Bioanalytical LC-MS/MS of therapeutic oligonucleotides€¦ · –diseases with a genetic...
Transcript of Bioanalytical LC-MS/MS of therapeutic oligonucleotides€¦ · –diseases with a genetic...
Bioanalytical LC-MS/MS of therapeutic oligonucleotides
W.D. van Dongen PROXY Laboratories B.V.
Oligonucleotide therapeutics
• RNA chains 15-25 nucleotide units • cytosine (C) guanine (G), adenine (A) uracil (U) • interferes with processing of genetic material
– inhibits/decreases expression of therapeutically relevant protein – blocks expression of virus mRNA
• can treat diseases “undruggable” using small molecules or MABs – diseases with a genetic background e.g. DMD, cystic fibrosis,
specific cancers and rare diseases – common diseases e.g. Hep-C, atherosclerosis, lupus, psoriasis
• Two types – single stranded: e.g. antisense RNA – double stranded: e.g. short interfering RNA
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
Oligonucleotide therapeutics
• Currently two drugs on the market
– Vitravene® for cytomegalovirus infection (herpes)
– Macugen® for wet macular degeneration (loss of vision in the center of the visual field)
• Many in development
– >250 therapeutic programs
– >100 in the clinic (2011)
– >5 in phase III
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
0
50
100
150
200
250
250*
83**
Comparison with biopharm Numbers in clinical development in 2009
**Source: Agilent Nucleic Acid Solutions
*Source: Insight Pharma reports
Bioanalysis of oligonucleotides
• Method-of-choice: ELISA
– based on hybridization of a probe or a capture and/or detection strand complementary to asRNA or siRNA
– unsurpassed sensitivity (25 pg/ml)
• Drawbacks
– cannot distinguish full-length oligonucleotides from truncated shortmer metabolites
– overestimation of parent oligonucleotide
– Cannot determine intact siRNA
Bioanalysis of oligonucleotides
• LC-MS
– unsurpassed selectivity : accurate levels
– indentify and quantify metabolites
• Drawbacks
– “best” reported sensitivity of validated method: 4 ng/ml [Deng et al, J Pharm Biomed Anal. 52(4), 571-579 (2010)]
• Acidic proton at each phosphodiester bond
• Highly charged poly-anionic backbone
• Extremely polar
• Phosphorothioate linkage
Bioanalytical LC-MS/MS of therapeutic oligonucleotides
Highly challenging from an analytical perspective:
• LC-MS efficiency – retention vs. ionisation
• ESI-MS – multiple negative charge states – H+-alkali+ exchange at phosphate groups
• MS/MS – fragmentation of multiple charged OGNs
• Quantitation – internal standard selection
• Sample preparation – SPE – LLE
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
Bioanalytical LC-MS/MS of oligonucleotides
Critical issues: ACGGCCAGCUUCCUGGACGGUUAACT TACGUGACGUACGUGAACGCGAUGUC TAAGGCGUACGUGAACGUACGUGAAC GUACGUGAACGUACGUGAACGUACGU TAAGGCGUACGUGAACGUACGUGAAC GUACGUGAACGUACGUGAACGUACGU TAAGGCGUACGUGAACGUACGUGAAC GUACGUGAACGUACCGUGAACGUACG UTAAGGCGUACGUGAACGUACGUGAC GUACGUGAACGUACGUGAACGUACGU TAAGGCGUACGUGAACGUACGUGAAC
GUACGUGAACGUACGUGAACGUACGU GAACGUACGUGAACCGUGAACCGUGA ACCGUGAACCGUGAACCGUGAACCGU GAACCGUGAUCACCGUGAUACCGUGA ACCGUGACUACUGUGAGUGAGUGACG UGAACCGUGAACCGUGAACCGUGAAC CGUGAACCGUGAACCGACGUGCAUGG
CUACAUGACGUUTATCCUGAACCGUGCUACAUGACGUUTATCCUGAACCGUGCUACAUGACGUUTATCCUGAACCGUGGUACGUGAACGUACGUGAACGUACGU GUACGUGAACGUACGUGAACGUACGU
William D van Dongen
100 pg/ml
LC-MS/MS
Plasma extraction
LC-MS of oligonucleotides
CRITICAL ISSUES FACING the OLIGONUCLEOTIDE
BIOANALYTICAL CHEMIST
ESI high high low
LC low low
ionpair
LC-MS efficiency: chromatographic retention vs. ionisation efficiency dilemma
organic
pH ions
IPLC-MS of oligonucleotides
• C18 column
• 10 mM triethylamine (TEA)
• 100 mM hexafluoro-2-propanol (HFIP)
• MeOH/MeCN gradient
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
IPLC-MS of oligonucleotides
• LC: HFIP increases hydrophobicity ion-pair
• ESI: HFIP dynamic liquid/gas phase pH adjuster
– pKa 9, 99% not charged at pH 7, bp 57◦C
– evaporates during ESI
– volatile HFIP depletes at droplet surface
– pH at the surface rises to 10
– OGN-TEA ion pair dissociation
– desorption OGN into the gas phase.
• And: HFIP reduces cation exchange
Single-quadrupole S/N ratios (n=3) of 20 pg (dT)25 IPLC-MS
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
TEA/HFIP: 15mM triethylammonium /400mM hexafluoro-2-propanol TEAA: 100mM triethylammonium acetate DMBAA: 100mM butyldimethylammonium ac. TPAA: 100mM tripropylammonium acetate TBAA: 100mM tributylammonium acetate HAA: 100mM hexyl ammonium acetate
McCarthy et al. 5th Symposium on the Practical Applications of Mass Spectrometry in the Biotechnology and Pharmaceutical Industries. The Meritage Resort, Napa, CA, USA, 9–11 September 2008
ESI-MS: formation of multiple negative charge states
5’-GGC CAA ACC UCG GCU UAC CU-3’: C208H277N72O119P19S19 Monoisotopic mass: 6882.75Da
Average mass: 6887.66Da
[M-3H]3-
[M-2H]2-
[M-4H]4-
[M-5H]5-
[M-6H]6-
[M-7H]7- [M-8H]8-
[M-9H]9-
[M-10H]10-
[M-8H]8-
[M-9H]9-
5’-GGC CAA ACC UCG GCU UAC CU-3’: C208H277N72O119P19S19 Monoisotopic mass: 6882.75Da
Average mass: 6887.66Da
ESI-MS: formation of multiple negative charge states
100 mM NH4OAc
Z = 7
Z = 5
Z = 3
5’-GAGACTGCAAGCG-3’
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
Griffey et al, JAmSoc 8, 155-160 (1997)
Complex MS/MS spectra 5’-GGC CAA ACC UCG GCU UAC CU-3’: C208H277N72O119P19S19 Monoisotopic mass: 6882.75Da
Average mass: 6887.66Da
1648,6 1554,8 1471,0 1387,1 1297,3 1207,5 1117,7 1033,8 950,0 866,0 782,1 688,3 594,5 510,7 426,6 342,5 252,7 4
2198,5 2073,4 1961,6 1849,8 1730,1 1610,3 1490,5 1378,8 1267,0 1154,9 1043,2 918,1 793,0 681,2 569,1 457,0 337,3 225,5 3
3298,2 3110,5 2942,9 2775,3 2595,6 2416,0 2236,3 2068,7 1901,0 1732,9 1565,3 1377,6 1190,0 1022,3 854,2 686,1 506,4 338,8 2
6597,4 6222,1 5886,8 5551,5 5192,2 4832,9 4473,6 4138,3 3803,1 3466,8 3131,5 2756,2 2380,9 2045,6 1709,4 1373,1 1013,8 678,5 343,3 1 w-ion
1695,1 1601,3 1517,5 1433,6 1343,8 1254,0 1164,2 1080,3 996,5 912,5 828,6 734,8 641,0 557,2 473,1 389,0 299,2 4
2237,8 2112,7 2000,9 1889,2 1769,4 1649,6 1529,9 1418,1 1306,4 1194,3 1082,5 957,4 832,3 720,5 608,5 496,4 376,6 264,8 3
3323,2 3135,5 2967,9 2800,3 2620,6 2441,0 2261,3 2093,7 1926,0 1757,9 1590,3 1402,6 1215,0 1047,3 879,2 711,1 531,4 329,8 2
6579,4 6204,1 5868,8 5533,5 5174,2 4814,9 4455,6 4120,3 3785,1 3448,8 3113,5 2738,2 2362,9 2027,6 1691,4 1355,1 995,8 660,5 325,3 1 x-ion
1627,1 1533,3 1449,5 1365,6 1275,8 1186,0 1096,2 1012,3 928,5 844,5 760,6 666,8 573,0 489,2 405,1 321,0 231,2 4
2169,8 2044,7 1932,9 1821,2 1701,4 1581,6 1461,9 1350,1 1238,4 1126,3 1014,5 889,4 764,3 652,5 540,5 428,4 308,6 196,8 3
3255,2 3067,5 2899,9 2732,3 2552,6 2373,0 2193,3 2025,7 1858,0 1689,9 1522,3 1334,6 1147,0 979,3 811,2 643,1 463,4 295,8 2
6511,4 6136,1 5800,8 5465,5 5106,2 4746,9 4387,6 4052,3 3717,1 3380,8 3045,5 2670,2 2294,9 1959,6 1623,4 1287,1 927,8 592,5 257,3 1 y-ion
1622,6 1528,8 1444,9 1361,1 1271,3 1181,5 1091,6 1007,8 924,0 839,9 756,1 662,3 568,5 484,7 400,6 316,5 226,7 4
2163,8 2038,7 1926,9 1815,2 1695,4 1575,6 1455,9 1344,1 1232,4 1120,3 1008,5 883,4 758,3 646,5 534,5 422,4 302,6 190,8 3
3246,2 3058,5 2890,9 2723,3 2543,6 2364,0 2184,3 2016,7 1849,0 1680,9 1513,3 1325,6 1138,0 970,3 802,2 634,1 454,4 286,8 2
6493,4 6118,1 5782,8 5447,5 5088,2 4728,9 4369,6 4034,3 3699,1 3362,8 3027,5 2652,2 2276,9 1941,6 1605,4 1269,1 909,8 574,5 239,3 1 z-ion
5' G G C C A A A C C U C G G C U U A C C U 3' mol mass
res-mass 17,0 375,3 375,3 335,3 335,3 359,3 359,3 359,3 335,3 335,3 336,3 335,3 375,3 375,3 335,3 336,3 336,3 359,3 335,3 335,3 336,3 -95,0 6887,7
Base 151,1 151,1 111,0 111,0 135,1 135,1 135,1 111,0 111,0 112,0 111,0 151,1 151,1 111,0 112,0 112,0 135,1 111,0 111,0 112,0
a-ions 1 295,3 670,6 1005,9 1341,2 1700,5 2059,8 2419,1 2851,4 3089,6 3425,9 3761,2 4136,5 4511,8 4847,1 5183,3 5519,6 5878,9 6214,2 6549,4 6885,7
2 334,8 502,4 670,1 849,7 1029,4 1209,0 1425,2 1544,3 1712,4 1880,1 2067,7 2255,4 2423,0 2591,2 2759,3 2938,9 3106,6 3274,2 3442,3
3 334,6 446,4 566,2 685,9 805,7 949,8 1029,2 1141,3 1253,1 1378,2 1503,3 1615,0 1727,1 1839,2 1959,0 2070,7 2182,5 2294,6
4 334,5 424,4 514,2 604,0 712,1 771,7 855,7 939,5 1033,4 1127,2 1211,0 1295,1 1379,1 1469,0 1552,8 1636,6 1720,7
a-B ions 1 144,3 519,6 894,8 1230,1 1565,4 1924,7 2284,0 2740,3 2978,6 3313,9 3650,1 3985,4 4360,7 4736,0 5071,3 5407,6 5743,8 6103,1 6438,4 6773,7
2 259,3 446,9 614,6 782,2 961,9 1141,5 1369,7 1488,8 1656,4 1824,6 1992,2 2179,9 2367,5 2535,1 2703,3 2871,4 3051,1 3218,7 3386,3
3 297,6 409,4 521,1 640,9 760,7 912,8 992,2 1104,0 1216,0 1327,8 1452,9 1578,0 1689,8 1801,9 1913,9 2033,7 2145,5 2257,2
4 306,8 390,6 480,4 570,3 684,3 743,9 827,7 911,8 995,6 1089,4 1183,3 1267,1 1351,1 1435,2 1525,0 1608,8 1692,7
C ions 1 374,3 749,6 1084,9 1420,2 1779,5 2138,8 2498,1 2833,3 3168,6 3504,9 3840,2 4215,5 4590,8 4926,0 5262,3 5598,6 5957,9 6293,1 6628,4 6964,7
2 374,3 541,9 709,6 889,2 1068,9 1248,5 1416,2 1583,8 1751,9 1919,6 2107,2 2294,9 2462,5 2630,6 2798,8 2978,4 3146,1 3313,7 3481,8
3 361,0 472,7 592,5 712,2 832,0 943,8 1055,5 1167,6 1279,4 1404,5 1529,6 1641,3 1753,4 1865,5 1985,3 2097,0 2208,8 2320,9
4 354,3 444,1 533,9 623,8 707,6 791,4 875,5 959,3 1053,1 1146,9 1230,8 1314,8 1398,9 1488,7 1572,5 1656,4 1740,4
b-ions 1 313,3 688,6 1023,9 1359,2 1718,5 2077,8 2437,1 2869,4 3107,6 3443,9 3779,2 4154,5 4529,8 4865,1 5201,3 5537,6 5896,9 6232,2 6567,4 6903,7
2 343,8 511,4 679,1 858,7 1038,4 1218,0 1434,2 1553,3 1721,4 1889,1 2076,7 2264,4 2432,0 2600,2 2768,3 2947,9 3115,6 3283,2 3451,3
3 340,6 452,4 572,2 691,9 811,7 955,8 1035,2 1147,3 1259,1 1384,2 1509,3 1621,0 1733,1 1845,2 1965,0 2076,7 2188,5 2300,6
4 339,0 428,9 518,7 608,5 716,6 776,2 860,2 944,0 1037,9 1131,7 1215,5 1299,6 1383,6 1473,5 1557,3 1641,1 1725,2
5’-GGCCAAACCUCGCUUACCU-3’ MS/MS of [M-3H]3-
y2
a2
c2
y3
a3 c3
y4
a4
c4
y5
a5
c5 c6 y6
[M-3H]3-
C208H277N72O119P19S19
Monoisotopic mass: 6882.75Da
Average mass: 6887.66Da
5’-TCTCCCAGCGTGCGCCAT-3’ MS/MS of [M-13H]13-
product ion scan of m/z 591 [M–13H]13−
Full scan m/z 400-800
Deng et al, J Pharm Biomed Anal. 52(4), 571-579 (2010)
PO2S-
PO4C2H6-
WD van Dongen - bioanalytical LC-MS of therapeutic oligonucleotides -
ESI-MS H+-alkali+ exchange at phosphate groups
[M-9H]9-
[M-10H+K]9-
[M-9H]9-
[M-12H+2Na+K]9-
[M-10H+Na]9-
[M-11H+Na+K]9-
[M-10H+K]9-
[M-12H+2Na+K]9-
[M-10H+Na]9-
[M-11H+Na+K]9-
[M-13H+3Na+K]9-
[M-13H+3Na+K]9-
[M-14H+2Na+2K]9-
1000 ng/ml analyte
200 ng/ml IS
analyte: [M-9H]9- m/z 95
IS: [M-9H]9- m/z 95
Quantitation: internal standard selection
Drug substance: rafAON G
STGCTCCATTGATG
SC mol mass: 4590
IS GSUGCUCCAUUGAUG
SC mol mass: 4521
Chemical modifications: lower case S = PS linkage
LC: no separation of rafAON and IS SRM: rafAON, [M-3H]3-: 1529 → 322 + 1529 → 746 IS , [M-3H]3- : 1506 → 289
LOQ: 50 ng/ml
Internal standard affairs: case 1
LC: no separation of PF-ODN and IS SRM: PF-ODN, [M-xH]x- 698.8, 640.1, 591.1 (n=11-13) → 95 IS , [M-10H]10- : 631.7 (n=10) → 125
LOQ: 4 ng/ml
Drug substance: PF-ODN TCGTCGTTTTGTCGTTTTGTCGTT
IS: TTTTTTTTTTTTTTTTTTTT
mol mass: 7697 6327
Deng et al, J Pharm Biomed Anal. 52(4), 571-579 (2010)
Internal standard affairs: case 2
Sample preparation of plasma samples
drug sample prep recovery suppression SPE G3139 OASIS HLB 40-50% na rafAON OASIS HLB 22.8 ± 6.5% 48.2 ± 3.5% rafAON Varian C18 80% 50% Compound X OASIS WAX 75% na Oligo1 Clarity OTX >80% na LLE Compounds phenol/ 80% na A/B/C chloroform/ isoamyl alcohol LLE & SPE PF-ODN chlorof/phenol & Oasis HLB 70-80% 0-6%
WD van Dongen and WMA Niessen, Bioanalysis (2011) 3(5), 541-564
drug sample prep range validation statistics
ISIS 1083 21-mer
SPE Phenyl 5-500 ng/ml
89-107% RSD 2-15%
rafAON 15-mer
monkey (OASIS HLB) mouse (OASIS C18)
50-10,000 ng/ml 25-5,000 ng/ml
94–102% RSD 6–14% 95–101% RSD 3–11%
PF-ODN 24-mer
LLE, chloroform/phenol & Oasis HLB
4-2.000 ng/ml
PF-ODN: 97-101% RSD 2-12% (n-1)5’/(n-1)3’: 102-106% RSD 1-12% (n-2)5’: 99 - 94% RSD 1-12 % (n-3)5’: 90– 100 % RSD 6-7%
WD van Dongen and WMA Niessen, Bioanalysis (2011) 3(5), 541-564
Bioanalytical LC-MS methods of asRNA
5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’
Metabolites of antisense G3139 in human plasma obtained from in vivo study
Dai et al. J. Chromatogr. B, 825 (2005) 201
Human metabolites of G3139
Dai et al. J. Chromatogr. B 825 (2005) 201
(n−1)3’
(n−2)3’
G3139 5’TCTCCCAGCGTGCGCCAT’3
Future perspective: asRNA
• Current 4 ng/ml, must and will be improved
– UPLC
– sensitive triple quadrupole MS (Xevo TQS, API 5500, Agilent 6490)
– (nano-)UPLC and chip technology
– make LLQ’s in the range of low pg/ml potentially possible
WD van Dongen and WMA Niessen, Bioanalysis (2011) 3(5), 541-564
Proxy Mibiton Mariët Ouwehand VU, Amsterdam Prosensa Laurens Cortvriendt therapeutics Wilfried Niessen
Acknowledgements