Chapter 13: DNA Technology

With all our knowledge of DNA and genes, is there any way to manipulate DNA?

• Genetic Engineering – form of applied genetics in which genes/DNA are

manipulated• Genetic engineers believe they can improve the foods we

eat. – Tomatoes are sensitive to frost. This shortens their growing

season. – Fish, on the other hand, survive in very cold water. – Scientists identified a particular gene which enables a flounder to

resist cold and used the technology of genetic engineering to insert this 'anti-freeze' gene into a tomato.

DNA Technology

Science involved in the ability to manipulate genes/DNA

Purpose:1. Treat genetic disorders (hemophilia,

diabetes, cystic fibrosis)2. Improve food crops (better tasting veggies,

longer shelf life, fungus resistance)3. Improve human life in general (vaccines…)

I. Isolate DNA. • Remove tissue from organism

(You did this in your DNA extraction lab)• Store at 4°C

II. Digestion:• Restriction enzymesRestriction enzymes –

–Enzymes that can cut (hydrolyze) DNA at specific sites.

• Current DNA technology is totally dependent on restriction enzymes.

• Restriction enzymes are endonucleases - Molecular scissors

What are restriction enzymes?• Bacterial enzymes – used to cut

bacteriophage DNA (viruses that invade bacteria)

• Different bacterial strains express different restriction enzymes

• The names of restriction enzymes are derived from the name of the bacterial strain they are isolated from

• Cut (hydrolyze) DNA into defined and REPRODUCIBLE fragments

• Basic tools of gene cloning • Animation

Names of restriction endonucleases

• Titles of restriction enzymes are derived from the first letter of the genus + the first two letters of the species of organism from which they were isolated. – EcoRI -  from Escherichia coli – BamHI - from Bacillus amyloliquefaciens– HindIII - from Haemophilus influenzae – PstI -  from Providencia stuartii – Sau3AI - from Staphylococcus aureus – AvaI -  from Anabaena variabilis

Source microorganism Enzyme Recognition Site Ends produced

Arthrobacter luteus Alu I AGCT BluntBacillus amyloiquefaciens H Bam HI GGATCC Sticky

Escherichia coli Eco RI GAATTC StickyHaemophilus gallinarum Hga I GACGC(N)5 StickyHaemophilus infulenzae Hind III AAGCTT StickyProvidencia stuartii 164 Pst I CTGCAG StickyNocardia otitiscaviaruns Not I GCGGCCGC StickyStaphylococcus aureus 3A Sau 3A GATC StickySerratia marcesans Sma I CCCGGG BluntThermus aquaticus Taq I TCGA Sticky

Restriction enzymes recognize a specific short nucleotide sequence

Animation• For example, EcoRI recognizes the

sequence • 5‘- G/ A A T T C -3'• 3'- C T T A A /G -5'

Examples of restriction enzymes and the sequences they cleave

•Palindromes – same base pairing forward and backwards

Let’s try some cutting:

• Using this piece of DNA, cut it with Eco RI• G/AATTC

• GACCGAATTCAGTTAATTCGAATTC• CTGGCTTAAGTCAATTAAGCTTAAG

• GACCG/AATTCAGTTAATTCG/AATTC• CTGGCTTAA/GTCAATTAAGCTTAA/G

What results is:

• GACCG AATTCAGTTAATTCG AATTC• CTGGCTTAA GTCAATTAAGCTTAA G

Sticky end Sticky end - tails of DNA – easily bind to other DNA strands

Blunt & Sticky ends

• Sticky ends – Creates an overhang. BamH1

• Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

5. A genetic engineer wants to use the restriction enzyme BamHI to cut the DNA sequence below:a. Consult the table above and state the recognition site for this enzyme: ___________________b. Place a mark at each point where the restriction enzyme BamHI would cleave the DNA sequence below:

10 20 30 40 50 60 AATGGGTACG/CACAGTGGAT/CCACGTAGTA/TGCGATGCGT/AGTGTTTATG/GAGAGAAGAA/ 70 80 90 100 110 120 AACGCGTCGC/CTTTTATCGA/TGCTGTACGG/ATGCGGAAGT/GGCGATGAGG/ATCCATGCAA/ 130 140 150 160 170 180 TCGCGGCCGA/TCGCGTAATA/TATCGTGGCT/GCGTTTATTA/TCGTGACTAG/TAGCAGTATG/ 190 200 210 220 230 240 CGATGTGACT/GATGCTATGC/TGACTATGCT/ATGTTTTTAT/GCTGGATCCA/GCGTAAGCAT/ 250 260 270 280 290 300 TTCGCTGCGT/GGATCCCATA/TCCTTATATG/CATATATTCT/TATACGGATC/GCGCACGTTT

c. State how many times the DNA was cut by the restriction enzymes: ___________________d. State how many fragments of DNA were created by this action: _______________e. What were the lengths of each DNA fragment in base pairs: ____________

____________ __________

__________ __________

4. The box below represents a gel during electrophoresis. You are to pretend that you have loaded and run your gel. A DNA marker lane is given to you in Lane #1. In Lane #2, run undigested (uncut) DNA through it. In

Lane #3, run your digested (cut) DNA. #1 #2 #3

(-) 300bp 250bp 200bp 150bp 100bp 50bp 25bp

(+)

Now that you have the desired gene or piece of DNA, what do you do with it?

III. Cloning vectors – Transfer of isolated gene to another

organism with the purpose of having the organism transfer the gene to another.

– Use bacterial plasmids

1. The same restriction enzyme used to cut the desired gene, is used to splice the plasmid

2. Donor gene (desired gene) is then spliced or annealed into the plasmid

3. Plasmid is then returned to bacterium and reproduces with donor gene in it.

4. Bacterium with donor gene can transfer donor genes to organisms it infects.

How this works to help humans • Looking at the gene that produces insulin for the

treatment of diabetes:1. Isolate insulin gene from a healthy human2. Using a restriction enzyme, cut out insulin

producing gene3. Cut bacterial plasmids with the same restriction

enzyme4. Introduce human insulin producing gene to

bacterial plasmid5. Bacterial plasmid takes up gene - recombinant DNArecombinant DNA6. Bacterial plasmid reproduces and starts expressing

insulin producing gene7. Insulin is produced and harvested from bacteria.

• What has been produced is Recombinant Recombinant DNADNA - DNA with genes from other organisms

• Transgenic organismsTransgenic organisms have introduced DNA from another species in them

Why GM Foods?Why GM Foods?

DNA Technology Techniques IV. Analysis of DNA

DNA fingerprinting – – Banding pattern of the fragments of cut

DNA on a special gel medium (agarose)

Purpose for DNA fingerprinting • Comparing banding

patterns to determine hereditary relationships between people

• Comparing banding patterns of 2 different species to determine evolutionary relationship

• Compare samples of blood or tissue for forensic purposes (who done it?)

• Paternity

How is it done?• RFLP analysis – Restriction fragment length

polymorphism. We each have non-coding segments on our DNA.

1. Extract DNA sample from blood or tissues2. Cut DNA using restriction enzymesrestriction enzymes. Fragment lengths

varies with each person3. Separate fragments by gel electrophoresis – separates

DNA fragments by the # of base pairs (length of the fragment) and charge. Another animation

4. Place DNA sample into wells in the agarose gelagarose gel – molecular sieve

5. Run a current through the gel. The DNA (negatively charged due to Phosphate groups) will migrate from (-) to (+)

6. The larger fragments will not migrate that far. The small fragments will go the furthest.

7. Stain gel and bands in a dye or use a radioactive probe to analyze the banding

•Very accurate method of accessing DNA. Does not work with identical twins

•Use strands of DNA that have a lot of introns (non-coding parts of your DNA)

Lane 1: Bromophenol blue

Lane 2: Crystal Violet

Lane 3: Orange G

Lane 4: Malachite Green

Lane 5: Xylene Cyanol

Lane 6: Mixture

1 2 3 4 5 6

Electrophoresis using DyesElectrophoresis using Dyes

Pipet dyes into the Pipet dyes into the Lanes’ wells in the Lanes’ wells in the order given on your order given on your lablab

Use your phones Use your phones and take a photo of and take a photo of your gelyour gel

Measure Measure migration in mm migration in mm

units for each units for each bandband

Malachite green

Crystal Violet

Orange G

Mixture

PCR – Polymerase Chain Reaction

A genetic copy machine • The polymerase

chain reaction (PCR) is a rapid way of amplifying (duplicating) specific DNA sequences from a small sample of DNA.

GTCA

Bio Rad song

Practical Use of DNA technology• Pharmaceutical products – insulin, HBCF

(human blood clotting factor)• Genetically engineered vaccines – to

combat viral infections (pathogenic – disease causing) – your body recognizes foreign proteins, produces antibodies. Introduced viral proteins will trigger an immune response and the production of antibodies

• Altering viral genomes – makes them no longer pathogenic – now a vaccine

• Increasing agricultural yields –– New strains of plants – GMO – Genetically Modified GMO – Genetically Modified

organismorganism. Try this one!!– Insect resistant plants – Insert gene that digests larvae

when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem

– Disease resistance – Fungal resistance in tomatoes, corn, soybean

– Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding

– Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils

– Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil

• Improve quality of produce- Slow down the ripening process

– ship when unripened, to market when ripe

- Enhance color of produce- Reduce hairs or fuzz on produce- Increase flavor

Why GM Foods?Why GM Foods?

Safety and Environmental Issues• All food products are regulated by the:

Food and Drug Administration – FDA• Nat’l Institutes of Health Recombinant DNA

Advisory Committee and the Department of Agriculture (USDA)

• Environmental Protection Agency (EPA)• All set standards for safety procedures and

require permits and labeling (not in US though). Look for a 8 before the product code. 84011 – GMO banana

• Problem with transgenic foods is that an Problem with transgenic foods is that an introduced gene may produce a protein that introduced gene may produce a protein that someone may be sensitive to. FDA does not someone may be sensitive to. FDA does not require that on a labelrequire that on a label

The negatives

• Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to.

• FDA does not require that on a label (here in the US)

• If a label starts with a “(8), then it’s a GMO product – 84011 = GMO banana

• Also, may create “superweeds” that cross pollinate with others & may take over environment

Gene Therapy • Treatment of a genetic

disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme.

• Nasal spray or injection that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary

• Has not been proven to be successful in the long term

1. The healthy gene is inserted into a genetically altered virus (retrovirus). 2. The (retro)virus is inserted into the patient (by injection or inhalation). 3. The (retro)virus enters the unhealthy cells and transfers the healthy gene

into the unhealthy cells' DNA. 4. Now when the cells divide, the new cells will contain the healthy gene.

                                                                                                                                                          

.

Hello Dolly!

Footpath Murders