Research Article

Combination Therapy Using Ruxolitinib andOncolytic HSV Renders Resistant MPNSTsSusceptible to VirotherapyMohammed G. Ghonime1 and Kevin A. Cassady1,2,3

Abstract

Malignant peripheral nerve sheath tumors (MPNSTs) areaggressive soft-tissue sarcomas resistant to most cancertreatments. Surgical resection remains the primary treat-ment, but this is often incomplete, ultimately resulting inhigh mortality and morbidity rates. There has been a resur-gence of interest in oncolytic virotherapy because of encour-aging preclinical and clinical trial results. Oncolytic herpessimplex virus (oHSV) selectively replicates in cancer cells,lysing the cell and inducing antitumor immunity. We pre-viously showed that basal interferon (IFN) signalingincreases interferon-stimulated gene (ISG) expression,restricting viral replication in almost 50% of MPNSTs. TheFDA-approved drug ruxolitinib (RUX) temporarily resetsthis constitutively active STAT signaling and renders thetumor cells susceptible to oHSV infection in cell culture.In the studies described here, we translated our in vitro

results into a syngeneic MPNST tumor model. Consistentwith our previous results, murine MPNSTs exhibit a similarIFN- and ISG-mediated oHSV-resistance mechanism, andvirotherapy alone provides no antitumor benefit in vivo.However, pretreatment of mice with ruxolitinib reducedISG expression, making the tumors susceptible to oHSVinfection. Ruxolitinib pretreatment improved viral replica-tion and altered the oHSV-induced immune-mediatedresponse. Our results showed that this combination therapyincreased CD8þ T-cell activation in the tumor microenvi-ronment and that this population was indispensable for theantitumor benefit that follows from the combination ofRUX and oHSV. These data suggest that JAK inhibition priorto oncolytic virus treatment augments both oHSV replica-tion and the immunotherapeutic efficacy of oncolytic herpesvirotherapy. Cancer Immunol Res; 6(12); 1499–510. �2018 AACR.

IntroductionMalignant peripheral nerve sheath tumors (MPNSTs) are high-

ly aggressive and clinically challenging soft-tissue sarcomas char-acterized by high local recurrence rates, metastatic potential, andresistance to chemotherapy. MPNSTs can develop from a periph-eral nerve, a preexisting peripheral nerve sheath tumor, or from aprecursor plexiform neurofibroma in the setting of cancer geneticpredisposition syndrome, neurofibromatosis type 1 (NF1; ref. 1).MPNST is the most common malignancy in patients with NF1,with an incidence rate of 2% and a lifetime risk of 8% to 13%(1–3). Complete surgical resection with negative margins is thetreatment of choice in the case of localized disease, but inmetastatic MPNST, outcomes are generally poor. The 5-yearsurvival range is between 15% and 50% (4). Poor clinical out-

comes with conventional agents have urged the need for newtherapeutic agents.

Oncolytic viruses are biological anticancer agents that prefer-entially target tumor cells while sparing normal cells and may beengineered to improve their efficacy and/or safety profile. Viralreplication leading to direct tumor cell lysis was previouslyconsidered the principal mechanism contributing to oncolyticviruses' antitumor activity: once the virus enters tumor cells, thevirus propagates and lyses the tumor cells. However, the oncolyticvirotherapy paradigm has evolved from a focus primarily on viralreplication and direct oncolysis to an emphasis on the immune-mediated antitumor mechanism (5, 6). In addition to its bene-ficial activity, the immune response could also negatively affectoncolytic virus antitumor activity by prematurely restricting viralinfection, leading to ineffective viral replication (7, 8). One of themain challenges facing oncolytic virotherapy is the optimizationof efficient viral replication and the generation of an anticancerimmune response.

Oncolytic herpes simplex viruses (oHSVs) used in clinicaltrials to date are derived from recombinant HSVs, from whichthe principal neurovirulence gene (g134.5) has been deleted(9–11). These attenuated Dg134.5 oHSVs are useful for thedevelopment of a therapeutic platform for cancer treatmentand have been safely administered to patients with peripheraland brain tumors in phase I clinical trials (10). Oncolytic HSV-1 has been shown to be safe and effective in phase I to IIIclinical trials (12), and in 2015, the FDA approved the firstoncolytic HSV called talimogene laherparepvec (T-VEC) for thetreatment of advanced, inoperable malignant melanoma byintralesional injection (13).

1The Research Institute at Nationwide Children's Hospital Center for ChildhoodCancer and Blood Disorders, The Ohio State University, Columbus, Ohio.2Nationwide Children's Hospital, Department of Pediatrics, Division of PediatricInfectious Diseases, The Ohio State University, Columbus, Ohio. 3The Ohio StateUniversity, Columbus, Ohio.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

Corresponding Author: Kevin A. Cassady, Center for Childhood Cancer andBlood Diseases, The Research Institute at Nationwide Children's Hospital, TheOhio State University College of Medicine, 700 Children's Drive, Columbus, Ohio43205. Phone: 614-722-2798; Fax: 614-722-2798; E-mail:Kevin.Cassady@Nationwidechildrens.org

doi: 10.1158/2326-6066.CIR-18-0014

�2018 American Association for Cancer Research.

CancerImmunologyResearch

www.aacrjournals.org 1499

However, limited replication and spread in tumors hasimpaired the clinical benefit of first-generation oHSV-1. The needfor efficient replication and improved immune activity led to next-generation oHSVs, such as T-VEC, and the virus we used here,C134. C134 is an oHSV that expresses the human cytomegalo-virus (HCMV) IRS1 gene, which is essential for HCMV replication(14), restoring the virus's ability to replicate and synthesize lateviral proteins but not its neurovirulence, allowing it to remain assafe as the parent Dg134.5 (15–17). However, C134 remainssensitive to IFN-mediated restriction and stimulates early IRF3-dependent signaling in nonmalignant cells and some tumorswithintact signaling pathways (16). This IRF3-mediated acute inflam-matory response recruits the immune cells and improves theimmune-mediated antitumor response (16).

Our studies demonstrated that 50% of humanMPNST tumorlines restrict both first-generation oHSV and C134. We inves-tigated the molecular mechanism underlying this oHSV resis-tance and showed that HSV entry was not the primary obstacle(18). Instead, basal NF-kB and IFN signaling activation primedan antiviral environment hostile to viral replication in theseresistant tumor cells (19). Constitutive expression of antiviralinterferon-stimulated genes (ISG), such as retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associatedprotein 5 (MDA-5), interferon-induced protein with tetratrico-peptide repeats 3 (IFIT3), myxovirus resistance 1 (MX1), and20,50-oligoadenylate synthetase-1 (OAS1), is driven by JAK/STAT-mediated signaling in these cells and contributes tooHSVs' inability to replicate efficiently, resulting in a negligibleantitumor effect (19). A similar mechanism has been describedin carcinomas and inflammation-driven tumors, where chroniclow cytokine signaling promotes myeloid and stromal cellinfiltration, as well as NF-kB and STAT-mediated chemokine,cytokine, and growth factor production in tumors. This chroniccytokine and chemokine production creates a paradoxicallyinflamed (IL10, PgE2, TGFb) and immunosuppressive tumorenvironment, that, when coupled with chronic tumor antigenstimulation, can lead to T-cell exhaustion (20, 21). We soughtto identify if murine MPNST tumor lines utilize a similar oHSV-resistance mechanism, which would allow us to dissect thecomplex relationship between viral replication, the intrinsicIFN-mediated antiviral response, and the resultant cellularimmune-mediated antitumor response.

In the current study, we showed that murine MPNST tumorlines recapitulated our findings in human MPNSTs. Resistantmurine MPNSTs rapidly expressed and accumulated higher ISGexpression and activated signal transducers and activators of thetranscription-1 (STAT1) signaling pathway in response to viralinfection, thus reducing oHSV replication. To test how JAK inhi-bition influenced oHSV therapy, we chose one of the moreresistant MPNST lines (67C-4), which constitutively activatesSTAT1 pathway signaling and restricts viral replication. Pretreat-ment of the resistant MPNSTs with the FDA-approved JAK1/2inhibitor ruxolitinib (RUX, Jakafi, Incyte Corporation) increasedMPNST susceptibility and improved viral spread and gene expres-sion in vitro. On the basis of these results, we hypothesized thatRUX pretreatment would improve C134 replication and antitu-mor effects in vivo. Here, we present evidence that combinationtherapy using RUX and C134 improves oHSV antitumor activityin resistant MPNSTs in a syngeneic model and that this combi-natorial therapy involves both enhanced viral replication and anessential, adaptive CD8þ T-cell response.

Materials and MethodsCell lines and viruses

B76 and B96 cells were generously provided by Dr. StevenCarroll at Medical University of South Carolina and were prop-agated in Dulbecco's modified eagle medium (DMEM) supple-mented with 10% fetal bovine serum (FBS). 67C-4 and 5NPCIScells were kindly provided by Dr. Tim Cripe and were developedand provided to him by his collaborator Dr. Nancy Ratner andmaintained in DMEM supplemented with 10% FBS. Tumor lineswere tested negative for Mycoplasma contamination using theATCC universal Mycoplasma detection kit. Tumor cells withrelative low passage numbers (<12 passages) were used in thestudy before returning for a "low" passage form of the cell line tominimize genetic drift inour studies. Viruses have beenpreviouslydescribed (22), but in brief; HSV-1 (F) strain and R3616, theDg134.5 recombinant, were kindly provided by Dr. BernardRoizman (University of Chicago, Chicago, IL; ref. 23). C134 hasbeen described previously (15, 17). Briefly, C134 is a Dg134.5virus that contains theHCMV IRS1 gene under control of theCMVIE promoter in the UL3/ UL4 intergenic region (ref. 15; Supple-mentary Table S1). C154 is an EGFP-expressing version of C134.

Viral spread assay (in vitro)B76, B96, 67C-4, and 5NPCIS cells were plated into clear, 48-

well flat-bottom polystyrene tissue culture–treated microplates(Corning) and allowed to adhere overnight at 37�C. Cells wereinfected the following day with an EGFP-expressing second-gen-eration oHSV-1 (C154) at the indicated multiplicity of infection(MOI), and the plates were monitored using the IncuCyte Zoomplatform, which was housed inside a cell incubator at 37�C with5%CO2 until the end of the assay.Nine images perwell from threereplicateswere taken every 3 hours for 3 days using a 10� objectivelens and then analyzed using the IncuCyte Basic Software. Greenchannel acquisition timewas 400ms in addition to phase contrast.

Animal studiesAnimal studies were approved by the Nationwide Children's

Hospital Institutional Animal Care and Use Committee (IACUC;protocol number AR16-00088) and performed in accordancewith guidelines established by NIH Guide for the Care and Useof Laboratory Animals. To establish tumors, 2 � 106 67C-4MPNST cells were injected subcutaneously into the flanks of 6-to 8-week-old C57BL/6 mice (Envigo). Tumor sizes were mea-sured biweekly by caliper after implantation, and tumor volumewas calculated by length�width� depth. When tumors reached25 to 150 mm3 in size, animals were pooled and randomlydivided into the specified groups, discussed below, with compa-rable average tumor size. Mice were administered 3 doses of RUX(INCB018424, AbexBio; 60 mg/kg) every day intraperitoneally(i.p.) as described previously (24). Studies were repeated 3 timesto ensure biological validity. Mice were treated with saline orC134 (3.5 � 107 in 100 mL 10% glycerol in PBS) intratumorally(i.t.) onday 4 (1day after the last RUXdose) and again aweek later.

For survival studies, animals were monitored for tumorvolumes three times per week after the initial treatment, untiltotal tumor volume/mouse exceeded 2,000mm3 or an individualtumor was >1,500 mm3. Once overall tumor size exceeded thesecriteria, mice were sacrificed based upon IACUC requirements.For cell recruitment analysis and in vivo gene expression, tumorswere harvested, as described below, 1, 3, 5, and 7 days after the

Ghonime and Cassady

Cancer Immunol Res; 6(12) December 2018 Cancer Immunology Research1500

initial C134 injection. Tumors were washed in PBS and finelyminced into small pieces. Then tissuesweredigested inRPMI1640containing collagenase D (2 mg/mL; Roche) and DNase I (0.01mg/mL; Roche) for 30 minutes at 37�C on a shaking platform.After collagenase digestion, the medium containing the mono-nuclear cells was strained and centrifuged at 400 � g for 10minutes at 4�C, and the resulting cells were resuspended in RPMI1640 supplemented with 1% FBS and penicillin/streptomycin,and then used for flow cytometry analysis and RNA extraction. Forthe CD8 depletion studies, mice were treated with RUX similar tothat described above, but upon initiationof theRUX therapy,micewere randomized into anti-CD8 depletion or isotype treatmentcohorts. Mice were treated with 100 mg of anti-CD8 (Clone 2.43,Bio X Cell) or the isotype control (Clone LTF-2, rat IgG2a. Bio XCell) i.p. twiceweekly throughout the experiment.Mice were thentreated with IT C134 as described above. To quantify CD8 deple-tion,mice underwent a tail-vein bleed (1week after initiatingCD8depletion), and the CD8þ T-cell populations were analyzed usingFITC-conjugated anti-CD8b (clone H35-17.2; eBioscience).

For the acyclovir (ACV, Carlsbad Technology Inc.) and UV-inactivated virus treatment studies, a similar design was used,except UV-inactivated C134 (300 mj) was administered. For theACV-treated cohort, the RUX/C134 treatment was performed asdescribed above, exceptmicewere providedwith 1mg/mLACV intheir drinking water beginning the day prior to virus administra-tion and for 4 days after treatment (25).

Viral replication (in vivo)67C-4 tumors were established in 6- to 8-week-old female

C57BL/6 mice as described in the previous section. When tumorsreached 25 to 150 mm3 in size, mice were randomized andadministered either 3 doses of RUX (60 mg/kg) or 3 doses ofvehicle i.p. daily for 3 days. On the fourth day, all mice weretreated with C134 i.t. (3.5 � 107 pfu in 100 mL 10% glycerol andPBS). On days 1, 3, and 5 after virus treatment, tumor sampleswere harvested and homogenized as mentioned previously. DNAwas extracted by DNeasy blood and tissue kit (Qiagen) per themanufacturer's instructions. Virus recovery was measured by Taq-Man quantitative PCR (22). Briefly, extracted DNA samples wereincubated with the following HSV-specific primers and probesfor HSV polymerase (sequences kindly provided by Dr. FredLakeman University of Alabama at Birmingham, Birmingham,Alabama): PolF (forward), 50-ACCGCCGAACTGAGCAGAC-30;and PolR (reverse), 50 -TGAGCT TGT AAT ACACCG TCAGGT-30.The fluorescent-labeled probe sequence was 50-6FAM-CGC GTACAC CAA CAA GCG CCT G-TAMRA-30. HSV genome equivalentsof the amplified product were measured from triplicate samplesusing a StepOne Plus real-time PCR system (Applied Biosystems)and compared against logarithmic dilutions of a positive controlDNA sequence (106–101 copies). Descriptive statistical analyses(mean and SD) were used to compare differences in DNA copynumbers between samples using Prism 7.0 statistical software(GraphPad).

RNA isolation and gene expressionTotal RNA was isolated from tumor samples using the Direct-

zol RNA Miniprep Plus kit (Zymo Research) according to themanufacturer's instructions. RNA quantity and purity was deter-mined using a NanoDrop 2000 Spectrophotometer (ThermoFisher Scientific). Two micrograms of total RNA was used tosynthesize cDNA using SuperScript III Reverse Transcriptase (Life

Technologies) according to the manufacturer's instructions.Quantitative real-time PCR was performed using the StepOnePlus real-time PCR system (Applied Biosystems). The primer pairsusedwere as follows: RIG-1: sense, TGTGGGCAATGTCATCAAAA,anti-sense, GAAGCACTTGCTACCTCTTGC; MDA5: sense, GGC-ACCATGGGAAGTGATT, anti-sense, ATTTGGTAAGGCCTGAGC-TG; IFN-a: sense, AAAGAA ATGTAA GAAAGC TTTTGATGA, anti-sense, TACACTTTG GCTCAGGACTCATTT GAPDH: sense, GAC-AACTTTGGTATCGTGGAA, anti-sense, CCAGGAAATGAGCTT-GACA (26, 27). PowerUp SYBR Green Master Mix (ThermoFisher Scientific) was used to quantify the gene transcripts in20 mL reactions according to the manufacturer's instructions.Cycling conditions included the initial step of 2 minutes at 50�Cand 2 minutes denaturation at 95�C, followed by 40 thermalcycles of denaturation at 95�C for 15 seconds, annealing at 58�Cfor 15 seconds, and elongation at 72�C for 30 seconds. Resultswere expressed in relative copy numbers (RCN) as describedelsewhere (28). Briefly, RCN¼ 2�DCt� 100,withDCt calculatedby subtracting the average Ct of housekeeping control (GAPDH)from the experimental sample Ct.

Flow cytometrySingle-cell suspensions from tumors were obtained as

described previously (29). Briefly, tumors were washed in PBSand finely minced into small pieces. Then tissues were digestedin RPMI 1640 containing collagenase D (2 mg/mL; Roche) andDNase I (0.01 mg/mL; Roche) for 30 minutes at 37�C on ashaking platform. After collagenase digestion, the medium con-taining the mononuclear cells was filtered and centrifuged at400 � g for 10 minutes at 4�C, and the resulting cells wereresuspended in PBS supplemented with 1% FBS and then usedfor flow cytometry analysis. Single-cell suspensions from tumorswere lysed with RBC lysis buffer (Sigma) and blocked with 5%mouse Fc blocking reagent (2.4G2, BD Biosciences) in FACSbuffer (1% FBS and 1 mmol/L EDTA in PBS). Cells were labeledwith the following antibody staining panels for analysis of theadaptive immune cells: CD11b-Violet 421 (M1/70), CD4-BV785(GK1.5), CD25-PE (7D4), CD8a-BV510 (53-6.7), CD3e-BV 711(145-2C11), CD44-APC, CD45-BV605, NKp46–PE-Cy7, andB220-AF488 (RA3-6B2) from BioLegend. Dead cells were exclud-ed by staining with Live/Dead Near/IR staining (APC-Cy7;Thermo Fisher Scientific). Single samples were stained with theabove staining panels for 30 minutes on ice and washed onetime with FACS buffer. After labeling, cells were fixed in 1%paraformaldehyde and analyzed on a BD FACS LSR II (BDBiosciences). Analysis was carried out using the FlowJo software,version 10.0.3 (TreeStar Inc.).

For T-cell proliferation assays, splenocytes were prepared frommechanically dissociated and filtered spleens using a 70-mm cellstrainer and a sterile 5mL syringe plunger. Then, splenocytes werelabeled with Cell Trace Violet (CTV) in accordance with themanufacturer's guidelines (Life Technologies). Dye levels weretitrated to achieve the brightest, most uniform staining distribu-tion and the best viability in culture for the cells that were beingused. Briefly, cells are counted, washed once in warm PBS, andresuspended in prewarmed PBS containing 0.2% FBS labelingsolution at a density of 20� 106/mL and incubated with an equalvolume of CTV staining solution in PBS at 37�C for 12 minutes.RPMI supplemented with 1% FBS was added at 4 times of theoriginal volume to absorb remaining free dye. Cells were centri-fuged and resuspended in fresh media.

Ruxolitinib Prior to Virotherapy Improves Its Efficacy

www.aacrjournals.org Cancer Immunol Res; 6(12) December 2018 1501

For proliferation and activation assays, splenocytes (5 � 105)from the treated tumor-bearing mice were plated in round-bottom 96-well plates and stimulated with 10 mmol/L EphA2peptide (671-FSHHNIIRL-679) or control peptide (498-SSIE-FARL-505) for 6 hours. In parallel studies, CFSE-labeled spleno-cytes (5�105)were incubated in 96-well plates alone (no cells) orwith mitomycin C (50 mg/mL for 45 minutes) treated andwashed 67C-4 cells at 37�C for 3 days. Samples were incubatedwith protein transport inhibitor containing 1 mL/mL brefeldin A(GolgiPlug, BD Biosciences) for 6 hours prior to flow cytometrystaining (as described above) and CD8þ T lymphocytes wereanalyzed by flow cytometry for IFNg intracellular staining,proliferation (CFSE), and activation (CD25).

Western blottingCellular lysates from tumor samples were collected on ice in

disruption buffer (10 mmol/L Tris-Cl pH 8.0, 1 mmol/L EDTA,1% Triton X100, 0.1% sodium deoxycholate, 0.1% SDS, 140mmol/L NaCl, 20% b-mercaptoethanol, 0.04% bromophenolblue) with complete, mini protease inhibitor cocktail (Roche).The protein concentrations were determined using Pierce BCAProtein Assay Kit (Thermo Scientific). Samples were denatured at98�C for 5minutes, chilled on ice, separated by PAGE, transferredto a nitrocellulosemembrane (Thermo Scientific) and blocked for1 hour at room temperature with 5% dry milk (S.T. Jerrell Co.) orbovine serum albumin (Fisher Scientific). Membranes were incu-bated overnight at 4�C with primary antibody diluted in Tris-buffered saline with 0.1% Tween-20 (TBST). Primary antibodiesagainst RIG-I (clone D14G6), MDA-5 (clone D74E4), and p-STAT-1 (clone 58D6) were purchased from Cell Signaling Tech-nology and against actin (clone C4) fromChemicon. Membraneswere repeatedly washed with TBST, incubated for 1 hour withHRP-conjugated goat anti-rabbit (Pierce) for RIG-I, MDA-5, andp-STAT-1 or goat anti-mouse (Pierce) for actin diluted in TBST(1:20,000 dilution) at room temperature, and subsequentlywashedwith TBST.Membraneswere developed using SuperSignalWest Pico Chemiluminescent Substrate (Thermo Scientific) andexposed to X-ray film (Research Products International).

Statistical analysisStatistical analysis was performed using Prism 7 (GraphPad

Software). One-way ANOVA with correction for multiple com-parisons (Holm–Sidhak or Kruskal–Wallis as specified) wasused for analysis involving multiple cell lines or otherwisespecified. For comparing tumor growth over time between twotreatment groups, two-way ANOVA with Sidak multiple com-parisons test was used. Survival was assessed using log-rankassay, and data were shown using Kaplan–Meier curves. For allanalyses, the cutoff for statistical significance was set at P < 0.05.The following notation was used: (ns) P > 0.05; �, P � 0.05; ��,P � 0.01; ���, P � 0.001.

ResultsIncreased IFN activity and ISG accumulation restricts oHSVinfection and spread

We previously showed that basal ISG accumulation and rapidIFN signaling in �50% of human MPNST lines restricts oHSVinfection and was a potential impediment to oncolytic HSVtherapy (19). We were interested in how viral replication andthe ensuing immune-mediated antitumor response were linked

and their role in the oHSV antitumor effect. We, therefore, soughtto develop a syngeneic MPNST model to evaluate how JAK/STATsignaling modulation influences the oHSV-1 antitumor effect inresistant MPNSTs. We screened four different murine MPNSTlines for STAT1 activation and ISG expression to determine ifmurine MPNSTs share a similar resistance mechanism to humanMPNSTs. Figure 1A shows that, consistent with our past studies(19), B76 cells were susceptible to C134 infection and permittedcell-to-cell spread (quantified by the EGFP expression over time),whereas the other MPNST lines tested (B96, 5NPCIS, and 67C-4)restricted C134 infection and spread. Immunoblotting analysisshowed that IFN signaling (phosphorylated STAT1: p-STAT1) didnot occur prior to infection or within 6 hours of C134 infection inthe sensitive MPNST B76 cell line. In contrast, the more resistantlines demonstrated varied IFN responsiveness to C134 infection,with two of the lines (5NPCIS and 67C-4) exhibiting basal p-STAT1 activity prior to oHSV infection. Consistent with the p-STAT1 results, we also saw increased accumulation of RIG-I, oursurrogate protein for ISG expression. The cell lines that had thehighest basal p-STAT1 and ISG accumulation (67C-4 and5NPCIS) were the most resistant to oHSV infection and spread,consistent with our prior human MPNST results (Fig. 1B).

RUX decreases ISG expression and improves oHSV spreadin vitro

To examine whether RUX pretreatment improved C134 infec-tion and spread in resistant murine MPNSTs, similar to our

Figure 1.

JAK/STAT activation and ISG accumulation in oHSV-susceptible and -resistantmurine MPNSTs. A, B76, B96, 5NPCIS, and 67C-4 murine MPNST cells wereinfected with GFP-expressing C134 (C154) at an MOI of 1. Viral spread wasmeasured by the IncuCyte Zoom over time. Viral infection and spread wasanalyzed using Prism 7 (GraphPad Software). Two-way ANOVA with Tukeycorrection for multiple comparisons; ���� , P < 0.0001. B, C134-infected(MOI ¼ 1) and noninfected (–) cells were harvested 6 hours after infection andanalyzed by immunoblotting for STAT1 phosphorylation (top), RIG-I expressionand actin (bottom).

Ghonime and Cassady

Cancer Immunol Res; 6(12) December 2018 Cancer Immunology Research1502

previous findings in human MPNSTs, we exposed 67C-4 toincreasing doses of RUX for two days and evaluated STAT1activation (p-STAT1) and ISG protein expression (RIG-I andMDA-5). We also performed studies that showed that RUX(125–1,000 nmol/L) did not have a direct cytotoxic or antipro-liferative effect on the tumor cells (Supplementary Fig. S1). RUXpretreatment decreased basal Stat activation and ISG accumula-tion (RIG-I and MDA-5) in a dose- and time-dependent manner,with maximal inhibition attained with pretreatment for 2 dayswith 250 nmol/L (Fig. 2A and B). Next, we examined how RUXpretreatment (250 nm) for 2 days with or without cotreatmentaffected STAT signaling and ISG accumulation, as well as subse-quent oHSV gene expression, infection, and spread. Figure 2Cshows that both regimens (pretreatment with or without cotreat-ment) diminished ISG accumulation, demonstrated by decreasedRIG-I and MDA-5 expression. STAT1 activation was blockedcompletely by the combined regimen (pretreatment and cotreat-ment). Pretreatment and removal at the time of infection per-mitted STAT1 phosphorylation in both mock and infectedcells, while reducing ISG expression prior to infection. We thenexamined the effect of RUX pretreatment on virus infection andspread. The results showed that in the untreated cells, C154 (GFP-expressing C134) did not readily infect or generate a cytopathiceffect, whereas in the RUX-pretreated cells, C154 gene expression(GFP), infection, and cytopathic effect was enhanced (Fig. 2D).Kinetic analysis of the varying drug doses and their effect on C154replication and spread over time is provided (Fig. 2E).

RUX reduces ISG accumulation in tumors and improves viralreplication in vivo

After showing that murine MPNSTs recapitulated a similaroHSV-resistance mechanism as human MPNSTs, we next soughtto determine whether RUX pretreatment reduced ISG accumula-tion and STAT response in vivo. As shown in the schematic

(Fig. 3A), C57BL/6J immunocompetent mice with established67C-4 tumors were treated with RUX (60 mg/kg/d) for 3 conse-cutive days. One day later (immediately prior to C134 treatment),micewere sacrificed, and ISG expression and STAT activationweremeasured in their tumors. Our results showed that, consistentwith in vitro studies, RUX pretreatment significantly reduced IFNaand ISG (RIG-I, MDA-5) gene expression (Fig. 3B). Immunoblot-ting analysis from the untreated and RUX-pretreated tumors alsoshowed reduced ISG expression in vivo (Fig. 3C). A day after theirfinal RUX dose, mice were treated with C134 i.t., and viralreplication was measured by HSV qPCR. As shown in Fig. 3D,in the untreated mice, C134 did not replicate effectively and virusrecovery declined after injection (2.7 � 105 copies), but RUXpretreatment improved C134 replication (2.61 � 107 copies),leading to a 96-fold increase in viral recovery by day 5 after C134treatment. In conclusion, these results showed that RUX pretreat-ment reduced IFN signaling and ISG expression and improvedviral replication in syngeneic 67C-4 tumors, similar to our earlierin vitro 67C-4 studies (Fig. 2A–C).

RUX pretreatment improves antitumor activity and survivalNext, we sought to determine if RUX pretreatment improved

C134 antitumor activity in the oHSV-resistant model. Similar tothe discussion above, 67C-4 tumors were established in C57BL/6Jmice and RUX-treated for 3 consecutive days, followed by 2 i.t.doses of C134, 1 week apart (Fig. 4A). When used alone, neitherRUX nor C134 injection had any antitumor activity in theseresistant tumors. However, when the two therapies were com-bined, they significantly reduced tumor growth (Fig. 4B and C)and improve animal survival (Fig. 4D). To determine if theobserved C134 replication advantage was integral to this antitu-mor efficacy, we repeated the RUX/C134 combination therapybut included matched cohorts where virus replication was sup-pressed using either C134 or UV-inactivated C134 in the presence

Figure 2.

RUX pretreatment diminishes basalISGs and improves viral spread inresistant MPNSTs. A, Immunoblottingof 67C-4 cells. p-STAT1, RIG-I, MDA-5,and actin (loading control) afterpretreatment with RUX at increasingconcentrations (0–1,000 nmol/L) for2 days. B, Immunoblotting of 67C-4cell lysates with RUX (250 nmol/L)daily for 3 days. C, 67C-4 cells wereuntreated (–), pretreated (PreTX),or pretreated and cotreated(Pre þ CoTx) with RUX (250 nmol/L)for 2 days and then infected with orwithout C134 or R3616 for 6 hours. Celllysates were then collected andanalyzed by immunoblotting for theexpression of p-STAT1, RIG-I, MDA-5,and actin (loading control). D, Brightfield, fluorescent, and combinedimages are shown frommock (NL) andC154 (C134 þ GFP) infected (MOI 1)untreated and RUX (250 nm) treated67C-4 cells 12 hours after infection.E, RUX pretreatment at variousconcentrations (125–500 nmol/L) for2 days, and its effect on C154 (MOI 1)viral spread in 67C-4 cells.

Ruxolitinib Prior to Virotherapy Improves Its Efficacy

www.aacrjournals.org Cancer Immunol Res; 6(12) December 2018 1503

of the HSV antiviral drug acyclovir (ACV). RUX pretreatedtumor-bearing mice that were administered UV-inactivatedC134 or were treated with C134 in conjunction with antiviraltherapy did not exhibit any antitumor effect, suggesting thatviral replication is necessary for the RUX/C134 antitumor effect(Supplementary Fig. S2).

The immune-mediated antitumor response is necessary forRUX/C134 activity

Combination therapy produced an initial antitumor effect(tumor growth reduction) that could be explained by theimproved C134 replication and direct oncolytic effect. However,the degree and timing of the antitumor effect appeared out ofproportion to direct oncolytic activity (Fig. 3D). The antitumoractivity and reduced tumor growth weeks after C134 treatmentsuggested that an immune-mediatedmechanismalso contributedto combination therapy's efficacy. We, therefore, repeated thestudies and analyzed the immune cell infiltrates. Although noproportional differences between the treatment cohorts withregard to their overall T-cell, CD4þ, or CD8þ T-cell populationswere seen (Supplementary Fig. S3A–S3C), a significant increase inthe activation status (CD44þ and CD25þ) of the CD8þ T cells inthe combination therapy group occurred (Fig. 5A–C; Supplemen-tary Fig. S3D). This activation was unique to CD8þ T cells and didnot occur in the CD4þ T-cell population (Supplementary Fig. S3Eand S3F). By day 5 after virotherapy, the CD8þ T-cell population

significantly increased in the RUX/C134-treated tumors (Fig. 5D).These data indicated that only Rux/C134 therapy was capable ofincreasing this effector population in the tumors. When weexamined the response in the periphery, we found that bothC134 and Rux/C134 combination therapy also induced CD8þ

T cells in the spleen (Supplementary Fig. S4A and S4B).To elucidate themechanisms underlying T-cell restrictionwithin

the tumors, wenext assessed expressionof inhibitory receptor PD-1on CD8þ T cells. Single-cell suspensions of enzymatically digestedtumors were analyzed by flow cytometry. As demonstratedin Fig. 5E, RUX/C134 combination therapy significantly increasedthe PD-1–negative CD8þ T cells, a cytotoxic T-lymphocyte (CTL)population not subject to costimulatory PD-L1 restriction in thetumor. Our results showed that RUX/C134 combination therapynot only increased CTLs but also decreased regulatory T cells (Treg)in the tumors (Fig. 5F), including the describedCD8þFoxP3þ T-cellpopulation (Supplementary Fig. S4C; refs. 30, 31). These datashowed that RUX/C134 therapy significantly shifted the CTLresponse in the tumors, increasing the effector T-cell-to-Treg ratio(Fig. 5G), and suggest thatCD8þCTLs contribute to the RUX/C134antitumor efficacy (32).

Next, to determine if the CD8þ T-cell population was requiredfor C134 antitumor activity, we repeated the in vivo studies andincluded a CD8þ T-cell–depleted cohort. The depletion condi-tions were validated by flow cytometry of peripheral blood andincluded an isotype-treated control cohort (Fig. 6A and B). In

Figure 3.

RUX treatment reduces basal STAT1 activation and ISG expression and enhances oHSV viral replication in mice bearing resistant MPNSTs. A, C57BL/6 micewere implanted with (2� 106) 67C-4 cells subcutaneously in the flank. Once the tumors reached 25 to 150mm in size, the tumor-bearingmice were randomized andadministered saline or RUX (60 mg/kg/d, i.p.) for 3 consecutive days. The following day, tumors were harvested, homogenized, and analyzed by (B)qPCR for IFNa, RIG-I, and MDA-5 gene expression and (C) by immunoblotting for RIG-I, MDA-5, p-STAT1, and actin. D, Viral replication was also measured in themock- and RUX-treated mice. As in A, mock- and RUX-treated cohorts were treated with 3.5 � 107 C134 i.t. on day 3. Mice were sacrificed on days 4, 6, and 8(days 1, 3, and 5 after C134 treatment), their tumors were harvested, and HSV recovery was measured by TaqMan qPCR. Results shown as the mean � SEMof 5 mice/group. �, P < 0.05; �� , P < 0.01; ��� , P < 0.001; n.s., not significant (two-way ANOVA).

Ghonime and Cassady

Cancer Immunol Res; 6(12) December 2018 Cancer Immunology Research1504

contrast to the isotype-treated cohort, CD8þ T-cell depletioneliminated the antitumor benefit of RUX/C134 therapy, indicat-ing that the CD8þ T cells were integral to the antitumor activity(Fig. 6C and D).

Combination treatment increases circulating antigen-specificCD8þ T cells

Having shown that the combination therapy improved anti-tumor activity and confirmed that CD8þ T cells were integral totumor regression, we next evaluated if combination therapyinduced a tumor antigen–specific response. To assess this, wemeasured CTL activation and proliferation after tumor antigenexposure using day 5 after treatment splenocytes. As shownin Fig. 7A, no basal difference in T-cell activity between the 4treatment cohorts was seen. However, when the splenocyteswere incubated with mitomycin C–treated 67C-4 cells, CD8þ

T cells from the RUX þ C134 cohort produced a significantlyhigher IFNg response than the CD8þ T cells from the othertreatment cohorts. Exposure of cells to the specific 67C-4 tumorantigen EphA2, but not control peptide (Supplementary Fig.S5A and S5B), induced CD8þ T-cell proliferation and activa-tion, represented by the CD25 expression (Fig. 7B). In sum-mary, our data suggest that combination RUX/C134 therapyimproves viral replication and antitumor immune activity,both of which are integral to the antitumor effect.

DiscussionIFN and STAT1 activation are generally considered to be anti-

tumor effectors due to their proapoptotic, antiangiogenic, geno-toxic potentiating effects. However, high STAT1 activation alsoconfers cancer therapy resistance (33). STAT1-mediated radio-resistance has been described in many tumors, is associated withthe expression of a subset of ISGs termed IRDS (IFN-related DNAdamage resistance signature), and occurs in squamous cell carci-noma, breast cancer, head and neck cancer, colon cancer, prostatecarcinoma, and gliosarcoma (34–36). A sustained STAT1 activa-tion was also described in cisplatin-resistant ovarian cancer cellsand human lung cancer cells resistant to the topoisomeraseinhibitor etoposide (37, 38).

Our previous studies in humanMPNSTs showed that basal IFNand ISG expression predicted oncolytic virotherapy resistance andthat by pretreating the resistant cells with a JAK1/2 inhibitor, RUX,we could reset ISG expression in the cells and make them oHSVsusceptible again. To test our hypothesis that ISG downregulationimproves viral replication and enhances the oHSV antitumoreffect, we sought a preclinical, syngeneic, resistant MPNSTmodel.In this study, we showed that RUX pretreatment followed byoHSV treatment reduced tumor growth and improved survivalin vivo. Our results showed that murine MPNSTs had a similaroHSV-resistance mechanism as human MPNSTs, composed of

Figure 4.

RUXenhancesC134 antitumor effect in resistantMPNSTs and improvesmice survival.A,Schematic of the experimental approach: C57BL/6micewere implantedwith(2 � 106) 67C-4 cells subcutaneously in the flank. Tumor-bearing mice were randomized and divided into 4 treatment cohorts (mock, RUX alone, C134alone, and combined RUXþC134) with 5mice/treatment group. Tumor-bearingmicewere administered saline or RUX (60mg/kg/d, i.p.) for 3 consecutive days andthen treated with vehicle or 3.5 � 107 C134 i.t. on days 3 and 10. B, Tumor growth was then measured by caliper-based tumor measurement (length � width�depth) over time.C, Tumor size differences (day 32) andD, mouse survival for the different treatment cohorts. Results, mean� SEMof 5mice/group. � , P <0.05; �� ,P < 0.01; ��� , P < 0.001; ���� , P < 0.0001; n.s., not significant (two-way ANOVA). Survival was assessed using the log-rank test: the data are shownusing Kaplan–Meier survival curves with median survival for each cohort included.

Ruxolitinib Prior to Virotherapy Improves Its Efficacy

www.aacrjournals.org Cancer Immunol Res; 6(12) December 2018 1505

basal IFN activity, rapid STAT1 phosphorylation, and ISG over-expression that restricted oHSV infection. Antiviral ISGs defendthe host cell from viral infection and replication. Viruses haveevolved genes to evade these host antiviral proteins (39–42).HSV encodes numerous genetic mechanisms (e.g., g134.5,Us11, and Us12) to subvert host mediated antiviral orimmune-mediated responses. HSV also encodes genes (VHSand a27) that give it a selective transcriptional advantage overthe host cell (43, 44). Our data showed that host RIG-I proteinexpression decreases in HSV-infected cells. However, we do notknow if this was a targeted viral response or a function of viraltranscriptional control of the cell (39–42).

RUX pretreatment reduced ISG expression and increasedmurine MPNST oHSV susceptibility both in vitro and in vivo. Totest if RUX pretreatment enhanced oncolytic HSV antitumoractivity, we used 67C-4 MPNST tumor cells because of their highISG expression and STAT1 activation. We anticipated that thisconstitutive STAT1 pathway activation produced an environmentunconducive to virus replication in vivo and would restrict oHSVantitumor activity. We found that, alone, neither RUX nor C134treatment produced detectable antitumor effects. However, whenthe two were administered sequentially (RUX followed by C134),the combination reduced tumor growth and improved animalsurvival.

Figure 5.

Combination therapy improves CD8þ

CTL activation in the tumor. As inFig. 3A, C57BL/6 mice implanted with(2 � 106) 67C-4 cells subcutaneouslywere randomized and divided into 4cohorts based on treatment regimen:mock, RUX alone, C134 alone, andRUX þ C134. Tumors were harvested,processed into single-cellsuspensions, and the TIL populationswere analyzed. A, Overall CD8þ

T-cell populations day 6 of treatment(day 3 after viral treatment) weresimilar in all treatment cohortsRUX þ C134 treatment increasedCD8þ T-cell activation as shownby (B)CD44 and (C) CD25 expression on theCD8þ T cells (D6 of the overall studyand D3 after oHSV treatment).Representative flow cytometry plotsbelow showCD25 expression onCD8þ

T cells from the different treatmentcohorts. D, On day 10 (day 7 after viraltreatment), tumors were harvested,processed into single-cellsuspensions, and CD8þ T lymphocyteswere analyzed by flow cytometry toassess CD8þ T-cell populationdifferences. E, PD-1 (þ) and PD-1 (�)T-cell population percentages; F,FoxP3 expression on T-cell subsets,and G, the ratio of CD8þ to CD4þ

FoxP3þ in the TILs from our differenttreatment cohorts are shown. Results,mean � SEM of 5 mice/group.� , P < 0.05; �� , P < 0.01; ��� , P < 0.001;���� , P < 0.0001; n.s., not significant(two-way ANOVA).

Ghonime and Cassady

Cancer Immunol Res; 6(12) December 2018 Cancer Immunology Research1506

Although our viral recovery studies showed improved viralreplication, the timing and persistence (2–3 weeks after virusadministration) of the tumor growth suppression suggested animmune-mediated mechanism was also involved. We, therefore,examined the immune cell infiltrates in the tumors, with a focuson the adaptive immune response. Combination treatment withRUX followed by C134 increased T-cell activation and antitumoractivity. The T-cell distributions (CD4þ, CD8þ, or total) in thetumor-infiltrating lymphocytes (TIL) were similar in all the treat-ment cohorts early. However, only mice pretreated with RUX andthen treated with C134 exhibited CD8þ T-cell activation (CD25/CD44) and generated an antitumor response. To examine wheth-er similar CTL activity was detectable in the periphery, we exam-ined the lymphocyte populations in the spleen. Our resultsshowed that CD8þ T-cell activity was increased in both oHSV-treated cohorts (C134 and RUX þ C134) on days 3 to 5 aftertreatment. By day 7 after virus treatment, the infiltrating CD8þ T-lymphocyte population was significantly increased in the RUX þC134–treated cohort, and these CTLs did not express PD-1 and,therefore, appeared capable of increased activity. Based uponthese findings, we sought to determine if CTLs were integral toRUX/C134 therapy. We depleted CD8þ T cells and confirmedtheir essential role in the oHSV-mediated antitumor effect. Whenthe CD8þ T cells were exposed to tumor antigens, cells fromanimals treated with the combination therapy showed a morerobust response (activation and proliferation), indicating thatOV

therapy can induce a specific antitumor antigen response and notsimply an antiviral response.

We conclude that CTLs are integral to C134 therapy but thatbasal STAT signaling in MPNSTs impairs TIL function and pre-vents an effective antitumor immune response after oHSV ther-apy. We postulate that this is likely related to an IFN-inducedchronic inflammatory state and T-cell immune exhaustion. Path-ologic type I IFN production is well described in chronic viralinfections and induces a dysfunctional immune statewhere T cellsbecome exhausted by the chronic inflammatory state, thus unableto clear the virus (45). Paradoxically, chronic expression of anantitumor cytokine (type I IFN) creates both an inflamed, yetimmunosuppressive, environment that prevents an effective anti-tumor immune response after oHSV treatment (46). Chronicinflammation promotes tumor initiation, progression, andmetastasis by providing a tumor-supporting microenvironment.Evidence indicates that chronic inflammation also establishesimmunosuppression that promotes immune exhaustion andlimits CTL function, which has been well described in manytumors, such as gliomas, melanoma, gastrointestinal malignan-cies, and hepatic and breast carcinoma (47–50). Bellucci andcolleagues and Liu and colleagues previously reported that acti-vation of JAK1, JAK2, and STAT1 in tumor cells results in theupregulation of PD-L1 and inhibition of T-cell functions (51, 52).We showed that MPNSTs should be included in this list ofinflammatory tumors.

Figure 6.

CD8þ T cells contribute to the efficacy of RUX þ C134 combination therapy. C57BL/6 mice were implanted with (2 � 106) 67C-4 cells subcutaneously in the flank.Tumor-bearing mice were randomized into 4 treatment cohorts each with 10 tumors (mock, RUX, C134, and RUX þ C134) with 5 mice/cohort. Mice wereadministered RUX (60mg/kg, i.p.) for 3 consecutive days and then treated with 3.5� 107 C134 i.t. at day 3 and 10 as described in Fig. 4A. Mice were randomized andthen treated with equimolar Ig anti-CD8a or isotype control every other day starting with the second dose of RUX. A, CD8þ T-cell depletion confirmationby flow cytometry of peripheral blood in the anti-CD8a and isotype control groups. B, Representative flow cytometry plot from the Ig anti-CD8a and isotype controlcohort. C and D, Tumor growth was measured by caliper and recorded (¼ length � width � depth) over time in the 6 treatment cohorts. C, Mock (Sal)-,RUX-, and C134-treated cohorts were indistinguishable, similar to earlier studies; combination RUXþ C134 reduces tumor growth. D, Combination therapy reducestumor growth in the isotype-treated control but is ineffective in the CD8a-depleted cohort. Data were analyzed by two-way ANOVA with the Sidak multiplecomparisons test. Results, mean � SEM of 5 mice per group. � , P < 0.05; �� , P < 0.01; ��� , P < 0.001; ���� , P < 0.0001; n.s., not significant (two-way ANOVA).

Ruxolitinib Prior to Virotherapy Improves Its Efficacy

www.aacrjournals.org Cancer Immunol Res; 6(12) December 2018 1507

In the case of MPNSTs, constitutive JAK/STAT signaling path-way activation not only acts as a resistance mechanism to protecttumor cells against oncolytic viruses and other antitumor modal-ities such as chemoradiotherapeutics (19, 53), but also protectstumor cells against the cytotoxic CD8þ T lymphocytes. We,therefore, postulated that modalities that enhance CD8þ T-cellcytotoxicity could further enhance the antitumor activity of ourcombination therapy. Inhibiting the interaction between the PD-L1–expressing cells and T lymphocytes by checkpoint inhibitors,such as anti–PD-1 or anti–CTLA-4, and the role of PD-L1 expres-sion on tumor andmyeloid immune cells, as well as on regulatingthe cytotoxic T-lymphocyte function, are key questions to beanswered in ensuing studies. Although we have shown that CTLsare an endpoint effector of the oHSV-induced antitumor immuneresponse, a complex set of immune regulatory events lead up to

this CTL response. Their role in oHSV combination therapy hasnot been fully investigated. How RUX "resets" this chronicinflammatory environment, the role of both myeloid and CD4þ

T-cell regulation of the CTL response, and whether the chronicinflammatory environment reestablishes or diminishes the anti-tumor CTL response have not been addressed. Our results showedthat basal IFN/STAT1 activity in some MPNSTs produced achronically inflamed antiviral, yet immunosuppressive, environ-ment that limited oHSV efficacy. RUX pretreatment not onlyenhanced virus infection and replication but also boosted theimmune-mediated antitumor immune response, improving sur-vival and reducing tumor growth.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Figure 7.

Activation of CD8þ T cells in response to exposure to tumor cells or antigens. C57BL/6 mice were implanted with (2 � 106) 67C-4 cells subcutaneously in theflank. Tumor-bearing mice were randomized and divided into 4 treatment cohorts (mock, RUX alone, C134 alone, and RUX þ C134); 3 mice in each cohort.Tumor-bearing mice were administered saline or RUX (60mg/kg/day, i.p.) for 3 consecutive days and then treated with vehicle or 3.5� 107 C134 i.t. on day 3. Threedays after viral treatment, spleens were harvested, processed into single-cell suspensions, and CFSE labeled. A, Splenocytes were stimulated with or withoutmitomycin C–treated 67C-4 for 6 hours in the presence of protein transport inhibitor containing brefeldin A, and CD8þ T lymphocytes were analyzed by flowcytometry for IFNg production by intracellular staining. B, Splenocytes were incubated with 10 mmol/L EphA2 for 3 days. On day 3, CD8þ T lymphocytes wereanalyzed by flow cytometry for proliferation (CFSE) and activation (CD25). Results, mean � SEM of 5 mice per group. � , P < 0.05; �� , P < 0.01; ��� , P < 0.001;���� , P < 0.0001; n.s., not significant (two-way ANOVA).

Ghonime and Cassady

Cancer Immunol Res; 6(12) December 2018 Cancer Immunology Research1508

Authors' ContributionsConception and design: M.G. Ghonime, K.A. CassadyDevelopment of methodology: M.G. Ghonime, K.A. CassadyAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M.G. Ghonime, K.A. CassadyAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): M.G. Ghonime, K.A. CassadyWriting, review, and/or revision of the manuscript: M.G. Ghonime,K.A. CassadyAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): M.G. Ghonime, K.A. CassadyStudy supervision: M.G. Ghonime

AcknowledgmentsThis study was supported by Hyundai Hope on Wheels, Alex's Lemonade

Stand Foundation, CancerFreeKids, and Department of Defense (NFRP-IIRA).The authors wish to thank Hannah Mohd Amir for her assistance with these

studies and manuscript editing.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received January 10, 2018; revised July 27, 2018; accepted October 16, 2018;published first October 23, 2018.

References1. FaridM, Demicco EG, Garcia R, Ahn L,Merola PR, CioffiA, et al. Malignant

peripheral nerve sheath tumors. Oncologist 2014;19:193–201.2. Evans DG, Baser ME, McGaughran J, Sharif S, Howard E, Moran A.

Malignant peripheral nerve sheath tumours in neurofibromatosis 1. J MedGenet 2002;39:311–4.

3. Kroep JR, Ouali M, GelderblomH, Le Cesne A, Dekker TJ, VanGlabbekeM,et al. First-line chemotherapy for malignant peripheral nerve sheath tumor(MPNST) versus other histological soft tissue sarcoma subtypes and as aprognostic factor for MPNST: an EORTC soft tissue and bone sarcomagroup study. Ann Oncol 2011;22:207–14.

4. Zou C, Smith KD, Liu J, Lahat G, Myers S, Wang WL, et al. Clinical,pathological, and molecular variables predictive of malignant peripheralnerve sheath tumor outcome. Ann Surg 2009;249:1014–22.

5. Deyle DR, Escobar DZ, Peng KW, Babovic-Vuksanovic D. Oncolytic mea-sles virus as a novel therapy for malignant peripheral nerve sheath tumors.Gene 2015;565:140–5.

6. Markert JM, Parker JN, Gillespie GY, Whitley RJ. Genetically engineeredhuman herpes simplex virus in the treatment of brain tumours. Herpes2001;8:17–22.

7. Filley AC, Dey M. Immune system, friend or foe of oncolytic virotherapy?Front Oncol 2017;7:106.

8. Fulci G, Breymann L, Gianni D, Kurozomi K, Rhee SS, Yu J, et al. Cyclo-phosphamide enhances glioma virotherapy by inhibiting innate immuneresponses. Proc Natl Acad Sci USA 2006;103:12873–8.

9. Sokolowski NA, Rizos H, Diefenbach RJ. Oncolytic virotherapy usingherpes simplex virus: how far have we come? Oncolytic Virother 2015;4:207–19.

10. Kanai R, ZaupaC, SgubinD, Antoszczyk SJ,Martuza RL,WakimotoH, et al.Effect of gamma34.5 deletions on oncolytic herpes simplex virus activity inbrain tumors. J Virol 2012;86:4420–31.

11. Kaur B, Chiocca EA, Cripe TP. Oncolytic HSV-1 virotherapy: clinicalexperience and opportunities for progress. Curr Pharm Biotechnol 2012;13:1842–51.

12. Fukuhara H, Ino Y, Todo T. Oncolytic virus therapy: A new era of cancertreatment at dawn. Cancer Sci 2016;107:1373–9.

13. Pol J, Kroemer G, Galluzzi L. First oncolytic virus approved for melanomaimmunotherapy. Oncoimmunology 2016;5:e1115641.

14. Marshall EE, Bierle CJ, Brune W, Geballe AP. Essential role for either TRS1or IRS1 in human cytomegalovirus replication. J Virol 2009;83:4112–20.

15. Cassady KA. Human cytomegalovirus TRS1 and IRS1 gene products blockthe double-stranded-RNA-activated host protein shutoff response inducedby herpes simplex virus type 1 infection. J Virol 2005;79:8707–15.

16. Cassady KA, Saunders U, Shimamura M. Deltagamma(1)134.5 herpessimplex viruses encoding human cytomegalovirus IRS1 or TRS1 induceinterferon regulatory factor 3 phosphorylation and an interferon-stimu-lated gene response. J Virol 2012;86:610–4.

17. Shah AC, Parker JN, Gillespie GY, Lakeman FD,Meleth S, Markert JM, et al.Enhanced antiglioma activity of chimeric HCMV/HSV-1 oncolytic viruses.Gene Ther 2007;14:1045–54.

18. Jackson JD, McMorris AM, Roth JC, Coleman JM, Whitley RJ, Gillespie GY,et al. Assessment of oncolytic HSV efficacy following increased entry-receptor expression in malignant peripheral nerve sheath tumor cell lines.Gene Ther 2014;21:984–90.

19. Jackson JD,Markert JM, Li L, Carroll SL, Cassady KA. STAT1 andNF-kappaBinhibitors diminish basal interferon-stimulated gene expression and

improve the productive infection of oncolytic HSV in MPNST cells.Mol Cancer Res 2016;14:482–92.

20. Snell LM, McGaha TL, Brooks DG. Type I interferon in chronic virusinfection and cancer. Trends Immunol 2017;38:542–57.

21. Wei F, Zhong S, Ma Z, Kong H, Medvec A, Ahmed R, et al. Strength of PD-1signaling differentially affects T-cell effector functions. Proc Natl Acad SciUSA 2013;110:E2480–9.

22. Ghonime MG, Jackson J, Shah A, Roth J, Li M, Saunders U, et al. ChimericHCMV/HSV-1 and Deltagamma134.5 oncolytic herpes simplex virus elicitimmunemediated antigliomal effect and antitumormemory. TranslOncol2017;11:86–93.

23. Chou J, Kern ER,Whitley RJ, RoizmanB.Mapping of herpes simplex virus-1neurovirulence to gamma 134.5, a gene nonessential for growth in culture.Science 1990;250:1262–6.

24. Dold C, Rodriguez Urbiola C, Wollmann G, Egerer L, Muik A, Bellmann L,et al. Application of interferon modulators to overcome partial resistanceof human ovarian cancers to VSV-GP oncolytic viral therapy. Mol TherOncolytics 2016;3:16021.

25. Field HJ, De Clercq E. Effects of oral treatment with acyclovir and bromo-vinyldeoxyuridine on the establishment of maintenance of latent herpessimplex virus infection in mice. J Gen Virol 1981;56:259–65.

26. FungMC, Sia SF, LeungKN,MakNK.Detection of differential expression ofmouse interferon-alpha subtypes by polymerase chain reaction usingspecific primers. J Immunol Methods 2004;284:177–86.

27. Nasirudeen AM, Wong HH, Thien P, Xu S, Lam KP, Liu DX. RIG-I, MDA5and TLR3 synergistically play an important role in restriction of denguevirus infection. PLoS NeglTrop Dis 2011;5:e926.

28. Ghonime MG, Mitra S, Eldomany RA, Wewers MD, Gavrilin MA. Inflam-masome priming is similar for francisella species that differentially induceinflammasome activation. PLoS One 2015;10:e0127278.

29. Leddon JL, Chen CY, Currier MA, Wang PY, Jung FA, Denton NL, et al.Oncolytic HSV virotherapy in murine sarcomas differentially triggers anantitumor T-cell response in the absence of virus permissivity. Mol TherOncolytics 2015;1:14010.

30. Le DT, Ladle BH, Lee T,Weiss V, Yao X, Leubner A, et al. CD8(þ) Foxp3(þ)tumor infiltrating lymphocytes accumulate in the context of an effectiveanti-tumor response. Int J Cancer 2011;129:636–47.

31. Peng LS, Zhuang Y, Shi Y, Zhao YL, Wang TT, Chen N, et al. Increasedtumor-infiltrating CD8(þ)Foxp3(þ) T lymphocytes are associated withtumor progression in human gastric cancer. Cancer Immunol Immunother2012;61:2183–92.

32. Saha D, Martuza RL, Rabkin SD. Macrophage polarization contributes toglioblastoma eradication by combination immunovirotherapy andimmune checkpoint blockade. Cancer Cell 2017;32:253–67e5.

33. Meissl K,Macho-Maschler S,MullerM, Strobl B. The good and the bad facesof STAT1 in solid tumours. Cytokine 2017;89:12–20.

34. KhodarevNN, BeckettM, Labay E, Darga T, Roizman B,WeichselbaumRR.STAT1 is overexpressed in tumors selected for radioresistance and confersprotection from radiation in transduced sensitive cells. Proc Natl Acad SciUSA 2004;101:1714–9.

35. Khodarev NN, Minn AJ, Efimova EV, Darga TE, Labay E, Beckett M, et al.Signal transducer and activator of transcription 1 regulates both cytotoxicand prosurvival functions in tumor cells. Cancer Res 2007;67:9214–20.

36. Tsai MH, Cook JA, Chandramouli GV, DeGraff W, Yan H, Zhao S, et al.Gene expression profiling of breast, prostate, and glioma cells

Ruxolitinib Prior to Virotherapy Improves Its Efficacy

www.aacrjournals.org Cancer Immunol Res; 6(12) December 2018 1509

following single versus fractionated doses of radiation. Cancer Res2007;67:3845–52.

37. Stronach EA, Alfraidi A, Rama N, Datler C, Studd JB, Agarwal R, et al.HDAC4-regulated STAT1 activation mediates platinum resistance in ovar-ian cancer. Cancer Res 2011;71:4412–22.

38. Kaewpiboon C, Srisuttee R, Malilas W, Moon J, Oh S, Jeong HG, et al.Upregulation of Stat1-HDAC4 confers resistance to etoposide throughenhanced multidrug resistance 1 expression in human A549 lung cancercells. Mol Med Rep 2015;11:2315–21.

39. Elliott J, Lynch OT, Suessmuth Y, Qian P, Boyd CR, Burrows JF, et al.Respiratory syncytial virus NS1 protein degrades STAT2 by using theElongin-Cullin E3 ligase. J Virol 2007;81:3428–36.

40. StevensonNJ,MurphyAG, BourkeNM,KeoghCA,Hegarty JE,O'Farrelly C.Ribavirin enhances IFN-alpha signalling and MxA expression: a novelimmune modulation mechanism during treatment of HCV. PLoS One2011;6:e27866.

41. Ulane CM, Rodriguez JJ, Parisien JP, Horvath CM. STAT3 ubiquitylationand degradation by mumps virus suppress cytokine and oncogene signal-ing. J Virol 2003;77:6385–93.

42. Andrejeva J, Young DF, Goodbourn S, Randall RE. Degradation ofSTAT1 and STAT2 by the V proteins of simian virus 5 and humanparainfluenza virus type 2, respectively: consequences for virus repli-cation in the presence of alpha/beta and gamma interferons. J Virol2002;76:2159–67.

43. Smiley JR. Herpes simplex virus virion host shutoff protein: immuneevasion mediated by a viral RNase? J Virol 2004;78:1063–8.

44. Khodarev NN, Advani SJ, Gupta N, Roizman B, Weichselbaum RR. Accu-mulation of specific RNAs encoding transcriptional factors and stressresponse proteins against a background of severe depletion of cellularRNAs in cells infected with herpes simplex virus 1. Proc Natl Acad Sci USA1999;96:12062–7.

45. Lu C, Talukder A, Savage NM, Singh N, Liu K. JAK-STAT-mediated chronicinflammation impairs cytotoxic T lymphocyte activation to decrease anti-PD-1 immunotherapy efficacy in pancreatic cancer. Oncoimmunology2017;6:e1291106.

46. Yin J, Markert JM, Leavenworth JW. Modulation of the intratumoralimmune landscape by oncolytic herpes simplex virus virotherapy. FrontOncol 2017;7:136.

47. Wang D, DuBois RN. Immunosuppression associated with chronic inflam-mation in the tumormicroenvironment. Carcinogenesis 2015;36:1085–93.

48. Meyer C, Sevko A, Ramacher M, Bazhin AV, Falk CS, OsenW, et al. Chronicinflammation promotes myeloid-derived suppressor cell activation block-ing antitumor immunity in transgenic mousemelanomamodel. Proc NatlAcad Sci USA 2011;108:17111–6.

49. Lowe DB, Storkus WJ. Chronic inflammation and immunologic-basedconstraints in malignant disease. Immunotherapy 2011;3:1265–74.

50. DeNardo DG, Coussens LM. Inflammation and breast cancer. Balancingimmune response: crosstalk between adaptive and innate immune cellsduring breast cancer progression. Breast Cancer Res 2007;9:212.

51. Liu J,Hamrouni A,WolowiecD, Coiteux V, Kuliczkowski K,HetuinD, et al.Plasma cells from multiple myeloma patients express B7-H1 (PD-L1) andincrease expression after stimulation with IFN-{gamma} and TLR ligandsvia a MyD88-, TRAF6-, and MEK-dependent pathway. Blood 2007;110:296–304.

52. Bellucci R,Martin A, BommaritoD,Wang K, Hansen SH, FreemanGJ, et al.Interferon-gamma-induced activation of JAK1 and JAK2 suppresses tumorcell susceptibility to NK cells through upregulation of PD-L1 expression.Oncoimmunology 2015;4:e1008824.

53. Shurell E, Singh AS, Crompton JG, Jensen S, Li Y, Dry S, et al. Characterizingthe immune microenvironment of malignant peripheral nerve sheathtumor by PD-L1 expression and presence of CD8þ tumor infiltratinglymphocytes. Oncotarget 2016;7:64300–8.

Cancer Immunol Res; 6(12) December 2018 Cancer Immunology Research1510

Ghonime and Cassady