Bonus Points 2011

www.downies.com

PO Box 888Abbotsford Vic 3067

Fax(03) 8456 8401

[email protected]

Shops 11 & 12Block Arcade98–100 Elizabeth StMelbourne Vic 3000

Tel(03) 8677 8888

Fax (03) 8677 8890

Email [email protected]

Shop 5Town Hall SquareSydney NSW 2000

Tel(02) 9299 4131

Fax (02) 9261 4199


Bonus Points Reward

Catalogue 2011

Please note: products may be shown smaller than actual size

www.downies.com2

1857–70 Sydney Mint Sovereign Fine

Gold Rush history you can hold in your hands, the Sydney Mint Sovereign series represents Australia’s fi rst gold sovereigns. A short-lived type, bearing highly distinctive designs, the importance, beauty and history of these 22-carat gold coins have made the series one of Australia’s most popular. We have the 1857-70 Sydney Mint Sovereign Type II available in Fine – dates of our choice.

Usually A$695 US$643 AB953

1893–1900 Veiled Head Half Sovereign VF

A powerful reminder of the last days of the Victorian Age, struck for just nine years from 1893 to 1900. The last half sovereign type issued for Britain’s longest reigning monarch bears the distinguished Veiled Head obverse portrait, united with the awe-inspiring St George and the Dragon reverse design by Benedetto Pistrucci. Date and Mint of our choice.

Usually A$395 US$355 AH329

GB 2010 Half Sovereign Gold BU

Continuing a series that began in 1817 during the reign of George III, Britain’s 2010 Gold Half Sovereign represents an eminently historic, highly prestigious addition to any collection. Produced using dies from 1893, when the St George design was fi rst seen on the denomination, this distinctive 19.30mm, 3.99g, 22-carat gold coin is available in superb Brilliant Uncirculated quality.

Usually A$329 US$280 AQ657

A397,000 Points US367,000

A225,500 Points US208,500

A188,000 Points US174,000

Aussie Gold!

www.downies.com 3

A14,500 Points US13,500

A7,500 Points US7,000


A25,000 Points US23,000


1927 Canberra FlorinAve Circ

Honouring the opening of the new Parliament House in Canberra, this one-year-only sterling silver coin was Australia’s fi rst commemorative and is arguably our most beautiful coin. Usually A$24.95 US$24 AP358

1951 Federation FlorinAve Circ

Struck from silver, this unique King George VI predecimal commemorative celebrated the 50th anniversary of Australian nationhood – achieved at Federation in January 1901.Usually A$12.95 US$12 AP359

1954 Royal Visit FlorinAve Circ

This unique silver coin commemorated the fi rst Royal Visit to Australia by Queen Elizabeth II in 1954 – the very fi rst time a reigning British monarch had toured Australia. Usually A$12.95 US$12 AP360

1937 Crown F–VF

Australia’s largest circulating coin, struck only in 1937 and 1938, this massive King George VI Five Shillings issue measures 38.50mm in diameter and comprises nearly one ounce of sterling silver!Usually A$44 US$41 AL763

Gold-plated Australian Halfpennies (bag of 10)A unique addition to your collection, and a great gift idea, each bag comprises ten genuine Australian predecimal halfpennies, with each coin plated in real 24-carat gold! Usually A$9.95 US$9.25 AP073

Classic Predecimals

www.downies.com4

A20,000 Points US18,500

A17,000 Points US15,500


A11,500 Points US10,500

1922 Penny London & Indian Die Pair

Highly regarded by serious predecimal collectors, this seldom seen 1922 pair comprises a penny struck with a London die and a penny struck with an Indian die – dies distinguished by the position of the rim beads relative to the obverse inscription. In highly collectable Fine condition.

Usually A$34.95 US$33 AO988

1926–28 Florin Trio Ave Circ

The last three fl orin dates before production was halted due to the Great Depression, the 1926, 1927 and 1928 fl orins are typical of all George V coinage: issued in low numbers, highly sought after and – with a huge number melted for the silver over the years, or simply lost – very scarce today.

Usually A$30 US$28 AR834

1959 Sixpence EF–aUnc

Struck at the Melbourne Mint, and among the higher cataloguing Elizabeth II 6d issues, the last sixpence date of the 1950s is a fi ne acquisition for the predecimal collector – especially when found in premium grade Extremely Fine to about Uncirculated condition, as here.

Usually A$10 US$9.25 AQ135

1964 Penny Pair Unc

An historic duo, this pair comprises Australia’s last predecimal penny dates – the 1964Y 1d from the Perth Mint and the 1964 1d no mintmark from the Melbourne Mint. As good as the day they were struck, both fi nal date pennies are available in superb Uncirculated condition!

Usually A$19.95 US$18.50 AR835

More Aussie Classics!

www.downies.com 5

COICOIOIOIOCOIN SN SN SN PECPECPECPECPECPECIFIIFIIFIFIFIFICATCATATCC IONIONIONSSSWeiWeiWeightghtghtghtght:: :: : 9 g9 g9 g9 gg9 gramramramramramrams s sss DiaDiaDiaDiaD metmetmeter:er:er: 2525 25 mmmmmmmmMetMetMetMetMeMM aaal:al:al: AluAlAluminminminiumiumiumiumiumi Br BrBronzonzonzonzonzonzeeeeeRevRevRevRevRevveversersrse:ee:: 22 2 0100010 $1 $11$1$1$1$ 15 150th0th00 An AnAnnnnivnivnivnnivnivversrsersserssersersaryaaryaararya B Burkurkurke &&&e &e & Wi Willsllsl ExExx iObvObvObvObvbvbverserserse se De De eyeyMininininMinntatagtagtagtat e: e:

CoinCoinoioiCCoinoi strstr strtrruckuck uckPackPackPackckPa kagedagedagedageagedage by by

2010 $1 150thth Anniversary Anniversary BURKE & WILLS ExpeditionExpedition



A11,500 Points US10,500

A23,000 Points US21,500

2006 5c & 10c Proof Pair

Defi ned by sharp, frosted designs, set upon fl awless mirror fi elds, this 5c & 10c pair gives you the unusual opportunity to enjoy Australia’s traditional motifs struck to Proof quality. Usually A$15 US$14 AP993

2010 $1 Burke & Wills Al-Br Unc In Pack

Not issued for circulation, this offi cial $1 portrays John King – the sole survivor of the 4-man Burke & Wills party that attempted to reach the Gulf of Carpentaria in 1861. Usually A$14.95 US$14 AR536

2006 20c Proof

A fantastic opportunity to enjoy Stuart Devlin’s iconic platypus design struck to the highest possible standard, we have the RAM’s 2006 Platypus 20c available in utterly fl awless Proof quality. Usually A$19.95 US$18.50 AP994

2009 $1 Centenary Of Age Pension Mint Roll Unc (20)Housed within distinctive, offi cial RAM packaging, each Mint Roll comprises twenty strictly Uncirculated examples of the unique, one-year-only Centenary of Age Pension $1.Usually A$39.95 US$37 AQ428

Dynamite Decimals!


1966 1c & 2c Pair EF–aUnc

Issued at the beginning of the decimal era in 1966, Australia’s very fi rst 1c and 2c dates are a fundamental element of every Australian collection – especially in premium grade EF-aUnc as here!Usually A$6.95 US$6.50 AP117

vObvbvvbbvbvvvvvvvbbvbvbvbvvbversseerrr e De e DDDeee eyyyeyMinMinMinMinMinMininnniiiiiiiinnnnnnnniiiiiiiiinniininnnninininiinniiiinnnniiMMMMMiinininiiiiMMMM nMMMMMiM nnnnnn ggggttagtagtagtagtagagtagagttaattagt gaaagagggaaaggggaggggaaaaaataagagaggttttatatataggtttttttt e::e: :eeeee:ee:eeee::

CCCCoCoinCo nnoiniooC innoiiCCoinnCCC iCCoiiiiiiioiiooiiC iCCCoo noiiiCoioiooi strrrrtrrrrtrrrtrtrrttrrt s rtrrtrrrrtrtrtrrruuckuuuccckuucPackkkkkkkkkckkkkkkkPPacckackcP cackPaaP kckckkkkkkckkP kagedgagedagggaggeddgggggggggggegeeaaaa edagagagggggeagagaggggagaaagagegg dggeegeeggggggggggeeegege bybybybyb

3

www.downies.com6

A11,500 Points US10,500

A25,500 Points US23,500

A11,500 Points US10,500

A57,000 Points US52,500

2008 Two-Coin Unc Set

An offi cial celebration of the International Year of Planet Earth, this eye-catching 2008 release comprises an imaginatively designed $1 and traditional platypus 20c coins – neither of which can be found in your change! Usually A$15 US$14 AN124

2010 Baby Mint Set

The perfect way to mark the arrival of the 2010 baby, this 6-coin set (5c-$2) is housed in a RAM pack with a 27mm Blinky Bill medallion. Includes unique $1 depicting Blinky Bill author Dorothy Wall! Usually A$45 US$42 AQ517

2010 Two-Coin Unc Set

Comprising two ‘not-issued-for-circulation’ Australian legal tender types – $1 and 20c – this beautifully presented release marks the 150th anniversary of the ill-fated Burke & Wills Expedition of 1860.

Usually A$19.95 US$18.50 AQ511

2009 ANDA Show Sydney & Melbourne Mint Set Pair

Released at the Melbourne and Sydney ANDA Shows, these offi cial RAM Mint Sets (5c-$2) both feature a special ANDA Show Overprint. Exclusive – just 1,500 of each set issued!

Usually A$99.90 US$93 KC786

Super Special Sets!

www.downies.com 7

A11,000 Points US10,000

A15,500 Points US14,500

A71,500 Points US66,000

A14,500 Points US13,500

A51,000 Points US47,000

2006 $1 Melbourne Commonwealth Games M Mintmark Unc

Presented in an attractive, offi cial pack, this offi cially endorsed Melbourne 2006 Commonwealth Games $1 was not issued for circulation and cannot be found in change. Usually A$19.50 US$18.25 AL560

Tuvalu 2007 50c Grand Sumo Tournament Al-Br BU

Honouring the 2007 Grand Sumo Tournament in Hawaii, this 38.61mm 50c BU coin from the Perth Mint is set in an offi cial souvenir card from this major international sporting event.Usually A$27.50 US$26 AQ267

2009 $1 1852 Adelaide Assay Offi ce Gold Ingot Silver & Gold Proof

A unique tribute to Australia’s fi rst gold coinage – the 1852 Adelaide Ingot – this 40mm coin is struck from 1oz .999 silver and fi nished in .9999 gold. Mintage a tiny 5,894!Usually A$125 US$116 AP617

2009 $1 Kangaroo Cu-Ni Unc

Designed by legendary Australian modern artist Ken Done, and beautifully presented in an offi cial pack, the 38.74mm Australian legal tender 2009 Kangaroo $1 forms a fi ne tribute to our primary native icon. Usually A$24.95 US$24 AO873

2009 Lunar Ox 1oz Silver Proof

Struck specifi cally for the Asian market, with few retained in Australia, the RAM’s 40mm Year of the Ox $1 is crafted to immaculate Proof quality from 1oz .999 silver. Housed in a case with Certifi cate.

Usually A$92.50 US$86 AP618

A Fine Selection…

fi ce

of

8

www.downies.com8

Tuvalu 2010 $1 Great River Journeys 1oz Silver Proof Collection (5)A stunning tribute to the world’s most famous rivers – Nile, Volga, Rhine, Mississippi and Yangtze – this set comprises fi ve 40.60mm .999 silver Proofs. Mintage just 1,500!Usually A$499 US$462 AQ5688

A74,500 Points US69,000

A61,500 Points US57,000

A57,000 Points US52,500

A285,000 Points US263,000

A51,000 Points US47,000

2009 Masterpieces In Silver Set

Comprising two large, weighty 38.74mm 36.31g .999 fi ne silver Proofs, this offi cial RAM issue honours two of Australia’s most famous passenger aircraft – the De Havilland DH86 and the Constellation L749. Usually A$130 US$121 AQ437

Cook Islands 2009 $1 First Space Walk Orbital 1oz Silver Proof

Featuring an outer ring that literally revolves 360 degrees around the central depiction of the Earth, this 38.79mm 1oz .999 silver Proof honours the fi rst space walk, in 1965.Usually A$107.50 US$100 AP452

Tuvalu 2010 $1 German Reunifi cation 20th Anniversary 1oz Silver Proof

Graced with an explosive full-colour design, this 40.60mm 1oz .999 silver coin marks the 20th anniversary of the union of East and West Germany. Just 5,000 issued worldwide!Usually A$99.75 US$93 AR316

2010 $1 Kangaroo At Sunset F15 1oz Silver BU

Bearing a design nominated for Peoples Choice Coin of the Year, and exclusive with a mintage of just 7,000, this stunning .999 silver 1oz is set in a case with a Certifi cate.Usually A$89 US$83 AR103

A Cracking Cache Of Crowns!

2

of

ys

www.downies.com 9


A1,425,000 Points US1,318,500

A43,000 Points US40,000

A39,500 Points US36,500

A60,000 Points US55,500

2009 $1 Celebrate Australia New South Wales BU

An offi cial Australian legal tender $1 type, and a brilliant example of full-colour minting, this unique tribute to NSW is set in an attractive, offi cial Perth Mint card.Usually A$14.95 US$14 AP976

2010 $25 Kangaroo In The Outback 1/5oz Gold Proof Trio

Restricted to a mintage of just 1,000, this prestigious Australian legal tender set comprises three 21.69mm 1/5oz .9999 Gold Proofs – housed in a timber case with Certifi cate.Usually A$2,495 US$2,308 AR230

2010 50c Australian Sealife Clownfi sh 1/2oz Silver Proof

With the mintage of 10,000 sold out at staggering speed, this eye-catching full-colour 36.60mm 1/2oz .999 fi ne silver tribute to the Clownfi sh is a rare catch.Usually A$75 US$70 AQ703

2010 50c Australian Sealife Moray Eel 1/2oz Silver Proof

An electrifying conclusion to the Perth Mint’s Sealife Series, the 10,000-coin mintage of this unique 36.60mm 1/2oz .999 silver tribute to the Moray Eel sold out at super speed.Usually A$69 US$64 AR132

2011 $1 Lunar Rabbit 1oz Silver Proof

Measuring a massive 45.60mm, this glorious 1oz .999 silver tribute to the Year of the Rabbit is limited to a mintage of just 5,000 coins – each set in a case with a Certifi cate.Usually A$105 US$98 AR512

Gold, Silver & Full-Colour!

2

www.downies.com10

NPA Training Note $2–$100 Set (6)

Issued by the Note Printing Branch of the Reserve Bank of Australia during the 1980s for banks to train tellers, this 6-banknote collection from the $2 to the $100 looks and feels exactly like real decimal paper notes! In perfect, unused Unc condition.

Usually A$9.95 US$9.25 AK824

A20,000 Points US18,500

A28,000 Points US26,000

A100,000 Points US92,500


1893 £100 James McEwan & Co Debenture

Forming a unique link to one of the big names in Australian commerce history, this £100 Mortgage Debenture was issued in the late 19th century for the hardware giant, McEwans. Large, hand-signed and perfect for framing!

Usually A$49.95 US$47 AL750

10/- R17 Coombs/Wilson QEII Reserve Bank Fine

Offering a tangible connection with the Australia of half a century ago, this short-lived type was the very last Australian 10/- note. Issued under the auspices of the Reserve Bank only from 1961 to 1965, each note is in Fine.

Usually A$49 US$46 AL088

£10 R63 Coombs/Wilson QEII Reserve Bank Fine

Issued from 1960 to 1965, Australia’s fi nal £10 type is highly sought after. The highest circulating predecimal denomination, rarely set aside at issue, the 1961-65 Coombs/Wilson Reserve Bank £10 can be tough to fi nd.

Usually A$100 US$92.50 AE018

Banknotes & Ephemera…

www.downies.com 11

USA $1,000,000 Fantasy Note Unc (pack of 10)Giving you or someone you know the chance to be a millionaire, these fantasy one million dollar USA banknotes are a fascinating collectable, and an original gift idea. Available in packs of ten, or as a bundle of 100 Uncirculated notes!

Usually A$12.95 US$12 AJ024

ALSO AVAILABLE

USA $1,000,000 Note Unc (bundle of 100)

A57,000 Points US52,500

Usually A$99.50 US$93 AL120

World Banknotes 50 Different Unc

A fantastic way to start a collection, this set comprises 50 different banknotes from 50 different countries – with every note in Unc!

Usually A$29.50 US$28 AM700



Famous Personalities Banknote Set (5)Five notes depicting Guevara (Cuba), Nefertiti (Egypt), Hussein (Iraq), Bolivar (Bolivia) & Ghandi (India).Usually A$20 US$18.50 AQ587

Zambia 1,000 Kwacha Polymer Unc

In strictly Uncirculated quality, Zambia’s 1,000K is a must-have for any polymer banknote collector.Usually A$10 US$9.25 AJ527

Vietnam 10,000 Dong Polymer Unc

From yet another convert to the polymer revolution, Vietnam’s 10,000D bears the portrait of Ho Chi Minh.Usually A$9.95 US$9.25 AM097

Notes From Around The Globe…

(p )


A17,000 Points US15,500

00)

A11,500 Points US10,500

www.downies.com12

Marco Polo Historical Coins Along The Silk Road Collection (9)A unique keepsake of Marco Polo’s journey along the Silk Road, this 13th century 9-coin set is housed in an informative, illustrated folder that maps out Polo’s famous adventure!Usually A$495 US$458 AQ157

A21,500 Points US20,000

A14,500 Points US13,500

A11,500 Points US10,500

A51,500 Points US47,500

Celtic Bronze Ring Money

Giving you the chance to hold the history of the Ancient Celts in your hands, these genuine, original Celtic rings (15mm-25mm) were used as currency from around 800BC to 600BC. Perfect for use as jewellery!Usually A$37.95 US$36 AO878

Denmark 2004 20 Kroner Wedding Al-Br BU

One of few Danish commemoratives, this unique legal tender coin forms a lasting keepsake of the Royal Wedding of Prince Frederik of Denmark and Australia’s own Mary Donaldson.Usually A$24.95 US$22 AJ869

Eurozone 5c Coin Set Unc

A fi ne memento of the greatest monetary reform in European history, this set comprises a 5 Euro Cent coin from each of the original twelve Eurozone member nations – set in an attractive, full-colour pack.Usually A$19.95 US$17 AH069

Kazakhstan 2008 100 Tenge Genghis Khan Silver Proof

Paying homage to one of the world’s most famous historical fi gures, this 38.61mm gold-plated 1oz sterling silver coin honours Genghis Khan – founder of the great Mongol Empire.Usually A$90 US$77 AP267

A World Of Coins…

.

gg

A283,000 Points US262,000

www.downies.com 13

NZ 2010 $1 Ancient Reptiles of NZ 1oz Silver Specimen Collection (5)Comprises fi ve 40mm 1oz .999 fi ne silver Specimen coins in a leather case – also features a set of matching stamps and a numbered booklet confi rming the 1,500-set mintage. Usually A$495 US$458 AQ981

A198,000 Points US183,000



A45,000 Points US41,500

Belgium 2009 2€ Louis Braille Unc

One of few legal tender coins to feature readable Braille, this offi cial Belgian 2€ commemorative marks the 200th anniversary of the birth of the inventor of Braille – Frenchman Louis Braille (1809-52).Usually A$9.95 US$8.50 AQ572

Finland 2005 2€ Bimetal Unc

Bearing a brilliant design highlighted by the Dove of Peace, this one-year-only type marks the 60th anniversary of the creation of the United Nations – and the 50th anniversary of Finnish membership.Usually A$9.95 US$8.50 AL319

France 2008 1.5€ Grand Canyon Silver Proof

Capturing the breathtaking beauty of one of the world’s most famous sites, this 37mm 22.20g 90% silver coin forms a dramatic tribute to the Grand Canyon. Just 5,000 struck!Usually A$79 US$68 AP064

France 2008 1.5€ Paris–Tokyo Silver Proof

Set in an offi cial Monnaie de Paris case with a numbered Certifi cate of Authenticity, this 37mm 22.2g 90% Silver Proof celebrates the strong bond between France and Japan. Usually A$79 US$68 AO506

A World Of Coins…

Z )

A45,000 Points US41,500

Unc

www.downies.com14






2010 $1 Burke & Wills PNC

Featuring a unique Australian $1 coin type, united with an Australia Post 60c stamp upon a brilliantly illustrated offi cial cover, this PNC forms a compelling memorial to the 1860 Burke & Wills Expedition. Usually A$17 US$15.75 AR381

2010 $1 Shanghai World Expo PNC

Highlighted by two Australia Post 55c stamps, this offi cial Shanghai World Expo 2010 keepsake is headlined by a unique Australian legal tender 30.60mm $1, bearing a design refl ecting the Year of the Tiger.Usually A$17.95 US$16.75 AR139

2009 $1 Postal Service Bicentenary PNC

Celebrating the 200th anniversary of Australia’s postal system, this PNC features a superb full-colour 30.60mm Australian legal tender $1 united with an Australian 55c stamp.Usually A$17 US$15.75 AP685

2008 Hawthorn Premiers Medallion PNC

A unique tribute to Hawthorn’s stunning victory over Geelong in the 2008 Grand Final, this limited edition PNC features a 55c stamp and a large 38mm full-colour medallion!Usually A$12 US$11.25 AR093

2009 Colour Dolphins Medallion PNC

Honouring one of Australia’s most admired aquatic inhabitants, this offi cial Australia Post release is highlighted by a 55c stamp, plus a full-colour 38mm Dolphin Medallion! Usually A$12.95 US$12 AR095

PNCs On Parade!

www.downies.com 15

A14,500 Points US13,500

A56,500 Points US52,500

A62,500 Points US58,000


A57,000 Points US52,500

GB 2010 Great Album Covers Presentation Pack & Souvenir Sheet Pair

Uniting a 10-stamp souvenir sheet with an LP-shaped 10-stamp presentation pack, this offi cial British Royal Mail issue honours Britain’s most highly regarded album covers.Usually A$24.95 US$22 AR267

Vatican 2005 Pope FDC Set (6)With each First Day Cover (FDC) distinguished by an offi cial Vatican stamp, this historic set charts the changing of the Papal guard, from the demise of John Paul II to the selection of Benedict XVI.Usually A$99 US$92 AK662

2008 Beijing Olympic Gold Medallist Stamp Album

Housed in an informative bound book with matching slipcase, this limited edition set (just 15,000 issued!) features an MUH example of every Australian 2008 Olympic Games stamp! Usually A$109 US$101 AP119

Australian Stamps 1932 Harbour Bridge Pair

An authentic keepsake of one of Australia’s fi nest engineering triumphs, the 2d and 3d were issued to commemorate the completion of the famous Sydney Harbour Bridge in 1932.Usually A$14.95 US$14 AR836

2010 Australia Post Year Collection

An outstanding presentation, this offi cial Australia Post release comprises an MUH example of every stamp issued in 2010, housed in a deluxe album – 83 stamps, seven minisheets and one sheetlet.Usually A$99.95 US$93 AR811

A Philatelic Feast!

www.downies.com

PO Box 888Abbotsford Vic 3067

Fax(03) 8456 8401

[email protected]

Shops 11 & 12Block Arcade98–100 Elizabeth StMelbourne Vic 3000

Tel(03) 8677 8888

Fax (03) 8677 8890


Shop 5Town Hall SquareSydney NSW 2000

Tel(02) 9299 4131

Fax (02) 9261 4199


Renniks Stamps of Australia 12th Ed.

Covering stamps from 1913-2010, Renniks 12th ed features 2,000+ colour photos and up-to-date valuations.

Usually A$19.95 US$18.50 AR770

A11,500 Points US10,500

A20,000 Points US18,500



A28,500 Points US26,500

Pocket Guide to Australian Coins & Banknotes 18th Ed.

New Maccas 18th ed – information, photos & up-to-date pricing!Usually A$35 US$33 AR828

Australian Banknote Album

Providing safety and display, this album can house 16 notes – add more pages as your collection grows!

Usually A$17.50 US$16.25 AJ401

Bag of 50 Mylars Assorted

Keep your coin collection safe, with this bag of 50 self-adhesive Mylars – sizes range from 17.5mm-39.5mm.Usually A$9.90 US$9.25 AO787

Coin Album PVC-free (including 20 pocket pages)A safe, PVC-free environment for your treasured coin collection!

Usually A$49.95 US$47 AQ308

Vital Collector Accessories

Bonus Points 2011

Documents

Transcript of Bonus Points 2011