BASIC TECHNIQUES IN MOLECULAR BIOLOGY

Ahmad Hamim Sadewa

Rapid development of molecular biology was based on three principles techniques :

Polymerase Chain Reaction (PCR)

DNA Sequencing

Cloning

POLYMERASE CHAIN REACTION (PCR)

DNA isolation/extraction usually produces a very small amount of DNA concentration (several hundreds

nanogram / microliter) difficult to analyze

It is necessary to amplify DNA / a fragment of DNA

PCR allows the production of more than 10 million copies of a target DNA sequence from only a few

molecules

PCR REACTION MIXTURE

Usually the amount of template DNA is in the range of 0.01-1 ng for plasmid or phage DNA and 0.1-1 µg for genomic DNA, for a total reaction mixture of 50 µl. Recently, with newest PCR technology, as low as 1 ng of genomic DNA can be amplified.

1. Template DNA

Higher amounts of template DNA usually increase the yield of nonspecific PCR products

Trace amounts of agents used in DNA purification procedures (phenol, EDTA, Heparin, Proteinase K, etc.) strongly inhibit Taq DNA Polymerase. Ethanol precipitation of DNA and repetitive washing of DNA pellets with 70% ethanol is usually effective in removing traces of contaminants from the DNA sample.

DNA Quality

All methods of DNA isolation (salting out, silica gel, phenol-chloroform, guanidine isothiocyanate etc.) from fresh tissue combine with good skills will provide high quality of DNA high concentration, pure, long DNA

2. Primers

: oligonucleotide which is complement with the flanking region of target DNA sequence

There are two primers; forward primer runs from 5’ to 3’ of the sense template, reverse primer runs from 5’ to 3’ of the antisense template

PCR primers are usually 15-30 (20 – 25) nucleotides in length. Longer primers provide higher specificity.

The primer should not be self-complementary or complementary to other primer in the reaction mixture, in order to avoid primer-dimer and hairpin formation.

The melting temperature of flanking primers (forward and reverse) should not differ by more than 5oC.

If the primer is shorter than 25 nucleotides, the approx. melting temperature (Tm) is calculated using the following formula: Tm= 4 (G + C) + 2 (A + T)

Annealing temperature should be approx. 5oC lower than the melting temperature.

If the primer is longer than 25 nucleotides, the melting temperature should be calculated using specialized computer programs where the interactions of adjacent bases, the influence of salt concentration, etc. are evaluated.

The optimum annealing temperature should be established from the experiments.

3. Deoxynucleotide triphosphates (dNTPs) dATP, dGTP, dCTP and dTTP)

The concentration of each dNTP in the reaction mixture is usually 200 µM. It is very important to have equal concentrations of each dNTP as inaccuracy in the concentration of even a single dNTP dramatically increases the misincorporation level.

4. Taq DNA polymerase

Heat stable DNA polymerase, isolated from hot spring bacteria Thermus aquaticus found in Yellowstone National Park, USA.

Usually 1-1.5 Units of Taq DNA Polymerase are used in 50 µl of reaction mix.

Higher Taq DNA Polymerase concentrations may cause synthesis of nonspecific products.

If inhibitors are present in the reaction mix (e.g., if the template DNA used is not highly purified), higher amounts of Taq DNA Polymerase (2-3 U) may be necessary to obtain a better yield of amplification products.

5. MgCl2

The optimal concentration of MgCl2 has to be selected for each experiment. Too few Mg2+ ions result in a low yield of PCR product, and too many increase the yield of non-specific products and promote misincorporation.

The recommended range of MgCl2 concentration is 1-4 mM

If the DNA samples contain EDTA or other chelators, the MgCl2 concentration in the reaction mixture should be raised proportionally.

Concentration of MgCl2 in 50 µl reaction mix, mM

1.0 1.25 1.5 1.75 2.0 2.5 3.0 4.0

Volume of 25 mM MgCl2, µl 2 2.5 3 3.5 4 5 6 8

6. PCR buffer

Standard PCR buffer contains 50 mM KCl, 10 mM Tris-HCl, pH 8.3 at room temperature

PCR Mixture

All components should be added one by one in thin-wall PCR tube carefully on ice high probability of mistake

Many companies produced PCR mix which contains Taq, MgCl2, dNTPs and PCR buffer in one reagents. Additional components are template and primers only.

ReagentFinal

concentrationQuantity, for 50 µl

of reaction mixture

Sterile deionized water - variable

10X Taq buffer 1X 5 µl

2 mM dNTP mix 0.2 mM of each 5 µl

Primer I 0.1-1 µM variable

Primer II 0.1-1 µM variable

Taq DNA Polymerase 1.25 u / 50 µl variable

25 mM MgCl2 1-4 mM variable*

Template DNA 10pg-1 µg variable

PCR Conditions

1. Initial Denaturation Step

The initial denaturation should be performed over an interval of 1-3 min at 95oC. This interval should be extended up to 10 min for GC-rich templates.

The complete denaturation of the DNA template at the start of the PCR reaction is of key importance. Incomplete denaturation of DNA results in the inefficient utilization of template in the first amplification cycle and in a poor yield of PCR product.

2. Denaturation Step

Usually denaturation for 0.5-2 min at 94-95oC is sufficient, since the PCR product synthesized in the first amplification cycle is significantly shorter than the template DNA and is completely denatured under these conditions.

3. Primer Annealing Step

Usually the optimal annealing temperature is 5oC lower than the Tm; established based on experiments. Incubation for 0.5-2 min is usually sufficient.

if nonspecific PCR products are obtained in addition to the expected product, the annealing temperature should be optimized by increasing it stepwise by 1-2oC.

4. Extending/Elongation Step

Usually the extending step is performed at 70-75oC. The rate of DNA synthesis by Taq DNA Polymerase is highest at this temperature.

Recommended extending time is 1 min for the synthesis of PCR fragments up to 2 kb (or 1 kb). When larger DNA fragments are amplified, the extending time is usually increased by 1 min for each 1000 bp.

5. Final Extending Step

After the last cycle, the samples are usually incubated at 72oC for 5-15 min (7 min) to fill-in the protruding ends of newly synthesized PCR products.

The terminal transferase activity of Taq DNA Polymerase adds extra A nucleotides overhang to the 3'-ends of PCR products.

Cycle Number

The number of PCR cycles depends on the amount of template DNA in the reaction mix and on the expected yield of the PCR product.

For less than 10 copies of template DNA, 40 cycles should be performed. If the initial quantity of template DNA is higher, 25-35 cycles are usually sufficient.

Denaturation

Annealing

Elongation

Mk 1 2 3

512 bp

Gel electrophoresis of PCR product (amplicon)

Unspecific band

RESTRICTION ENDONUCLEASE

A restriction enzyme (or restriction endonuclease) is an enzyme that cuts double-stranded DNA. The enzyme makes two incisions, one through each of the sugar-phosphate backbones (i.e., each strand) of the double helix without damaging the nitrogenous bases cleave the sugar-phosphate backbone of DNA

Thousands of restriction enzymes have been isolated from bacteria, where they appear to serve a host-defense role.

Restriction enzymes are classified biochemically into four types (classes), designated Type I,Type II, Type III, and Type IV.

Type I and III, both the methylase and restriction activities are carried out by a single large enzyme complex. Both require ATP for their proper function.

In type II systems, the restriction enzyme is independent of its methylase, and cleavage occurs at very specific sites that are within or close to the recognition sequence. The vast majority of known restriction enzymes are of type II, and it is these that find the most use as laboratory tools. The first to be discovered and utilized was EcoRI, which is staggered and its recognition sequence is 5'-GAATTC-3'. Most type II enzymes cut palindromic DNA sequences

In type IV, the restriction enzymes target only methylated DNA.

Restriction enzymes are named based on the bacteria in which they are isolated in the following manner:E : Escherichia (genus); co : coli (species); R : RY13 (strain); I : First identified Order ID'd in bacterium

The substrates for restriction enzymes are specific sequences of double-stranded DNA called recognition sequences.

The length of restriction recognition sites varies: The enzymes EcoRI, SacI and SstI each recognize a 6 base-pair (bp) sequence of DNA, whereas NotI recognizes a sequence 8 bp in length, and the recognition site for Sau3AI is only 4 bp in length.

Different restriction enzymes which have the same recognition site are called isoschizomers (SacI and SstI)

Restriction recognitions sites can be unambiguous or ambiguous: BamHI recognizes the sequence GGATCC unambiguous. HinfI recognizes a 5 bp sequence starting with GA, ending in TC, and having any base between (in the table, "N" stands for any nucleotide) ambiguous recognition site. XhoII also ambiguous)

The recognition site for one enzyme may contain the restriction site for another. The BamHI recognition site contains the recognition site for Sau3AI.

most recognition sequences are palindromes - they read the same forward (5' to 3' on the top strand) and backward (5' to 3' on the bottom strand).

Pattern of DNA Cutting by Restriction Endonuclease

1. 5' overhangs: The enzyme cuts asymmetrically within the recognition site such that a short single-stranded segment extends from the 5' ends. BamHI cuts in this manner.

The 5' or 3' overhangs generated by enzymes that cut asymmetrically are called sticky ends or cohesive ends, because they will readily stick or anneal with their partner by base pairing.

2. 3' overhangs: asymmetrical cutting within the recognition site, the result is a single-stranded overhang from the two 3' ends. KpnI cuts in this manner.

3. Blunts: Enzymes that cut at precisely opposite sites in the two strands of DNA generate blunt ends without overhangs. SmaI is an example of an enzyme that generates blunt ends.

PCR – RFLP (Restriction Fragment Length Polymorphisms)

A combination of PCR – restriction method to detect SNP (single nucleotide polymorphsim)

The sample is first run in a restriction digest to cut the DNA, then gel electrophoresis is performed on this digest. In the case of MTHFR C677T polymorphism, single band of 198 bp denotes CC genotype, two bands of 198 and 175 bp denote CT genotype and single band of 175 bp denotes TT genotype.

After gel electrophoresis, DNA can be visualized by staining with ethidium bromide, an intercalating agent and fluorescent dye.

PCR amplification of MTHFR exon 4

M M CCCC 　 　 CTCT TTTT

198 bp198 bp

175 bp175 bp

Gel Electrophoresis

Enzyme digestion (HinfI)

G A G C CCC (wild type)

Ala198 bp198 bp

TT (mutant) G A G T CVal

~175 bp~175 bp~23 bp~23 bp

G A N T CC T N A G

PCR amplification of RET exon 2

Gel Electrophoresis

Enzyme digestion (EagI)

294 bp294 bp

~207 bp~207 bp~87 bp~87 bp

C G G C C GG C C G G C

PCR-RFLP untuk polimorfisme G135A gena RET

SMN2 Exon 8

SMN2 Exon 8

3 5 7 8 9 11 19 20 21 22 23 24 C+ C-Mk

B

C

ASMN1 Exon 7

Vietnamese SMA Patients

NAIP Exon 5

SMN2 Exon 7

SMN2 Exon 8

DNA SEQUENCING

The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide bases in a DNA fragment

The advent of DNA sequencing has significantly accelerated biological research and discovery.

The rapid speed of sequencing attainable with modern DNA sequencing technology has been instrumental in the large-scale sequencing of the human genome, in the Human Genome Project.

1. mixture of all four dNTPs (dATP, dGTP, dCTP, dTTP)2. mixture of all four dideoxynucleotides, each present in limiting quantities and each labeled with a "tag" that fluoresces a different color: ddATP, ddGTP, ddCTP,ddTTP 3. DNA polymerase I 4. Template DNA (only single strand is needed)5. One primer

Because all four normal nucleotides are present, chain elongation proceeds normally until, by chance, DNA polymerase inserts a dideoxy nucleotide (shown as colored letters) instead of the normal deoxynucleotide.

Chain Termination Methods (Sanger)

Reagents

PCR cycle sequencing/terminator cycle

At the end of the incubation period, the fragments are separated by length from longest to shortest. The resolution is capable to recognize one nucleotide different. Each of the four dideoxynucleotides fluoresces a different color when illuminated by a laser beam and an automatic scanner provides a printout of the sequence.

Once ddNTP was incorporated, DNA elongation will be terminated. The ddNTPs posses hydrogen instead of hydroxyl moeities at 3’ position.

ddNTPs

ATGATCCGCATGGACCGGCGGGGAGGCACCTGG

M I R 　 M D R R G G T W

ATGATCCGCATGGACCGGCGGGGAGGCACCTGG

M I R 　 M D R R G G T W

ATGATCCGCATGGACTGGCGGGGAGGCACCTGG

M I R 　 M D W R G G T W

Chemical Degradation Method (Maxam – Gilbert)

Sequence of double stranded DNA is determined with chemical that cut the molecules at specific position

Maxam-Gilbert sequencing has fallen out of favour due to its technical complexity, extensive use of hazardous chemicals, and difficulties with scale-up.

The method requires radioactive labelling at one end and purification of the DNA fragment to be sequenced. Chemical treatment generates breaks at a small proportion of one or two of the four nucleotide bases in each of four reactions.

The fragments are then separated by gel electrophoresis. To visualize the fragments generated in each reaction, the gel is exposed to X-ray film for autoradiography

MOLECULAR CLONING

Molecular cloning refers to the procedure of isolating a defined DNA sequence and obtaining multiple copies of it in vivo.

Cloning is frequently employed to amplify DNA fragments containing genes, but it can be used to amplify any DNA sequence such as promoters, non-coding sequences and randomly fragmented DNA.

The term cloning is misleadingly used to refer to the identification of the chromosomal location of a gene associated with a particular phenotype of interest, such as in positional cloning. In practice, localization of the gene to a chromosome or genomic region does not necessarily enable one to isolate or amplify the relevant genomic sequence.

Procedures

Fragmentation : the DNA of interest needs to be isolated to provide a relevant DNA segment of suitable size.

Ligation : a ligation procedure is employed whereby the amplified fragment is inserted into a vector. The vector (which is frequently circular) is linearised by means of restriction enzymes, and incubated with the fragment of interest under appropriate conditions with an enzyme called DNA ligase.

Transfection : following ligation the vector with the insert of interest is transfected into cells (competent cells, E. coli is widely used). A number of alternative techniques are available, such as chemical sensitivation of cells, electroporation. The transfected cells are cultured.

Colony selection

Modern cloning vectors include selectable antibiotic resistance markers, which allow only cells in which the vector has been transfected, to grow. Additionally, the cloning vectors may contain colour selection markers which provide blue/white screening (α-factor complementation) on X-gal medium.

These selection steps do not absolutely guarantee that the DNA insert is present in the cells obtained. Further investigation of the resulting colonies is required to confirm that cloning was successful. This may be accomplished by means of PCR (insert check), restriction fragment analysis and/or DNA sequencing.

TA Cloning

TA Cloning is one of the most popular methods of cloning the amplified PCR product using Taq and other polymerases.

TA cloning is brought about by the terminal transferase activity of certain type of DNA polymerase such as the Taq polymerase. This enzyme adds a single, 3'-A overhang to each end of the PCR product. As a result, the PCR product can be directly cloned into a linearized cloning vector that have single base 3'-T overhangs on each end. Such vectors are called T- vectors.

The PCR product with A overhang, is mixed with this vector in high proportion. The complementary overhangs of a "T" vector and the PCR product hybridize. The result is a recombinant DNA, the recombination being brought about by DNA ligase.