context of the coat

protein DAG motif affects potyvirus transmissibility by aphids. Journal of

General Virology 80, 3281-3288.

Magdalita, P.M., Persley, D.M., Godwin, I.D., Drew, R.A. and Adkins, S.W.

(1997). Screening Carica papaya x C. cauliflora hybrids for resistance to

papaya ringspot virus-type P. Plant Pathology 46, 837-841.

168

Mahajan, S., Dolja, V.V. and Carrington, J.C. (1996). Roles of the sequence

encoding tobacco etch virus capsid protein in genome amplification:

requirements for the translation process and a cis-active element. Journal of

General Virology 70, 4370-4379.

Maia, I.G. and Bernardi, F. (1996). Nucleic acid-binding properties of a

bacterially expressed potato virus Y helper component-proteinase. Journal of

General Virology 77, 869-877.

Maiss, E., Timpe, U., Brisske-Rode, A., Lesemann, D.E. and Casper, R.

(1992). Infectious in vivo transcripts of a plum pox potyvirus full-length cDNA

clone containing the cauliflower mosaic virus 35S RNA promoter. Journal of

General Virology 73, 709-713.

Manshardt, R.M. (1992). Papaya. In: Biotechnology of Perennial Fruit Crops.

R.E.Litz (Ed) CAB International, 489-511.

Maoka, T., Kashiwazaki, S., Tsuda, S., Usugi, T. and Hibino, H. (1996).

Nucleotide sequence of the capsid protein gene of papaya leaf-distortion

mosaic potyvirus. Archives of Virology 141, 197-204.

Masuta, C., Nishimura, M., Morishita, H. and Hataya, T. (1999). A single

amino acid change in viral genome-associated protein of potato virus Y

correlates with resistance breaking in "virgin A mutant" tobacco.

Phytopathology 89, 118-123.

Matthews, R.E.F. (1991). Plant Virology. Academic Press Inc., California.

Merits, A., Guo, D. and Saarma, M. (1998). VPg, coat protein and five non-

structural proteins of potato A potyvirus bind RNA in a sequence-unspecific

manner. Journal of General Virology 79, 3123-3127.

Meyerhans, A., Vartanian, J.P. and Wain-Hobson, S. (1990). DNA

recombination during PCR. Nucleic Acids Research 18, 1687-1691.

169

Mora-Aquilera, G., Nieto-Angel, D., Teliz, D. and Campbell, C.L. (1993).

Development of a prediction model for papaya ringspot in Veracruz, Mexico.

Plant Disease 77, 1205-1211.

Mori, M., Mise, K., Kobayashi, K., Okuno, T. and Furusawa, I. (1991).

Infectivity of plasmids containing brome mosaic cDNA linked to the

cauliflower mosaic virus 35S RNA promoter. Journal of General Virology 72,

243-246.

Mowat, W.P. and Dawson, S. (1987). Detection and identification of plant

viruses by ELISA using crude sap extracts and unfractionated antisera.

Journal of Virological Methods 15, 233-247

Murphy, J.F., Rhoads, R.E., Hunt, A.G. and Shaw, J.G. (1990). The VPg of

tobacco etch virus RNA is the 49-kDa proteinase or the N-terminal 24-kDa

part of the proteinase. Virology 178, 285-288.

Nagel, J. and Hiebert, E. (1985). Complementary DNA cloning and

expression of the papaya ringspot potyvirus sequences encoding capsid

protein and a nuclear inclusion like protein in E. coli. Virology 143, 435-441.

Nicolas, O, Pirone, T.P. and Hellmann, G.M. (1996). Construction and

analysis of infectious transcriptsfrom a resistance-breaking strain of tobacco

vein mottling potyvirus. Archives of Virology 141,1535-1552.

Nicolas, O., Dunnington, S.W., Gotow, L.F., Pirone, T.P. and Hellmann, G.M.

(1997). Variations in the VPg protein allow a potyvirus to overcome va gene

resistance in tobacco. Virology 237, 452-459.

Nicolaisen, M., Jahansen, E., Poulsen, G.B. and Borkhardt, B. (1992). The

5'untranslated region from pea seedborne mosaic potyvirus RNA as a

translation enhancer in pea and tobacco protoplasts. FEBS Letters 303, 169-

172.

170

Noueiry, A.O., Lucas, W.J. and Gilbertson, R.L. (1994). Two proteins of a

plant DNA virus coordinate nuclear and plasmodesmal transport. Cell 76, 925-932.

Oh, C.S. and Carrington, J.C. (1989). Identification of essential residues in

potyvirus proteinase HC-Pro by site-directed mutagenesis. Virology 173,

692-699.

Olsen, B.S. and Johansen, I.E. (2001). Nucleotide sequence and infectious

cDNA clone of the L1 isolate of Pea seed-borne mosaic potyvirus. Archives

of Virology 146, 15-25.

Oparka, K.J., Boevink, P. and Cruz, S.S. (1996). Studying the movement of

plant viruses using green fluorescent protein. Trends in Plant Science 1, 412-

418.

Opina, O.S. (1991). Epidemiology of papaya ringspot. Proceedings First

National Symposium/ Workshop on Ringspot and other Diseases of Papaya

in the Philippines, Bureau of Plant Industry, Manila, Philippines, 46-51.

Osman, T.A.M. and Buck, K.W. (1997). The tobacco mosaic virus RNA

polymerase complex contains a plant protein related to the RNA-binding

subunit of yeast eIF-3. Journal of Virology 71, 6075-6082.

Page, R.M.D. (1996). TREEVIEW: an application to display phylogenetic

trees on personal computers. Computer Applications in the Biosciences 12,

357-358.

Parks, T.D. and Dougherty, W.G. (1991). Substrate recognition by the NIa

proteinase of two potyviruses involves multiple domains: characterization

using genetically engineered hybrid protinase molecules. Virology 182, 17-

27.

171

Parks, T.D., Howard, E.D., Wolpert, T.J., Arp., D.J. and Dougherty, W.G.

(1995). Expression and purification of a recombinant tobacco etch virus NIa

proteinase: biochemical analyses of the full-length and a naturally occurring

truncated proteinase form. Virology 210, 194-201.

Payne, S.L., Rausch, J., Rushlow, K. Montelaro, R.C., Issel, C., Flaherty, M.,

Perry, S., Sellon, D. and Fuller, F. (1994). Characterization of infectious

molecular clones of equine infectious anemia virus. Journal of General

Virology 75, 425-429.

Peng, Y., Kadoury, D., Gal-On, A., Huet, H., Wang, Y. and Raccah, B.

(1998). Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus:

effects on aphid transmission and binding to purified virions. Journal of

General Virology 79, 897-904.

Perrin, Y. and Hull, R. (1999). Original reverse transcription polymerase

chain reaction method to obtain the full-length cDNA of rice tungro spherical

virus. Journal of Virological Methods 79, 161-168.

Persley, D.M. (1997). Identification, epidemiology and control of papaya

ringspot virus, recently recorded in papaya (Carica papaya) in Australia.

Master’s thesis, Queensland University of Technology Brisbane.

Pirone, T.P. (1981). Efficiency and selectivity of the helper component

mediated aphid transmission of purified potyviruses. Phytopathology 71, 922-

924.

Pirone, T.P. (1991). Viral genes and gene products that determine insect

transmissibility. Seminars in Virology 2, 81-87.

Pirone, T.P. and Blanc, S. (1996). Helper-dependent vector transmission of

plant viruses. Annual Review of Phytopathology 34, 227-247.

172

Plochocka, D., Welnicki, M. Zielenkiewicz, P. and Ostoja-Za-gorski, W.

(1996). Three-dimensional model of the potyviral genome-linked protein.

Proceedings of the National Academy of Sciences of the United States of

America 93, 12150-12154.

Pogany, J., Huang, Q., Romero, J., Nagy, P.D. and Bujarski, J.J. (1994).

Infectious transcripts from PCR-amplified broad bean mottle bromovirus

cDNA clones and variable nature of leader regions in RNA 3 segment.

Journal of General Virology 75, 693-697.

Pruss, G., Ge, X., Shi, X.M., Carrington, J.C. and Vance, V.B. (1997). Plant

viral synergism: the potyviral genome encodes a broad-range pathogenicity

enhancer that transactivates replication of heterologous viruses. Plant Cell 9,

859-868.

Purcifull, D.E., Edwardson, J., Hiebert, E.L. and Gonsalves, D. (1984).

Papaya ringspot virus. CMI/AAB description of plant viruses No.292.

Puurand, U., Valkonen, J.P.T., Makinen, K., Rabenstein, F. and Saarma, M.

(1996). Infectious in vitro transcripts from cloned cDNA of the potato A

potyvirus. Virus Research 40, 135-140.

Quadt, R., Kao, C.C., Browning, K.S., Hershberger, R.P. and Ahlquist, P.

(1993). Characterisation of a host protein associated with brome mosaic

virus RNA-dependent RNA polymerase. Proceedings of the National

Academy of Sciences of the United States of America 90, 1498-1502.

Quemada, H., L'Hostis, B., Gonsalves, D., Reardon, I.M., Heinrikson, R.,

Seiu, L.C. and Slightom, J.L. (1990). The nucleotide sequence of the 3'-

terminal regions of papaya ringspot virus strains W and P. Journal of General

Virology 71, 203-210.

173

Quillet, L., Guilley, H., Jonard, G. and Richards, K. (1989). In vitro synthesis

of biologically active beet necrotic yellow vein virus RNA. Virology 172, 293-

301.

Rajamaki, M.L. and Valkonen, J.P.T. (1999). The 6K2 protein and the VPg of

potato virus A are determinants of systemic infection in Nicandra

physaloides. Molecular Plant-Microbe Interactions 12, 1074-1081.

Rajamaki, M.L. and Valkonen, J.P.T. (2002). Viral genome-linked protein

(VPg) controls accumulation and phloem-loading of a potyvirus in inoculated

potato leaves. Molecular Plant-Microbe Interactions 15, 138-149.

Rao, A.L.N. (1997). Analysis of cell-to-cell movement competence of coat

protein defective variants of cowpea chlorotic mottle virus. Virology 232, 358-

395.

Restrepo-Hartwig, M.A. and Carrington, J.C. (1992). Regulation of nuclear

transport of a plant potyvirus protein by autoproteolysis. Journal of Virology

66, 5662-5666.

Restrepo-Hartwig, M.A. and Carrington, J.C. (1994). The tobacco etch

potyvirus 6-kilodalton protein is membrane associated and involved in viral

replication. Journal of Virology 68, 2388-2397.

Revers, F., Gall, O.L., Candresse, T. and Maule, A.J. (1999). New advances

in understanding the molecular biology of plant/potyvirus interactions.

Molecular Plant-Microbe Interactions 12, 367-376.

Rezende, J.A.M. and Costa, A.S. (1993). Papaya diseases caused by virus

and mycoplasma. Summa Phytopathologica 19, 73-79.

Rezende, J.A.M. and Pacheco, D.A. (1998). Control of papaya ringspot

virus-type W in zucchini squash by cross-protection. Plant Disease 82, 171-

175.

174

Rice, C.M., Grakoui, A., Galler, R. and Chambers, T.J. (1989). Transcription

of infectious yellow fever RNA from full-length cDNA templates produced by

in vitro lidation. The New Biologist 1, 285-296.

Riechmann, J.L., Cervera, M.T. and Garcia, J.A. (1995). Processing of the

plum pox virus polyprotein at the P3-6K1 junction is not required for virus

viability. Journal of General Virology 76, 951-956.

Riechmann, J.L., Lain, S. and Garcia, J.A. (1990). Infectious in vitro

transcripts from a plum pox virus cDNA clone. Virology 177, 710-716.

Riechmann, J.L., Lain, S. and Garcia, J.A. (1992). Highlights and prospects

of potyvirus molecular biology. Virology 177, 710-716.

Robertson, N.L., French, N.L. and Gray, S.M. (1991). Use of group-specific

primers and the polymerase chain reaction for the detection and identification

of luteoviruses. Journal of General Virology 72, 1473-1477.

Rodriguez-Cerezo, E. and Shaw, J.G. (1991). Two newly detected

nonstructural viral proteins in potyvirus-infected cells. Virology 185, 572-579.

Rodriguez-Cerezo, E., Ammar, E.D., Pirone, T.P. and Shaw, J.G. (1993).

Association of the non-structural P3 viral protein with cylindrical inclusions in

potyvirus-infected cells. Journal of General Virology 74, 1945-1949.

Rodriguez-Cerezo, E., Findlay, K., Shaw, J.G., Lomonossoff, G.P., Qiu, S.G.,

Linstead, P., Shanks, M. and Risco, C. (1997). The coat and cylindrical

inclusion proteins of a potyvirus are associated with connections between

plant cells. Virology 236, 296-306.

Rojas, M.R., Zerbini, F.M., Allison, R.F., Gilbertson, R.L. and Lucass, W.J.

(1997). Capsid protein and helper component-proteinase function as

potyvirus cell-to-cell movement proteins. Virology 237, 283-295.

175

Ruffel, S., Dussault, M., Palloix, A., Moury, B., Bendahmane, A., Robaglia

and C., Caranta, C. (2202). A natural recessive resistance gene against

potato virus Y in pepper corresponds to the eukaryotic initiation factor 4E

(eIF4E). The Plant Journal 32, 1067-1075.

Saenz, P., Cervera, M.T., Dallot, S., Quiot, L., Quiot, J.B., Riechmann, J.L.

and Garcia, J.A (2000). Identification of a pathogenicity determinant of Plum

pox virus in the sequence encoding the C-terminal region of protein P3+6K1.

Journal of General Virology 81, 557-566.

Saenz, P., Quiot, L., Quiot, J.B., Candresse, T. and Garcia, J.A. (2001).

Pathogenicity determinants in the complex virus population of a plum pox

virus isolate. Molecular Plant-Microbe Interactions 14, 278-287.

Saenz, P., Salvador, B., Simon-Mateo, C., Kasschau, K.D., Carrington, J.C.

and Garcia, J.A. (2002). Host-specific involvement of the HC protein in the

long-distance movement of potyviruses. Journal of Virology 76, 1922-1931.

Saldarelli, P., Dell'Orco, M. and Minafra, A. (2000). Infectious cDNA clones

of two grapevine viruses. Archives of Virology 145, 397-405.

Salomon, R. and Bernardi, F. (1995). Inhibition of viral aphid transmission by

the N-terminus of the maize dwarf mosaic virus coat protein. Virology 213,

676-679.

Sanchez, F., Martinez-Herrera, D., Aguilar, I. and Ponz, F. (1998). Infectivity

of turnip mosaic potyvirus cDNA clones and transcripts on the systemic host

Arabidopsis thaliana and local lesion hosts. Virus Research 55, 207-219.

Schaad, M.C. and Carrington, J.C. (1996). Suppression of long-distance

movement of tobacco etch virus in a nonsusceptible host. Journal of Virology

70, 2556-2561.

176

Schaad, M.C., Anderberg, R.J. and Carrington, J.C. (2000). Strain-specific

interaction of the tobacco etch virus NIa protein with the translation initiation

factor eIF4E in the yeast two-hybrid system. Virology 273, 300-306.

Schaad, M.C., Lellis, A.D. and Carrington, J.C. (1997). VPg of tobacco etch

potyvirus is a host genotype-specific determinant for long-distance

movement. Journal of Virology 71, 8624-8631.

Schaad, M.C., Cahill, R.H., Cronin, S. and Carrington, J.C. (1996). Analysis

of the VPg-proteinase (NIa) encoded by tobacco etch potyvirus: effects of

mutations on subcellular transport, proteolytic processing, and genome

amplification. Journal of Virology 70, 7039-7048.

Shukla, D.D. and Ward, C.W. (1989). Structure of potyvirus coat proteins and

its application in the taxonomy of the potyvirus group. Advances in Virus

Research 36, 273-314.

Shukla, D.D., Jilka, J., Tosic, M. and Ford, R.E. (1989). A noval approach to

the serology of potyviruses involving affinity-purified polyclonal antibodies

directed towards virus-specific N termini of coat proteins. Journal of General

Virology 70, 13-23.

Shukla, D.D., Ward, C.W. and Brunt, A.A. (1994). The Potyviridae. C.A.B

International, Wallingford, Uk.

Skaf, J.S., Schultz, M.H., Hirata, H. and De Zoeten, G.A. (2000). Mutational

evidence that the VPg is involved in the replication and not the movement of

Pea enation mosaic virus-1. Journal of General Virology 81, 1103-1109.

Sonoda, S., Koiwa, H., Kanda, K., Kato, H., Shimono, M. and Nishiguchi, M.

(2000). The helper component-proteinase of Sweet potato feathery mottle

virus facilitates systemic spread of Potato virus X in Ipomoea nil.

Phytopathology 90, 944-950.

177

Soumonuou, Y. and Laliberte, J.F. (1994). Nucleic-acid binding properties of

the P1 protein of turnip mosaic potyvirus produced in Escherichia coli.

Journal of General Virology 75, 2567-2573.

Stokoe, R. (1996). Amplification of the papaya ringspot virus type P genome

by long-distance PCR and sequence variability within the helper component

of PRSV-P and PRSV-W. Honours Thesis, Queensland University of

Technology, Brisbane.

Suranto, G., K.H., Shukla, D.D. and Pallaghy, C.K. (1998). Coat protein

sequence of Krish-infecting strain of Johnsongrass mosaic potyvirus.

Archives of Virology 143, 1015-1020.

Tacahashi, Y. and Uyeda, I. (1999). Restoration of the 3' end of potyvirus

RNA derived from poly(A)-deficient infectious cDNA clones. Virology 265,

147-152.

Takahashi, Y., Takahashi, T. and Uyeda, I. (1997). A cDNA clone to Clover

yellow vein potyvirus genome is highly infectious. Virus Genes 14, 235-243.

Tellier, R., Bukh, J., Emerson, S.U. and Purcell, R.H. (1996). Amplification of

the full-length hepatitis A virus genome by long reverse transcription-PCR

and transcription of infectious RNA directly from the amplicon. Proceedings

of the National Academy of Sciences of the United States of America 93,

4370-4373.

Tennant, P., Gonsalves, C., Fitch, M., Manshardt, R., Slightom, J. L. and

Gonsalves, D. (1994). Differential protection against papaya ringspot virus

isolates in coat protein gene transgenic papaya and classically cross-

protected papaya. Phytopathology 84, 1359-1366.

Thomas, J.E. and Dodman, R.L. (1993). The first record of papaya ringspot

virus-type P from Australia. Australasian Plant Pathology 22, 2-7.

178

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins,

D.G. (1997). The ClustalX windows interface: flexible strategies for multiple

sequence alignment aided by quality analysis tools. Nucleic Acids Research

24, 4876-4882.

Thornbury, D.W., Hellmann, G.M., Rhoads, R.E. and Pirone, T.P. (1985).

Purification and characterisation of potyvirus helper component. Virology

144, 260-267.

Thornbury, D.W., Patterson, C.A., Dessens, J.T. and Pirone, T.P. (1990).

Comparative sequence of helper-component (HC) region of potato virus Y

and a HC-defective strain, potato virus C. Virology 178, 573-578.

Tordo, V.M.J., Chachulska, A.M., Fakhfakh, H., Romancer, M.L., Robaglia,

C. and Astier-Manifacier, S. (1995). Sequence polymorphism in the P1

coding region of potato virus Y genomic RNA. Journal of General Virology

76, 939-949.

Urcuqui-Inchima, S., Haenni, A. and Bernardi, F. (2001). Potyvirus proteins:

a wealth of functions. Virus Research 74, 157-175.

Urcuqui-Inchima, S., Maia, I.G., Arruda, P., Haenni, A.L. and Bernardi, F.

(2000). Deletion mapping of the potyviral helper component-proteinase

reveals two regions involved in RNA binding. Virology 268, 104-111.

Urcuqui-Inchima, S., Walter, J., Drugeon, G., German-Retana, S., Haenni,

A.L., Candresse, T., Bernardi, F. and Le Gall, O. (1999). Potyvirus helper

component-proteinase self-interaction in the yeast two-hybrid system and

delineation of the interaction domain involved. Virology 258, 95-99.

179

Van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B.,

Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle,

C.R. and Wickner, R.B. (2000). Virus Taxonomy, Seventh report of the

International Committee on Taxonomy of Viruses. International Union of

Microbiological Societies 7, 703-724.

Verchot, J. and Carrington, J.C. (1995a.). Debilitation of plant potyvirus

infectivity by P1 proteinase-inactivating mutations and restoration by second-

site modifications. Journal of Virology 69, 1582-1590.

Verchot, J. and Carrington, J.C. (1995b). Evidence that the potyvirus P1

proteinase functions in trans as an accessory factor for genome

amplification. Journal of Virology 69, 3668-3674.

Verchot, J., Herndon, K.L. and Carrington, J.C. (1992). Mutational analysis of

the tobacco etch potyviral 35-kDa proteinase: identification of essential

residues and requirements for autoproteolysis. Virology 190, 298-306.

Verchot, J., Koonin, E.V. and Carrington, J.C. (1991). The 35-kDa protein

from the amino-terminus of the potyviral polyprotein functions as a third

virus-encoded proteinase. Virology 185, 527-535.

Varrelmann, M. and Maiss, E. (2000). Mutations in the coat protein gene of

Plum pox virus suppress particle assembly, heterologous encapsidation and

complementation in transgenic plants of Nicotiana benthamiana. Journal of

General Virology 81, 567-576.

Verver, J., Wellink, J., Lent, J.V., Gopinath, K. and Kammen, A.V. (1998).

Studies on the movement of cowpea mosaic virus using the jellyfish green

fluorescent protein. Virology 242, 22-27.

Viry, M., Serghini, M.A., Hans, F., Ritzenthaler, C., Pinck, M. and Pinck, L.

(1993). Biologically active transcripts from cloned cDNA of genomic

grapevine fanleaf nepovirus RNAs. Journal of General Virology 74, 169-174.

180

Wai, T. and Grummet, R. (1995). Inheritance of resistance to the watermelon

strain of papaya ringspot virus in cucumber line TMG-1. Hort. Science 30,

338-340.

Wai, T., Staub, J.E., Kabelka, W. and Grumet, R. (1997). Linkage analysis of

potyvirus resistance alleles in cucumber. Journal of Heredity 88, 454-458.

Waigmann, E., Lucas, W.J., Citovsky, V. and Zambryski, P. (1994). Direct

functional assay for tobacco mosaic virus cell-to-cell movement protein and

identification of a domain involved in increasing plasmodesmal permeability.

Proceedings of the National Academy of Sciences of the United States of

America 91, 1433-1437.

Wang, C.H. and Yeh, S.D. (1992). Nucleotide sequence comparison of the

3'terminal regions of severe, mild and non-papaya infecting strains of papaya

ringspot virus. Archives of Virology 127, 345-354.

Wang, C.H. and Yeh, S.D. (1997). Divergence and conservation of the

genomic RNAs of Taiwan and Hawaii strains of papaya ringspot potyvirus.

Archives of Virology 142, 271-285.

Wang, L., Radkowski, M., Vargas, H., Rakela, J. and Laskus, T. (1997).

Amplification and fusion of long fragments of hepatitis C virus genome.

Journal of Virological Methods 68, 217-223.

Wang, H.L., Wang, Y., Cookmeyer, D.G., Lommel, S.A. and Lucas, W.J.

(1998). Mutations in viral movement protein alter systemic infection and

identify an intercellular barrier to entry into the phloem long-distance

transport system. Virology 245, 75-89.

Wang, H.L., Yeh, S.D., Chiu, R.J. and Gonsalves, D. (1987). Effectiveness of

cross-protection by mild mutants of papaya ringspot virus for control of

ringspot disease of papaya in Taiwan. Plant Disease 71, 491-497.

181

Wang, X., Ullah, Z. and Grumet, R. (2000). Interaction between zucchini

yellow mosaic potyvirus RNA-dependent RNA polymerase and host poly-(A)

binding protein. Virology 275, 433-443.

Weber, H., Haeckel, P. and Pfitzner, A.J.P. (1992). A cDNA clone of tomato

mosaic virus is infectious in plants. Journal of Virology 45, 3909-3912.

Wisler, G.C., Purcifull, D.E. and Heibert E. (1995). Characterisation of the

P1 protein and coding region of the zucchini yellow mosaic virus. Journal of

General Virology 76, 37-45.

Wittmann, S., Chatel, H., Fortin, M.G. and Laliberte, J.F. (1997). Interaction

of the viral protein genome linked of turnip mosaic potyvirus with the

translational eukaryotic initiation factor (iso)4E of Arabidopsis thaliana using

the yeast two-hybrid system. Virology 234, 84-92.

Xiao, X.W., Frenkel, M.J., Teakle, D.S., Ward, C.W. and Shukla, D.D. (1993).

Sequence diversity in the surface-exposed amino-terminal of the coat protein

of seven strains of sugarcane mosaic virus correlates to their host range.

Archives of Virology 132, 399-408.

Yamaya, Y., Yoshioka, M., Meshi, T., Okada, Y. and Ohno, T. (1988).

Expression of tobacco mosaic virus RNA in transgenic plants. Molecular &

General Genetics 211, 520-525.

Yamshchikov, V., Mishin, V. and Cominelli, F. (2001). A new strategy in

design of +RNA virus infectious clones enabling their stable propagation in

E. coli. Virology 281, 272-280.

Yang, L.J., Hidaka, M.Masaki, H. and Uozumi, T. (1998a). Detection of

Potato virus Y P1 protein in infected cells and analysis of its cleavage site.

Biosciences, Biotechnology, and Biochemistry 62, 380-382.

182

Yang, S.J., Revers, F., Souche, S., Lot, H., Gall, O.L., Candresse, T. and

Dunez, J. (1998b). Construction of full-length cDNA clones of lettuce mosaic

virus (LMV) and the effects on their viability in Escherichia coli and on their

infectivity to plants. Archives of Virology 143, 2443-2451.

Yeh, S.D. (1994). Comparison of the genetic organisation of papaya ringspot

virus with other potyviruses. Plant Pathology Bulletin 3, 54-64.

Yeh, S.D. and Gonsalves, D. (1984). Evaluation of induced mutants of

papaya ringspot virus for control by cross protection. Phytopathology 74:

1086-1089.

Yeh, S.D., Gonsalves, D., Wang, H.I., Namba, R. and Chiu, R.J. (1988).

Control of papaya ringspot virus by cross protection. Plant Disease 72, 375-

380.

Yeh, S.D., Jan, F.J., Chiang, C.H., Doong, T.J., Chen, M.C., Chung, P.H.

and Bau, H.J. (1992). Complete nucleotide sequence and genetic

organisation of papaya ringspot virus RNA. Journal of General Virology 73,

2531-2541.

Yeh, S.D., Wang, C.H. and Chiang, C.H. (1997). Genetically-engineered

attenuated strain for control of papaya ringspot virus by cross protection. 5th

international Congress of Plant Molecular Biology, Singapore (Abstract).

Zambryski, P. and Crawford, K. (2000). Plasmodesmata: gatekeepers for

cell-to-cell transport of development signals in plants. Annual Review of Cell

and Developmental Biology 16, 393-421.

183

APPENDIX I Alignment of the full-length nucleotide sequences of Australian isolates of PRSV-W

(AUS-W) and PRSV-P (AUS-P). 80 AUS-W AAAATAAAAC ATCTCAACAC AACACAATCA AAAACACTTC AACAAGTATC AACTTATCTC ATTTTCAATT GTCATAGCAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 160 AUS-W GCAACAATGT CTTCTCTGTA CACTTTGCGA CCAGCAGCTC AGTACGATAG GAGGTTGGAG AGCAAGAAAG GTTCTGGCTG AUS-P ---------- ---------- ---------- ---------- ---------- ------A--- ---------- ---------- 240 AUS-W GATCGAGCAC AAACTCGAAA GAAAAGGGGA TAGAGGAAAC ACTCACTATT GTAGTGAGTT TGACATTAGC AAGGGTGCCA AUS-P ---------- ---------- ---------- ---------- -------T-- ---------- ---------- ---------- 320 AUS-W AGATTCTGCA ATTGGTGCAG ATTGGTAACG CTGAAGTTGG AAGGACCTTC CTGGAAGGTA ACAGATTTGT CCGTGCAAAC AUS-P ---------- ---------- ---------- ---------- ---------- --A------- ---------- ---------- 400 AUS-W ATATTCGAGA TCATCCGGAA AACTATGGTT GGTCGTCTAG GATATGATTT CGAGAGTGAG CTATGGGTTT GTCACGATTG AUS-P --------A- ----T----- ---------- ---------- ---------- ---------A ---------- -------A-- 480 AUS-W CGGTAACACT TCTGACAAAT ACTTCAAGAA ATGTGACTGT GGAGAAAAAT ATTACTACTC TGAAAGAAAC CTGATGAAAA AUS-P -A-------- ---------- ---------- ---------- ---------- -------T-- ------G--- -------GG- 560 AUS-W CAATACAAGA CCTGATGTAT CAGTTTGACA TGACACCATC AGAGATTAAC TCCGTCGATT TTGATTATCT TGCTGATGCA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------

AUS-W GTGGATTATG CTGAGCGGTC AGTCAAGGGA TCTCAAGTTC CGGAACCTGT GGAACTTGCA ATGATGGAAC CAATTGCGGC AUS-P ---------- ----A----- ---------- ---------- ---------- ---------- ---------- ---------- 720 AUS-W TAGTGAGAAA GGTACTCTAG TGGTTTCTGA ACTAAAAGTT GTGCCTGTAA CTACCAAAGT TGAAGAAGCA TGGACTATAC AUS-P -------G-- ---------- ---------- ---------- ---------- ---------- ----A----- ---------- 800 AUS-W AGATTGGGGA AATTCCTGTC CCACTTGTTG TTATTAAGGA AACACCAGTT ATTAGTGGTG TGAATGGAAC TCTGAACTCA AUS-P ---------- ---------- --------G- --------A- ---------- ------A--- ---------- ------T--- 880 AUS-W ACTGGTTTCT CACTTGAAGC CGATGTTACA AAAATGGTTG AGAAGGAAGT CCCTCAGGAA GAGGTGAAAG AAGCAGTGCA AUS-P ---------- ---------- T---A----- ---------A ---------- ---------- ---------- ---------- 960

184

AUS-W CCTGGCACTC GAAGTTGGTA ACGAGATTGC TGAGAAGAAA CCTGAACTCA ATCTAACACC ATACTGGAGT GCTAGCCTTG AUS-P ---------- ---------- -----T---- ---------- ---------- --T------- ---------- -----T---- 1040 AUS-W AGTTGCACAA GAGAGTTCGT AAGCATAAGG AGCATGCTAA GATTGCAGCA ATTCAAGTTC AGAAGGAACA AGAGGAAAAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- T--------- G-----T--- 1120 AUS-W CAGAAGATAT TCTCAACTAT GGAGTTAAGG CTTGACTTAA AGTCAAGGAG AAGAAATCAA ACTGTGGTCT GTGACAAAAG AUS-P ---------- --------C- T-------A- ---------- ---------- ---------- ---------- ---------- 1200 AUS-W AGGTACACTT AAATGGGAGA CCCGACAAGG TTGCAAGAAG AGTAGGCTAA TGCAACAAGT GAGTGATTCT GTTGTCACTC AUS-P ---------- ------A--- ---------- -CA------- ---------- ---------- ---------- -C-------- 1280 AUS-W AAATTCATCG TGATTTTGGG TGTGAACCTC AATATTTTGA ACCTCAACTT CCTGGCATCA AGCGAGCTAC ATCTAAGAAG AUS-P -----T---A ---------T ---------- ---------- ---------- ---------- ---------- ---------- 1360 AUS-W ATCTGCAGAT CGCGCAAGTA TTCGAGAATT GTTGGTAGTA ACAAGATAAA TTATGTCATG AAAAACCTGT GTGACATAAT AUS-P --T------- ---------- ---A------ -------A-- ---------- ---------- ---------- ---------- 1440 AUS-W CATTGAAAGA AGCATTCCTG TAGAGCTTGT TACGAGGCGA TGCAAGAGAA GAATTATTCA GAAGGAAGGT AGAAGCTATG AUS-P ---------- ---------- ---------- ---------- ---G------ ---------- ---------- ---------- 1520 AUS-W TGCAGTTGAG GCACATGGGT GGCATTCGAA CACGACAAGA TGTGAGCAGC TCGCCCGAAA TGGAGCAATT ATTCACGCAA AUS-P ---------- -------A-- ---------- ---------- ---------- ---------- ---------- ---------- 1600 AUS-W TTTTGCAAGT TTTTAGTTGG ACACAAACCA TTTAAATCCG AAAATCTGAC GTTTGGTTCT AGCGGCCTAA TTTTCAAGCC AUS-P ---------- ----G----- ---------- C-C------- ---------- ---C------ --T-----G- -C----G--- 1680 AUS-W AAAGTTTGCC GACAATGTGG GGCGATACTT TGGAGACTAT TTTATTGTTC GAGGACGTCT TGGAGGTAGG CTATTTGATG AUS-P -------A-- ---------- ---------- ---G------ ---G------ ---------- ---------- ---------- 1760 AUS-W GTAGATCAAA ACTAGCGAGA TCAATCTATG CCAAGATGGA TCAATACAAT GACGTGGCTG AAAAATTCTG GCTTGGTTTT AUS-P ---------- ---------- ---------- ---------- ------T--- ---------- ---------- ---------- 1840 AUS-W AATAGGGCTT TTCTACGGCA TAGAAAACCA ACGGACCATA CTTGCACGTC TGACATGGAT GTCACAATGT GTGGGGAGGT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------

185

1920 AUS-W AGCAGCTCTT GCAACTATAA TCCTGTTTCC ATGCCACAAG ATAACTTGCA ACACTTGCAT GATCAAAGTA AAGGGAAGAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2000 AUS-W TCATTGACGA AGTCGGTGAG GATTTAAATT GTGAGCTTGA AAGGCTGCGT GAAACTCCCT CATCATATGG AGGGTCATTC AUS-P ---------- ---------- ---------- ---------- -----AA--- -------T-- ---------A ---------- 2080 AUS-W GGACATGTCT CAACATTACT TGATCAACTA AACAGAGTTT TGAATGCGCG GAACATGAAC GATGGAGCTT TTAAAGAGAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------T ---------- -------A-- 2160 AUS-W TGCGAAGAGG ATTGATGCAA AGAAAGAGAG TCCTTGGACT CACATGACAG CCATCAACAA CACGCTCATC AAAGGTTCGC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2240 AUS-W TAGCAACTGG CTACGAATTT GAAAGAGCGT CTGATAGTCT CCTGGAAATC GTGAGGTGGC ATCTCAAAAG GACAGAATCA AUS-P ---------- ---------- ---------- ---------- ------G--T ---------- ---------- ---------- 2320 AUS-W ATAAAAGCTG GCAGTGTTGA AAGTTTTAGA AACAAGCGTT CTGGAAAAGC TCACTTCAAC CCAGCTCTTA CGTGTGATAA AUS-P ---------- -T-------- ---------- ---------- ---------- ---------- ---------- ---------- 2400 AUS-W TCAGTTGGAC AAGAATGGTA ATTTCTTATG GGGCGAAAGG CAATACCACG CCAAGAGATT CTTTGCCAAC TATTTCGAGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2480 AUS-W AGATTGATCA TAGTAAGGGT TATGAGTACT ATAGTCAACG CCAAAACCCA AATGGTATCA GGAAGATAGC TATTGGCAAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- -A-------- ---------- 2560 AUS-W TTGGTATTTT CAACAAATTT GGAGAGATTT CGACAGCAAA TGGTTGAACA CCACATTGAT CAAGGACCAA TTACCCGTGA AUS-P ---------- ---------- ---------- --G--A---- ---------- ---------- ---------- ---T------ 2640 AUS-W GTGTATCGCA TTGCGCAATA ACAATTATGT TCATGTATGC AGCTGCGTAA CTTTAGATGA TGGAACTCCA GCAACAAGTG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2720 AUS-W AGTTGAAGAC TCCTACCAAG AATCACATTG TGCTTGGTAA TTCTGGTGAT CCTAAGTACG TTGACCTGCC GACTCTTGAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 2800 AUS-W TCTGATTCGA TGTACATAGC CAAGAAGGGT TATTGCTACA TGAACATCTT TTTGGCGATG CTTATAAACA TACCCGAGAA

186

AUS-P ---------- ---------- ---------- --------T- ---------- ---------- --C------- ---------- 2880 AUS-W TGAGGCGAAA GACTTCACAA AGAGAGTTCG TGACCTTGTG GGTTCAAAAC TTGGAGAGTG GCCAACGATG TTGGATGTAG AUS-P ---------G ------C--- ---------- ---------- ---------- ---------- ---------- --A------- 2960 AUS-W CAACATGCGC AAATCAGCTA ATAATCTTTC ATCCTGACGC GGCCAACGCA GAATTGCCGC GAATTCTAGT GGACCACCGA AUS-P ---------- ---------G ---------- ---------- ---------- ---------- ---------- C--------- 3040 AUS-W CAGAAAACAA TGCATGTCAT TGACTCTTTT GGGTCCGTGG ATTCTGGATA TCATGTATTG AAAGCAAACA CAGTTAATCA AUS-P ---------- ---------- ---------- ---------- ---------- ----A----- ---------- ---------- 3120 AUS-W GCTGATCCAA TTCGCTAGGG AGCCACTCGA TAGCGAGATG AAGCACTACA TTGTCGGTGG AGAGTTTGAC CCGACTACTA AUS-P ---------- ---------- -T-----T-- ---T------ ---------- ---------- ---------- ---------- 3200 AUS-W ACTGCTTGCA TCAGTTGATT CGTGTCATCT ATAAGCCTCA TGAACTCCGG AACTTGCTCA GGAATGAACC ATACCTGATT AUS-P ---------- ---------- -----T---- -C-----C-- ---------A ---------- ---------- ------A--- 3280 AUS-W GTGATTGCAT TGATGTCACC AAGTGTACTT TTAACTTTGT TCAATAGTGG TGCGATTGAG CACGCGTTGA ATTATTGGAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 3360 AUS-W CAAAAGGGAT CAAGATGTTG TTGAGGTCAT TATTTTAGTG GAGCAATTAT GCAGAAAAGT GACGCTTGCT AGAACAATCC AUS-P ---------- --G------- ----A----- -G-------- ---------- ----G----- ---------- ---------- 3440 AUS-W TGGAGCAGTT CAATGAAATT CGTCAAAATG CGAGAGATAT ACATGAGCTA ATGGATCGAA ACAATAAGCC TTGGATTTCA AUS-P ---------- T--------- ---------- ---------- ---------- ---------- ---------- ---------- 3520 AUS-W TATGATCGCT CATTGGAACT ATTGAGTGTG TATGCAAATT CGCAGTTGAC GGATGAAGGT CTGTTCAAGC AAGGCTTTTC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---C------ ----A----- 3600 AUS-W AACATTAGAC CCTAAGTTGC GTGAAGCTGT GGAAAAAACC TACGCCACCC TATTGAAGGA AGAGTGGCGT GCGTTAAGTT AUS-P ---------- ---------- ---------- ---------- ---------- -----C---- ---------- ---------- 3680 AUS-W TGTTTCAAAA GTTGCACTTA AGGTACTTTG CATTCAAGTC ACAACCGTCT TTTTCCGAGT ATTTAAAGCC AAAAGGGCGC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------

187

3760 AUS-W GCAGATTTAA AAATTGTATA CGACTTCTCA CCGAAGTATT GTGTACACGA GGTCGGGAAG GCGTTGTTAC AGCCAGTCAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 3840 AUS-W GGCCGGGGCT GAATTCACGT CGCGAATCAT TAATGGTTGC GGAACTTTCA TTCGGAAGAG TGCCGCAAGA GGCTGTGCTT AUS-P ---------- ---------- ---------- ----A----- ---------G ---------- ---------- ---------- 3920 AUS-W ACATTTTCAA GGATCTTTTC CAGTTTGTAC ATGTAGTACT AGTTTTAAGC ATTTTATTAC AAATTTTTAG GAGTGTGCAA AUS-P ---------G ---------- ---------- ---------- ---------- ---------- ---------- --A------- 4000 AUS-W GGAATTGCCA CAGAGCATAT ACAATTGAAG CAGGCGAAGG CAGAAATGGA GAAACAGGAG GATTTTGATC GTCTGGAGGC AUS-P -------T-- ---------- ---------- -----A---- ---------- -------A-- -----CA--- ---------- 4080 AUS-W TTTATACGCT GAACTGTGCG TTAAGATCGG TGAGCAACCA ACTGCTGAAG AATTTCTTGA TTTTGTGATG GAGCGTGAAC AUS-P ---------- ---------A ---------- ---------- ---------- ---------- ---------- ---------- 4160 AUS-W CAAGGCTGAA GGATCAAGCT TATAGTTTAA TCCACATACC AGTGATTCAT CAAGCAAAAT CGGACAATGA GAAAAAGCTC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4240 AUS-W GAGCAAGTCA TTGCATTTAT TACATTAATT TTAATGATGG TCGACGTGGA CAAGAGCGAT TGTGTTTACA GAATCTTGAA AUS-P ---------- ---------- ---------- ---------- -T-------- ---------- ---------- ---------- 4320 AUS-W TAAGTTTAAA GGCGTGATAA ACTCTTGCAA CACAAATGTT TATCACCAGT CTTTAGATGA CATTAAGGAT TTCTATGAAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4400 AUS-W ACAAGCAGTT GACTATTGAC TTCGATATCA CTGGAGAAAA TCAGATCAAT AGAGGACCTA TAGACGTTAC ATTCGAGAAA AUS-P ---------- ---------T ---------- ---------- ---------- ---------- ---------- ---------- 4480 AUS-W TGGTGGGATA ACCAATTGTC CAACAACAAC ACAGTTGGCC ATTATCGAAT TGGGGGAATG TTCGTTGAAT TTTCACGGAG AUS-P ---------- ---------- ---------- ---------- ---------- --------CA ---A------ ---------- 4560 AUS-W TAATGCAGCC ACTGTAGCTA GTGAGATAGC TCATAGTCCT GAGCGTGAGT TTCTAGTTCG CGGAGCTGTT GGTAGTGGTA AUS-P --C------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4640 AUS-W AATCAACGAA TCTACCTTTC TTACTTAGTA AGCATGGCAG CGTGCTGTTA ATAGAGCCCA CCAGACCTCT TTGCGAGAAC

188

AUS-P ---------- ---------- ---------- -----A-T-- ---------- ---------- ---------- ------A--- 4720 AUS-W GTTTGTAAGC AACTACGTGG TGACCCATTC CATTGCAATC CAACCATTCG CATGCGTGGG TTAACGGCTT TCGGTTCTAC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 4800 AUS-W CAACATCACG ATAATGACAA GCGGATTTGC TTTACATTAT TACGCTCACA ACATTCAGCA ATTGAGGCTC TTTGATTTCA AUS-P A--------- ---------- ---------- ---------- ---------- -------A-- ---------- ---------- 4880 AUS-W TAATTTTTGA TGAATGTCAT GTCATAGATA GCCAAGCCAT GGCCTTCTAC TGCCTTATGG AGGGGAACGC TGTTGAGAAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- -A-------- 4960 AUS-W AAGATTCTCA AAGTTTCTGC CACGCCACCT GGGCGTGAGG TTGAGTTTTC AACACAATTC CCAACAAAAA TTGTAACTGA AUS-P --------T- ---------- ---------- ---------- ---------- ---------- --G-----G- ---------- 5040 AUS-W ACAATCCATA AGCTTTAAAC AGTTGGTTGA CAACTTCGGT ACTGGTGCGA ATAGTGATGT GACTGCCTTT GCTGACAACA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 5120 AUS-W TATTAGTTTA TGTCGCGAGT TACAATGAAG TGGATCAACT AAGTAAGCTC TTATCCGATA AAGGCTACTT GGTCACTAAA AUS-P ---------- ---------- ---------- ---------- ---------- --G------- ---------- ---------- 5200 AUS-W ATCGATGGAA GAACGATGAA AGTTGGAAAG ACTGAAATTT CTACTAGTGG CACAAAATCC AAAAAGCATT TCATAGTTGC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 5280 AUS-W CACAAATATC ATCGAGAACG GCGTCACACT TGACATAGAA GCTGTCATAG ATTTTGGGAT GAAAGTAGTA CCTGAGATGG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 5360 AUS-W ATTCAGACAA TCGCATGATT CGGTACTCGA AGCAAGCAAT CAGTTTTGGA GAGAGAATTC AAAGACTTGG GCGAGTGGGA AUS-P ---------- ---------- --------A- ---------- ---------- ---------- ---------- ---------- 5440 AUS-W AGACACAAAG AAGGAATTGC ACTAAGAATT GGACACACGG AGAAAGGCAT TCAAGAAATT CCAGAGATGG CAGCTACTGA AUS-P ---------- ---------- ---------- ---------- -------T-- ---------- ---------- ---------- 5520 AUS-W GGCAGCTTTT CTGAGCTTCA CGTATGGCTT GCCTGTTATG ACGCACAATG TAGGGTTAAG CTTGCTCAAA AACTGCACTG AUS-P A--------- T--------- ---------- ---------- --T------- ---------- ---------- ----------

189

5600 AUS-W TGAGACAAGC ACGTACAATG CAACAGTACG AACTAAGCCC GTTCTTCACA CAAAATTTAG TTAACTTCGA TGGAACAGTA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- -A-------- ---------- 5680 AUS-W CACCCCAAGA TTGATGTTCT GTTACGCCCT TATAAACTGA GAGATTGTGA AATCAGGTTA AGTGAAGCAG CGATACCGCA AUS-P ---------- ---------- ---------- -----G---- ---------- ---------- ---------- ---------- 5760 AUS-W TGGGGTGCAG TCTATTTGGA TGTCTGCTCG AGAGTATGAA GCAGTTGGAA GCCGTCTTTG CCTAGAAGGC GATGTCAGAA AUS-P ---------- ---------- ---------- ---------- ---------G ---------- ---------T ---------- 5840 AUS-W TACCGTTCCT CATTAAAGAT GTTCCTGAGC GATTATACAA GGAACTGTGG GATATCGTGC AGACATATAA GCGTGACTTT AUS-P ---------- ------G--- ---------- -G-------- ---------- ---------- ---------- ---------- 5920 AUS-W ACATTTGGGC GAATTAATTC TGTATCCGCT GGGAAAATTG CGTACACATT AAGAACTGAT GTATATTCTA TTCCCAGAAC AUS-P ---------- -G-------- ---------- ---------- ---------- ---------- --G------- ---------- 6000 AUS-W TCTCATAACA ATTGACAAAC TGATTGAGAG TGAAAACATG AAGCATGCCC ATTTTAAAGC TATGACAAGT TGCACTGGCC AUS-P ---------- ---------- ---------- ---------- ---------- -C-------- ---------- ---------- 6080 AUS-W TAAACTCTAG CTTCTCTCTC CTTGGTATCA TAAACACTAT CCAGAGTAGA TACCTAGTTG ACCATTCAGT TGAAAATATC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6160 AUS-W AGAAAACTTC AGCTGGCAAA GGCCCAGATC CAACAACTCG AAGCTCATGT GCAAGAGAAC AACGTTGAGA ATTTGATTCA AUS-P ---------- -------G-- ---------- ---------- ---------- ---------- --T------- -C-------- 6240 AUS-W ATCTCTTGGT GCTGTCAGAG CTGTTTATCA TCAAGGTGTT GATGGAGTTA AGCACATAAA GCGAGAGTTG GGCTTGAAAG AUS-P ---------- ---------- ---------- ----A----- ---------- ---------- ---------- ---------- 6320 AUS-W GAATTTGGGA TGGCTCATTG ATGATTAAGG ATGCGATTAT ATGCGGTTTC ACAATGGTTG GCGGTGCGAT GCTCTTGTAC AUS-P --C------- ---------- ---------- ---------- ---------- -------C-- ---------- ---------- 6400 AUS-W CAACACTTTC GTGATAAGCT TATAAATGTT CATGTGTTTC ACCAAGGTTT CTCTGCGCGA CAGCGGCAAA AGTTAAGATT AUS-P ---------- ---------- --C------- ---------- ---------- ---------- -----A---- ----G----- 6480

190

AUS-W TAAGTCAGCA GCAAATGCTA AGCTTGGTCG AGAGGTTTAT GGAGATGATG GGACCATTGA GCACTATTTC GGAGAAGCGT AUS-P ---------- ---------- ---------- ---------- ---------- -------C-- ---------- ---------- 6560 AUS-W ACACGAAGAA AGGAAACAAG AAAGGAAAGA TGCATGGCAT GGGTGTCAAA ACGAGAAAAT TCGTTGCGAC ATATGGATTT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6640 AUS-W AAACCAGAGG ATTACTCGTA CGTGCGGTAC TTGGATCCTT TAACAGGTGA GACTTTGGAT GAAAGCCCAC AAACTGACAT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6720 AUS-W CTCAATGGTG CAAGAGCATT TTGGTGATAT TCGGAGTAAG TATATGGATT CAGACAGCTT CGACAAGCAG GCTTTAATAG AUS-P ---------- ---------- -------C-- ---------- ---------- ---------- ---------- -T-------- 6800 AUS-W CAAACAATAC AATTAAGGCC TATTACGTCC GAAACTCCGC GAAAACAGCA TTGGAAGTCG ATTTGACACC GCACAACCCT AUS-P ---------- G--------- --------T- ---------- ---G------ ---------- ---------- ---------- 6880 AUS-W CTGAAAGTCT GTGATAACAA ATTGACCATT GCAGGATTTC CTGACAGGGA AGCTGAGCTG AGACAGACAG GCCCGCCCAG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 6960 AUS-W AACTATTCAA TTCGATCAAG TTCCACCACC CTCGAAATCA GTTCATCATG AAGGAAAAAG TCTTTGTCAA GGTATGAGGA AUS-P ---A------ G-T------- ---------- ---------- ---------- ---------- ---------- --------A- 7040 AUS-W ATTACAATGG CATAGCTTCT GTGGTTTGTC ATTTGAAAAA CACATCAGGA GATGGGAGGA GCCTATTTGG AATTGGATAC AUS-P ---------- ---------- ---------- ---------- ---------- -------A-- ---------- ---------T 7120 AUS-W AATTCATTCA TCATCACAAA CCGACATTTG TTTAAGGAGA ATAATGGTGA ACTTATAGTG CAATCCCAAC ACGGTAAGTT AUS-P ---------- ---------- ---------- ------A--- ---------- ---------- ---------- ---------- 7200 AUS-W TGTTGTCAAG AACACCACAA CGCTTCGAAT TGCTCCAGTT GGAAAGACTG ATCTTCTAAT CATTCGGATG CCGAAAGATT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 7280 AUS-W TTCCTCCATT CCATAGCAGA GCTAGGTTTA GGGCCATGAA AGCTGGGGAC AAGGTTTGCA TGATAGGTGT TGACTACCAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 7360 AUS-W GACAATCATA TCGCGAGCAA AGTATCTGAG ACTTCTATCA TCAGCGAAGG CACGGGAGAG TTTGGATGTC ACTGGATATC AUS-P --T------- ---------- ---------- ---------- ---------- --T------- ---------- ----------

191

7440 AUS-W CACGAATGAC GGTGATTGTG GTAATCCACT AGTTAGTGTT TCAGATGGTT TTATTGTTGG CTTGCATAGT TTATCGACAT AUS-P ---------- --------C- ---------- ---------- ---------- ---------- ---------- ---------- 7520 AUS-W CAACTGGAGA TCAAAATTTC TTCGCTAAAA TACCCGCGCA ATTTGAAGAG AAGGTTCTGA GGAAAATTGA TGATCTAACT AUS-P ----C----- ---------- ---------- -------A-- ---------- --TA------ ---------- ---------- 7600 AUS-W TGGAGTAAAC ACTGGAGCTA CAATGTTAAT GAATTGAGTT GGGGAGCTCT TAAAGTGTGG GAAAGTCGGC CCGAAGCAAT AUS-P -----C---- ---------- ------C--- ---------- ---------- ---------- ---------- ---------- 7680 AUS-W TTTTAATGCA CAAAAAGAAG TTAATCAATT GAATGTTTTC GAGCAAAGTG GTAGTCGTTG GCTCTTTGAC AAATTACACG AUS-P ---------- ---------- ------G--- ---------- ---------- ------A--- ---------- ---------- 7760 AUS-W GTAATTTGAA AGGTGTAAGC TCCGCTTCCA GCAATTTGGT GACGAAGCAC GTTGTTAAAG GTATTTGTCC TCTCTTTAGG AUS-P ---------- ---------- ---------- ---------- ---A------ ---------- ---------- ---------- 7840 AUS-W AATTACCTCG AGTGTAATGA GGAGGCTAAG GTTTTCTTCA TTCCACTTAT GGGTCACTAC ATGAAGAGTG TTCTGAGCAA AUS-P ---------- -----G---- ---------- ---------- A--------- ------T--- ---------- ---------- 7920 AUS-W GGAAGCATAC ACTAAGGATT TATTGAAATA TTCAAGTGAC ATTGTCGTTG GAGAAGTTAA TCACGATGTT TTTGAGGATA AUS-P ---------- -T-------- ---------- ---------- ---------- ---------- C--------- ---------- 8000 AUS-W GTGTTGCGCA AGTTATCGAG CTGTTAAATG ATTACGAGTG TCCCGAACTT GAATACATTA CAGACAGCGA AGTGATTATA AUS-P ---------- ----G----- ---------- --C----A-- ---------- --------C- ---------- ---------- 8080 AUS-W CAGGCCTTGA ACATGGATGC AGCTGTTGGA GCCTTATACA CGGGAAAGAA AAGGAAATAT TTTGAGGGGT CAACAGTGGA AUS-P ---------- ---------- --------TG --------T- ---------- ---------- ---------- ---------- 8160 AUS-W GCATAGGCAA GCTCTTGTAC GGAAAAGCTG TGAACGTCTC TACGAAGGGA AAATGGGCGT CTGGAACGGT TCGTTAAAGG AUS-P ---------- ---------- ---------- ---G------ ---------- ---------- ---------- ---------- 8240 AUS-W CTGAGCTGAG ACCAGCTGAA AAAGTGCTCG CGAAAAAGAC AAGGTCATTT ACAGCAGCTC CTCTTGACAC ACTGTTAGGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- -T-------- 8320

192

AUS-W GCCAAAGTCT GCGTTGATGA TTTCAACAAC TGGTTCTACA GTAAAAATAT GGAATGCCCA TGGACCGTTG GAATGACAAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 8400 AUS-W ATTTTACAAA GGCTGGGACG AGTTTCTGAG GAAATTTCCT GATGGCTGGG TGTATTGTGA TGCGGATGGC TCTCAGTTCG AUS-P ---------- ---------- ---------- ---------C --C------- ---------- ---------- ---------- 8480 AUS-W ATAGCTCATT AACACCATAC TTGTTGAATG CTGTGCTATC AATTCGGTTA TGGGCGATGG AGGACTGGGA TATTGGAGAA AUS-P ---------- --T------T ---------- ---------- ---------- ---------- ----T----- ---------- 8560 AUS-W CAAATGCTTA AAAACCTGTA TGGGGAAATC ACTTACACGC CAATTTTGAC ACCAGACGGA ACAATTGTTA AAAAGTTTAA AUS-P --------C- ---------- ---------- -----T---- -G-------- ------T--- --------C- ---------- 8640 AUS-W AGGGAATAAT AGTGGCCAAC CTTCGACGGT TGTCGACAAT ACATTGATGG TTCTAATCAC AATGTATTAT GCGCTGCGGA AUS-P ---------- ---------- -------A-- ---------- ---------- ---------- ---------- ---------- 8720 AUS-W AGGCTGGTTA CGATACAAAG GCCCAAGAAG ATATGTGTGT ATTTTATATA AATGGTGATG ATCTCTGTAC TGCCATTCAC AUS-P ---------- ----G----- A-----A--- ---------- ---------- ---------- ---------T ---------- 8800 AUS-W CCGGATCATG AACATGTTCT TGACTCATTC TCTAGTTCAT TTGCTGAGCT TGGGCTTAAG TATGATTTCA CACAAAGGCA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 8880 AUS-W CCGGAATAAA CAGGATTTGT GGTTTATGTC GCATCGAGGT ATTCTGATTG ATGATATTTA CATTCCGAAA CTTGAACCTG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 8960 AUS-W AGCGAATTGT TGCAATTCTT GAATGGGACA AATCTAAGCT TCCGGAGCAT CGATTGGAAG CAATCACAGC AGCAATGATA AUS-P ---------- ---------- ---------- ----A----- ---------- --------G- ---------- ---------- 9040 AUS-W GAGTCATGGG GTTATGGTGA GTTAACACAA CAGATTCGCA GATTCTACCA ATGGGTTCTC GAGCAAGCTC CATTCAATGA AUS-P ---------- -------C-- ---------C --A------- ---------- ---------- ---------- ---------- 9120 AUS-W GTTGGCGAAA CAAGGAAGGG CTCCATACGT CTCGGAAGTT GGATTGAGAA GACTGTACAC AAGTGAACGT GGATCAATGG AUS-P ---------- ---------- ---------- ---------- ---------- --T------- ----A----- ---------- 9200 AUS-W ATGAATTGGA AGCGTATATA GACAAATACT TTGAGCGTGA GAGGGGAGAC TCACCCGAAC TACTGGTATA TCATGAATCA AUS-P ---------- ---------- --T------- -------C-- ---------- ---------- ---------- ----------

193

9280 AUS-W AGGAGTGTTG ATGATTATCA ACTTGTTTGT AGTAACAATA CACACGTGTT TCATCAGTCC AAAAATGAAG CTGTGGATGC AUS-P -----C-C-- -C-------- ---------- ---------- ---------- C--------- ---------- ---------- 9360 AUS-W TGGTTTGAAC GAAAAGCTCA AAGAAAAAGA AAAACAGAAA GAAAAAGAAA AAGAAAAACA AAAAGAGAAA GAAAAAGACG AUS-P ---------- ---------- G--------- ---------- ---------- ---------- ---------- ---------- 9440 AUS-W ATGCTAGTGA CGGAAATGAT GTGTCAACTA GCACAAAAAC TGGAGAGAGA GATAGAGATG TCAATGTTGG GACCAGTGGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 9520 AUS-W ACTTTCACTG TTCCAAGAAT CAAATCATTT ACTGACAAGA TGATTCTACC AAGAATTAAG GGAAAGACTG TCCTTAATTT AUS-P ---------- ---------- ---------- -----T---- ---------- ---------- ------C--- ---------- 9600 AUS-W AAATCACCTT CTTCAGTATA ACCCGCAACA AATTGACATT TCTAACACTC GTGCCACCCA GTCACAATTT GAGAAGTGGT AUS-P ---------- ---------- -T-------- ---------- ---------- -------T-- ---------- ---------- 9680 AUS-W ATGAGGGAGT GAGGAATGGT TATGGCCTTA ATGATAATGA AATGCAAGTG ATGCTAAATG GCTTGATGGT TTGGTGTATC AUS-P ---------- --------A- ---------- ---------- ---------- ---T------ ---------- ---------- 9760 AUS-W GAGAATGGTA CATCTCCAGA CGTATCTGGT GTCTGGGTTA TGATGGATGG GGAAACCCAA GTTGATTATC CAATCAAGCC AUS-P ---------- ---------- TA-------C --T------- ---------- ---------- ---------- ---------- 9840 AUS-W TTTAATTGAA CATGCTACTC CGACATTTAG GCAAATTATG GTTCACTTTA GTAACGCGGC AGAAGCATAT ATTGCAAAGA AUS-P ------C--G ---------- --T------- ---------- -C-------- ---------- ---------- ---------- 9920 AUS-W GAAATGCTAC TGAGAGGTAC ATGCCGCGGT ATGGAATCAA GAGAAATTTG ACTGACATTA GCCTCGCTAG ATACGCTTTC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ----A----- ---------- 10000 AUS-W GATTTCTATG AGGTGAATTC GAAAACACCT GATAGGGCTC GCGAAGCTCA CATGCAGATG AAAGCTGCAG CGCTGCGAAA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10080 AUS-W CACTAGTCGC AGAATGTTTG GTATGGACGG CAGTGTTAGT AACAAGGAAG AAAACACGGA GAGACACACA GTGGGAGATG AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----A----- 10160

194

AUS-W TCAATAGAGA CATGCACTCT CTCCTGGGTA TGCGCAACTG AATACTCGCA CTTGTGTGTT TGTCGGGCCT GGCTCGACCT AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10240 AUS-W TGTTTCACCT TATAGTACTA TATAAGCATT AGAATACAGT GTGGCTGCGC CACCGCTTCT ATTTTACAGT GAGGGTAGCC AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10320 AUS-W CTCCGTGCTT TTAGTATTAT TCGAGTTCTC TGAGTCTCCA TACAGTGTGG GTGGCCCACG TGCTATTCGA GCCTCTTAGA AUS-P ---------- ---------- ---------- ---------- ---------- ---------- ---------- ---------- 10321 AUS-W ATGAGAG AUS-P -------