CHAPTER-III

IDENTIFICATION AND ISOLATION

OF eDNA CLONES ENCODING TYROSINE-KINASES

FROM RAT SPLEEN eDNA LIBRARY

IDENTIFICATION AND ISOLATION OP eDNA CLONES ENCODING TYROSINE­

KINASES PROM RAT SPLEEN eDNA LIBRARY

3.1. INTRODUCTION:

Amongst thousands of clones in a eDNA library, recombinant

clones of interest encoding a particular mRNA sequence are

usually identified and isolated by screening, which involves

rapid assays to determine whether a particular clone contains the

desired nucleic acid sequence.

The principle of screening recombinant libraries is based on

the fact that bacteriophage plaques or bacterial colonies

containing plasmids or cosmids contain relatively large amounts

of insert DNA which can be detected either directly by hybridiza­

tion or indirectly by the protein that may be expressed from the

cloned segment.

The size of the library and the number of clones to be

screened reflects on the relative abundance of the mRNA of

interest. Since the abundance of the desired sequence is not

known with precision, it is usually preferred to select a library

having 5 times more recombinants than the total indicated by the

lowest abundance estimate. Generally the technique involves the

spreading of the library on agar or agarose plates. The clones

67

are then transferred to appropriate membrane filters and screened

using any one of the following methods:

1. Nucleic acid screening or hybridization to labelled DNA:

In this screening procedure recombinant DNA libraries are

screened by hybridizing the plaques or colonies which have been

transferred on to the filters to the nucleic acid probes which

have been radiolabelled or fluorescence labelled. Following a

prehybridization wash, the filter replicas are incubated with

denatured or single stranded DNA probe in appropriate hybridiza­

tion buffer at appropriate temperature. The filters are then

washed to remove the excess probe and the positive clones are

identified either by autoradiography or fluorescence. (Grunstein

and Hogness 1975, Benton and Davis 1977).

2. The hybrid selection of mRNA and translation:

This method involves identification of cloned eDNA

complementary to specific mRNA by hybridization. The identified

clone is then denatured and immobilized on filters and hybridized

to mRNA preparation. The RNA is released from the RNA-DNA hybrid

by heating, and is translated in a cell-free in-vitro translation

system. The products are then identified by immunoprecipitation

and SDS-polyacrylamide gel electrophoresis, or by other

biological assays (Harpold et al., 1978).

3 • Expression screening or immunoreactivity:

Screening eDNA clones by hybrid-selected translation is

68

generally difficult when a rare mRNA is to be cloned or when the

efficiency of in vitro translation is low (eg. for large mRNA

molecules). These difficulties are overcome by cloning the eDNA

in bacterial expression vectors, and screening the antigenic

determinants expressed in situ using antibody which recognizes

the desired protein. The two basic technical procedures involved

in the immunological screening of bacterially synthesized fusion

proteins are, first, the synthesis and immobilization of the

antigenic materials to a solid support and second, detection of

antigen by a sensitive detection procedure. Both fusion products

and in vitro translated mRNA can be detected with the antibody.

In the present studies, eDNA clones encoding a tyrosine

kinase were identified and isolated from rat spleen eDNA

libraries in plasmid pGEM-3Z and bacteriophage Agtll using the

nucleic acid screening technique.

3.2. MATERIALS AND METHODS

3.2.1. MATERIALS:

Nitrocellulose filter papers were purchased from Schleicher . and Schuell, West Germany. The random primer labelling kit was

from Boehringer Mannheim, West Germany. The T4 polynucleotide

kinase was bought from Pharmacia, Sweden. PVP and salmon sperm

DNA were obtained from Sigma Chemical co., USA.

69

Description of the probes used:

A murine eDNA clone designated as bmk, a gift from Dr Ashley

R Dunn, Australia, was used as probe to identify the eDNA clones

coding for tyrosine kinases from the spleen eDNA library. It is a

1896 bp eDNA which has been subcloned into the Eco RI site of

pGEM 3 and the plasmid is called pM 41.5. The bmk clone shares

extensive homology with members of the src-related family of

protein tyrosine kinases. The myeloid and lymphoid cells of the B

cell lineage show high level of expression of this gene, and

hence has been named as bmk (B cell/myeloid kinase). It is also

expressed in normal macrophages. The bmk was found to have 86%

homology and similar expression pattern as compared with human

HCK, indicating that the bmk was the murine homologue of human

b£k. Therefore the term hck is used for both the loci (Holtzman

et al. , 1987) •

A 32-mer deoxyoligonucleotide for a region of the conserved

domain of the tyrosine kinases was synthesized. This probe was

used in order to identify eDNA clones of different tyrosine

kinases from the rat spleen eDNA libraries. The sequence of the

probe is shown below:

TTCAAGGGGTAGTTCACCTGTCGGGGACTCCG T A T

70

3.2.2. METHODS

Preparation of probes:

The plasmid pM 41.5 is a eDNA clone containing the 1896 bp

fragment of the bmk eDNA. The competent E.coli DH5a cells were

transformed with this plasmid as described in section

2.2.2. From a single colony of transformed bacteria a large scale

plasmid preparation was done using the procedure described by

Maniatis et al., (1982).

One litre culture of pM 41.5 plasmid was grown overnight in

LB containing 100p.g/ml ampicillin. The cells were collected by

centrifugation in a Sorvall RC5B centrifuge using GSA rotor at

6000rpm for 10min at 4°C, and washed with 200ml of cold STE (0.1M

NaCl, 10mM Tris-Cl pH 7. 8, 1mM EDTA) . The pellet was then

resuspended in 15ml solution I (50mM Glucose, 25mM Tris-Cl, pH

8.0, lOmM EDTA). To the suspended cells 5ml of solution I

containing 100mg lysozyme was added and mixed well with a glass

rod. Following incubation at room t~mperature for ~min, 40ml of

freshly prepared s.olution II ( 0. 2N NaOH, 1% SDS) was added and

mixed gently by inverting the tube several times and incubated

for lOmin on ice. Thirty ml of 5M potassium acetate, pH 4.8 was

then added, and the contents were mixed by quickly inverting the

tube several times and incubated for 10min on ice. The material

was centrifuged for 40min at 18000rpm in Sorvall RC5B centrifuge

at room temperature. The supernatant was decanted and the plasmid

was precipitated by adding o. 6 volumes of isopropanol and

incubating at room temperature for 15min. The plasmid DNA was

pelleted by centrifuging at 12000rpm for 30min at room

temperature and the pellet was washed with 70% ethanol, dried

under vacuum, and dissolved in 6ml TE. Further purification of

the plasmid DNA was carried out on cesium chloride - ethidium

bromide gradients. Solid cesium chloride was added to the DNA

solution in the ratio of 1gm per ml. To 10ml of the cesium

chloride plasmid solution 0.8ml of 10mg/ml ethidium bromide solu­

tion was added. This solution was then poured into quickseal

centrifuge tubes and centrifuged in a Beckman L8-80 ultra­

centrifuge, VTi-80 rotor, at 70,000 rpm for 5h 30min at 20°C. The

lower band of closed circular plasmid DNA was removed into a

syringe by inserting a 21 guage needle on the side of the tube.

The DNA solution was transferred to a siliconized glass tube and

the ethidium bromide was removed by repeated extractions with

equal volumes of water saturated 1-butanol until the pink colour

had disappeared. The aqueous phase was dialysed overnight against

several changes of TE (pH 8.0) •. The plasmid DNA .was precipitated

at -20°C after adding 0.1 volume of 3M sodium acetate (pH 5.2)

and 2. 2 volumes of ethanol. After keeping for 2h at -2o0 c the

plasmid was collected by centrifugation for 30min in an eppendorf

centrifuge. The pellet was dried briefly under vacuum and

dissolved in 2ml TE. The contaminating RNA was removed by treat­

ing the DNA solution for 1h at room temperature with DNase free

RNase added to a final concentration of 10~gjml. The plasmid was

72

extracted once with phenol-chloroform, twice with chloroform and

precipitated with 0.1 volume of 3M sodium acetate and 2.2 volumes

ethanol at -2o0 c overnight. The precipitate was collected by

centrifugation at 12,000 rpm at 4°C. The pellet was washed with

70% ethanol, dried under vacuum and dissolved in 1ml TE. An

aliquot was analysed by electrophoresis on an 1% agarose gel to

check the preparation.

Electroelution of hck fragment:

About 50~g of pM 41.5 plasmid was digested with 100U Eco RI

and the 1896 bp hck fragment· was separated from the pGEM 3

plasmid fragment by electrophoresis in an 1% preparative agarose . gel. The hck fragment was purified by electroelution according to

the procedure of Maniatis et al., ( 1982) • Elution was done in

0.05X TBE in dialysis bag for 3h at 100V. The DNA solution was

collected and the fragment was precipitated by 0.1 volume of 3M

sodium acetate and 2.5 volumes of ethanol at -2o0 c overnight. The

fragment was electroeluted twice more to remove all contami-

nation with the vector pGEM-3.

Nick translation:

The probe was prepared by radiolabelling the hck fragment by

nick translation. The procedure for nick translation was as

described by Maniatis et al., ( 1982) • The reaction was carried

out in 50pl volume containing SOOng of DNA, 1 nmole of each un­

labelled dNTPs, 20 pmoles of 32 P labelled dNTP (dATP or dCTP),

73

50mM Tris-Cl, pH 7.2, lOmM MgC1 2 , lOmM OTT, 2.5~g DNase free BSA,

50pg DNase I and 5 u of E.coli DNA Pol I. After 90min of incuba­

tion at 15°C the reaction was stopped by adding 2pl of 0.5M EDTA.

The labelled DNA was purified from unincorporated dNTPs by spun

column chromatography.

Spun column chromatography:

Autoclaved Sephadex G-50 was poured in a 2ml disposable

plastic syringe till the top and packed by centrifuging for 5min

at JOOOrpm in HB 4 rotor in a Sorvall RC5B centrifuge. The nick

translated material was applied on top of the column. The tube

was washed with 100~1 of STE and the washings were also loaded on

the column. The eluate was collected in an eppendorf tube placed

beneath the syringe, by centrifugation at 4000rpm for 15min. The

percentage of incorporation of radioactivity was determined by

Cerenkov counting.

Random primed DNA labelling:

--.For some experiments the DNA fragment was labelled by the

random primed DNA labelling technique, using the kit obtained

from Boehringer Mannheim. The procedure followed was as

recommended by the supplier. The DNA was denatured by heating for

lOmin at 95°C and subsequently cooling on ice. The reaction

mixture in a final volume of 20pl contained lOOng of the

denatured DNA, 0.5nmol of each of unlabelled dNTPs, 20 pmoles of

labelled dNTPs, 2pl of solution containing hexanucleotide primer

74

in reaction buffer and 2 units of Klenow enzyme. Incubation was

at 37°C for 30min, after which the reaction was stopped by adding

lul of 0. 5M EDTA. The labelled fragments were separated from

unincorporated dNTPs by spun column seperation as described

above.

End labelling of deoxyoligonucleotide:

The 32 mer synthetic deoxyoligonucleotide was used for

screening after end labelling it with ( Y - 32 P) ATP using the

procedure of Maniatis et al., ( 1982) . The reaction was done in

20pl volume which contained, 250ng deoxyoligonucleotide, 2ul 10 x

Kinase buffer, 16.6 pmoles ( y-32 P) ATP, lOU of T4 polynucleotide

kinase. (10 x kinase buffer contains 0.5M Tris (pH 7.6), O.lM

Mgcl 2 50mM OTT, lmM spermidine, lmM EDTA). The mixture was incu­

bated for 30min at 37°C and the reaction was stopped by adding

lpl of 0.5M EDTA. The probe was purified by spun column chromato­

graphy as described earlier in this chapter. Sephadex G25 was

used instead of Sephadex G50.

Colony Hybridization:

Plating of colonies:

The plasmid library was plated on 48 soc agar plates (90mm

diameter) containing lOO}lg/ml ampicillin. On each plate about

5000 colonies were plated for high density screening. The plates

were incubated at 37°C for 17h. The transfer of colonies and

75

hybridization was done by the procedure of Grunstein and Hogness

(1975) with some modifications.

Transfer and lysis of colonies:

The plates with bacterial colonies were kept at 4°C for 2h.

For transfer 4 plates were removed each time. Nitrocellulose

filter (NC), 87mm diameter, was used for transfer straight from

the box. The dry NC was placed on the plate and orientation was

marked by stabbing a needle dipped in a nondiffusable ink through

the NC into the agar at asymmetric locations. The filter was

peeled off from the plate using a blunt ended forceps and placed

colony side up, for Jmin on two sheets of Whatman JMM filter

paper soaked in 10% SDS. The NC was transferred to a second set

of Whatman papers wetted with denaturing solution (0.5M NaOH,

1.5M NaCl) and left for 5min for colonies to lyse. Neutralizing

was done by placing them on a third set of Whatman)saturated with

neutralizing solution (1.5M Nacl; 0.5M Tris-Cl, pH 7.4) for 5min

and then for 5min on two Whatman sheets soaked in 2X SSPE. These

filters were then airdried for 30-60min and were placed between

Whatman JMM paper and baked for 2h at ao0 c in a vacuum oven. The

plates were reincubated at 37°C till the colonies appeared again.

They were then sealed and stored at 4°C.

Hybridization . . The filters were washed with 250m! of prewashing solution

(50mM Tris-Cl, pH 8.0·, 1M NaCl, lmM EDTA, 0.1% SDS) for 2h at

76

42°C. Prehybridization was then done for 6h at 65°C in 200m! of

prehybridization solution (5X SSPE, 5X Denhardts' solution, 0.1%

SDS, 100~g/ml denatured salmon sperm DNA).

Hybridization was done at 65°C for l8h. The double stranded

probe was denatured with 0.1 volume of 3N NaOH at 37°C for 5min

and added to 80ml prehybridization solution at a concentration of

5ngjml, and mixed well. The solution was transferred to two

crystallization dishes and the filters were immersed in it one by

one. In each dish 24 filters were placed and was shaken at 65°C

in a water bath.

The filters were washed at 65°C with 5X SSPE, 0.1% SDS for

30min, followed by 2 washes with 2X SSPE, 0.1% SDS for 30min each

and finally with 1X SSPE, 0.1% SDS for 30min and then for 15min.

The wet filters were arranged between plastic sheets and were

exposed to X-ray film at -70°C for 32h. The films were developed

and the positive colonies were replated at a density of about

100-300 colonies per 90mm plate for secondary screening. The

transfer and hybridization conditions were same as those used for

primary screening. After secondary screening positive clones were

picked up for further analysis.

The filter used for the primary screening were then rehybri­

dized to the end labelled oligoprobe. Prehybridization and

hybridization were done at 37°c. The hybridization solution con­

tained 3. 5ng of probe per ml. After hybridization for 20h the

77

filters were washed twice with 5 x SSPE, 0.1% SDS for 30min at

37°C and autoradiographed. The positive colonies were rescreened

using the same conditions.

Plaque Hybridization

Hybridization of plaques was similar to colony

hybridization. The Agt11 library of 80,000 plaques were screened

following the procedure of Benton and Davis (1977). E.coli Y1090

cells were infected with the phage as described in section

2..2.2. 18 plates were overlayed with the

incubated at 42°C for 10h. Each plate

> ¥-;i

infection mixture and

had about 4.5 x 103

plaques. The plates were cooled at 4°C for 2h. Transfer was done

by placing the NC on the plate for 30s. Using a needle dipped in

ink the filters were marked for orientation. The filters were

placed on 2 Whatman 3MM sheets soaked in denaturing solution. The

filters were neutralized, air dried and baked as described for

colony hybridization. The prewashing, prehybridization and hybri­

dization were done at 65°C as was described for colony hybridiza­

tion. The filters were exposed to x-ray films 14h at -7o0 c. The

positive clones were replated and rescreened using the same con­

ditions of primary screening. The positive Agt11 clones were

picked up and DNA was prepared for further analysis.

Southern Hybridization:

The ~ositive clones obtained after secondary screening were

identified and picked up. Miniplasmid preparation was done with

the plasmid clones as described in section 2.2.2. DNA was prepa-

red from the positive clones of the Agtll library following the

procedure described in section 2.2.2, using the lysate obtained

from one 90mm plate. The plasmid DNA samples were digested with

EcoRI and analysed by electrophoresis on an 1% agarose gel. The

clones were digested with EcoRI and also double digested with

EcoRI and Hindiii and electrophoresed on a 0.5% agarose gel to

determine the size of the inserts. Southern hybridization of the

clones was performed to confirm the positive clpnes (Southern,

1975). The digested samples were seperated by electrophoresis on

an 1. 2% agarose gel at 7V/cm, till the bromophenol blue dye

reached 2cm from the edge of the gel. The gel was then denatured

for 30min by gently shaking it in denaturing solution. Neutrali-

zation was done for lh with two changes of neutralization solu-

tion. The gel was then washed with lOX SSPE and capillary

transfer was set up. Six pieces of Whatman 3 MM paper 0. Scm

larger than the gel were soaked in lOX SSPE and placed on a

plastic. ·sh·eet-. The·--·gel was placed on the stack of What-man .

filters. A nitrocellulose filter was cut to the exact size of the

gel and was soaked for Smin in 6X SSPE. It was put on top of the

gel without entrapping any air bubbles. All the edges of the

gel and NC were covered with Saran Wrap to prevent transfer of

buffer directly from the Whatman paper. Two sheets of Whatman

filter were cut exactly to the size of the gel, soaked in lOX

SSPE and placed on top of the nitrocellulose filter. A stack of

79

30-40 dry handmade filter papers were kept on top of the Whatman

• ~M • • paper, above wh1.ch a glass plateA_ we1.ghed down w1.th about SOOg

weight. Transfer was allowed to proceed overnight. In order to

ascertain complete transfer the gel was stained and examined

under uv. The DNA on the nitrocellulose paper was also seen by

keeping the NC on the UV transilluminator. The NC was air dried

for 30min and then baked under vacuum at 80°C for 2h.

Prehybridization and hybridization were done as described for

colony hybridization. Hybridization was for 16h in solution

containing 10 ng hck probe/ml. The nitrocellulose filters were

washed as described earlier. The final wash was with O.SX SSPE at

65°c. Autoradiography was done 14h at. -70°C.

3.3. RESULTS

Purification and labelling of the probe DNA:

The 1.89 kb EcoRl fragment of hck was used to screen the

eDNA libraries.The fragment was purified thrice by electro-

elution and was free from any contamination of the vector DNA.

The fragment was electroeluted three times to purify it from

contamination of the vector DNA. A dot blot of the plasmid with

nick translated hck fragment showed no hybridization of the

vector with the fragment (Fig.J.l) and hence the fragment could

be used for the screening of the eDNA libraries.

Radioactive labelling of the fragment was done either by

nick translation or by random primed labelling. The specific

80

1 2

A • B • c

Fig.3.1. Dot hybridization ofpGEM-3Z with electroeluted hck probe. Lane 1, pGEM-3Z; A, 20ng; B, lOng, C, 5ng; lane 2, adult rat spleen mRNA; A, 2pg; B. lpg; C, 0.5pg.

81

...

•

•

Fig.3.2. Primary screening of the spleen eDNA library in pGEM-3Z with hck probe.

81 Q.

activity of the probe was between 5 to 8 x 107 cpm per microgram

of DNA.

The 32-mer oligonucleotide was end labelled with ( y 32 P]

ATP. The incorporation was estimated by Cerenkov counting and

specific activity of the oligoprobe was calculated to be 4x1o7

cpm per microgram of probe.

Screening of plasmid eDNA library with hck fraqment:

The rat spleen eDNA library in plasmid pGEMJZ (unamplified)

was screened at high colony density, each plate having

approximately 5000 clones. A total of about 240,000 colonies were

screened and five regions of hybridization were detected

(Fig.3.2). Bacterial colonies from these positive regions were

removed and secondary screening at low density was performed.

Four colonies out of the five were positive on secondary

screening (Fig.3.3). Two positive colonies from each plate 1a,

1b, 3a, Jb, 4a, 4b, 5a, and 5b were picked and plasmids were

prepared from them. Analysis of the undigested plasmids on an 1%

agarose gel showed presence of inserts (Fig.3.4). Clones 1a, 1b,

3a, and 3b were larger than 4a, 4b, 5a and 5b. EcoR1 digestion

was done for 1a and 3b. The clones 1a and 3b were further

analysed by Southern hybridization. They hybridized to the ,bg

fragment and so were used for sequence analysis (Fig.3.5).

82

•

, •

Fig.3.3. Secondary screening of the spleen eDNA library in pGEM-3Z with hck probe.

83

123456789

Fig.3.4. Plasmid preparation of the hck positive clones of the plasmid library. Lane 1, pGEM-3Z; lane 2, 1a; lane 3, 1b; lane 4, 3a; lane 5, 3b, lane 6, 4a; lane 7, 4b; lane 8, Sa; lane 9, 5b.

1 2

Fig.3.5. Inserts released from the positive clones after EcoRI digestion. Lane 1, 1 a; lane 2, 3b.

84

Screening of the plasmid library with the oligonucleotide probe:

The filters which were used for primary screening with hck

fragment were directly screened with the end labelled oligo­

nucleotide probe, without deprobing the filters. The autoradio­

gram had 10 regions of faint hybri dization {Fig.3.6), which were

rescreened. Only one of the 10 clones showed positive hybridiza­

tion after the secondary screeni ng (Fig.3.7). Plasmids were

prepared from 2 positive clones 6a and 6b. The clone 6b was

digested with EcoRl and analysed by electrophoresis on an 1%

agarose gel. It released an approximately 600 bp insert. This

clone was also analysed by sequencing.

Screening of the Aqtll eDNA library with hck fragment:

In order to isolate full lengt h clones, an unamplified rat

spleen eDNA library in ~t11 vector consisting of about 83,000

plaques {Table-IV, Chapter-!!) was s c reened with the b&k fragment.

After the hybridizatio~, 31 posit i ve plaques were identified

(Fig. 3. 8). Secondary screening was done for 10 of the strongly

hybridizing~laques. Nine filters had positive signal (Fig.3.9).

DNA was prepared from the positive clones L103, L108, L109, L110,

L111, L112, L115, and L116. Digestions were done with EcoR1 and

also double digestion with EcoR1 + Hindi!! (Fig. 2. 9 and 3 .10).

All the clones had released inserts. The EcoRl + Hindi!! digested

samples were analysed by Southern hybridization (Fig.3.11). The

inserts of all the clones were showing hybridization with the hck

fragment. Though positive clones were obtained from the plasmid

85

Fig.3.6. Primary screening of the spleen eDNA library in pGEM-3Z with deoxyoligonucleotide probe. The postive clone is shown en­circled.

Flg.S.7. Secondi.lly screening of the spleen eDNA library in pla~ ..,. iJ pGEM-3Z wi!1 deoxyoligonucleotide probe.

86

Fig.3.8. Primary screening ofthe A.gtll spleen eDNA library with hck probe.

87

•

0

( 1/~ .r I •

,. . . I ' .

•

. . '

;'

Fig,3.9. Secondary screening of A.gtll spleen eDNA !ibrary with hck probe.

88

1 2 3 4 5 6 7 8 9 10

-23.1 kb

4.4

2.3 2.0

- 0.5

Fig.3.10. Inserts released after EcoRI +Hindiii digestion of the positive A.gtll clones. Lane 1, L103, lane 2, L108; lane 3, L109; lane 4, LllO; lane 5, Llll; lane 6, L112; lane 7, L115; lane 8, L116; lane 9, A.gt 11; lane 10, markers.

89

1 2 3 4 56 7 8

Fig.3.11. Southern hybridization of the A.gtll clones digested with EcoRI + Hindlll with hck probe. Lane 1, L116; lane 2, L115; lane 3, L112; lane 4, Llll; lane 5, LllO; lane 6, L109; lane 7, L108; lane 8, L103.

90

library the inserts were small in size. From the Agt11 library

more clones were obtained with larger insert size. These were

further analysed by sequencing to determine the presence of the

complete gene (Chapter-IV).

3.4. DISCUSSION

The screening of rat spleen eDNA libraries by two different

probes has given positive clones which are likely to code for

tyrosine-specific protein kinases {see also Chapter-IV) . This

shows that if appropriate probes are used for screening, positive

clones can be isolated even for a relatively rare mRNA such as

hck from the eDNA libraries. This also shows that the eDNA

libraries constructed (see Chapter-II) are in fact very good. The

plasmid eDNA library contains smaller cDNA·clones although same

preparation of eDNA was used for constructing plasmid as well as

Agt11 eDNA libraries {see Chapter-II). The smaller number of

positive clones obtained by screening plasmid library could be

due to the fact that the full length of hck gene is about 2 kb.

--The size selection in plasmid .eDNA library .. might .. have occurred at

either the ligation step or the transformation step or both. The

Agt11 eDNA library appears to be suitable for isolating full

length eDNA clones {size greater than 1 kb) whereas plasmid eDNA

library may be suitable for smaller inserts.

The oligonucleotide probe was designed to pick up src rela­

ted tyrosine-specific protein kinase genes. It was expected to

91

pick up more clones than the hck probe since in addition to hck, . other src related kinase genes should hybridize with the probe.

Failure to obtain many positive clones with oligonucleotide probe

could be due to one or more of the several possible reasons (a)

design of the probe may be inappropriate (b) synthesis of the

probe may be inefficient and all possible oligomers may not be

represented (c) screening conditions may not be ideal.

The strategy of screening a eDNA 1 ibrary is of utmost

importance in any eDNA cloning project. At present several

different approaches can be attempted. Other oligonucleotide

probes can be designed for this purpose using some other

conserved region of the kinase domain. Another.· approach would be

to use the conserved kinase domain from one of the clones such as

Lll5 or Jb and screen a >. gtll library under less stringent

conditions followed by washing under stringent conditions. Using

this approach primary screening gave several positive clones most

of which are not hck clones since these clones do not appear

-"positive---under stringent- conditions of washing • Secondary screen-

ing and further analysis of these clones is under progress.

92