Cell Stem Cell

Supplemental Information

Human Neuropsychiatric Disease Modeling using

Conditional Deletion Reveals Synaptic Transmission

Defects Caused By Heterozygous Mutations in NRXN1

ChangHui Pak, Tamas Danko, Yingsha Zhang, Jason Aoto, Garret Anderson, Stephan

Maxeiner, Fei Yi, Marius Wernig, and Thomas C. Südhof

 

SUPPLEMENTARY FIGURES and FIGURE LEGENDS

Figure S1 (related to Figures 1, 3, and 4): Phenotypic characterization of cortical neurons cultured from heterozygous and homozygous Nrxn1α KO mice fails to uncover a significant change in excitatory synaptic transmission. Experiments were performed with cortical neurons cultured from newborn littermate wild-type and heterozygous and homozygous Nrxn1α KO mice, which were not previously analyzed electrophysiologically in cultured neurons (Missler et al., 2003); only limited slice physiology data on Nrxn1α KO mice is available (Etherton et al., 2009). Neurons were analyzed by whole-cell patch-clamp recordings at 14-16 days in vitro (DIV). (A) Intrinsic electrical properties (membrane resistance, left, and membrane capacitance, right) of cortical neurons that were cultured from wild-type, heterozygous and homozygous Nrxn1α KO mice. (B) Spontaneous miniature excitatory postsynaptic currents (mEPSCs) recorded from wild-type, heterozygous and homozygous Nrxn1α KO cortical neurons in the presence of 1 µM

 

tetrodotoxin. Representative traces are shown on the left, and summary plots and graphs of the mEPSC frequency and amplitude are shown on the right, both as cumulative probability plots and as bar diagrams (inserts). (C) Action-potential evoked excitatory postsynaptic currents (EPSCs). Representative traces (left) and summary graphs of the amplitudes (right) of evoked AMPAR–mediated EPSCs recorded in wild-type, heterozygous and homozygous Nrxn1α KO cortical neurons as indicated. Data shown in summary graphs are means ± SEM. Number of neurons/independent cultures analyzed are shown in the bars. Statistical significance was evaluated with the Kolmogorov-Smirnov test (cumulative probability plots) and Student’s t-test (bar graphs). No parameters are significantly different in any comparison of genotypes.

 

Figure S2 (related to Figure 1): Analysis of the accuracy of homologous recombination in isolated drug-resistant ES cell clones by genomic PCR and Southern blotting. Puromycin-resistant ES cell clones were isolated and screened by PCR (panels A-C; see Fig. 1A for an additional schematic view of the PCR strategy) and by Southern blotting (panel D).

 

(A) PCR screening of candidate mutant clones during homologous recombination experiments. PCR#1 confirms the presence of both wild-type (lower bands) and targeted alleles (upper bands; asterisk) for the NRXN1 cKO. PCR#2-3 detect only the targeted cKO allele due to the partially annealing sequences of primers to the loxP sites in combination with primers that are present outside the homology arms. PCR#4 and PCR#5 only amplify correctly targeted alleles on both homology regions for the cTr experiments because the primers lie outside of the homology arms and anneal to unique sequences in the targeting constructs (HA-epitope tag and puromycin resistance cassette; see Fig. 1A). PCR bands corresponding to homologous recombination alleles are highlighted with asterisks. (B) PCR confirms the correct Cre-mediated deletion of the floxed exon in mutant NRXN1 cKO ES cells. The various fragments are schematically illustrated on the left, and the results of a representative PCR experiment with NRXN1 cKO ES cells treated with lentiviruses expressing Flp- or Cre-recombinase is shown on the right. Compared to naive H1 genomic DNA, which generates a PCR product of 712 bp, cKO deleted allele generates PCR products of both wild type band (712 bp) and deleted band (369 bp). cKO ES cells without any virus treatment does not amplify in this PCR condition. (C) PCR analysis of genomic DNA confirms the presence of correct junctions containing loxP and frt sites in the targeted cKO cell line, and the removal of the junctional sequences after Flp- or Cre-recombinase-mediated excision of the puromycin cassette or the targeted exon, respectively. (D) Representative images of Southern blotting experiments confirming correct homologous recombination in NRXN1 cTr targeted ES cells. Genomic DNA digested with NsiI from multiple cTr clones (#1-12) was analyzed using 5’ arm (#1) and 3’ arm probes (#2). Since the probes lie outside the homology regions used to target the allele as illustrated by the schematic diagram on top, correct targeting was confirmed on both arms as shown by the Southern blot below. Presence of a single band for probe #3, which is specific for the puromycin drug-resistance cassette, confirms a single integration site in cTr #1 and #2 clones. “-“ denotes negative control (untargeted ES cell line), and (R) represents randomly integrated ES cell line.

 

Figure S3 (related to Figure 1): Measurements of the lentiviral infection efficiency for delivery of Cre-recombinase to cells during iN cell differentiation (A & B), characterization of HA-tagged neurexin-1 protein in mutant NRXN1 cTr iN cells (C & D), and analysis of expression of mutant NRXN1 mRNA in NRXN1 cKO iN cells (E).

 

(A) Representative images of NRXN1 cKO iN cells that express the Cre-recombinase-EGFP fusion protein used as a standard in our experiments (see Kaeser et al., 2011), driven by an Ubiquitin promoter. iN cells at day 14 were immunostained with antibodies to EGFP (green) and human nuclei (HuNu; red). 10x field images were taken from 3 different experiments; total of 9 images (scale bar (100 µm) applies to all images). (B) Quantification of EGFP- and HuNu-positive nuclei in cKO iN cells. Total number of nuclei positive for EGFP (green bar) or for HuNu (red bar), and of nuclei double-positive for EGFP and HuNu (black bar) in each image was averaged and plotted. White bar represents the average percentage of HuNu-positive nuclei that are also EGFP-positive. Data shown in summary graphs are means ± SEM (n=3). (C) Representative images of NRXN1 cTr#1 iN cells that are co-expressing EGFP (green) with either wild-type (Control) or mutant Cre-recombinase (produces truncated allele). iN cells were immunostained for surface-exposed HA-tagged NRXN1 protein with an anti-HA antibody (red). Scale bar (50 µm) applies to all images. Note that no truncated protein is detected by surface labeling on the neurons. The knocked-in HA epitope, on the other hand, is present at high levels. (D) Representative immunoblot to probe for HA-tagged NRXN1 protein in the lysates and medium from iN cells derived from cTr#1 and control ES cells. cTr#1 iN cells expressing either active (Cre) or mutant Cre-recombinase (mCre) and iN cells from wild-type ES cells (WT iN cells) were analyzed. Immunoblots (30 µl cell lysate or medium per lane) were probed for HA and visualized by ECL; asterisks identify non-specific bands. Note that at this level of sensitivity, no soluble secreted HA-tagged NRXN1 was detected in the medium or cells, suggesting that either the truncated protein or the mRNA encoding the truncated protein is degraded rapidly. (E) Analysis by RT-PCR of NRXN1 mRNAs in matching control wild-type and NRXN1-mutant cKO iN cells. The location of the various PCR primers with respect to the exon of origin in the mRNAs is shown schematically on top for both the wild-type (Flp) and KO (Cre) allele, and a representative gel of the PCR bands is shown on the bottom. Note that no mutant mRNA is detectable in PCR #1, despite robust detection of the larger wild-type allele in the same reaction, suggesting that the mutant NRXN1 mRNA is subject to non-sense mediated decay and rapidly degraded.

 

Figure S4 (related to Figure 1): Immunostaining of pre- and post-synaptic markers in NRXN1 cTr iN cells.

Representative confocal images of iN cells derived from NRXN1 cTr#1 ES cells. At day 23, cTr iN cells are immuno-positive for a pre-synaptic marker Synapsin-1 (A) and a post-synaptic marker Homer-1 (B). No significant change was observed between iN cells expressing mCre- (mutant) and Cre- (control) recombinases. Scale bars in right images (10 µM for the top three rows, 50 µm for the bottom row) apply to all images in a row.

 

Figure S5 (related to Figure 2): Intrinsic membrane properties of NRXN1 cTr #1 iN cells are unchanged. (A) Summary graphs of the quantification of passive membrane properties in NRXN1 cTr#1 cell line expressing either wild type Cre (control) or mutant Cre-recombinase (mutant). Vrest, resting membrane potential. (B) Intrinsic excitability is unaltered by NRXN1αβ mutation. Left: Representative traces of action potentials in response to step current injections (from -5pA to +50 pA, upper panel) recorded in current-clamp mode. Membrane potential was maintained at approximately –70 mV. Right: Intensity-Frequency (I-F) plot of the number of action potentials (APs) in response to step current injections in control (Cre) and mutant (mCre) iN cells. (C) Quantification of action potential (AP) properties in NRXN1 cTr#1 cell line expressing either wild type Cre (control) or mutant Cre-recombinase (mutant). (D) Representative traces of whole-cell Na+ (INa

+) and K+ (IK+) currents and summary Current-Voltage (I-V) relationship recorded in iN cells from NRXN1 cTr#1 cell line (Cre vs mCre). Currents were recorded in voltage-clamp mode; cells were held at -70 mV; stepwise depolarization from -90 mV to +20 mV at 10-mV intervals was delivered (upper panel). The insets show Na+ currents. All data are means ± SEM; numbers of cells/cultures analyzed are shown in the graphs or plots. No parameters are significantly different in any comparison of genotypes.

 

Figure S6 (related to Figure 3): Analysis of synapse formation and neuronal morphology in heterozygous mutant NRXN1 cKO and cTr#2 iN cells. (A) Left, representative images of iN cells generated from NRXN1 cKO (top) and NRXN1 cTr#2 ES cells (bottom) infected with lentiviruses expressing either Cre- and Flp-recombinases (top) or wild-type (control) or mutant Cre-recombinases (mCre, mutant; bottom). iN cells were co-infected with EGFP, and also stained for the synaptic marker Synapsin-1 (scale bar, 5 µm, applies to all images). Right, quantification of the density, staining intensity, and size of synapses in control and NRXN1-mutant iN cells. (B) Left, representative images of isolated control and mutant iN cells derived as described for A. iN cells were sparsely infected with lentiviruses expressing tdTomato to label individual neurons (scale bar, 40 µm, applies to all images). Right, quantification of the total neurite length, number of primary processes, neurite branch points, and cell size in control and NRXN1-mutant iN cells. Data are means ± SEM; numbers in bars represent total cells/experiments performed. Note no significant change was observed between genotypes.

 

Figure S7 (related to Figure 4): Control experiments demonstrating that viral expression of wild-type and mutant Cre-recombinase and of Flp-recombinase in iN cells has no effect on evoked synaptic transmission. (A) Sample traces (left) and summary graphs (right) of the amplitudes of evoked AMPAR–mediated EPSCs measured in iN cells derived from parental naive H1 ES cells that were not subjected to gene targeting and were infected with either Flp- or Cre-recombinase (Flp vs Cre) expressing viruses. (B) Sample traces (left) and summary graphs (right) of the amplitudes of evoked AMPAR–mediated EPSCs measured in iN cells derived from non-gene targeted H1 ES cells that were either not infected with a virus (‘No virus’) or infected with viruses expressing either wild-type Cre-recombinase (Cre) or mutant inactive Cre-recombinase (mCre). Data shown in summary graphs are presented as means ± SEM, and number of cells/independent cultures analyzed are shown in the bars. Note no significant change was observed between conditions.

 

SUPPLEMENTARY DETAILED METHODS Cloning of AAV targeting constructs. 1. AAV for conditional truncation (cTr): The 2X-HA sequence was introduced in frame into the last coding exon (exon 24) of the NRXN1 gene, followed by the first loxP site, a stop codon, and a second loxP site. A puromycin resistance cassette was inserted between the stop codon and the second loxP site. 5’ and 3’ homology arms (1.0 kb and 1.3 kb, respectively), were amplified from H1 ES cell genomic DNA by PCR, assembled into pBluescript (Invitrogen) shuttle vector and sequenced. Synthetic oligos containing 2X-HA-loxP-STOP-loxP were used via Gibson assembly (IDT) to ligate with the homology arms. The FRT-PGK-puromycin-hGH polyA-FRT cassette was assembled into pBluescript and the activity of puromycin resistance was tested in HEK cells prior to testing in ES cells. 2. AAV for cKO: H1 ES cell genomic DNA was used to amplify and sequence 5’ and 3’ homology arms (1.5 kb each), as well as the exon cassette. A synthetic minigene (IDT) including multiple cloning sites and loxP sites was then used for subcloning. Both constructs were subcloned into pAAV H1 DJ via MluI and KpnI sites, which are proximal to two ITR sites (Xu et al., 2012). The sequence information for both constructs is provided below.

Lentiviral plasmid construction. The following lentivirus constructs were used for the current study: 1. Lentiviruses expressing FUW-TetO-Ngn2-P2A-puromycin (Zhang et al., 2013); 2. rtTA virus (Zhang et al., 2013); 3. Matched sets of lentiviruses expressing either mutant or active Cre-recombinase fused to EGFP or to mCherry and driven by the human synapsin-1 or ubiquitin-C promoters (Kaeser et al., 2011); 4. Ubiquitin-C promoter driven Flp-recombinase; 5. Ubiquitin-C promoter driven tdTomato.

Lentivirus and AAV preparations. Lentiviruses were produced as described (Pang et al., 2010). For all lentiviral vectors, viruses were produced in HEK293T cells (ATCC, VA) by co-transfection with three helper plasmids (3.25 µg of pRSV-REV, 8.1 µg of pMDLg/pRRE and 4.5 µg of vesicular stomatitis virus G protein expression vector) and 10 µg of lentiviral vector DNA per 75 cm2 culture area using calcium phosphate method (Chen and Okayama, 1987). Lentiviruses were harvested from the medium 48 hrs. after transfection and either concentrated by high centrifugation for infection at day -1 iN induction or directly harvested for superinfection at day 4 of iN protocol. For concentration of lentiviral particles, viral supernatant was pelleted by high-speed centrifugation (49,000 x g for 90 min), resuspended in MEM (Life Technologies), and aliquoted and snap-frozen in liquid N2. Only virus preparations with over 90% infection efficiency as assessed by EGFP expression or puromycin resistance were used for experiments.

AAVs (strain DJ) were produced as described (Xu et al., 2012). AAV plasmids were co-transfected with pHelper and pRC-DJ into HEK293T cells. 72 h post transfection, cells were harvested, lysed and run on an iodixanol gradient by ultracentrifugation at 400,000 x g for 2 hrs. The 40% iodixanol fraction containing AAV was collected, concentrated and washed in a 100K MWCO ultracon filter (Milipore).

 

Transduction of ES cells using AAVs was performed essentially as described (Kohli et al., 2004). H1 cells were seeded on a matrigel-coated 6-well plate and split at a 1:10 density (~1x105 cells/well). After 24 hrs., H1 cells were infected with purified AAV particles diluted in Nutristem (Invitrogen) to achieve a multiplicity of infection (MOI) of 2000-20,000 genome particles per cell. Cells were then selected in puromycin (1 mg/ml) containing mTeSR1 medium until independent clones emerged on the plate. Clones were manually picked under sterile conditions and transferred to 24-well or 12-well plates in mTeSR1+puromycin, and further grown until confluence. Cells were harvested and prepared for frozen stocks or genomic DNA preps for genotyping. PCR genotyping and southern blotting. Genotyping on engineered H1 ES cells was performed using the following primers (see Fig. 1A for location of primers): (PCR #1) F: 5’-GATGTGTGCTGCTGTTGCTTTTTGG-3’; R: 5’-AAATGTGCTCAAGAAAGTGGACCAAG-3’; (PCR #2) F: 5’-GGCCTGTGGAAATGTCTGTAACA-3’; R: 5’-TATCAAGGTAC CAGTTGTTTTAAAAGA-3’; (PCR #3) F: 5’-TATTCTGGATCCTTTACTGTTAACTTTT-3’; R: 5’-CTTATCAATGAATTCAGCCCTTGTGGT-3’; (PCR #4) F: 5’-AAGCAGTATAGA GCCATATGTTTGG-3’; R: 5’-GCATAGTCAGGTACGTCGTAAGGAT-3’; (PCR #5) F: 5’-ACGTAGATCCAGACATGATAAGA-3’; R: 5’-CGTCACTTATCACAGTCCAGAAAGC-3’ (PCR for cKO-mediated deletion – see Fig. S2B and C for location of primers): F: 5’- GATGTGTGCTGCTGTTGCTTTTTGG-3’; R 5’- GTACTGGTTTCTGGGGGAAGGAA-3’; F: 5’-ACGTAGATCCAGACATGATAAGA-3’; R: 5’- GTACTGGTTTCTGGGGGAAGGAA-3’; F: 5’-TTCAGGCTTGGGTGACTACC-3’; R: 5’-  CAGAAAGCGAAGGAGCAAAG-3’. Southern blotting on conditional truncation lines was performed as described (Kaeser et al., 2008). Following primer pairs were used for generating southern probes by PCR: for puromycin cassette: F: 5’-GTCACCGAGCTGCAAGAACT-3’; R: 5’-GCTCGTAGAAGGGGAGGTTG-3’; for 5’ probe: F: 5’-ATTCCATCAGGCTGGAAAAA-3’; R: 5’-TTGCTTCTGTGGACAAGGTG-3’; for 3’ probe: F: 5’-CACACACACACGAATCCACA-3’; R: 5’-GCAGCAGCCAGAGTTAAGGT-3’.

Generation of iN cells from naïve and genetically engineered human ES cells. iN cells were generated from ES cells according to (Zhang et al., 2013) with the following modifications: ES cells were treated with accutase (Innovative Cell Technologies) and plated as dissociated cells in 6-well plates (H1: 4x104 cells/well) on day -2. Cells were plated on matrigel-coated wells in mTeSR1 containing 2 µM thiazovivin (Bio Vision). On day -1, lentivirus prepared as described above (1.0-2.0 µl/well of 6-well plate) was added in fresh mTeSR1 medium containing polybrene (8  µg/µl, Sigma). On day 0, the culture medium was replaced with N2/DMEM-F12/NEAA (Invitrogen) containing human BDNF (10 µg/l, PeproTech), human NT-3 (10 µg/l, PeproTech) and mouse laminin (0.2 mg/l, Invitrogen). Doxycycline (2 mg/l, Clontech) was added on day 0 to induce TetO gene expression and gradually turned off from day 10. On day 1, a 48 h puromycin selection (1 mg/l) period was started. On day 3, iN cells were dissociated with accutase and re-plated (~200,000 cells/well of 24-well plate) with mouse glia cells in Neurobasal medium supplemented with B27/Glutamax (Invitrogen) containing BDNF, NT3 and laminin; Ara-C (2 µM, Sigma) was added to the medium to inhibit astrocyte proliferation. Mouse glial cells

 

were cultured from forebrain of newborn wildtype CD1 mice as described (Franke et al., 1998). Briefly, newborn mouse forebrain homogenates were digested with papain (Worthington Biochemicals) and EDTA for 20 min, cells were dissociated by harsh trituration to avoid growing of neurons, and plated onto T75 flasks in DMEM supplemented with 10% fetal bovine serum (FBS). Upon reaching confluence, glial cells were trypsinized and replated at lower density. This procedure was repeated 1-2 times to further remove the potential trace amounts of mouse neurons before the glia cell cultures were used for co-culture experiment with iN cells. At day 4, iN cells were treated with lentiviral particles harvested in B27/Glutamax medium if necessary. From day 6, 50% of the medium in each well was exchanged every 2-3 days. At day 10, 50% of the medium was exchanged with neuronal growth medium (Maximov et al., 2007) containing 5% FBS, 2% B27, 0.5% glucose (Sigma), 0.02% NaHCO3 (Sigma), L-glutamine (0.5mM, Sigma), glucose (0.5%, Sigma), native bovine transferrin (0.1 mg/mL Gemini Bio products) in MEM. At day 13, 0.5mL of neuronal growth media was added into each well without media change and at day 20, last media change occurred. iN cells were assayed on day 23-25 for experiments.

Neural differentiation via NPC intermediates. Differentiation of hESCs to human neural precursor cells (NPCs) by embryoid body (EB) formation was performed previously described (Zhang et al., 2001, Wu et. al, 2007, Koch et al., 2009,) with the following modifications. EBs were generated using AggreWell 800 plate (StemCell Technologies) following manufacture's protocol (Ungrin et al., 2008). Single cell suspensions of 3 ×106 ES cells were seeded in each well of the AggreWell 800 with a total volume of 2 ml of STEMdiff Induction Medium (StemCell Technologies) with thiazovivin. The plate was centrifuged at 100 xg for 3 minutes to capture the cells in the microwells. Half of the medium was changed daily for 5 days. At day 5, the ES cells were collected at the bottom of the well, which aggregated to form EBs/neurospheres. The EBs were flushed out of the microwells using MEM and collected into a 50 ml conical tube. Supernatant was aspirated out and EBs were resuspended with STEMdiff Induction Medium. All of the EBs was transferred to a matrigel coated 6-well plate (one well of the AggreWell 800 well = one well of a 6-well plate). Over the course of 7 days, EBs/neurospheres were attached and neural rosettes formed. Medium was changed daily. At day 12, neural rosettes were selected manually under the dissection microscope using sterile conditions. Only the cells with rosette morphology were picked out of the culture plate. Collected rosettes were transferred to a matrigel coated 6-well plate with STEMdiff Induction Medium. NPCs grew out of neural rosettes within 12 hours and maintained for another 7 days. At day 19, NPCs were detached with accutase to make a single cell suspension and transferred onto a matrigel-coated 24-well plate at a density of 3×105 per well in neuronal growth medium (see above) with BDNF, NT3, laminin, and thiazovivin. At day 20, single NPCs were infected with Lentiviruses containing either Flp-recombinase or Cre-recombinase (0.8ul virus per well). At day 22, mouse glia cells were plated on top of differentiated NPCs to promote synapse formation. Differentiated neurons were maintained with half medium change every five days until day 40 for analysis.

 

Primary neuronal cultures from mice. Cortical neurons were cultured from littermate progeny of matings between heterozygous neurexin-1α KO mice (maintained on a hybrid SV129/C57 black6 background to avoid artifactual phenotypes caused by mutations in homozygous inbred strains) as described previously (Missler et al. 2003, Maximov et al. 2007). Briefly, primary cortical neurons were isolated from P0-1 mice, dissociated by papain (Worthington Biochemicals) digestion and plated on matrigel-coated glass coverslips using plating media containing 10% FBS, 0.5% glucose (Sigma), 0.02% NaHCO3 (Sigma), L-glutamine (2 mM, Sigma), native bovine transferrin (0.1 mg/mL Gemini Bio products), insulin (0.1 mg/ml, Sigma) in MEM (Invitrogen). 24 h later, media was completely replaced with neuronal growth media without Ara-C. 72 h after plating, half of the media was replaced by neuronal growth media (see above) with Ara-C (4 µM) to reach a final concentration of 2 µM Ara-C. The neurons were cultured for 14–16 days in vitro. All experiments involving handling of mice were performed in accordance with Stanford University and federal guidelines.

Immunofluorescence labeling experiments. Cultured iN cells were fixed in 4% paraformaldehyde + 4% sucrose in PBS for 20 min at room temperature, washed three times with PBS and treated with 0.2% Triton X-100 in PBS (PBST) for 10 min each wash at room temperature. Cells were incubated with blocking buffer (PBS containing 2% normal goat serum (Sigma) and 0.02% Sodium-azide) for 1 h at room temperature. Primary antibodies, diluted in blocking buffer, were applied for 1 hour at room temperature then washed three times with PBST. Secondary antibodies were diluted in blocking buffer and applied for 1 hr. at room temperature. Immunolabeled neurons were then mounted on glass slides with Fluoromount-G mounting medium (Southern biotech) or Vectashield mounting medium with DAPI (Vector laboratories). The following antibodies were used for our analysis: mouse anti-MAP2 (Sigma; 1:500), mouse anti-Tuj1 (Covance; 1:200), rabbit anti-synapsin (Synaptic Systems; 1:200), mouse anti-HA (Covance; 1:200), mouse anti-HuNu (Milipore; 1:1000), rabbit anti-GFP (Invitrogen; 1:200), rabbit anti-Homer (Synaptic Systems; 1:200), mouse anti-vGAT (Synaptic Systems; 1:200), Pax6 (Covance; 1:400), Nestin (Milipore; 1:200), and chicken anti-MAP2 (Abcam; 1:15,000). Alexa-488, Alexa-546-, and Alexa-633-conjugated secondary antibodies were obtained from Invitrogen.

Surface labeling of HA-Nrxn1 was performed on neurons fixed with 4%PFA +4% sucrose for 15 min, then blocked in detergent-free blocking solution for 1 hr. Fixed neurons were immunostained under non-permeablized conditions for 1 hr at room temperature before application of secondary antibody.

Image Acquisition and Quantification. Image acquisition and quantification were performed as described (Anderson et al., 2012). Cells were chosen at random from three or more independent cultures. Images were taken from at least three coverslips per experiment. Fluorescent images were acquired at room temperature with an Olympus (Tokyo, Japan) FV1000 BX61WI laser-scanning confocal microscope using an Olympus Plan Apochromat 60x oil objective (NA: 1.42; WD: 0.15) set to 3x zoom with sequential acquisition,

 

averaging of 3 frames, and set to 1024x1024 pixel resolution. Laser power and photomutiplier settings were set so bleedthrough was negligible between channels. Within the same experiment, the same settings for laser power, PMT gain, and offset were used. These settings provided images where the brightest pixels were just under saturation. Digital images were taken using the Olympus Fluoview Imaging software (Olympus). 7-12 0.5 µm optical sections were used and maximum pixel intensity projections were created.

For quantifications of synaptic puncta, images were thresholded by intensity to exclude background signals and puncta were quantified by counting the number of puncta whose areas ranged from 0.1-4.0 mm2. For each experiment, at least 15 cells per condition were analyzed and the mean and SEM were calculated. Data shown represent the average of the mean values from at least 3 independent experiments.

For analysis of dendritic arborizations, iN cells were sparsely infected with lentiviruses expressing tdTomato to obtain fluorescent images of individual neurons. Images were acquired using a Leica digital camera (DFC400), attached to a Leica inverted microscope (DMIL LED) with a 20× objective, driven by Leica image acquisition software (LAS App. Suite Version 4.2.0). Images from 20 to 30 neurons per condition (per n=1) were reconstructed using the MetaMorph neurite application, scoring for total neurite length, neurite branch points, and soma area. Data shown represent the average of the mean values and SEM from at least 3 independent experiments.

Electrophysiological recordings in cultured iN cells were performed in the whole cell configuration as described previously (Maximov and Südhof, 2005; Zhang et al., 2013). Patch pipettes were pulled from borosilicate glass capillary tubes (Warner Instruments) using a PC-10 pipette puller (Narishige). The resistance of pipettes filled with intracellular solution varied between 2-4 MOhm. The bath solution in all experiments contained (in mM): 140 NaCl, 5 KCl, 2 CaCl2, 2 MgCl2, 10 HEPES-NaOH pH 7.4, and 10 glucose; 300-305 mosm/l. Intrinsic firing properties of iN cells were recorded in current-clamp mode. Minimal currents were introduced to hold membrane potentials around −65 to −70 mV. To elicit action potentials, increasing amount of currents were injected for 1s in a stepwise manner. Voltage-dependent sodium and potassium currents were recorded in voltage-clamp mode at a holding potential of -70 mV; voltage steps ranging from -90mV to +20mV were delivered at 10-mV increments. The pipette solution used for these recordings contained (in mM): 123 K-gluconate, 10 KCl, 1 MgCl2, 10 HEPES-KOH pH 7.2, 1 EGTA, 0.1 CaCl2, 1.5 MgATP, 0.2 Na4GTP and 4 glucose; 290-295 mosm/l. Spontaneous miniature and evoked synaptic responses were monitored in voltage-clamp mode with a pipette solution containing (in mM): 135 CsCl, 10 HEPES-CsOH pH 7.2, 5 EGTA, 4 Mg-ATP, 0.3 Na4GTP, and 5 QX-314; 290-295 mosm/l. Evoked synaptic responses were triggered by 0.5-ms current (100 µA) injection through a local extracellular electrode (FHC concentric bipolar electrode, Catalogue number CBAEC75) placed 100–150µm from the soma of neurons recorded. The frequency, duration, and magnitude of the extracellular stimulus were controlled with a Model 2100 Isolated Pulse Stimulator (A-M Systems, Inc.)

 

synchronized with the Clampex 9 data acquisition software (Molecular Devices). Excitatory postsynaptic currents (EPSCs) were pharmacologically isolated with picrotoxin (50 µM) and recorded at a -70mV holding potential; mEPSCs were monitored in the presence of tetrodotoxin (1 µM) in addition to the compound listed above; all drugs were applied to the bath solution. Spontaneous miniature events were analyzed in Clampfit 9.02 (Molecular Devices) using the template matching search and a minimal threshold of 5 pA and each event was visually inspected for inclusion or rejection. Sucrose-evoked release was triggered by puff application of bath solution to which 0.5 M sucrose were added and which also contained 1 µM TTX. Sucrose puffs (10 psi; 20 s duration) were applied with a picospritzer (Picospritzer III, General Valve, Fairfield, NJ) using puff pipettes pulled to a tip diameter of 3–6 µm. For all electrophysiological experiments, the experimenter was blind to the condition/genotype of the cultures analyzed. Data were digitized at 10 kHz with a 2 kHz low-pass filter using a Multiclamp 700A amplifier (Molecular Devices). Data were analyzed using Clampfit 9.02 software. All experiments were performed at room temperature.

Gene expression analyses. For quantitative RT–PCR analyses of cultured cells in bulk, total RNA was isolated using RNAqueous Kit (Ambion) following the manufacturer’s instructions, treated with DNase (Ambion) and reverse-transcribed and PCR amplified using one-step reaction (Roche Lightcycler 480 RNA master hydrolysis probes). mRNA levels were quantified by real-time PCR assay using the Applied Biosystems 7900HT Fast real-time PCR system and RQ analysis software (Applied Biosystems). To ensure the specificity of the amplification, titrations of total human brain RNA were used to test primer pairs and only primers that demonstrated a linear amplification were analyzed. For quantitative RT-PCR of single neurons, cytosol of neurons was aspirated via a patch pipette and analyzed using a fluidigm chip as described previously (Pang et al., 2011). For regular RT-PCR reactions, purified total RNA was converted into cDNAs using SuperScript III Reverse Transcriptase (Invitrogen) and PCR amplified using specific primers.

Primer sequences for qRT-PCR assays. All real-time PCR PrimeTime assays were custom designed through Integrated DNA Technologies. Human primetime assay sequences are as follows (probe; primer 1; primer 2): ASCL1: CGATCACCCTGCTTCCAAAGTCCA; AGCTTCTCGACTTCACCAAC; CAACGCCACTGACAAGAAAG BRN2: CATGACTCTCGGAGCCGGACTG; AAAGTAACTGTCAAATGCGCG; GCTGTAGTGGTTAGACGCTG CASK: CGACGTAGTGGCACATGAAGTTTACAG; CGACGCAAAGGAACTAAAGC; AATAGGGAGAGGTGGGAGG CNTNAP2: TTCTTGGCAGTCCTCGTCAAACCC; CCACCCAGGTTGTATCGAATC; TCTACATCAGCTCCTTCACCA COLLYBISTIN: TCACTGAACATGTCCCTTCTCTTCCG; TCACTACATCAAGCACCTCAAG; CACAAAGCCCATCTGAAATCTG

 

FOXG1: CCCTCTTTGCCAAGTTTTACGACGG; CCTGCCCTGTGAGTCTTTAAG; GTTCACTTACAGTCTGGTCCC GAD65: ATGCGCTTCAAACCCGGTAGTCC; CACCATCTCATATCCTTCTCGG; AAACTATGGCTGATGTGGAGG GAD67: CCGCAGATCTTGAGCCCCAGTT; CACTCACAAGGCGACTCTTC; GACCCCAATACCACTAACCTG GAPDH: CAGCAAGAGCACAAGAGGAAGAGAGA; AGGGTGGTGGACCTCAT; TGAGTGTGGCAGGGACT GEPHYRIN: AGGTGCTCCAATACCCTGCGG; AGACAGTAATGCCAGGACAAG; CACCAGAATTCGCACTTCAAG GRIA1: AGCCACAGCCACATCTGCTCTT; TGATGGAAAATACGGAGCCC; CTTCCCGGACCAAAGTGATAG GRIA2: TTGTTGGAGGTGTGTGGTGGTTCT; TCTCTGGTTTTCCTTGGGTG; CAGTCAGGAAGGCAGCTAAG GRIA4: CAGGGAATTGACATGGAGAGGACACT; CAAGGAGAGGAAATGCTGGG; ACGTCCATAGTGGTCAAACTG LBX1: CCTGCAGAACGCTGACCTCCA; CGCCAGCAAGACGTTTAAG; GCCCAAAGATGGTCATACCG LRRTM2: TGCAGCCTCCAATGTGCTCAGAA; GGGACACAGAAAACAGGAAAC; GCCACTTGAAATGTAAGCCC MINT1: TCCTTTCTGCTTCTCTATGAAAACATCTTTACAGTT; CTCCACAATCACCACACCTA; GACCTGATCCACTTCTCCAAG MUNC18-1: ATCTCTACCCGTTCCTCTGCCTCC; TTCTTATGCCAGTGCCCATAG; CAAACTTGACACCAAACACTACC NLGN1: TGTCTTGAGGGACTGGTTGATTTGGG; GCTGAGTGCAGTTGTAATGAC; CGGTTGGGTTTGGTATGAATG NLGN2: TCAATCCGCCAGACACAGATATCCG; GTACCTCAACCTCTACGTGC; TGGAGAAACAGCATCACAGG NLGN3: CGCTAAGTCCTCGCCCTGTTTCT; GTCGCTACTTACATCCAGGAG; GTCTTCATCTTCATCCCCGTC NLGN4X: TGGCCTTCTGGAAGAGACCTTCTGA; CTCCTGTGTCAGCCTGTTG; CCTTGTCTGCCAATATCCG NLGN4Y: TAACTGCCGTCTGGGAATACTAGGGT; GATCTTACATGGAGGGAACCG; GAGCCCATAGTTGCCTTTTG NRXN1 (exon 19/20): CACCCAAGCCTGAAGAACTGTCCA; GCCATAGGTTTTAGCACTGTTC; CTGTCCCAACATTAAACTTAACTCC NRXN1 (alpha): ATCTGTTCCACCCATCCCTGCAC;  CATAGCTCAAAACCGTTGCC;  TCAAAGGAAACAGCAAAACCG

 

NRXN1 (beta): TGCCTATTGCAATCTACAGGTCACCG; GTCCGCCTCGCAAGGAT; ATTTCCATGGCAGCAGCAAG NRXN2: AAAGGCAAGGAGGAGTTTGTGGC; TTAAACAGCGAAGTAGGGTCC; GTGACA GGTCGTAGCAGAAG NRXN3: AGCCAGCATTCAGCCAACATCAGA; ACC ACAACCCGTAAGAATCG; TGTACT CGGCTCACATTCAAC NURR1: ACCTCTCCGGCCTTTTAAACTGTCTG; CTGGCTGTTGGGATGGTC; TGTGGGCTCTTCGGTTTC PSD95: TCAACACAGATACCCTAGAAGCCCCA; AGTCAGAAATACCGCTACCAAG; CCG TTCACCTGCAACTCATATC SYB2: AGGAACGGCTGAGGGTTGGG; TCATCTTGGGAGTGATTTGCG; GGGCTGAAAGATATGGCTGAG SYN1: ACCTTGACCTTGCCCATCCCA; CCCCAATCACAAAGAAATGCTC; ATGTCCTGGAAGTCATGCTG SYT1: TGGGTGGCTTATCCGATCCTTATGTGA; GTGATATCTGCTTCTCCCTTCG; AGCCTCTTACCATTCTGCATC TBR1: TGCATGTGGTGGAAGTGAACGAGG; GGAGCTTCAAATAACAATGGGC; GAGTCTCAGGGAAAGTGAACG TUJ1: CCTCCGTGTAGTGACCCTTGGC; TTTGGACATCTCTTCAGGCC; TTTCACACTCCTTCCGCAC VGAT: CTACCCTACGCCATCCTGCACG; CACGACAAGCCCAAAATCAC; AGATGATGAGAAACAACCCCAG VGLUT1: TGTATGAGGCCGACAGTCTCTGGA; TCAATAACAGCACGACCCAC; TCCTGG AATCTGAGTGACAATG VGLUT2: TGGTACTTGCAGTGGGATTCAGTGG; TGGTCGTTGGCTATTCTCATAC; ATACTGGCATATCTTGGAGCG Primer sequences for RT-PCR (see Fig. S3E for location of primers). (PCR #1) F: 5’- GGCCCAGCACAACCTGCCAAGAG-3’;

R: 5’- CTGCAGGGTAGCGCTCGATCACT-3’; (PCR #2) F: 5’- TTCGTTTCACGAGGAGTGGTGG-3’;

R: 5’-CTGGCTAATGGGTTCTTTTGTC-3’; (PCR #3) F: 5’- CCGACAAAAGAACCCATTAGCCA-3’;

R: 5’- TGCTGGGTTGTTTCTCCTTTAC-3’; (PCR #4) F1: 5’- GTGACTTATATATAGGAGGAGTAG-3’;

R: 5’- GGTCATTGCAGAGTGGTCCACTGA-3’.

Immunoblotting and protein quantifications. For immunoblotting of proteins from iN cells, neurons were washed three times with PBS, lysed with Laemmli sample buffer containing

 

DTT, and boiled for 5 min. Lysates were subjected to SDS-PAGE and immunoblotting using fluorescently labeled secondary antibodies (donkey anti-mouse IRDye 800CW, 1:15,000; donkey anti-rabbit IRDye 800CW, 1:15,000; donkey anti-rabbit IRDye 680, 1:15,000; LI-COR Bioscience) and signal detection with an Odyssey Infrared Imager and Odyssey software (LI-COR Biosciences). Signals were normalized for NeuN probed on the same blots as loading controls. Antibodies used were as follows: monoclonal mouse antibodies to HA (Sigma; 1:1000), synaptobrevin-2 (Cl69-1; 1:1000), synaptotagmin-1 (41.1, Synaptic Systems; 1:1000), and CASK (BD Transduction; 1:1000) and CASK (Neuromab; 1:1000), Munc18-1 (610336, BD Transduction; 1:500), and rabbit polyclonal antibodies to SNAP-25 (p913; 1:1000), Mint1 (p730; 1:500), Veli (U049; 1:500), PSD-95 (L667; 1:1000), GluA1 (ab1504, Abcam; 1:500), Cpx1/2 (p942; 1:1000), and NeuN (ABN78, Millipore; 1:500).

 

Appendix: Full Sequences of AAV targeting constructs for cKO and cTr lines

AAV-cKO CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTTTAATTAAATGTACACAAATGTGATAGTAGGTCAACTCCATTTAACTGGTAAACTTGGTAATCATGGCAATTCAATGTATAGTTTTCTTCAAAACATACTGCTGTACACACAACTTTTACACATAAATGTTACTCTTGGTACAAGCTATTTTTCTATAAATACAAGAAGTTTTGTGGCCTAAGTTTTCATATTTTCTCTTATTATGTATAATCATGTATATATGATCAAATCATATATGATCTGCTGTCTGCAAGTTAGAGAACCAGAAAAGCTAGGGGTATCGATTATGGGACTGACAACTGGAGAAACAACGATGTAGATTTTAGTCCAGGTTTGAAGGCATGAGAACAAGAAGCTGCAAAGGCAGGAAAACAACAATGTCCCATTTTAAGCAGTCAGAAGAAGACAGAGGGAAAATCCAATCTTTTTTCTTTCTTTTTTGGTTCTATTCAGGACCTCAAAATAATAGAACCAAAATGGGTGGCCAATGAATGATGCATTGAGGTAAGACTAGTGCACCAAATGCTCTATTAGTCCATTTTCACACTGCTATAAAGAACTTCCCTGAGACTGGGTAATTGATAAAGAAAAGAGGTTTAATTGACTCACAGTTCTGTGTGGCTGAGGAGGCCTCAGGAAACTTACAGTCATGGTAGAAGGGGAAGCAGGCACCTTCTTCACAAGGCAGCAGGAGAGACAGAAGTGTGTGTAGGAGGAAATGTCAAACACTTATAAAACCATCAGATCTTGTTAGAACTCACTATCATGAGAACAGCATGGGCAAAGCCACTCCATGATCCCATCACCTTCCACCAGGCCCTGCCCTCAACATATGGGGTTTATGGGGTTTACCATTTCAGATGAGATTTGAGTGGGGACACAGAGCCAAACCATATCAAATGCTGAATAAATTTGTTTGAAAAAGACTCTTTTCATTTAAGCTGGATAATTTACTGACCAGACAACCATAAGGTAAAATTTGAACACTCACAGAATGAGTCCGTGACATTATTCTCAGTGCTATAAGGCTTGTATTCACCTTGGGGTGGCAGAGGATGTGGGTCTTTTTATGATTCTGAATAGTTTGACAGCTACTAGATGTTGCTTGTTAAACAAAACCTGACTTCTAGGGATGACATCTATTATCTGTATTTTCTTGACATGGCTACTGGGGCTTGTGGCTATTCATCCATTAGTTATCTGTCACATGTAAGTAGATCCTTTTTCCATAAAAGTTACATTCCTAGCACATTTGTTGCGACTTTCTCCACTGTGCTGTATGACCCTGTCACATCTGCATGCAGCTCCTATTTCAATACCAAGTTGATGTGTGCTGCTGTTGCTTTTTGGAAGCATCCAGTCAATGTTTTCTACTAAACTATTTCTTAAAAACTGGCAGGAAGAGATAATGCCTCATTACATTCCGTTCTTGTCCAACTCAATGGAAAACACAATAACCTACTATTTGTTCTGAAACACCTACTGGTAAATTGAATCAGTGTATTAAAAACTGAGCTACCTCTCCATTTCTTTTAAAACAACTGGTACCTTGATAACTTCGTATAGCATACATTATACGAAGTTATCAGGGTTACCGAGCTTGGTCCACTTTCTTGAGCACATTTGATTGAAATCTATGATTTACTTTGCCATAGTTTTGTGTGTAGAGTTGATACTTTACTGATATATCAATATAACATGCCTTGCTAATGTGCAGACTTGATGTATTTGGACTAATTGGTTTTGGTTTTTGTTTTCCAGCTGGGACGACATATATCTTTAGCAAAGGTGGTGGACAAATCACGTATAAGTGGCCTCCTAATGACCGACCCAGTACACGAGCAGACAGACTGGCCATAGGTTTTAGCACTGTTCAGAAAGAAGCCGTATTGGTGCGAGTGGACAGTTCTTCAGGCTTGGGTGACTACCTAGAACTGCATATAGTAAGTACTTTTTGCATAAGATTCAGCTTTTACTTCAGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGATACGTAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAATGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCCTAGTCCATAACTTCGTATAGCATACATTATACGAAGTTATTCTGGATCCTT

 

TACTGTTAACTTTTTGTAAAGAATTTATAATTTTGCTTCTTGGATGCTTCCTTCCCCCAGAAACCAGTACTTTGTTATAGGAAATATGAATACAATCTAGAGGAAATAAGACCATATACCTATTGCTGTAGTTAATCGCGTTCTTTACAATGCAAACTTTTTTTTTTTTTTTTTGGAGTGTGAATTCCTCTTAATTCTGTGTTCAAAATAATTTTTAAAAAAATTTTGGAGTGATTTTAGTGTCTTTAGGCAGACTTGCCAAATGAATAAAATAAGTTATTGCCTAGTAGATACCACACCATCTGGCTGGAAGCAGGAGGTTGTAATACTGGTGACATCCAAAGATCTGGATTCTGTCTTTATTTCTTTGCTCACTAGAGAAAGTACTTATCTGAAGCTACATGAAATAAAAGGAACGAAAGTATACTTTAAGGATACTTGGGGATGTGAAACAAGATGGCAAAAAGATTGTTTCTGTGCCATTTTGTACTCATTTTGATACGTGTCAGGAAAATACATTTTAATTCATAATTACCACTTACATCCTGGGCCCATTCTCTTTTCTCTAAAGTTGTAAGCCTCCCACAGTAATTTACTCAGCATATAATAGATAGCAAAGAATAGTCATGAATGAAAAACTTCATTTTCCTTTGAAAGTTGCCATAATTAACTTTAGGGTTCAGGGGCACTTATTTCTCTGCATTTTAAAAATTATTAATGAGTATGTTTGCAACTCTTTAAATCTTCATTTTCTTGCATTATTTGTAAAGAAGCACAGTGTCTTTTATTAAGAGATATGAATATTTTATTGATATATCCAAAAAATCGTAGTGTGTCACATATTCAAAAACTTTTCTAAAGGGTTCTTATTATCATAGTTCTTGGTCTAAAGTCTATCTTTTGGAAGATTTCAGAAGAAACAGGTAAGTCTCCCCATCCTCTTTTTTATCCTTGAGGTTCTGTTTATTTCCCATGCATTAAGCGACCATGGAAGTTTGTTCTATTTTGTTTTGTCTTTCCCTATAAGTTCTCCTTCTATCAGTGCTCACTCTCCAAAGGACATTTGATTAGGTCATCATGTTCTTTCCTGTTAGAAAGTGGTCATCGGGTACCAGTTCTAAAATAATTAAGAAAAACATGAAACACCAAAGTACATTAGCACAAACTTTTACAAGTTTTTAATTCTCTGTTTTTATTAAACTATTTTCTTAATCTTAATTTTGCCTTAGAATTCTGGAATTTCACGCGTGGTACCGGTAACCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGC

 

CTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT

AAV-cTr CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTCATATGTAATAACATAATAAGCGTGCATGAAAATTTCCCAATGATTGCATCTATGCCCTCTTGTTTTTGTTTTGAAATTTTGTGTGAAAACGTGCCTTATATTTCACATTTTTGAAAATAAGGCCTCCATACTTTTTTTTCCTCTCTCACAACCAGAAAGGGGCTTTTTGAATGTGTTCCTACACAAGTCTTCAAAAAAGCCAGCACTTTGTTTCAAATGCAAGTTCCAACCACTGCTCCAGTTGCACCAGGCGGCAAACTCTTAAAGGTTTGCAGGTTGAGTCACTCAAAAGGACAGTCTTCTCTGGCAATTGGACTGACTTCTCAGGAAAGCGCTAGCACTTTGGCTAAATCCAGGATCATAGGTAGCTTCTTTTTTGTGTTATGTTTTGTGTTGGTTTTTGTGTTGTGCCTTGATGCTGTAGTACTCCTTTGCTTTATGAATGCGTGCGGTCATCACTGTCTTTTAGAAATGTTCCAGCAACATAAAGACAAGCAGAGTAAATGAAAACACTGTGGATGTTAGGGAATTTATTGGCCCCTGTTTTTTGTTTTTTGTTTTTCTTTTTTGAGAAACAAGAGCATGAGATACTTGTTTTTATTTTTTAAAAAGTCTTTCCTTCCTGATTGCATTCCCTGTCTTCTTTTGTATGTGCTTCATAAAAAGGAAAGTAAATAAGTTTATATTATGTCTCAGATAAAATGAAGACTATTTCTATACAAGTGTCCATTTAAGATCTTGGGATCAGACATAATACTCTTTATCCTTGTTTTTCTTATTTTTGTTGGAGCTTTTCGCACTGCTGGGTTGTTTCTCCTTTACAACAGCCCCATTGGACTGTGCTGAGTTACTGATGTAGTTTCGACTCTCGTCCACATGGTATGAGCCTTCATCCCGGTTTCTGTACTTGTACATGGCATAGAGGAGGATAAGGATGCACAGGGCGGCAGCGGCTACTATCCCAACGACCATACCCGTGGTGCTGCTGGACTCCCGGATCACTTCTGCTGAGCCTGGATACGGCTCTCTGCCGCCTGCTCGGGTTGGGTTGTTGGATAACTTCGTATAATGTATGCTATACGAAGTTATGAAGGGTTCCGCAAGCTCTACCTAGGCTTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGTGATTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTACGTAGGGCCCTCAGGCACCGGGCTTGCGGGTCATGCACCAGGTGCGCGGTCCTTCGGGCACCTCGACGTCGGCGGTGACGGTGAAGCCGAGCCGCTCGTAGAAGGGGAGGTTGCGGGGCGCGGAGGTCTCCAGGAAGGCGGGCACCCCGGCGCGCTCGGCCGCCTCCACTCCGGGGAGCACGACGGCGCTGCCCAGACCCTTGCCCTGGTGGTCGGGCGAGACGCCGACGGTGGCCAGGAACCACGCGGGCTCCTTGGGCCGGTGCGGCGCCAGGAGGCCTTCCATCTGTTGCTGCGCGGCCAGCCGGGAACCGCTCAACTCGGCCATGCGCGGGCCGATCTCGGCGAACACCGCCCCCGCTTCGACGCTCTCCGGCGTGGTCCAGACCGCCACCGCGGCGCCGTCGTCCGCGACCCACACCTTGCCGATGTCGAGCCCGACGCGCGTGAGGAAGAGTTCTTGCAGCTCGGTGACCCGCTCGATGTGGCGGTCCGGATCGACGGTGTGGCGCGTGGCGGGGTAGTCGGCGAACGCGGCGGCGAGGGTGCGTACGGCCCTGGGGACGTCGTCGCGGGTGGCGAGGCGCACCGTGGGCTTGTACTCGGTCATGGCGCGCCGCTGCAGGTCGAAAGGCCCGGAGATGAGGAAGAGGAGAACAGCGCGGCAGACGTGCGCTTTTGAAGCGTGCAGAATGCCGGGCCTCCGGAGGACCTTCGGGCGCCCGCCCCGCCCCTGAGCCCGCCCCTGAGCCCGCCCCCGGACCCACCCCTTCCCAGCCTCTGAGCCCAGAAAGCGAAGGAGCAAAGCTGCTATTGGCCGCTGCCCCAAAGGCCTACCCGCTTCCATTGCTCAGCGGTGCTGTCCATCTGCACGAGACTAGTGAGACGTGCTACTTCCATTTGTCACGTCCTGCACGACGCGAGCTGCGGGGCGGGGGGGAACTTCCTGACTAGGGGAGGAGTAGAAGGTGGCGCGAAGGGGCCACCAAAGAACGGAGCCGGTTGGCGCCTACCGGTGGATGTGGAATGTGTGCGAGGCCAGAGGCCACTTGTGTAGCGCCAAGTGCCCAGCGGGGCTGCTAAAGCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACCCGGTAGAGCGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCACACCTAGGGTCGAGCCCCAGCTGGTTCTTTCCGCCTCAGAAGCCATAGAGCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTCAGACAATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGGGGGAGGGGCAAACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGAGCTCTAGAGAATTGATCCCCTCATAACTTCGTATAATGTATGCTATACGAAGTTATAGCATAGTCAGGTACGTCGTAAGGATAAGCGTAATCTGGAACATCGTATGGGTAGGCTATAGAAAAGAGGATGAGAACAAACACAAAAACGTGATCATTGAGTTCACTGAATACCAGAGAGCTATATTAACATTTATTATCTAATTCTAACAGCACCTATGCTTTAGGAAAGGTATGCTATTGATAAATGTAGCCATCCCTTTGCCTCATGGTTACTAAAAACTAGGGACTGTGATTTAAAGTTCTCTGGGAGATTTGTTGCTGTGTCTTCTTTCTTCACAAATCAATTTTGTTCACAGAGTTTGGTAAGCATTGTCCCAAATAAACTCCAATTAGCTCTAAAGGGCCATGTGGGTGACTTAAGTAAAAAAAACCCACAAACCCAGCATAAAGAAAAGCAGAACAGCCCTACCCTATAATACTAGAGGGAATCATAAGAATCAAATAGGTGTTGCTCTAGAACATAGGTCTAACTCTAGAC

 

TGAATCAGGACAACTAAATTTAGGATTACTTTAGAAATCATATTCCCCTTGTATTTTAAAGAATACAGTATTGAACAATAAGATAATCCATACATTTTAACTGTCTGCTTTTTAAAGTATAACTTTAGTTACATTTTTATAAATAAAAATAGACTAATTTCCATTTTGTTGGAGATTCATTTGTTTACATAAGTATGTGTGTATTTTATTAATTGATTGGGGAGCTCCCAAGATGAACTTTGGAGGAGAAAGTAATAAAATATTCTTTCTCAGTTTTAAATACAGTCTAGATTGATTTTTTGGTCAAAACTCTGAACTACCTAATAGATTAGATAATAATAGAAGGCTGGCTAGTCTAGTTTTATTCAACTGACAAAACCCTTCTTCAGTCTTCCCAAAGTATAAATAAGGCTCTTTCTTGGATGAGACCAATGGATTTTGGGGTGCCTACGTCTTCTTGAAGGCCTGGTCAGGCACTGAAATTGATGATTGATGGGGAAGAATGGACCTGAGATTTAATTGGTAGATATGAGGAGAAGGGGCAGCTCTTTTCCCCTATATATAATAAACTTTTTTGATATAAAAGGATAGAAACTGTAGCGAGAGAAGAAGATTCTATCCTACTCTGACTGTAGGTCATTTTTTCCTTGTGAATTGTGTTTTCTGTTTTTCCCTGAATCTCTATCCTCTCGCTTGTCTTACATAAAAATATTACTTTTCAGATGTAATGTATTAAAAATGCTACAACTTTCAAAACACTATTCTTTGCCAATTATGTATAATGAACAAATAATCTCATGAGGTACCGGTAACCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT

 

SUPPLEMENTARY REFERENCES

Chen, C., and Okayama, H. (1987). High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745–2752. Franke, B., Figiel, M., and Engele, J. (1998). CNS glia are targets for GDNF and neuturin. Histochem Cell Biol. 110:595-601. Kaeser, P.S., Kwon, H.B., Chiu, C.Q., Deng, L., Castillo, P.E., and Südhof, T.C. (2008). RIM1α and RIM1β are synthesized from distinct promoters of the RIM1 gene to mediate differential but overlapping synaptic functions. J. Neurosci. 28, 13435–13447. Kaeser, P.S., Deng, L., Wang, Y., Dulubova, I., Liu, X., Rizo, J., and Südhof, T.C. (2011). RIM proteins tether Ca2+ channels to presynaptic active zones via a direct PDZ-domain interaction. Cell 144, 282–295. Maximov, A., Pang, Z.P., Tervo, D.G., and Südhof, T.C. (2007) Monitoring synaptic transmission in primary neuronal cultures using local extracellular stimulation. J Neurosci Methods 161:75–87. Ungrin, M. D., Joshi, C., Nica, A., Bauwens, C., and Zandstra, P. W. (2008). Reproducible, Ultra HighThroughput Formation of Multicellular Organization from Single Cell Suspension-Derived Human Embryonic Stem Cell Aggregates. PLoS ONE 3, e1565.