Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions...
-
Upload
sandra-white -
Category
Documents
-
view
214 -
download
1
Transcript of Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions...
![Page 1: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/1.jpg)
CloningandmolecularcharacterizationofPenicilliumexpansumgenesupregulatedunderconditionspermissivefor patulinbiosynthesisSandra White, John O’Callaghan & Alan D.W. Dobson
Department of Microbiology, and Environmental Research Institute, University College Cork, National University of Ireland Cork, Cork, Ireland
Correspondence: Alan D.W. Dobson,
Department of Microbiology, University
College, National University of Ireland, Cork,
Ireland. Tel.: 1353 21 4902743; fax:1353 21
4903101; e-mail: [email protected]
Received 13 September 2005; accepted
4 November 2005.
First published online 15 December 2005.
doi:10.1111/j.1574-6968.2005.00051.x
Editor: Geoffrey Gadd
Keywords
patulin; Penicillium expansum; isoepoxydon
dehydrogenase; 6-methylsalicylic acid synthase;
ABC transporters; cytochrome p-450
monooxygenases.
Abstract
Penicillium expansum is commonly associated with patulin production in pomac-
eous fruits. Both the full-length isoepoxydon dehydrogenase (idh) gene and a
470 bp fragment of the 6-methylsalicylic acid synthase (6-msas) gene have been
cloned from P. expansum. In addition, we cloned a 715 bp fragment of a putative
ATP-binding cassette transporter gene peab1, together with part of two putative
cytochrome P450 monooxygenase genes P-450 1 and P-450 2. Increased expression
of all five genes was observed under patulin-permissive conditions, indicating not
only their likely involvement in patulin biosynthesis but indicating for the first
time that regulation of patulin biosynthesis in P. expansum is mediated at the level
of gene transcription.
Introduction
The mycotoxin patulin (4-hydroxy-4H-furo [3,2c] pyran-
2[6H]-one) is produced by a number of different Penicillium
species, including Penicillium griseofulvum, Penicillium pa-
neum, Penicillium patulum, Penicillium carneum and Peni-
cillium sclerotigenum (Frisvad & Samson, 2004; Dombrink-
Kurtzman & Blackburn, 2005). Penicillium expansum is the
species most commonly associated with spoilage and myco-
toxin production in apples, apple juice and in pomaceous
fruits; with production occurring predominantly during
storage of apples (Watanabe & Shimizu, 2005). Patulin is
destroyed by the fermentation process and thus is not found
in either alcoholic or fruit beverages. It will however survive
the pasteurization process if present in the juice. Patulin is
cytotoxic to immortalized cell lines (Barhoumi & Bur-
ghardt, 1996), and is believed to exert its cytotoxic effects
by forming covalent adducts with essential cellular thiols of
amino acids, (Riley & Showker, 1991). The potential adverse
effects of this mycotoxin are reflected in the fact that it was
deemed necessary to set an upper limit of intake because of
the high amounts of fruit juices typically consumed by
children and infants. In Europe, a maximum level of 50mg
patulin per kg has been established for apple juice and apple
cider, while maximum levels for solid apple products and
apple products intended for consumption by young children
have been set at 25mg and 10mg kg�1, respectively (Commi-
sion Regulation, 2003). In addition the USFDA (2004) has
set limits for patulin of 50mg L�1 in single-strength and
reconstituted apple juices.
The pathway leading to the production of patulin from
the polyketide, 6-methylsalicylic acid (6-MSA) has been
established using mutants and by examining the time of
appearance of intermediates in the pathway and is thought
to involve at least 10 different enzymatic steps (Fig. 1) (for a
review, see Moake et al., 2005). However, only two of the
genes encoding these enzymes have been cloned and
sequenced to date namely the 6-methylsalicylic acid
synthase (6-msas) gene (Beck et al., 1990) and the isoepox-
ydon dehydrogenase gene (idh) (Gaucher & Fedeshko,
2000), both from Penicillium urticae. We report here on the
cloning of 6-msas and idh homologues from the other main
patulin producing Penicillium strain, P. expansum; together
with the cloning of part of two cytochrome P450 monoox-
ygenase genes P450-1 and P450-2 and a putative ATP-
binding cassette (ABC) transporter gene PEAB1. These
FEMS Microbiol Lett 255 (2006) 17–26 c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
![Page 2: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/2.jpg)
genes appear to be involved in the patulin biosynthesis in
P. expansum, since their transcription is up-regulated under
conditions that are permissive for patulin production.
Materials andmethods
Culture,mediaandgrowth conditions
Penicillium expansum strains IBT 21771, was obtained from
the IBT Culture Collection of Fungi (Technical University of
Denmark). The fungus was grown in a liquid medium
containing either 35 g L�1 czapek-dox broth (CYB) or
24 g L�1 potato dextrose broth (PDB) at 30 1C without shak-
ing in the dark. PDB media supported the production of
patulin (permissive) while CYB media did not (White, 2005).
High-performance liquid chromatography(HPLC)analysis of patulin production
Patulin was extracted from the culture media using ethyl
acetate. Analysis of extracts was performed by high-perfor-
mance liquid chromatography (HPLC) according to stan-
dard protocols (ISO 8128-1:1993) using a Beckman System
Gold HPLC machine and a Beckman Ultraphere C18
(250� 4.6 mm, 5mM) reversed phase column. Fifty micro-
litres of sample was injected using a Beckman 508 auto
sampler (Beckman-Coulter, Fullerton, CA), the mobile
phase was acetonitrile/water (10 : 90) at a flow rate of
1.0 mL min�1 and patulin was detected by UV absorbance
at 276 nm on a Beckman 166 UV-VIS detector (Beckman-
Coulter). Patulin standards (Sigma-Aldrich, St Louis, MO)
were diluted to varying concentration with ethyl acetate and
used to verify results.
RNApreparationand cDNAsynthesis
RNA was isolated from frozen (� 70 1C) mycelial tissue using
an RNeasy Plant Mini kit (Qiagen, Hilden, Germany). One
hundred milligrams of frozen mycelial tissue was ground
under liquid nitrogen with a mortar and pestle and total
RNA was isolated according to the manual. The RNA samples
were treated with DNAse I (Roche Diagnostics, Mannheim,
phyllostine
CH3 CH3
OH
6-methylsalicylic acid
OHm-cresol
m-hydroxybenzyl alcohol
OH
CH2OH
CHO
OH
m-hydroxybenzaldehydeOH
HO
gentisyl alcohol
CH2OH
CHO
OH
HO
gentisaldehyde
M-cresol2-hydroxylase
m-hydroxybenzylAlcohol dehydrogenase
Isoepoxydondehydrogenase
OH
gentisic acid
OH
COOH
OH
CH3
CHO
C
OCH2OH
CH2OH
O
OO
O
OHO
CH2OH
6-MSAsynthase
6-MSAdecarboxylaseAcetyl-CoA
+3 Malonyl-CoA
CO2H
OH
toluquinoneO
OOH
O
patulin
HOCH2
O
(E)-ascladiol
C
HO
CH2OH
O
H
isoepoxydon
neopatulin
Fig. 1. Patulin biosynthetic pathway. The relevant metabolic intermediates and enzymes involved in the biosynthesis of patulin are shown. Adapted
from Moake et al. (2005).
FEMS Microbiol Lett 255 (2006) 17–26c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
18 S.White et al.
![Page 3: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/3.jpg)
Germany) and stored at � 80 1C until needed. cDNA was
synthesized from each sample using the SMARTTM PCR
cDNA Synthesis kit (BD Biosciences Clontech, Palo Alto,
CA) according to the manufacturer’s instructions.
Suppression subtractivehybridization (SSH)-PCR
Suppression subtractive hybridization (SSH)-PCR was per-
formed with a PCR-Select kit (BD Biosciences Clontech) as
specified by the manufacturer. cDNA from tissue which
produced patulin served as the tester DNA and cDNA from
tissue which did not produce patulin served as the driver
DNA. All PCR amplifications during the cDNA synthesis and
suppression subtractive hybridization (SSH)-PCR reactions
were performed with an Advantage-2 PCR kit (BD Biosciences
Clontech) as previously described (O’Callaghan et al., 2003).
CloningofPCRproducts
The final pool of PCR products representing the genes
which are expressed under patulin-permissive conditions
but are down-regulated under patulin restrictive conditions
were cloned into the pGEM-T easy vector (Promega, Madi-
son, WI) and the ligation mixtures were transformed into
chemically competent TOP10 Escherichia coli cells
(Invitrogen, Groningen, the Netherlands).
Identificationof up-regulated clones
White colonies, representing cells containing a vector with an
insert, were picked from plates with a sterile wooden stick and
used in colony PCRs containing nested primers from the SSH-
PCR kit. 2.5mL of each PCR product was transferred onto
duplicate nitrocellulose membranes (Hybond-N1, Strata-
gene, La Jolla, CA) and allowed to dry. The PCR samples were
fixed to the membrane by UV cross linking (Stratalinker,
Stratagene). Probes consisting of driver and tester cDNA were
radioactively labeled with a 32P ATP (Amersham Biosciences,
Bucks, UK) using the Prime-a-gene labeling kit (Promega).
Probing was carried out according to standard procedures and
blots were washed to a stringency of 0.1% SSC/0.1% SDS.
Table 1. Polymerase chain reaction primers used in this study
Name Primer sequence 50–30 Annealing temperature ( 1C)
IDH F1 GGNGARGCNATGGTNCATAARTT 58
IDH R1 CCAATGYTCNGTCTCNCCCTCCATATG 58
IDH BSP1 GGTGCATAAATTCCTCCAG 60
NSP1 TGCCCGGACTGTCACCAATA 58
ICP F1 GACGCTCGCTAAGGGTAA 56
ICP R1 GCCCTTCCAATGTTCGGTCTC 56
IDH BSP 2 CCGGAATGGGTGGAGGAACAG 58
NSP 2 GGANGCCCGACAGAGGTG 58
ICP F2 TCTGCCCTTCTTTTCCCTCTGTTG 56
ICP R2 TCCTCTCGCCAGCTTTGTGACG 56
IDH BSP 3 ANCGGGGCTGCCACCTCTGTC 60
NSP 3 AGTCGCTGTTCCTCCACCCATTCC 58
ICP F3 GGATTGGCCCTGGCGAGATGG 57
ICP R3 AGGCGAGACGGAGGACTGGAGAA 57
SD FP1 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNCCGGT 58
SD FP 2 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNGCGCT 58
SD FP 3 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNGGCCT 58
SD FP 4 CAGTTCAAGCTTGTCCAGGAATTCNNNNNNNCGCGT 58
ND primer CAGTTCAAGCTTGTCCAGGAATTCNNNNNNN 58
P450-2F1 AGCGGCCAAACTCATGACTAACTG 58
P450-2R1 CCCGGATTTGTAAAGACTGGAC 58
P450-1F1 ACGCGGCCAGTTTTGAT 59
P450-1R1 TTTGGCCGCGTCTGACCTTCTT 59
MSAS F2 CGAAATCGCGGCCAGTGTTGTG 60
MSAS R2 GACCATGTTGCCGGCCCAGTATTC 60
IDH F1 GGNGARGCNATGGTNCATAARTT 58
IDH R1 CCAATGYTCNGTCTCNCCCTCCATATG 58
G3PDH-F CGGCTTCGGTCGTATTGG 55
G3PDH-R TGGAGGAGGGGATGATGTT 55
ATP 3F TGAGCTCCACCGCCCACAAG 62
ATP 2R GGTGGGAGATGCGAAGATTAGAGG 62
BSP, biotinylated-specific primer; NSP, nested specific primer; ICP, internal control primer.
FEMS Microbiol Lett 255 (2006) 17–26 c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
19Cloning and molecular characterization of P. expansum genes
![Page 4: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/4.jpg)
Fig. 2. (a) Alignment of the deduced amino-acid sequence of the Penicillium expansum 6-methylsalicylic acid synthase (6-MSAS) compared with part of
6-MSAS proteins from Penicillium griseofulvum ( synonyms of Penicillium patulum, Penicillium urticae), Byssochlamys nivea and Aspergillus terreus (Fujii
et al., 1996). Those residues shaded in black are residues common in at least three of the four sequences. (b) (page 5) Alignment of the deduced amino-
acid sequence of the P. expansum IDH with that of the P. urticae IDH (Gaucher & Fedechko, 2000), to a keto-acyl reductase protein from
Rhodopseudomonas palustris (Latimer et al., 2004) and to a short chain alcohol dehydrogenase from Brevibacterium linens. Those residues shaded in
black are residues common to at least three of the four sequences.
FEMS Microbiol Lett 255 (2006) 17–26c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
20 S.White et al.
![Page 5: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/5.jpg)
Hybridization was detected by autoradiography with KODAK
biomax film after overnight exposure at � 70 1C.
Sequencing of clones
Those PCR products which hybridized strongly to the tester
probe and weakly to the driver probe were sequenced.
Before sequencing the clones were grown in Luria–Bertani/
amp media in 96-well microtiter plates overnight at 37 1C.
Forty percent glycerol (volume in volume) was added and
colonies were frozen at � 80 1C. DNA preparation and
sequencing was carried out by Lark Technologies (Essex,
UK). These sequences were then compared to sequences in
the NCBI database using the BLASTX algorithm.
Amplificationofflanking region (AFR)-PCR
A series of biotinylated primers (Table 1) were designed to
allow the sequential amplification of a full length idh gene
and flanking sequence based initially on the DNA sequence
of the 320 bp idh clone, using an amplification of flanking
region (AFR)-based approach as previously described (So-
den & Dobson, 2003).
Reverse transcriptase-PCR
Complementary DNA was synthesized from mycelia grow-
ing under patulin permissive and patulin restrictive condi-
tions using Expand reverse transcriptase and random
hexamer primers (Roche Diagnostics), as previously de-
scribed (Soden & Dobson, 2001). PCR was carried out on
the cDNA using primers specific to the cloned gene sequence
(P450-2F1, P450-2R1, P450-1F1 and P450-1R1; Table 1).
Primers specific to the constitutively expressed housekeep-
ing gene, glyceraldehyde-3-phosphate dehydrogenase
(G3PDH-F and G3PDH-R; Table 1) were used to equalize
the reaction. The concentration of cDNA used in each PCR
reaction was adjusted such that a G3PDH PCR product
appeared at the same cycle number when using either
permissive or restrictive cDNA as a template in the PCR
reaction. This ensured that equal concentrations of template
cDNA were used in both reactions.
Quantitative real-timePCR
Real-time PCR was carried out on a LightCyclerTM (Roche
Diagnostics). Reactions were carried out in LightCyclerTM
glass capillaries (Roche Diagnostics), as per the manufac-
turer’s instructions for the LightCyclerTM Faststart Master
SYBR Green I kit (Roche Diagnostics) which was used for all
reactions. All LightCyclerTM (LC) assay analysis was carried
out using the fit points option of the LC software (version
3.39, Roche Diagnostics) as previously described (Casey &
Dobson, 2004).
Nucleotide sequenceaccessionnumbers
The nucleotide sequences described in this work have been
assigned the following GenBank accession numbers: msas,
DQ084387; idh, DQ084388; p450-1, DQ084389; p450-2,
DQ084390; peab1, DQ084391.
Results
Cloningofa6-msasgene fragment
Primers MSAS 2F and MSAS 2R (Table 1), designed to
conserved regions in previously cloned 6-msas genes from
other fungal species were used to amplify a 470 bp PCR
product from Penicillium expansum IBT 21771. The nucleo-
tide sequence showed similarity to the previously cloned
Penicillium patulum 6-msas gene (Beck et al., 1990), while
the deduced amino-acid sequence of this product displayed
high levels of similarity to the 6-MSAS proteins from
Byssochlamys nivea and Aspergillus terreus (Fig. 2a). The
gene appears to encode for part of the acyl-transferase
domain of the 6-msas gene; common to many polyketide
synthase (PKS) enzymes involved in mycotoxin biosynth-
esis. The acyl-transferase domain is believed to be involved
in delivering the extender unit, in this case malonlyl-CoA, to
the PKS complex for condensation and linkage to the
polyketide chain.
Cloningofthe idhgene
Degenerate primers IDH F1 and IDHR1 (Table 1) based on
a Penicillium urticae isoepoxydon dehydrogenase gene se-
quence (Gaucher & Fedeshko, 2000), were designed to
amplify a 320 bp isoepoxydon dehydrogenase gene frag-
ment from P. expansum IBT 21771. Upstream and down-
stream regions flanking this 320 bp fragment were then
cloned by using an AFR approach to generate a full-length
idh clone. The full-length idh gene sequence beginning
with a conventional ATG start codon, consisted of a 882 bp
nucleotide ORF capable of encoding a deduced protein of
259 amino acids with two introns of 55 and 54 bp, respec-
tively. The idh gene nucleotide sequence showed 85%
similarity to the previously cloned idh gene from P. patulum.
There was also strong similarity at the deduced amino-
acid level to an IDH from P. urticae, to a keto-acyl reduc-
tase protein from Rhodopseudomonas palustris (Latimer
et al., 2004) and to a short chain alcohol dehydrogenase
from Brevibacterium linens (Fig. 2b). A 153 bp region
located upstream of the idh gene contained a putative
TATA box at � 27 bp and putative CAAT boxes as well as
a putative GC box at � 188 bp. This represents the first
full length patulin biosynthetic gene to be cloned from
P. expansum.
FEMS Microbiol Lett 255 (2006) 17–26 c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
21Cloning and molecular characterization of P. expansum genes
![Page 6: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/6.jpg)
Cloningofpartofa putativeABCtransportergene
PCR primers ATP 3F and ATP 2R (Table 1), designed based
on a gene sequence which had been reported to be located
upstream of the Penicillium urticae idh gene (Gaucher &
Fedechko, 2000), were used to amplify a 715 bp gene
fragment from P. expansum. This 715 bp gene fragment,
peab1, displayed 87% nucleotide identity to a putative ABC
transporter gene in P. urticae while the deduced amino-acid
sequence displaying 45% identity to an ABC transporter
protein in Botyrotinia fuckeliana, 43% identity to a putative
ABC transporter from Candida albicans (Jones et al., 2004)
and 33% identity to an ABC transporter in Penicillium
digitatum (Nakaune et al., 1998), (Fig 3).
Expressionofthemsas, idhandpeab1genes
Reverse transcriptase-PCR was then performed on P. expan-
sum IBT 21771 cultures grown under both patulin permis-
sive and restrictive conditions, to determine whether
expression of these three genes correlated with patulin
production. Transcription of the G3PDH gene was also
monitored as a control. The expression levels of all three
genes were higher under patulin-permissive conditions,
indicating a link between these genes and patulin biosynth-
esis in the fungus (Fig. 4). In contrast, expression of the
housekeeping G3PDH gene was similar in P. expansum
under both patulin permissive and restrictive growth condi-
tions indicating that the observed effects were not occurring
simply as a result of global changes in gene expression.
Suppressionsubtractivehybridization (SSH)-PCR
Having cloned three putative patulin biosynthetic genes we
then used a SSH-PCR-based approach to clone additional
genes involved in patulin production in P. expansum.
Following SSH-PCR a pool of PCR products that repre-
sented transcripts preferentially expressed under patulin-
permissive conditions was obtained. We analysed 800 of
these PCR products, and 197 of these which hybridized
strongly to the permissive cDNA were subsequent sequen-
cing. Nine of these clones showed similarity to previously
cloned cytochrome P450 monooxygensase genes. Subse-
quent analysis indicated that these nine clones in fact
represented two distinct cloned sequences, namely p450-1
and p450-2. The deduced amino-acid sequence of these two
clones displayed 39–43% identity at the deduced amino-
acid level with other fungal cytochrome P450 monooxy-
genases (Figs 5a and b).
Transcriptionof p450-1andp450-2genes
Reverse transcriptase-PCR analysis was then performed, and
high levels of expression of both p450-1 and p450-2 was
shown to occur only during patulin biosynthesis (Fig. 4).
Real-time PCR was then used to quantify this level of up-
regulation, by comparing the copy number of these
Fig. 3. Alignment of the deduced amino-acid sequence of Penicillium expansum PEAB1 with part of ATP-binding cassette transporter proteins of Botryotinia
fuckeliana, Penicillium digitatum and Candida albicans. Those residues shaded in black are residues common to at least three of the four sequences.
FEMS Microbiol Lett 255 (2006) 17–26c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
22 S.White et al.
![Page 7: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/7.jpg)
transcripts under both permissive and restrictive conditions.
p450-2 transcript levels (1.98� 107 copies per mg�1 RNA, in
permissive medium) and (1.76� 104 copies per mg RNA, in
restrictive medium) were shown to be up-regulated 1127-
fold while the p450-1 gene transcript levels (1.4� 105 copies
per mg�1 RNA, in permissive medium and 5.6� 102 copies
per mg RNA, in restrictive medium) were up-regulated 250-
fold under patulin-permissive conditions, indicating the
likely involvement of both these genes in patulin biosynth-
esis in P. expansum. Expression of the housekeeping G3PDH
gene was similar in P. expansum under both patulin permis-
sive (1.25� 105 copies per mg RNA) and restrictive
(1.35� 105 copies per mg RNA) growth conditions indicat-
ing that the observed effects were not occurring because of
global changes in gene expression.
Discussion
Patulin is a secondary metabolite predominantly produced
by different species of the genera Penicillium with Penicillium
expansum being generally regarded as the main producer in
apples, the major potential dietary sources of patulin in
humans. Particular concerns centres on the consumption of
apple-based products by young children, who are known to
consume increased levels of apple products during their first
years of life; and whose lower body weights means that the
amount consumed per kilogram body mass is high, when
compared with adults (Moake et al., 2005). Strict regulations
exist both in Europe and in the US concerning maximum
levels for patulin in apple-based products intended for
young children Commision Regulation 2003, USFDA 2004.
We set out to genetically characterize the patulin biosyn-
thetic genes from P. expansum, with a view ultimately to
identify potentially useful target genes for molecular-based
detection methods. Patulin is believed to be derived from
the polyketide, methylsalicylic acid following around 10
possible enzymatic modifications (Fig. 1). A number of
these enzymes namely 6-methylsalicylic acid decarboxylase,
isoepoxydon dehydrogenase and a putative cytochrome P-
450, have been biochemically characterized from Penicillium
patulum (Scott & Beadling, 1974; Murphy & Lynen, 1975);
while two of the genes namely the idh gene from Penicillium
urticae (Gaucher & Fedeshko, 2000) and the 6-msas gene
from P. patulum (Beck et al., 1990) have been cloned and
sequenced.
Our aim was to clone homologues of both the 6-msas and
idh genes from P. expansum and to determine whether
expression of these genes correlated with patulin produc-
tion. To this end both a 470 bp fragment of the 6-msas gene
and the full length idh gene were cloned from P. expansum
IBT 21771 and were found to display a high degree of
similarity at both the nucleotide and deduced amino-acid
level with previously cloned fungal genes in the databases
(Fig. 2). Expression of these genes was shown to be higher
under patulin-permissive conditions (Fig. 4); indicating for
the first time that regulation of patulin biosynthesis in P.
expansum is mediated at the level of gene transcription.
Transcriptional regulation of mycotoxin biosynthetic genes
under different physiological conditions is quite common in
mycotoxigenic fungi, for example for aflatoxin and sterig-
matocystin production in Aspergillus parasiticus and Asper-
gillus nidulans (Liu & Chu, 1998; Bhatnagar et al., 2003).
This suggested to us that other genes involved in patulin
Fig. 4. (a) Reverse transcriptase-PCR analysis of gene transcription of (1)
idh gene, (2) msas gene, (3) peab1 gene, (4) p450-1, (5) p450-2 and (6)
glyceraldehyde-3-phosphate dehydrogenase gene as a control in patulin
permissive (1) potato dextrose medium (PDB) and restrictive (� )
Czapek-Dox yeast medium (CYB). (b) Patulin production by Penicillium
expansum in permissive and restrictive media.
FEMS Microbiol Lett 255 (2006) 17–26 c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
23Cloning and molecular characterization of P. expansum genes
![Page 8: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/8.jpg)
biosynthesis might also be transcriptionally regulated and
that the use of a SSH-based approach might prove useful in
identifying these genes in P. expansum.
Using this SSH approach we identified putative cyto-
chrome P450 monooxygenase gene fragments, namely
p450-2 and p450-1 whose expression was shown to be up-
regulated by 1127- and 250-fold, respectively, under patulin-
permissive conditions. Cytochrome P450 monooxygenase
genes have previously been shown to be involved in the
biosynthesis of other mycotoxins; for example in the bio-
synthesis of aflatoxin B1 in both A. parasiticus (Udwary
et al., 2002) and Aspergillus flavus (Keller & Hohn, 1997),
and in trichothecene biosynthesis in Fusarium sporotri-
chioides (Meek et al., 2003). As previously mentioned that
based on biochemical data, at least two cytochrome P450
monooxygenase enzymes may be involved in the
Fig. 5. (a) Alignment of clone P450-1 to cytochrome P450 monooxygenases from Coriolus versicolor, Gibberella fujikuroi and Penicillium paxilli .
Residues shaded in black are common in at least three of the four sequences. (b) alignment of clone P450-2 to cytochrome P450 monooxygenases from
Penicillium paxilli, Gibberella fujiuroi and Neurospora crassa. Residues shaded in black are common to at least three of the four sequences.
FEMS Microbiol Lett 255 (2006) 17–26c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
24 S.White et al.
![Page 9: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/9.jpg)
biosynthesis of patulin; this indicates a potential role for
both P450-2 and P450-1 in patulin biosynthesis in P.
expansum.
Finally upstream from the idh gene in P. expansum we
cloned part of a putative ABC transporter gene peab1, which
at the nucleotide level showed a high level of identity with
the ABC transporter gene from P. patulum (Gaucher &
Fedechko, 2000). Transcription of this putative ABC trans-
porter gene is also up-regulated under patulin-permissive
conditions in P. expansum (Fig. 3), again indicating its
potential involvement in patulin biosynthesis. ABC trans-
porters are a large family of transmembrane proteins which
play a significant role in fungicide sensitivity and resistance
(Del Sorbo et al., 2000). For example the ABC transporter in
the fungal plant pathogen Magnaporthe grisea helps the
fungus defend itself against anti-microbial compounds
(Urban et al., 1999); while an ABC transporter in the
phytopathogen Leptosphaeria maculans protects the fungus
from the epipolythiodioxopiperazine secondary metabolite
gliotoxin (Gardiner et al., 2005). An ABC transporter gene
has previously also been identified in other Penicillium
species, namely the PMRI1gene in the phytopathogenic
fungus Penicillium digitatum which is involved in the efflux
of demethylation inhibitors out of the fungal cell (Nakaune
et al., 1998). As patulin has been shown to exhibit fungal
toxicity properties (Palmgren & Cielger, 1983), it seems
plausible that this ABC transporter may potentially be
involved in patulin efflux in P. expansum. ABC transporters
have previously been identified which are involved in the
transport of mycotoxins in producing fungi with TOXA in
Cochliobolus carbonum, encoding an efflux pump which
contributes to self-protection against HC-toxin and/or is
involved in HC-toxin secretion (Pitkin et al., 1996). Further
work will however be needed to establish whether peab1, is
involved in patulin biosynthesis in P. expansum.
Acknowledgements
This research was funded under the PRTLI programme for
Irish Third Level Institutions, administered by the Higher
Education Authority and by the Irish government under the
National Development Plan 2000–2006.
References
Barhoumi R & Burghardt RC (1996) Kinetic analysis of the
chronology of patulin- and gossypol-induced cytotoxicity in
vitro. Fund Appl Toxicol 30: 290–297.
Beck J, Ripka S, Siegner A, Schiltz E & Schweizer E (1990) The
multifunctional 6-methylsalicylic acid synthase gene of
Penicillium patulum. Its gene structure relative to that of other
polyketide synthases. Eur J Biochem 192: 487–498.
Bhatnagar D, Ehrlich KC & Cleveland TE (2003) Molecular
genetic analysis and regulation of aflatoxin biosynthesis. Appl
Microbiol Biotechnol 61: 83–93.
Casey GD & Dobson ADW (2004) Potential of using real-time-
PCR based detection of spoilage yeast in fruit juice – a
preliminary study. Int J Food Microbiol 91: 327–335.
Commission Regulation (EC) No 1425/2003 of 11 August 2003
amending Regulation (EC) No 466/2001 as regards patulin.
Official Journal of the European Union L 203/13.
Dombrink-Kurtzman MA & Blackburn JA (2005) Evaluation of
several culture media for production of patulin by Penicillium
species. Int J Food Microbiol 98: 241–2483.
Frisvad JC & Samson RA (2004) Polyphasic taxonomy of
Penicillium subspecies Penicillium. A guide to identification of
food and air-borne terverticillate Penicillia and their
mycotoxins. Stud Mycol (Utrecht) 49: 1–173.
Fujii I, Ono Y, Tada H, Gomi K, Ebizuka Y & Sankawa U (1996)
Cloning of the polyketide synthase gene atX from Aspergillus
terreus and its identification as the 6-methylsalicylic acid
synthase gene by heterologous expression. Mol Gen Genet 253:
1–10.
Gardiner DM, Jarvis RS & Howlett BJ (2005) The ABC
transporter gene in the sirodesmin biosynthetic gene cluster of
Leptosphaeria maculans is not essential for sirodesmin
production but facilitates self-protection. Fung Genet Biol 42:
257–263.
Gaucher GM & Fedechko RW (2000). Isolation and
characterization of the isoepoxydon dehydrogenase gene in
Penicillium urticae. Direct submission to NCBI.
Jones T, Federspiel NA, Chibana H, et al. (2004) The diploid
genome sequence of Candida albicans. Proc Natl Acad Sci USA
101: 7329–7334.
Keller NP & Hohn TM (1997) Metabolic pathway gene clusters in
filamentous fungi. Fung Genet Biol 21: 17–29.
Latimer FW, Chain P, Hauser L, et al. (2004) Complete genome
sequence of the metabolically versatile photosynthetic
bacterium Rhodopseudomonas palustris. Nat Biotechnol 22:
55–61.
Liu B-H & Chu FS (1998) Regulation of aflR and its product,
AflR, associated with aflatoxin biosynthesis. Appl Environ
Microbiol 64: 3718–3723.
Meek IB, Peplow AW, Ake Jr C, Phillips TD & Beremand MN
(2003) Tri1 encodes the cytochrome P450 monooxygenase for
C-8 hydroxylation during trichothecene biosynthesis in
Fusarium sporotrichioides and resides upstream of another new
Tri gene. Appl Environ Microbiol 69: 1607–1613.
Moake MM, Padilla-Zakour OI & Worobo RW (2005)
Comprehensive review of patulin control methods in foods.
Com Rev Food Sci Food Safety 4: 8–22.
Murphy G & Lynen F (1975) Patulin biosynthesis: the
metabolism of m-hydroxybenzyl alcohol and m-
hydroxybenzaldehyde by particulate preparations from
Penicillium patulum. Eur J Biochem 58: 467–75.
Nakaune R, Adachi K, Nawata O, Tomiyama M, Akutsu K & Hibi
T (1998) A novel ATP-binding transporter involved in
FEMS Microbiol Lett 255 (2006) 17–26 c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
25Cloning and molecular characterization of P. expansum genes
![Page 10: Cloning and molecular characterization of Penicillium expansum genes upregulated under conditions permissive for patulin biosynthesis](https://reader035.fdocuments.in/reader035/viewer/2022080319/575066bc1a28ab0f07a84b0e/html5/thumbnails/10.jpg)
multidrug resistance in the phytopathogenic fungus
Penicillium digitatum. Appl Environ Microbiol 64: 3983–3988.
O’Callaghan J, Caddick MX & Dobson ADW (2003) A polyketide
synthase gene required for ochratoxin biosynthesis in
Aspergillus ochraceus. Microbiology 148: 3485–3481.
Palmgren MS & Cielger A (1983) Toxicity and carcinogenicity of
fungal lactones: patulin and penicillic acid. Plant and Fungal
Toxins, Handbook of Natural Toxins, Vol. 1. (Keeler RF & Tu AT,
eds), Marcel Dekker Inc, New York.
Pitkin JW, Panaccione DG & Walton JD (1996) A putative cyclic
peptide efflux pump encoded by the TOXA gene of the plant-
pathogenic fungus Cochliobolus carbonum. Microbiology 142:
1557–1565.
Riley RT & Showker JL (1991) The mechanism of patulin’s
cytotoxicity and its antioxidant activity of indole tetramic
acids. Toxicol Appl Pharmacol 109: 108–126.
Scott A & Beadling L (1974) Biosynthesis of patulin.
Dehydrogenase and dioxygenase enzymes of Penicillium
patulum. Bioorg Chem 3: 281–301.
Soden DM & Dobson ADW (2001) Differential regulation of
laccase gene expression in Pleurotus sajor-caju. Microbiology
147: 1755–1763.
Soden DM & Dobson ADW (2003) The use of amplified flanking
region-PCR in the isolation of laccase promoter sequences
from the edible fungus Pleurotus sajor-caju. J Appl Microbiol
95: 553–562.
Del Sorbo G, Schoonbeek H-J & De Waard MA (2000) Fungal
transporters involved in efflux of natural compounds and
fungicides. Fung Genet Biol 30: 1–15.
Udwary DW, Casillas LK & Townsend CA (2002) Synthesis of 11-
hydroxyl O-methylsterigmatocystin and the role of a
cytochrome P-450 in the final step of aflatoxin biosynthesis.
J Am Chem Soc 124: 5294–5303.
Urban M, Bhargava T & Harmer JE (1999) An ATP-driven efflux
pump is a novel pathogenicity factor in rice blast disease.
EMBO J 18: 512–521.
Watanabe M & Shimizu H (2005) Detection of patulin in apple
juices marketed in the Tohoku district, Japan. J Food Prot 68:
610–612.
White S (2005) Physiology and genetics of patulin biosynthesis in
Penicillium expansum. PhD thesis, National University of
Ireland, Cork, Ireland.
U.S. Food and Drug Administration (USFDA) (2004)
Compliance policy guide. Compliance policy guidance
for FDA staff. Sec. 510.150. Apple juice, apple juice
concentrates, and apple juice products- adulteration with
patulin. http://www.fda.gov/ora/compliance ref/cpg/cpgfod/
cpg510-150.htm
FEMS Microbiol Lett 255 (2006) 17–26c� 2005 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved
26 S.White et al.