D Wu et al . Nature 000 , 1 - 6 (2012) doi:10.1038/nature10931

1
D Wu et al. Nature 000, 1-6 (2012) doi:10.1038/nature10931 Identification of Trp 285 and Trp 233 as the ultraviolet-B chromophore.

description

Identification of Trp 285 and Trp 233 as the ultraviolet-B chromophore. D Wu et al . Nature 000 , 1 - 6 (2012) doi:10.1038/nature10931. - PowerPoint PPT Presentation

Transcript of D Wu et al . Nature 000 , 1 - 6 (2012) doi:10.1038/nature10931

Page 1: D Wu et al . Nature 000 , 1 - 6 (2012) doi:10.1038/nature10931

D Wu et al. Nature 000, 1-6 (2012) doi:10.1038/nature10931

Identification of Trp 285 and Trp 233 as the ultraviolet-B chromophore.

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

DOI: 10.1038/NPHYS3211 Supplementary Information for ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Published in Nature Materials (2016) doi:10.1038/nmat4569 ...

Published in Nature Materials (2016) doi:10.1038/nmat4569 ...

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

17 September 2009 doi:10.1038/nature08355 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature06481 LETTERS