BACTERIOCINS: UNIQUE APPROACHES FOR THE...

BACTERIOCINS: UNIQUE APPROACHES FOR THE

CHARACTERIZATION OF PEPTIDE

ANTIMICROBIALS IN LACTIC ACID BACTERIA

By

SUNITA (Susan) MACWANA

Master of Science in Medical Microbiology

Kasturba Medical College

Manipal, India

1998

Submitted to the Faculty of the Graduate College of the

Oklahoma State University in partial fulfillment of

the requirements for the Degree of

DOCTOR OF PHILOSOPHY May, 2007

ii

BACTERIOCINS: UNIQUE APPROACHES FOR THE

CHARACTERIZATION OF PEPTIDE

ANTIMICROBIALS IN LACTIC ACID BACTERIA

Dissertation Approved:

Dr. Peter Muriana

Dissertation Advisor

Dr. Stanley Gilliland

Dr. William McGlynn

Dr. Christina DeWitt

Dr. A. Gordon Emslie Dean of the Graduate College

iii

ACKNOWLEDGMENT

I wish to express my sincere appreciation to my advisor, Dr. Peter Muriana for his

supervision, optimism and guidance which has enabled me to be an independent

researcher. My extended appreciation to my committee members, Dr. Gilliland, Dr.

McGlynn and Dr. DeWitt for serving on my graduate committee. Thank You for your

support, suggestion, time and encouragement.

I would also like to thank my parents, John and Victoria Macwana, for their love,

encouragement, understanding, and continued support throughout my life. The

foundation of family is what had given me solid ground to grow into the person I am

today. A million thank you’s to my sisters Selina, Susan and Susannah for their constant

support, friendship, love and prayers which have brought me thus far. I would also like to

thank my fiancé Paul Kurias, for his patience.

My gratitude extends to the most positive person, Sumit Punj who has seen me

through my research here at Oklahoma State University. In addition, I would like to

thank all the graduate students in the Department of Microbiology and Molecular

Genetics and the Food and Agricultural Product Center, Oklahoma State University for

their support and friendship.

iv

To all my friends and co-workers, I greatly appreciate all your help, advice,

support, and most importantly your friendships.

Lastly, I would like to thank all the faculty and staff in the Food and Agricultural

Product Center for their accommodating nature and friendliness. I want to thank the

department for supporting me financially throughout my study here at Oklahoma State

University.

v

TABLE OF CONTENTS

Chapter Page

I. INTRODUCTION TO LITERATURE REVIEW.............................................. 1

Historical background.................................................................................... 1

Inhibitory properties of bacteria used in food manufacture/fermentation ..... 2

Food preservation........................................................................................... 4

II. REVIEW OF LITERATURE ............................................................................. 6

Characteristics of Bacteriocins (from lactic acid bacteria) ............................ 6

General nature of bacteriocins ................................................................. 6

Inhibitory spectrum.................................................................................. 7

Bactericidal action ................................................................................... 8

Classification of bacteriocins................................................................... 8

Genetic organization and regulation of bacteriocin of lactic acid bacteria.... 9

Organization of gene clusters: genetics and biosynthesis........................ 9

Biosynthetic pathway............................................................................. 11

Post-translational modification, activation and transport ...................... 12

Regulation of biosynthesis..................................................................... 13

Producer immunity................................................................................. 14

Mode of action ............................................................................................. 15

Antimicrobial spectrum ......................................................................... 15

Primary mode of action.......................................................................... 16

Secondary mode of action...................................................................... 17

Passage across the cell wall ................................................................... 18

Importance of three dimensional structures........................................... 19

vi

Detection of bacteriocins produced by lactic acid bacteria (LAB).............. 20

Traditional methods ............................................................................... 20

Agar diffusion method....................................................................... 21

Mass spectrometry ............................................................................. 21

Hybridization method ........................................................................ 22

Flow cell cytometry ........................................................................... 22

PCR detection methods.......................................................................... 23

SYBR Green method ......................................................................... 24

TaqMan® probes ............................................................................... 25

Molecular beacons ............................................................................. 26

AmplifluorTM uniprimerTM real-time PCR......................................... 26

Bacteriocin resistance .................................................................................. 27

Food applications ......................................................................................... 29

Biopreservation of meat products .......................................................... 30

Biopreservation of dairy products.......................................................... 31

Biopreservation of seafood products ..................................................... 32

Hurdle technology to enhance food safety............................................. 33

Bacteriocins in packaging films............................................................. 34

Conclusion ................................................................................................... 36

References.................................................................................................... 38

III. SEQUENCE ANALYSIS OF THE CURVATICIN FS47 BACTERIOCIN

OPERON OF LACTOBACILLUS CURVATUS FS47................................... 52

Introduction ................................................................................................. 53

Materials and Methods ................................................................................ 55

Bacterial strains, plasmids, and media. .................................................. 55

DNA isolation and manipulation............................................................ 55

Genomic clones, sequencing and PCR walking. .................................... 55

Vectorette PCR....................................................................................... 56

Differentiation of L. sakei and L. curvatus............................................. 56

Sequence analysis. .................................................................................. 57

Results and Discussion................................................................................ 58

vii

Detection of the curvaticin FS47 bacteriocin operon. ............................ 58

Sequencing of the cloned fragments....................................................... 58

Identifying the ORF’s related to the curvaticin FS47 operon. ............... 59

Comparing the curvaticin FS47 bacteriocin operon with other bacteriocin operons................................................................................. 60

Identifying the bacteriocin producing species. ....................................... 60

Conclusion................................................................................................... 61

References ................................................................................................... 62

IV. USE OF ACQUIRED SPONTANEOUS RESISTANCE TO SCREEN

BACTERIOCINS OF LACTIC ACID BACTERIA INTO FUNCTIONAL INHIBITORY GROUPS .................................................................................. 69

Introduction ................................................................................................. 70


Bacterial growth conditions.................................................................... 72

Bacteriocin detection and assay.............................................................. 72

Isolation of bacteriocin-producing Lactic Acid Bacteria from foods..... 73

Identification of bacteriocin-producing Lactic Acid Bacteria. ............... 74

Preparation of bacteriocin culture supernatants. .................................... 74

Derivation of spontaneous bacteriocin-resistant strains of L. monocytogenes. ...................................................................................... 75

Bacteriocin inhibitory assay in culture broth.......................................... 75

Statistical analysis .................................................................................. 76


Bacteriocin resistance and cross-resistance............................................ 77

Functional classification into ‘resistance groups’ or ‘classes’. .............. 78

Use of spontaneously-derived bacteriocin-resistant isolates as indicators for different resistance classes of bacteriocins. ..................... 79

Anti-listerial bacteriocins and ‘resistance classes’ of Lactic Acid Bacteria isolated from foods................................................................... 80

Inhibitory assay demonstrating the practical functionality of different resistance-class groupings. ..................................................................... 81

References ................................................................................................... 84

viii

V. USE OF PCR ARRAYS TO QUICKLY IDENTIFY BACTERIOCIN RELATED SEQUENCES IN BACTERIOCINOGENIC LACTIC ACID BACTERIA……………………………………………………………………91

Introduction ................................................................................................. 92


Bacterial strains and growth conditions ................................................. 94

Isolation of bacteriocin-producing Lactic Acid Bacteria from foods..... 94

Identification of bacteriocin-producing Lactic Acid bacteria................. 95

PCR array for bacteriocin structural genes............................................. 95

Sequence analysis ................................................................................... 96


Conclusion................................................................................................. 103

References ................................................................................................. 104

ix

LIST OF TABLES

Table Page

1. Sequences of oligonucleotide primers used to differentiate L.curvatus and L. sakei. ..................................................................................................................... 64

2. Sequences of oligonucleotide primers used in the Vectorette PCR Approach..... 64

3. Sensitivity reactions of bacteriocins spotted on various indicator lawns of L. monocytogenes, including those for which spontaneous bacteriocin resistance

was acquired.......................................................................................................... 87

4. Lactic acid bacteria (LAB) and Bac+ LAB isolated from retail foods.................. 88

5. Bacterial strains used in this study...................................................................... 107

6. Primers used in this study ................................................................................... 108

x

LIST OF FIGURES

Figure Page

1. Schematic of restriction map of L.curvatus FS47 chromosomal DNA. ............... 65

2. Representation of the major open reading frames (ORFs) related to the curvaticin FS47 bacteriocin operon. ..................................................................... 66

3. Comparison of the curvaticin FS47 operon with other known bacteriocin operons. ................................................................................................................. 67

4. PCR amplification of species-specific DNA targets to help identify the bacteriocin-producing strain FS47........................................................................ 68

5. Inhibitory zones of filter-sterilized, pH-adjusted (pH 7.0) bacteriocin extracts on indicator lawns of L. monocytogenes 39-2 (wild-type) and bacteriocin- resistant derivatives………………………………………………………………89

6. Liquid inhibition assay of inidividual bacteriocins or in combination against L. monocytogenes 39-2.............................................................................................. 90

7. Primer array real-time PCR of Pediococcus acidilactici Bac3 (pediocin Bac3) 109

8. Sequence alignment of 3 different bacteriocin sequences obtained from amplification of DNA from Lb. sakei JD against the bacteriocin primer array.. 110

9. Bacteriocin PCR array amplification and sequence analysis of two Bac+ strains of Lc. lactis in comparison with the original bacteriocin gene sequence from which the primers were derived. ................................................................ 111

10. Bacteriocin array real-time PCR and sequence identify of lacticin FS92 produced by of Lc. lactis FS92. .......................................................................... 112

xi

ABBREVIATIONS AND SYMBOLS

1. LAB ………………………………………………………….Lactic Acid Bacteria

2. FDA ……………………………………………….Food and Drug Administration

3. Tm …………………………………………………………...Melting Temperature

4. SG…………………………………………………………………… SYBR Green

5. GRAS……………………………………………….. Generally recognized as safe

6. CFU………………………………………………………….Colony forming units

7. MAP……………………………………………. Modified atmospheric packaging

8. µl ………………………………………………………………………..microliters

9. µg ……………………………………………………………………….microgram

10. CHL ……………………………………………….Carbohydrate media for lactics

11. AU …………………………………………………………………Arbitrary units

12. W-T ……………………………………………………………………Wild type

1

CHAPTER I

INTRODUCTION TO LITERATURE REVIEW

Historical background

Initially, most of the significant progress in bacteriocin research stemmed from

investigations of the colicins, the prototype bacteriocins produced by various members of

the family Enterobacteriaceae, and this resulted in considerable knowledge of the genetic

basis, domain structure, mode of formation, and killing action of these molecules

(Pugsley, 1984). However, there has now been a remarkable amount of research activity

centered upon the bacteriocin-like activities of Gram-positive bacteria, particularly lactic

acid bacteria (LAB). Many of these are food-grade organisms that are already widely

used in the food industry but now offer the further prospect of food preservative

applications to inhibit bacterial pathogens and spoilage microorganisms.

It was Pasteur together with Joubert who, first systematically recorded an

observation of antagonistic interactions between bacteria. In summarizing their findings

that ‘‘common bacteria’’ (probably Escherichia coli) could interfere with the growth of

co-inoculated anthrax bacilli, either in urine (used as a culture medium) or in

experimentally infected animals. Since, in most cases the observations were of a clinical

rather than experimental nature, there is no information on the isolation and

characterization of any inhibitory chemical substance.

2

The first clear documentation of the nature of an antibiotic agent produced by E.

coli was provided by Gratia, who demonstrated in 1925 that strain V (virulent in

experimental infections), produced in liquid media, a dialyzable and heat-stable substance

(later referred to as colicin V) that inhibited the growth of E. coli even with a high

dilution. Later a series of different colicins were discovered over a period of time.

The more general term ‘‘bacteriocin’’ was coined by Jacob et al. in 1953.

Bacteriocins were specifically defined as protein inhibitors or ‘antibiotics’ of the colicin

type, i.e., molecules characterized by lethality after biosynthesis, predominant

intraspecies killing activity, and adsorption to specific receptors on the surface of

bacteriocin sensitive cells.

In 1976, a review of the bacteriocins of Gram-positive bacteria opened with the

remark that most of the definitive investigations in the field of bacteriocins had centered

on those of Gram-negative bacteria but predicted an increase in research emphasis on

bacteriocins of Gram-positive lactic acid bacteria (Tagg et al. 1976). It seems that much

of the renewed interest in these substances is a direct response to the perceived potential

practical application of these agents, either for the preservation of foods or the prevention

and treatment of bacterial infections.

Inhibitory properties of bacteria used in food manufacture/fermentation

Fermentation processes rely on natural or modified environments to select against

spoilage and pathogenic microorganisms and to promote the growth of desirable

microorganisms, either those naturally occurring or intentionally added. Most

3

fermentations progress through a sequence of microbial species, where the desirable

species usually predominates and imparts the characteristic identity attributed to the

particular food or beverage. Examples of disruptive activities that can obstruct the

fermentation process and compromise the product are phage infection of dairy starters,

growth of lactobacilli in wines and growth of staphylococci in fermented meats. The use

of bacteriocins as fermentation aids has been studied and presents a unique feature, i.e.,

the desirable microorganisms used in fermentation can also be the source of bacteriocins.

One of the first applications of bacteriocins was using nisin-producing starter

cultures in cheese making. Several observations came to light that did not encourage their

further development and application. Nisin-producing starters were effective in

controlling Clostridia spoilage; however, it was observed that cheese made with these

starters was not as high a quality as compared to cheese made with regular starters. Nisin-

producing starter cultures were also sensitive to phage attack (Hurst, 1981). A second

approach was using nisin resistant starters with good properties. The nisin resistant

starters were observed to possess some significant differences in terms of starter

performance and stability when compared to the regular parent starter cultures (Lipinska,

1977).

Foegeding et al. (1992) used a strain of Pediococcus acidilactici that produced

pediocin A1 as a lactic starter for the production of dry fermented sausage. The objective

was to evaluate the ability of this strain to inhibit intentionally introduced Listeria

monocytogenes. It was concluded that the lactic fermentation by itself was sufficient to

control L. monocytogenes if enough acid was produced. However, pediocin production

4

was shown to provide a safeguard against L. monocytogenes if acid production was

insufficient.

The use of bacteriocins and bacteriocinogenic LAB to control microbial

populations in food and beverage fermentations has been demonstrated with various

commodities. Certain problems or hurdles that may emerge are the appearance of

bacteriocin-resistant populations of spoilage LAB, increased likelihood of phage

infection because of the dependence on one or two starters instead of a heterogeneous

mixture of LAB, and inactivation of inhibitory properties by interaction with product

components.

Food preservation

Although nisin is the only bacteriocin in the United States approved as a direct

food additive, there is a great deal of interest in other bacteriocins that have similar

properties and exhibit broad spectrum inhibitory activity. Bacteriocins produced by

fermentation could be purified and added to foods as pure chemicals to inhibit food

pathogens and spoilage organisms only after obtaining approval as a direct food additive

by the FDA. Bacteriocins have several characteristics that make them ideal food

preservatives. Many bacteriocins can resist high temperature used in food processing and

can remain functional over a broad pH range. Bacteriocins can be digested by many

enzymes in the human gastrointestinal tract just like other proteins in the diet and not

become an issue for beneficial gut microflora. Bacteriocins are non-toxic, odorless,

colorless, and tasteless. Finally, bacteriocins are considered by consumers to be more

natural than chemical preservatives.

5

The efficacy of using bacteriocins as food preservatives will need to be

determined for each food system. Solubility, stability, sensory impact, heat, pH tolerance,

and types and numbers of organisms inhibited would need to be evaluated for each

bacteriocin in each food product category under a variety of storage conditions.

6

CHAPTER II

REVIEW OF LITERATURE

Characteristics of Bacteriocins (from lactic acid bacteria)

General nature of bacteriocins

Many species of LAB (Lactococcus, Lactobacillus, Pediococcus, Leuconostoc)

used for the production of fermented foods have shown to be strongly antagonistic

towards other bacteria. Bacteriocins can be small proteins, with molecular weights of a

few thousand Daltons (Da), or complex structures containing subunits in excess of 106

Da, with associated carbohydrate or lipid moieties. The heterogeneity of bacteriocins is

reflected in the differences in conditions for activity, mode of action, production, and

genetic basis (chromosomal or plasmid). Bacteriocin producing strains have evolved

mechanisms of immunity to the inhibitory action of their own bacteriocins, and immunity

genes are usually linked to production genes.

Nisin is produced by some strains of Lactococcus lactis and has been used as a

food preservative for over 30 years. Nisin is the most thoroughly characterized

bacteriocin produced by LAB. It has been used to inhibit spore-forming organisms in

cheese spreads, canned foods, bakery products and pasteurized milk. It is mainly

7

effective on Gram Positive pathogens. Nisin is a pentacyclic peptide containing three

unusual amino acids and has a molecular weight of 3,510 Da. It is inactivated by

chymotrypsin, but resistant to treatment with pronase, trypsin, and heat (100°C) under

acidic conditions.

Inhibitory spectrum

Though some bacteriocin-like substances produced by lactococci and lactobacilli

do appear to have a relatively narrow inhibitory spectra, most are much broadly active

than the colicins. They tend to be active against a wide range of Gram-positive bacteria,

and some have also been reported to inhibit Gram-negative species (Stevens et al. 1991).

The degree of activity of bacteriocin-like agents against sensitive bacteria can sometimes

be substantially increased by testing them either at particular pH values (Zajdel et al.

1985) or in the presence of chemical agents that weaken cell wall integrity

(Kalchayanand et al. 1992).

Although the specific ‘‘immunity’’ (or producer strain self-protection) of Gram-

positive bacteriocin-producing cells to their homologous bacteriocin is weak, genes

encoding membrane associated molecules that confer a degree of specific protection upon

the producer strain have been found in some Gram-positive bacteria (Klaenhammer,

1993). In the case of nisin (Nissen-Meyer et al. 1993), it has been found that the presence

of the bacteriocin structural gene as well as the immunity gene is required for expression

of immunity. Immunity to lactococcin A has been shown to function at the membrane

level via a mechanism that presumably blocks access to a putative receptor molecule,

prevents its insertion, or inactivates the bacteriocin (Van Belkum et al. 1991).

8

Bactericidal action

It appears that two major classes of killing actions are displayed by colicins: some

form ion channels in the cytoplasmic membrane, and others exhibit nuclease activity

upon gaining entry to a sensitive cell (Pugsley, 1984). However, the low-molecular-

weight bacteriocins of Gram-positive bacteria generally appear to be membrane active

(Bruno and Montville 1993; Chikindas et al. 1993). The lantibiotic subgroup of

bacteriocins tends to differ from the other groups in the voltage dependence of their

membrane insertion (Garcera et al. 1993; Schuller et al. 1989). Poration complexes

(Klaenhammer, 1993; Nissen-Meyer et al. 1992) have been proposed to be formed

between one, two, or possibly even more species of amphipathic peptides, resulting in ion

leakage, loss of proton motive force, and ultimately cell death.

Classification of bacteriocins

Most of the bacteriocins from LAB are cationic, hydrophobic, or amphiphilic

molecules composed of 20 to 60 amino acid residues (Nes and Holo 2000). These

bacteriocins are commonly classified into 3 groups that also include bacteriocins from

other Gram-positive bacteria (Klaenhammer, 1993; Nes et al. 1996).

Lantibiotics (from lanthionine-containing antibiotic) are small (<5 kDa) peptides

containing the unusual amino acids lanthionine, α-methyllanthionine, dehydroalanine,

and dehydrobutyrine. These bacteriocins are grouped into class I bacteriocins. Class I is

further subdivided into type A and type B lantibiotics according to their chemical

structures and antimicrobial activities. Type A lantibiotics are elongated peptides with a

net positive charge that exert their activity through the formation of pores in bacterial

9

membranes. Type B lantibiotics are smaller globular peptides and have a negative, or no

net charge, and antimicrobial activity is related to the inhibition of specific enzymes.

Small (<10 kDa), heat-stable, non-lanthionine containing peptides are contained

in class II, the largest group of bacteriocins in this classification system. These peptides

are divided into 3 subgroups. Class IIa includes pediocin-like peptides having an N-

terminal consensus sequence -Tyr-Gly-Asn-Gly-Val-Xaa-Cys. This subgroup has

attracted much of the attention due to their anti-Listeria activity (Ennahar et al. 2000).

Class IIb contains bacteriocins requiring two different peptides for activity, and class IIc

contains the remaining peptides of the class, including sec-dependent secreted

bacteriocins.

The class III bacteriocins are not as well characterized. This group houses large

(>30 kDa) heat-labile proteins that are of lesser interest to food scientists. A fourth class

consisting of complex bacteriocins that require carbohydrate or lipid moieties for activity

has also been suggested by Klaenhammer (1993). However, bacteriocins in this class

have not been characterized adequately at the biochemical level and has been suggested

that the definition of this class requires additional descriptive information (Jimenez-Diaz

et al. 1993; McAuliffe et al. 2001).

Genetic organization and regulation of bacteriocin of lactic acid bacteria.

Organization of gene clusters: genetics and biosynthesis

Bacteriocins are ribosomally synthesized. The genes encoding bacteriocin

production and immunity are usually organized in operon clusters (Nes et al. 1996). For

10

linear unmodified bacteriocins, which include the plantaricins, carnobacteriocins, and

sakacins, it appears that specific inducing peptides or peptide pheromones stimulate

synthesis of bacteriocins that are usually located on the same gene cluster (Quadri et al.

1997). Bacteriocin gene clusters can be located on the chromosome as in the case of

subtilin and mersacidin (Altena et al. 2000), plasmids as in the case of divergicin A and

sakacin A (Axelsson and Holck 1995), or in transposons as in the case of nisin and

lacticin 481 (Dufour et al. 2000).

The lantibiotic biosynthesis operons generally contain genes coding for the

prepeptide (LanA - the abbreviation lan refers to homologous genes of different

lantibiotic gene clusters), enzymes responsible for modification reactions

(LanB,C/LanM), processing proteases responsible for removal of the leader peptide

(LanP), the ABC (ATP-binding cassette), super family transport proteins involved in

peptide translocation (LanT), regulatory proteins (LanR, K), and proteins involved in

producer self-protection (immunity) (LanI, FEG). This information was gathered from

studies on genetic analysis of several lantibiotics, including epidermin (Schnell et al.

1992), nisin (Buchmann et al. 1988), subtilin (Klein et al. 1992), lacticin 481 (Piard et al.

1992), and mersacidin (Altena et al. 2000).

The genetic regulation of the class II bacteriocins, lactococcins A, B, and M,

pediocin PA-1/AcH (pediocin PA-1 and AcH are the same molecule; the name of

pediocin PA-1 is more commonly used), plantaricin A and sakacin A have been studied.

Genes encoding the biosynthesis of class II bacteriocins share many similarities in their

genetic organizations, consisting of a structural gene coding for a precursor peptide,

followed immediately by a dedicated immunity gene and genes for an ABC-transporter

11

and an accessory protein. In some cases, regulatory genes have been found. The

accessory proteins are essential for the export of class II bacteriocins. No counterparts of

these accessory proteins in lantibiotics have been found (Nes et al. 1996; Sablon et al.

2000).

Biosynthetic pathway

Most bacteriocins are synthesized as a biologically inactive prepeptide carrying an

N-terminal leader peptide that is attached to the C-terminal propeptide. The biosynthetic

pathway of lantibiotics follows a general scheme: formation of the prepeptide,

modification reactions, proteolytic cleavage of the leader peptide, and the translocation of

the modified prepeptide or mature propeptide across the cytoplasmic membrane. A

typical series of events in bacteriocin production and transport include: (i) The formation

of prebacteriocin; (ii) Modification of the prebacteriocin by LanB and LanC that is

translocated through a dedicated ABC-transporter (LanT) and processed by LanP,

resulting in the release of a mature bacteriocin; (iii) The histidine protein kinase (HPK)

senses the presence of the bacteriocin and gets autophosphorylated; (iv) The phosphoryl

group (P) is subsequently transferred to the response regulator (RR); (v) The RR activates

transcription of the regulated genes; (vi) Lan FEG and LanI are associated with immunity

(Skaugen et al. 1997).

Class II bacteriocins are synthesized as a prepeptide containing a conserved N-

terminal leader and a characteristic double-glycine proteolytic processing site. Unlike the

lantibiotics, class II bacteriocins do not undergo extensive post-translational

modification. A typical series of events in bacteriocin production and transport include:

12

(i) The simultaneous production of an inducing factor (IF) along with the formation of the

prepeptide; (ii) The prepeptide is processed to remove the leader peptide concomitant

with export from the cell through a dedicated ABC-transporter and its accessory protein,

the same process occurs with the IF; (iii) The histidine protein kinase (HPK) senses the

presence of IF and gets autophosphorylated; (iv) The phosphoryl group (P) is

subsequently transferred to the response regulator (RR). The RR activates transcription of

the regulated genes (Nes et al. 1996).

Several functions of leader peptides have been proposed. They may serve as a

recognition site which directs the prepeptide towards maturation and transport proteins,

protecting the producer strain by keeping the lantibiotic in an inactive state while it is

inside the producer, and interacts with the propeptide domain to ensure a suitable

conformation essential for enzyme-substrate interaction (McAuliffe et al. 2001).

Post-translational modification, activation and transport

Ingram (1970) first proposed a two-step post-translational modification reaction

of a pre-lantibiotic leading to the formation of Lan/MeLan. Following the modification

reactions, the modified pre-lantibiotics undergo proteolytic processing to release the

leader peptide that leads to activation of the lantibiotic. The ABC-transporter contains

500 to 600 amino acids and is characterized by two membrane-associated domains. This

transports the bacteriocin across the membrane. Energy for the export process is provided

by ATP hydrolysis and likely occurs at the ATP-binding domains.

Substantial similarities exist between the leader peptides of class IIa, IIb and those

of lantibiotics. Both contain the characteristic double-glycine cleavage site (Nes et al.

13

1996). The conservation of the cleavage site strongly suggests that the mechanism of

processing and translocation of class IIa and IIb bacteriocins is very similar to that of the

lantibiotics. Class IIc bacteriocins are processed by a signal peptidase during

translocation across the cytoplasmic membrane.

Regulation of biosynthesis

The biosynthesis of lantibiotics and non-lantibiotics is usually regulated through a

well known two-component regulatory system. These regulatory systems consist of two

signal-producing proteins; a membrane bound histidine protein kinase (HPK), and a

cytoplasmic response regulator (RR) (Stock et al. 1989; Parkinson, 1993; Nes et al.

1996). In this signal transduction pathway, HPK autophosphorylates the conserved

histidine residue in its intracellular domain when it senses a certain concentration of

bacteriocins in the environment. The phosphoryl group is subsequently transferred to the

RR resulting in the intramolecular change and this activates the transcription of the

regulated genes. These regulated genes include the structural gene, the export genes, the

immunity genes, and in some cases, the regulatory genes themselves. For nisin and

subtilin, the bacteriocin molecule itself apparently acts as an external signal to

autoregulate its own biosynthesis via signal transduction (Kuipers et al. 1995). In

contrast, most class II bacteriocins produce a bacteriocin-like peptide with no

antimicrobial activity and use it as an inducing factor (IF) to activate the transcription of

the regulated genes. The IF is a small, heat-stable, cationic and hydrophobic peptide that

is first synthesized as a prepeptide with a double-glycine leader sequence. A dedicated

ABC-transporter specifically cleaves the leader peptide of IF concomitant with export of

14

the mature peptide from the cell. The secreted IF acts as an external signal that triggers

transcription of the genes involved in bacteriocins production (Nes et al. 1996).

Producer immunity

Two systems of lantibiotic immunity in the producing cell have been identified.

Protection can be mediated by immunity proteins, LanI, and dedicated ABC-transport

proteins, LanFEG, which can be encoded on multiple open-reading frames (Reis et al.

1994). These two immunity systems work synergistically to protect producing cells from

their own bacteriocin. LanI, which is most likely attached to the outside of the

cytoplasmic membrane, probably confers immunity to the producer cells by preventing

pore formation by the bacteriocin. LanFEG apparently acts by transporting bacteriocin

molecules that have inserted into the membrane back to the surrounding medium and thus

keeping the concentration of the bacteriocin in the membrane under a critical level.

For class II bacteriocins the immunity gene usually codes for a dedicated protein

that is loosely associated with the cytoplasmic membrane. Quadri et al. (1995) using

Western blot (immunoblot) analysis, indicated that the major part of the immunity protein

CbiB2 of carnobacteriocin B2 is found in the cytoplasm and that a smaller proportion is

associated with the membrane. Similarly, Abdel-Dayem et al. (1996) have demonstrated

that the majority of the immunity protein MesI of mesentericin Y105 is in the cytoplasm,

with only a small proportion detected in the membrane. The immunity protein, which is

cationic and ranges in size from 51 to 254 amino acids, provides total immunity against

the bacteriocin. Interaction of the immunity protein with the membrane appears to protect

the producer against its own bacteriocins.

15

Mode of action

Antimicrobial spectrum

The low molecular weight bacteriocins of Gram-positive bacteria demonstrate

bactericidal activity which is directed principally against certain other Gram-positive

bacteria (Tagg et al. 1976). For example, the lantibiotic nisin has been shown to be

effective against many strains of Gram-positive bacteria, including staphylococci,

streptococci, bacilli, clostridia, and mycobacteria (Hurst, 1981).

Similarly, among the non-lanthionine containing bacteriocins some, like pediocin

AcH, have a wide range of action against Gram-positive bacteria, while others, such as

lactococcin A, have a much narrower range and are effective against only a few strains of

Lactococcus lactis (De Vuyst and Vandamme 1994; Van Belkum et al. 1991). Several

other general observations may be made which apply to the antibacterial activities of the

low molecular weight bacteriocins: (i) within a given species, some strains may be

sensitive and others may be resistant to a particular bacteriocin (Hurst, 1981); (ii) a strain

that appears to be sensitive to a bacteriocin may also have some cells in the population

that are resistant to it (Hanlin et al. 1993); (iii) a strain can be sensitive to one bacteriocin

while being resistant to a similar type of bacteriocin (Hanlin et al. 1993; Yang et al.

1992); (iv) cells of a strain producing one bacteriocin can be sensitive to another

bacteriocin (Hanlin et al. 1993); (v) although the spores of a strain whose cells are

sensitive to a bacteriocin are resistant to that bacteriocin, the vegetative cells maybe

sensitive following germination (Hurst, 1981); and (vi) under normal conditions, Gram-

16

negative bacteria are not sensitive to bacteriocins produced by Gram-positive bacteria

(Hurst, 1981; Bhunia et al. 1988).

The details of the mechanism(s) by which Gram-negative bacteria and certain

Gram-positive bacteria manifest resistance to bacteriocins are generally not well

understood. However, this resistance does appear to differ from the specific immunity

displayed by a producer strain to its own bacteriocin product. The possible mechanism of

bacteriocin resistance of Gram-negative and some Gram-positive bacteria has been

suggested to be associated with the barrier properties of the outer membrane and the cell

wall (Stevens et al. 1991).

Primary mode of action

Several features of the mode of action of the non-lanthionine containing

bacteriocins of Gram-positive bacteria require further explanation: (i) the reason why, for

two sensitive strains, one undergoes lysis following treatment with a particular

bacteriocin while the other does not, is not known (Bhunia et al. 1991); (ii) for a

bacteriocin to come into contact with the cytoplasmic membrane of sensitive cells, the

molecules must first pass through the cell wall; the mechanism of this translocation

remains to be understood; and, finally, (iii) there is evidence that non-lanthionine

containing bacteriocin molecules may be adsorbed on the surface of most Gram-positive

bacterial cells, including sensitive, resistant, and producer strains; the influence of this is

not yet fully understood (Bhunia et al. 1991; Yang et al. 1992).The non-lanthionine

containing bacteriocins also appear to affect their bactericidal action by destabilizing the

17

cytoplasmic membrane of sensitive cells; however, the mechanism through which they

achieve this appears to differ somewhat from that described for the lantibiotics.

In general, it appears that the bactericidal action of the non-lanthionine containing

bacteriocins against sensitive cells is produced principally by destabilization of

membrane functions, such as energy transduction, rather than by disruption of the

structural integrity of the membrane. This effect results from the energy independent

dissipation of the proton motive force (PMF) and loss of the permeability barrier of the

cytoplasmic membrane and contrasts with the energy-dependent bactericidal action of the

lantibiotics. Both the lantibiotic and non-lanthionine containing bacteriocins seem to

affect the membrane permeability barrier by forming water-filled membrane channels or

pores, probably by a barrel-stave mechanism (Klaenhammer, 1993). In addition, prior to

the formation of pores, all of the non-lanthionine containing bacteriocins appear to

interact with membrane associated receptor proteins, again, in direct contrast to the

lantibiotic type bacteriocins which appear to have no such requirement (Schuller et al.

1989). Furthermore, producer strains harboring an immunity gene appear to produce

specific immunity proteins that prevent pore formation by the bacteriocin by an

unidentified mechanism(s). However, this might be accomplished either by shielding of

the receptor protein, by competitive interaction with the bacteriocin molecules, or by

closing or blocking the pores (Nissen-Meyer et al. 1993; Venema et al. 1993).

Secondary mode of action

In addition to their membrane pore-forming capabilities, both Pep5 and nisin have

been shown to induce autolysis in Staphylococcus. As seen with lanthionine bacteriocins

18

(nisin) it is suggested that following membrane depolarization by pore formation, since

the pores formed in the membrane are not sufficiently large to allow efflux of high

molecular weight components, there should be enhanced osmoinduced influx of water

through the pores. The resulting increase in osmotic pressure will encourage subsequent

cell lysis. Conflicting results have been reported concerning the ability of non-lanthionine

containing bacteriocins to induce lysis of sensitive cells.

Following treatment with lactococcin A, sensitive L. lactis cells and membrane

vesicles derived from these cells showed neither lysis nor other morphological alterations

when examined by electron microscopy. They suggested that the loss of barrier functions

of the membrane of sensitive cells occurs not as a result of lysis but as a result of pore

formation. Bhunia et al. (1991) have also suggested that the primary killing action of non-

lanthionine containing bacteriocins, such as pediocin AcH, is destabilization of

cytoplasmic membranes, but that cell death may activate autolytic systems and bring

about lysis in some strains.

Passage across the cell wall

The loss of viability of sensitive cells of Gram-positive bacteria following

treatment with a number of the non-lanthionine containing bacteriocins occurs very

rapidly, perhaps within one minute (Bhunia et al. 1991). Since cell death appears to occur

through destabilization of the cytoplasmic membrane, the bacteriocin molecules must

cross the cell wall before establishing contact with the membrane. However, the

mechanism(s) of bacteriocin passage through the cell wall has not yet been critically

19

studied. Simple diffusion models fail to entirely account for many of the observations

regarding the action of these bacteriocins.

Many bacteriocins have been reported to have greater bactericidal activity at low

pH. The peptides carry both positive and negative charges with a net positive charge

below pH 7. Both non-lanthionine containing bacteriocins and lantibiotic molecules are

adsorbed to the cell surfaces of Gram-positive bacteria, irrespective of their being

bacteriocin producer, nonproducer, resistant, or sensitive. A recent study of several of

these bacteriocins has shown that their degree of adsorption is pH dependent, with a

maximum at about pH 6.0 and a minimum at or below pH 2.0 (Yang et al. 1992). These

observations further support the suggestion that initial adsorption occurs through ionic

attraction between the bacteriocin molecules and the cell surface. The molecular

components on the cell surfaces of Gram-positive bacteria to which bacteriocin

molecules are adsorbed are thought to include teichoic and lipoteichoic acids (Bhunia et

al. 1991).

Therefore, it has been suggested that adsorption of bacteriocin molecules can

induce a change in cell wall barrier functions only in sensitive Gram-positive bacteria,

rendering the wall more permeable to the bacteriocin. No such change occurs following

adsorption to bacteriocin resistant cells (Kalchayanand et al. 1992; Ray, 1993).

Importance of three dimensional structures

Hydropathy plots of lactococcin A indicate that the carboxy terminus has a

hydrophobic region which is thought to form an amphiphilic membrane-spanning helix.

The bacteriocin appears to interact with receptor proteins in the cytoplasmic membrane of

20

the sensitive cells, form a helical transmembrane structure, and, probably in conjunction

with additional lactococcin A molecules which might form a water-filled barrel stave like

structure, increase the membrane permeability. Current models of pore formation by

lantibiotics and non-lantibiotics are based on structural data (Freund et al. 1991; Vogel et

al. 1993) and suggest that cationic lantibiotics are attracted to the membrane by ionic

interaction. When sufficient peptides come together, electrostatic repulsion between the

positive charges may be responsible for pushing open the transmembrane channel. It is

not yet clear when the peptides might aggregate (i.e., before or after they adopt a

transmembrane orientation), which terminus remains on the outside of the membrane or

whether insertion is bidirectional, and how many peptides represent the minimum

requirement for pore formation.

Detection of bacteriocins produced by lactic acid bacteria (LAB).

Traditional methods

The demonstration of antagonism from one strain of bacteria against another is

very common. Bacteriocins are only one category of substances produced by bacteria that

are inhibitory to other bacteria. In any ecological niche, one type of bacteria can be more

competitive than another regarding nutrient uptake or sensitivity to an environmental

factor, such as available oxygen. With such a wide range of possible inhibitory products

or conditions, it is no wonder that some bacteriocin-like activities may not be caused by

bacteriocins at all. When investigating bacteriocins synthesized by LAB, one must

always be aware of the presence of relatively high amounts of organic acids, and take

appropriate steps to determine or eliminate acidic effects.

21

Agar diffusion method

A common method for screening bacteriocin activity involves the use of agar

media contained in petri plates. Piddock (1990) has reviewed a number of these methods

for detection and measurement of bacteriocin activity. There are many variations, most of

them derivatives of the “spot-on-lawn” approach, which can involve an agar overlay. The

direct simultaneous tests are the simplest. In this approach, the bacteriocin from the

producer culture is spotted on the indicator cultures and these plates are incubated

concurrently before examination for zones of inhibition around the growth of producing

cultures. Deferred methods allow separation of the independent variables of time and

conditions of incubation for the bacteriocin-producing and indicator strains and are often

more sensitive than direct tests (Tagg et al. 1976). Kekessy and Piguet (1970) described a

procedure in which the producing and indicator strains were each grown on different

optimal media. The producing culture was spot-inoculated onto a spread plate, and after

growth, the agar mass was aseptically dislodged with a spatula from the petri dish bottom

and transferred to the lid of the dish. A soft agar overlay seeded with the indicator was

then poured over the inverted agar. Following re-incubation, bacteriocin-positive cultures

displayed a halo of clearing in the lawn around the original button of growth. This assay

minimizes the effects of acids and bacteriophages, since the bacteriocin-producing and

indicator strains are physically separated by an agar layer.

Mass spectrometry

Mass spectrometry has been adapted for the rapid detection of pediocin, nisin,

brochocins A and B, and enterocins A and B from culture supernatants by Rose et al.

22

(1999). The method is called matrix-assisted laser desorption/ionization time-of-flight

mass spectroscopy (MALDI-TOF MS) and was originally devised for the examination of

large molecules, such as biopolymers. In the protocol, a 30-s water wash of the

supernatant is intended to remove interfering compounds; however, this step of the

procedure requires improvement to eliminate the contaminating and interfering

substances found in foods that prevent accurate identification of the bacteriocins.

Hybridization method

Rodriguez et al. (1998) detected enterocin AS-48 from Enterococci isolated from

milk and dairy products using dot-blot and colony hybridization. Genes encoding for the

synthesis of AS-48 have been sequenced and a Polymerase Chain Reaction (PCR)

technique developed for rapid detection of these genes in isolated strains. Colony

hybridization allowed for a more rapid technique in which cultures are spotted on MRS

agar, incubated, and colony growth is transferred to membranes for lysis with subsequent

hybridization using a DNA probe.

Flow cell cytometry

In a flow cell, Mugochi et al. (2001) developed a rapid and sensitive method for

detection of bacteriocins in fermentation broth. Low concentrations of potassium ions

were measured, so that released potassium ions from a bacteriocin-sensitive indicator

strain directly correlated to concentrations of crude bacteriocin present in fermentation

broth injected into the cell. This method compared very well to a conventional agar well

diffusion assay.

23

PCR detection methods

Molecular methods used for the detection of bacteriocins have some improved

aspects over the traditional methods. The PCR technique has been used to rapidly identify

lactobacilli that may produce well-characterized bacteriocins, instead of relying on the

use of complex biochemical techniques which are usually required for the identification

and characterization of such bacteriocins. PCR methods have been used to detect genes

responsible for bacteriocin production and regulation in bacterial cultures. Rodriguez et

al. (1995) demonstrated the amplification of a 75 bp gene fragment of the lactocin S

structural gene in seven bacteriocinogenic strains of lactobacilli isolated from fermented

sausages. In another work, Garde et al. (2001) detected the genes necessary for the

synthesis of lacticin 481 and nisin using PCR techniques with specific probes on an

isolate of L. lactis subsp. lactis.

In an effort to reduce the time necessary for detection, methods to simplify or

even eliminate the need for post-amplification gel assays have been introduced. A

method for PCR quantification has been devised and is called “real-time” PCR because

use of a fluorescent label allows the user to actually view the increase in the amount of

target DNA as it is amplified. The real-time PCR system is based on detection and

quantification using one of the several types of fluorescent reporter molecules. This

signal increases in direct proportion to the amount of PCR product in the reaction (Heid

et al. 1996). A thermocycler fitted with a fluorescence detection system measures the

fluorescence in specially designed tubes that contain the reaction components. The

amplification results in a characteristic sigmoid shaped curve which represents three

phases of PCR: the lag phase (little product accumulation), the exponential phase (rapid

24

product accumulation) and the plateau phase (no further product is amplified). By

recording the amount of fluorescence emission in each cycle, it is possible to monitor the

PCR during the exponential phase where the first significant increase in the fluorescence

directly correlates with the initial amount of target template and the PCR cycle at which

this fluorescence is measured is referred to as a threshold cycle (Ct) (Higuchi et al. 1992,

Sawyer et al. 2003).

There are generally several methods of fluorescence quantification based on the

principle of fluorescent probes or DNA binding agent which includes: 1) TaqMan®

probes 2) Molecular Beacons 3) AmplifluorTM 4) SYBR Green dye. Since real-time PCR

does not require a post PCR manipulation (closed tube) and also avoids the cross

contamination of the PCR amplicons, it becomes highly suitable for food industries

where they can be used for routine applications towards rapid pathogen detection with

ease of use and high throughput (Zhang et al. 2003).

SYBR Green method

SYBR Green (SG) chemistry is an alternate method used to perform real-time

PCR analysis. SG is a dye that binds to the minor groove of double stranded DNA. When

the SG dye binds to double-stranded DNA, the intensity of the fluorescent emissions

increases. As more double-stranded amplicons are produced, the SG dye signal will

increase. This technique requires no specific probe and classic PCR protocols can be

easily adapted. One reason that SG is often used is that it is relatively inexpensive

compared to other detection chemistries. Additionally, SG allows confirmation of

amplicons by melting curve analysis, producing a characteristic melting temperature

25

(Tm) for an amplicon that is analogous to the detection of a specific sized fragment by

electrophoresis (Giglio et al. 2003).

TaqMan® probes

The TaqMan® probe is an oligonucleotide probe labeled with a fluorescent

reporter dye on the 5' end and quencher molecule on the 3' end which is hybridized to an

internal region intended to be amplified. The close proximity of the dye and quencher

results in negligible fluorescence when the probe is intact. However, during PCR

amplification, the 5'-nuclease activity of Taq DNA polymerase cleaves the probe,

separating the dye and quencher resulting in an increase in fluorescence. Accumulation of

PCR products is detected directly by monitoring the increase in fluorescence of the

reporter dye. Martin et al. (2006) reports the use of TaqMan® probes as a sensitive assay

for reliable quantitative identification of a bacteriocin produced by L. sakei in meat

products.

Advantages: Since a ratio of the specific hybridization between the probe and

target sequence must occur to generate fluorescence, non-specific products and primer-

dimers will not affect the fluorescent signal. Furthermore, by labeling multiple probes

with different dyes, multiplex reactions can be done to track different targets with a

different color flurophore. Disadvantages: The cost to run these probes has increased

because different probes need to be synthesized for different target sequences, thus

raising the running costs. However, TaqMan® is a cost effective option when the same

sequence is tested numerous times. (Nazarenko et al. 1997).

26

Molecular beacons

The molecular beacon fluorescent probe contains a short complementary

sequence of nucleotides attached to the 5’ and 3’ ends of the probe sequence so that a

stem-loop structure forms in solution (i.e., the “loop” is comprised of sequence related to

a specific target sequence). A fluorophore and a suitable quencher are attached via linkers

to the ends of the stem. In the absence of the target, the fluorophore and quencher are

held close together by the stem structure and fluorescence is quenched. However, when

the single-stranded loop hybridizes with a complementary target sequence, the stem

denatures and fluorescence appears because the flurophore and quencher molecules are in

close proximity as they are in the stem-loop conformation. Since these probes fluoresce

strongly only in the presence of their target, they can be used in solution and the removal

of the unhybridized probe is unnecessary (Tyagi and Kramer 1996).

AmplifluorTM uniprimerTM real-time PCR

The AmplifluorTM universal amplification and detection system utilizes a

molecular energy transfer system that uses an acceptor moiety to quench fluorescence

from an excited fluorophore (Nazarenko et al. 1997). The fluorophore (fluorescein) and

quencher (DABSYL) are located on the same oligonucleotide primer. The UniPrimerTM

primer has a universal format, as it will bind to any amplified DNA containing a unique

recognition sequence that can be added to existing PCR primers. The UniPrimerTM will

only emit fluorescence when incorporated into amplification products; unincorporated

UniPrimerTM does not fluoresce strongly. It is also possible to obtain custom primers with

the UniPrimerTM sequence already included.

27

These real-time PCR methods have been used to detect bacteriocin-producing

LAB by amplification of the bacteriocin structural genes or other genes involved with

bacteriocins operons. No reports have been published whereby bacteriocins have been

identified using an array of primers for all known structural genes from LAB.

Bacteriocin resistance

The presence of an antibacterial substance in a given environment will eventually

select for a variety of bacteria resistant to the antagonistic component. As found with

therapeutic antibiotics in the environment, bacteriocin-resistant mutants do occur.

Gravesen et al. (2002) examined the responses of a number of strains of L.

monocytogenes to pediocin PA-1 and nisin, and found a wide range of resistances to the

two bacteriocins occurring naturally. The influence of environmental stress (reduced pH,

low temperature, and the presence of sodium chloride) appeared bacteriocin-specific.

These stresses did not influence the frequency of resistance to pediocin PA-1, but the

frequency of nisin resistance was significantly reduced. Also of interest, the stability of

the phenotype of nisin resistance varied substantially, while resistance to the pediocin

was stable with ongoing growth of L. monocytogenes. Fitness costs as measured by

reduced growth rate in pediocin-resistant mutants were demonstrable, but nisin-resistant

mutants showed limited growth rate reductions. The bacteriocin-resistant mutants of L.

monocytogenes were not more sensitive to the applied environmental stresses than wild-

type strains and in a model sausage system their growth differences were minimal.

The genes for synthesis of pediocin PA-1 were transferred into nisin-producing L.

lactis FI5876 by Horn et al. (1998, 1999). As a result, both pediocin PA-1 and nisin A

28

were synthesized concurrently in this strain of Lactococcus. Production levels of pediocin

PA-1 were at the same levels as found in the original producer strain, P. acidilactici 347.

Since pediocin PA-1 and nisin A are unrelated bacteriocins, use of L. lactis FI5876 as a

starter culture in fermented dairy products should prevent the emergence of any

bacteriocin-resistant isolates of L. monocytogenes because the frequency for emergence

of a strain resistant to both peptides should be low.

Modi et al. (2000) evaluated resistance to nisin by L. monocytogenes to ask the

question of whether spontaneous nisin resistance leads to increased heat resistance

relative to the wild-type strains. In the absence of nisin, there was no significant

difference in heat resistance as shown by D-values. When nisin-resistant L.

monocytogenes were grown in the presence of nisin at 55ºC, the cells became more

sensitive to heat. When nisin-resistant cells were subjected to a combined treatment of

nisin and heat, there was a synergistic effect of inactivation. After exposure to heat, nisin-

resistant cells once again became sensitive to the effects of nisin. In the case of L.

monocytogenes, resistance to nisin did not appear to be particularly stable, nor impart an

undesirable effect of heightened heat resistance.

A natural concern about using bacteriocins for the preservation of food is the

selection of resistant strains. Treatment with a combination of bacteriocins, for instance

nisin and a class IIa bacteriocin would theoretically reduce the incidence of resistance

(Bouttefroy and Milliere 2000, Vignolo et al. 2000). There is currently conflicting

evidence as to whether resistance to one class of LAB bacteriocins can result in cross-

resistance to another class (Bouttefroy and Milliere 2000, Song and Richard 1997). There

29

have been no reports thus far for the selection of bacteriocin-resistant mutants towards

several bacteriocins and grouping these into different resistant classes.

Food applications

Consumers have been consistently concerned about possible adverse health

effects from the presence of chemical additives in their foods. As a result, consumers are

drawn to natural and “fresher” foods with no chemical preservatives added. This

perception, coupled with the increasing demand for minimally processed foods with long

shelf life and convenience, has stimulated research interest in finding natural but effective

preservatives. Bacteriocins produced by LAB, may be considered natural preservatives or

biopreservatives that fulfill these requirements. Biopreservation refers to the use of

antagonistic microorganisms or their metabolic products to inhibit or destroy undesired

microorganisms in foods to enhance food safety and extend shelf life (Schillinger et al.

1996).

Three approaches are commonly used in the application of bacteriocins for

biopreservation of foods (Schillinger et al. 1996):

(1) Inoculation of food with LAB that produce bacteriocin in the products. The ability of

the LAB to grow and produce bacteriocin in the products is crucial for its successful use.

(2) Addition of purified or semi-purified bacteriocins as food preservatives.

(3) Use of a product previously fermented with a bacteriocin-producing strain as an

ingredient in food processing.

30

Biopreservation of meat products

The United States government has the most rigid policy regarding L.

monocytogenes and set a zero tolerance level for L. monocytogenes in ready-to-eat foods.

It has been detected in a variety of foods and implicated in several food borne outbreaks,

such as turkey franks (Jay, 1996). Many studies have been carried out to control L.

monocytogenes in meat products since it is common within slaughterhouse and meat

packing environments and has been isolated from raw meat, cooked and ready-to-eat

meat products (Ryser and Marth 1999).

The activity of nisin alone at concentrations of 400 and 800 IU/g (International

Units/g) and in combination with 2% sodium chloride against L. monocytogenes in

minced raw buffalo meat was examined by Pawar et al. (2000). Addition of 2% sodium

chloride in combination with nisin was found to increase the efficacy of nisin. Adding

10000 IU/ml of nisin to inoculated cooked tenderloin pork inhibited the growth of L.

monocytogenes, but not Pseudomonas fragi. Nisin was found to be more effective when

used in combination with modified atmosphere packaging [MAP] (100% CO2 or 80%

CO2 + 20% air). MAP and nisin (1000 or 10000 IU/ml) inhibited growth of both

organisms, and this inhibitory effect for MAP/nisin combination system was more

pronounced at 4°C than at 20°C.

Hugas et al. (1998) found that sakacin K, a bacteriocin produced by Lactobacillus

sake CTC494, inhibited the growth of Listeria innocua in vacuum-packaged samples of

poultry breasts and cooked pork, and in MAP samples of raw minced pork. Vignolo et al.

31

(1996) showed that lactocin 705 produced by Lactobacillus casei CRL 705 inhibited the

growth of L. monocytogenes in ground beef.

Biopreservation of dairy products

L. monocytogenes has been the documented cause of a number of outbreaks

associated with dairy products, such as pasteurized milk and cheese. Nisin has been

shown effective against L. monocytogenes in dairy products (Fleming et al. 1985).

A problem in cheese production is the Clostridium-associated butyric acid

fermentation. Nisin is commonly added to pasteurized, processed cheese spreads to

prevent the outgrowth of clostridial spores, such as Clostridium tyrobutyricum

(Schillinger et al. 1996).

Lacticin 3147, a broad-spectrum, two-component bacteriocin produced by L.

lactis subsp. lactis DPC 3147, is used to control cheddar cheese quality by reducing non-

starter LAB populations during ripening (Ross et al. 1999). Cheese manufactured with

the lacticin 3147, contained 2 log10 less non-starter LAB than control cheese after 6 mo of

ripening. The lacticin 3147 producing transconjugant has also been used as a protective

culture to inhibit Listeria on the surface of a mold-ripened cheese. Presence of the

lacticin 3147 producer on the cheese surface reduced the number of L. monocytogenes by

3 log10 cycles (Ross et al. 1999).

Apart from using nisin, a bacteriocin (pediocin) produced by Pediococcus

acidilactici PAC1.0 has shown to inhibit Gram-positive spoilage organisms like

lactobacilli in salad dressings (Gonzalez 1987). Also, reports show the effectiveness of

32

pediocin AcH to reduce the population of L. monocytogenes and L. ivanovii in cottage

cheese, ice cream and reconstituted dry milk.

US patent 4,883,673 by Gonzalez describes the use of PA-1 in a salad dressing

composition to inhibit Lactobacillus bifermentans that was added at a concentration of

103 cfu/g. The experiments were conducted at 25°C for 7 days. PA-I at 200AU/g

(Arbitrary Units/g) was able to prevent spoilage of the salad dressing, which was

confirmed through organoleptic and microbiological evaluation.

Biopreservation of seafood products

The effectiveness of bacteriocins and protective cultures to control growth of L.

monocytogenes in vacuum packed cold smoked salmon has been demonstrated by several

researchers. The inhibitory effect of sakacin P against L. monocytogenes was examined in

cold-smoked salmon. When L. sake culture was added to salmon together with sakacin P,

a bactericidal effect against L. monocytogenes was observed.

The inhibitory effect of nisin, in combination with carbon dioxide and low

temperature, on the survival of L. monocytogenes in cold smoked salmon has also been

investigated (Nilsson et al. 1997). Addition of nisin to CO2-packed cold smoked salmon

resulted in a 1 to 2 log10 reduction of L. monocytogenes.

In order to improve shelf life, brined shrimp are typically produced with the

addition of sorbic and benzoic acids. Concerns about the use of these organic acids have

led researchers to explore the potential of using bacteriocins for their preservation. The

effectiveness of nisin Z, carnocin UI49, and a preparation of crude bavaricin A on shelf

33

life extension of brined shrimp was evaluated. Carnocin UI49 did not extend the shelf life

compared to the control (10 day shelf life), while bavaricin A resulted in a shelf life of 16

days. Nisin Z delivered a shelf life of 31days. The benzoate-sorbate solution was superior

as it preserved the brined shrimp for the entire storage period of 59 days.

In a study using vacuum-packed cold smoked rainbow trout, the inhibition of L.

monocytogenes and mesophilic aerobic bacteria by nisin, sodium lactate, or their

combination was examined. The combination of nisin and sodium lactate injected into

smoked fish decreased the count of L. monocytogenes from 3.3 to 1.8 log10 CFU/g over

16 days of storage at 8°C.

Hurdle technology to enhance food safety

The major functional limitations for the application of bacteriocins in foods are

their relatively narrow activity spectra and moderate antibacterial effects. Moreover, they

are generally not active against Gram-negative bacteria. To overcome these limitations,

more and more researchers use the concept of hurdle technology to improve shelf life and

enhance food safety. Nisin enhances thermal inactivation of bacteria, thus reducing the

treatment time, resulting in better food quality. Addition of nisin (500 to 2500 IU/ml) in

liquid whole egg or egg white caused a reduction of required pasteurization time of up to

35% (Boziaris et al. 1998). Nisin reduced the heat resistance of L. monocytogenes in

lobster meat and significantly reduced the treatment time compared with thermal

treatment alone. The reduced heat process resulted in significant reduction in drained

weight loss that would allow considerable cost savings. The synergistic effect between

bacteriocins and other processing technologies on the inactivation of microorganisms has

34

also been frequently reported. A synergistic effect between sodium diacetate and pediocin

against L. monocytogenes in meat slurries has been reported by Schlyter et al. (1993).

A listericidal inhibitory effect of approximately 7 log10 CFU/ml was observed in

treatments containing pediocin (5000 AU/ml) with 0.5% diacetate at 25°C and pediocin

with 0.3% diacetate at 4°C. Zapico et al. (1998) showed a synergistic effect of nisin and

the lactoperoxidase system on the inactivation of L. monocytogenes in skim milk.

Addition of nisin and the lactoperoxidase system resulted in counts of L. monocytogenes

up to 5.6 log10 cycles lower than the control milk after 24 h at 30°C. The use of

combinations of various bacteriocins has also been shown to enhance antibacterial

activity. Nisin and leucocin F10 provided greater activity against L. monocytogenes when

used in combination (Parente et al. 1998).

There has been continued interest in the food industry for using nonthermal

processing technologies, such as high hydrostatic pressure (HP) and pulsed electric field

(PEF) in food preservation. It is frequently observed that bacteriocins, in combination

with these processing techniques, enhance bacterial inactivation. Gram-negative bacteria

that are usually insensitive to LAB bacteriocins, such as E. coli O157:H7 and S.

typhimurium, become sensitive following HP/PEF treatments that induce sub lethal injury

to bacterial cells (Kalchayanand et al. 1994).

Bacteriocins in packaging films

Incorporation of bacteriocins into packaging films to control food spoilage and

pathogenic organisms has also been an area of active research. An antimicrobial

packaging film prevents microbial growth on the food surface by direct contact of the

35

package with the surface of foods, such as meats and cheese. For this method to work, the

antimicrobial packaging film must contact the surface of the food so that bacteriocins can

diffuse to the surface. The gradual release of bacteriocins from a packaging film to the

food surface may have an advantage over dipping and spraying foods with bacteriocins.

In the latter processes, antimicrobial activity may be lost or reduced due to inactivation of

the bacteriocins by food components or dilution below active concentration due to the

migration into the foods (Appendini and Hotchkiss 2002).

Two methods have been commonly used to prepare packaging films with

bacteriocins. One is to incorporate bacteriocins directly into polymers and the other is the

incorporation of nisin into biodegradable protein films. Both cast and heat-press films,

formed excellent films and inhibited the growth of Lactobacillus plantarum. Siragusa et

al. (1999) incorporated nisin into a polyethylene based plastic film that was used to

vacuum pack beef carcasses. Nisin retained activity against Lactobacillus helveticus and

Bacillus thermosphacta inoculated in carcass surface tissue sections. Coma et al. (2001)

incorporated nisin into edible cellulosic films made with hydroxypropylmethylcellulose

by adding nisin to the film forming solution. An inhibitory effect was demonstrated

against L. innocua and Staphylococcus aureus, but film additives, such as stearic acid,

used to improve the water vapor barrier properties of the film, significantly reduced

inhibitory activity.

Another method to incorporate bacteriocins into packaging films is to coat or

adsorb bacteriocins to the polymer surface. Examples include nisin/methylcellulose

coatings for polyethylene films and nisin coatings for poultry, adsorption of nisin on

polyethylene, ethylene vinyl acetate, polypropylene, polyamide, polyester, acrylics, and

36

polyvinyl chloride (Appendini and Hotchkiss 2002). The efficacy of bacteriocin coatings

on the inhibition of pathogens has also been demonstrated. Coating of pediocin onto

cellulose casings and plastic bags has been found to completely inhibit growth of

inoculated L. monocytogenes in meats and poultry through 12 wk storage at 4°C (Ming et

al. 1997). Coating of solutions containing nisin, citric acid, EDTA, and Tween 80 onto

polyvinyl chloride, low density polyethylene, and nylon films reduced the counts of

Salmonella typhimurium in fresh broiler drumstick skin by 0.4 to 2.1 log10 cycles after

incubation at 4°C for 24 h (Natrajan and Sheldon 2000).

Conclusion

Although intensive studies over the last decade have greatly advanced our

knowledge base about bacteriocins, further work is needed before we are able to fully

understand the molecular mechanisms, structure-function relationships, and mechanisms

of action of bacteriocins. In the biosynthesis of lantibiotics, the function of the enzymes

responsible for modification reactions is still not clearly understood. The mechanism of

producer immunity remains to be answered. Research in these areas is critical for the

effective applications of bacteriocins and would help develop methods to genetically

engineer bacteriocins with better activity, solubility, and stability.

Although many bacteriocins have been isolated and characterized, only a few

have demonstrated commercial potential in food application. Nisin is the only purified

bacteriocin approved for food use in the U.S. It has been used as a food preservative in

more than 50 countries, mainly in cheese, canned vegetables, various pasteurized dairy,

liquid egg products, and salad dressings. The applications of other bacteriocins in food

37

preservation have been studied intensively. The use of pediocin PA-1 for food

biopreservation has been commercially exploited and is covered by several U.S. and

European patents (Ennahar et al. 2000b). Fermentate containing pediocin PA-1 and

AltaTM, is commercially available and used as a food preservative to increase shelf life

and inhibit the growth of bacteria, especially L. monocytogenes in ready-to-eat meats.

Lacticin 3147, which is active over a wider pH range than nisin, is expected to find

applications in non-acid foods (Ross et al. 1999).

Many interacting factors influence the development of bacteriocin-resistance

during the biopreservation of food. In order to increase the efficiency of bacteriocins as

food preservatives, it may be necessary to incorporate bacteriocins from different

resistant classes. In doing so, the incidence of food spoilage organisms developing

resistance towards bacteriocins can be minimized because even if an organism develops

resistance towards one class, it may still be sensitive to the other class and hence its

growth will continue to be inhibited.

Since bacteriocins that have been used as food preservatives have relatively

narrow activity spectra and are generally not active against Gram-negative bacteria, it can

be expected that nisin and other bacteriocins will continue to be incorporated and

developed into hurdle concept technologies for food preservation. The simultaneous

application of bacteriocins and nonthermal processing technologies, such as HP and PEF,

to improve shelf life of foods is attractive since foods produced using these non-thermal

technologies usually have better sensory and nutritional qualities compared with products

produced using conventional thermal processing methods.

38

REFERENCES

1. Abdel-Dayem, M., Fleury, Y., Devilliers, G., Chaboisseau, E., Girard, R.,

Nicolas, P., and A. Delfour. 1996. The putative immunity protein of the Gram-

positive bacteria Leuconostoc mesenteroides in preferentially located in the

cytoplasm compartment. FEMS Microbiol. Lett. 138:251-9.

2. Altena, K., Guder, A., Cramer, C., and G. Bierbaum. 2000. Biosynthesis of

the lantibiotic mersacidin: organization of a type B lantibiotic gene cluster. Appl.

Environ. Microbiol. 66:2565-71.

3. Appendini, P., and J. H. Hotchkiss. 2002. Review of antimicrobial food

packaging. Innov. Food Sci. Emerg. Technol. 3:113-126.

4. Axelsson, L., and A. Holck. 1995. The genes involved in production of and

immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706. J. Bacteriol.

177:2125-37.

5. Bhunia, A.K., Johnson, M.C., and B. Ray. 1988. Purification, characterization

and antimicrobial spectrum of a bacteriocin produced by Pediococcus acidilactici

H. J. Appl. Bacteriol. 65:261–268.

6. Bhunia, A.K., Johnson, M.C., Ray, B., and N. Kalchayanand. 1991. Mode of

action of pediocin AcH from Pediococcus acidilactici H on sensitive bacterial

strains. J. Appl. Bacteriol. 70:25–30.

39

7. Bouttefroy, A., and J. Milliere. 2000. Nisin-curvaticin 13 combinations for

avoiding the regrowth of bacteriocin resistant cells of Listeria monocytogenes

ATCC 15313. Int. J. Food Microbiol. 62:65–75.

8. Boziaris, I.S., Humpheson, L., and M.R. Adam. 1998. Effect of nisin on heat

injury and inactivation of Salmonella enteritidis PT4. Int. J. Food Microbiol.

43:7-13.

9. Bruno, M.C., and T.J. Montville. 1993. Common mechanistic action of

bacteriocins from lactic acid bacteria. Appl. Environ. Microbiol. 59:3003– 3010.

10. Buchmann, G.W., Banerjee, S., and J.N. Hansen. 1988. Structure, expression,

and evolution of a gene encoding the precursor of nisin, a small protein antibiotic.

J. Biol. Chem. 263:16260-6.

11. Chikindas, M.L., Garcý´a-Garcera, M.J., Driessen, A.J.M., Ledeboer, A.M.,

Nissen-Meyer, J., Nes, I.F., Abee, T., Konings, W.N., and G. Venema. 1993.

Pediocin PA-1, a bacteriocin from Pediococcus acidilactici PAC1.0, forms

hydrophilic pores in the cytoplasmic membrane of target cells. Appl. Environ.

Microbiol. 59:3577–3584.

12. Coma, V., Sebti, I., Pardon, P., Deschamps, A., and F.H. Pichavant. 2001.

Antimicrobial edible packaging based on cellulosic ethers, fatty acids, and nisin

incorporation to inhibit Listeria innocua and Staphylococcus aureus. J. Food Prot.

64:470-5.

40

13. De Vuyst, L., and E. Vandamme (Ed). 1994. Bacteriocins of lactic acid

bacteria: microbiology, genetics and application. Chapman & Hall, Ltd., London.

14. Dufour, A., Rince, A., Uguen, P., and J.P. LePennec. 2000. IS1675, a novel

lactococcal insertion element, forms a transposon like structure including the

lacticin 481 lantibiotic operon. J. Bacteriol. 182:5600-5.

15. Ennahar, S., Sashihara, T., Sonomoto, K., and A. Ishizaki. 2000. Class IIa

bacteriocins: biosynthesis, structure and activity. FEMS Microbiol. Rev. 24:85-

106.

16. Fleming, D.W., Cochi, S.L., MacDonald, K.L., Brondum, J., Hayes, P.S.,

Plikaytis, B.D., Holmes, M.B., Audurier, A., Broome, C.V., an A.L. Reingold.

1985. Pasteurized milk as a vehicle of infection in an outbreak of listeriosis. New

England J. Med. 312: 404-7.

17. Foegeding, P.M., Thomas, A.B., Pilkington, D.H., and T.R. Klaenhammer.

1992. Enhanced control of Listeria monocytogenes by in situ-produced pediocin

during dry fermented sausage production. Appl. Environ. Microbiol. 58: 884-890.

18. Freund, S., Jung, G., Gutbrod, O., Folkers, G., Gibbons, W.A., Allgaier, H.,

and R. Werner. 1991. The solution structure of the lantibiotic gallidermin.

Biopolymers 31:803–811.

19. Garcera, M.J.G., Elferink, M.G.L., Driessen, A.J.M., and W.N. Konings.

1993. In vitro pore-forming ability of the lantibiotic nisin, role of proton-motive

force and lipid composition. Eur. J. Biochem. 212:417–422.

41

20. Garde, S., Rodriguez, E., Gaya, P., Medina, M., and M. Nunez. 2001. PCR

detection of the structural genes of nisin Z and lacticin 481 in Lactococcus lactis

subsp. lactis INIA 415, a strain isolated from raw milk Manchego cheese.

Biotechnol. Lett. 23:85-9.

21. Giglio, S., Monis, P.T., and C.P. Saint. 2003. Demonstration of preferential

binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR.

Nucleic Acids Research 31 (22): e136.

22. Gonzalez, C.F. 1987. Method for inhibiting bacterial spoilage and resulting

compositions. United States Patent 4,883,673.

23. Gravesen, A., Axelsen, A.M.J., da Silva, J.M., Hansen, T.B., and S. Knochel.

2002. Frequency of bacteriocin resistance development and associated fitness

costs in Listeria monocytogenes. Appl. Environ. Microbiol. 68:756-64.

24. Hanlin, M.B., Kalchayanand, N., Ray, P., and B. Ray. 1993. Bacteriocins of

lactic acid bacteria in combination have greater antibacterial activity. J. Food Prot.

56:252–255.

25. Heid, C. A., Stevens J., Livak K.J., and P.M. Williams. 1996. Real-time

quantitative PCR. Genome Res. 6: 986-994.

26. Higuchi, R., Dollinger G., Walsh S., and R. Griffith. 1992. Simultaneous

amplification and detection of specific DNA sequences. BioTechnology. 10: 413-

417.

42

27. Horn, N., Martinez, M.I., Martinez, J.M., Hernandez, P.E., Gasson, M.J.,

Rodriguez, J.M., and H.M. Dodd. 1998. Production of pediocin PA-1 by

Lactococcus lactis using the lactococcin A secretory apparatus. Appl. Environ.

Microbiol. 64:818-23.


Rodriguez, J.M., and H.M. Dodd. 1999. Enhanced production of pediocin PA-1

and coproduction of nisin and pediocin PA-1 by Lactococcus lactis. Appl.


29. Hugas, M., Pagés, F., Garriga, M., and J.M. Monfort. 1998. Application of the

bacteriocinogenic Lactobacillus sakei CTC494 to prevent growth of Listeria in

fresh and cooked meat products packed with different atmospheres. Food


30. Hurst, A., 1981. Nisin. Adv. Appl. Microbiol. 27:85–123.

31. Ingram, L.C., 1970. A ribosomal mechanism of synthesis for peptides related to

nisin. Biochim. Biophys. Acta. 224:263-5.

32. Jay, J.M., 1996. Modern food microbiology. 5th ed. New York: Chapman and

Hall. 635 p.

33. Jimenez-Diaz, R., Rios-Sanchez, R.M., Dezmazeaud, M., Ruiz-Barba, J.L.,

and J.C. Piard. 1993. Plantaricins S and T, two new bacteriocins produced by

Lactobacillus plantarum LPCO10 isolated from a green olive fermentation. Appl.

Environ. Microbiol. 59:1416–1424.

43

34. Kalchayanand, N., Hanilin, M.B., and B. Ray. 1992. Sub lethal injury makes

Gram negative and resistant Gram-positive bacteria sensitive to the bacteriocins,

pediocin AcH and nisin. Lett. Appl. Microbiol. 15:239–243.

35. Kalchayanand, N., Sikes, T., Dunne C.P., B. Ray. 1994. Hydrostatic pressure

and electroporation efficiency in combination with bacteriocins. Appl. Environ.


36. Kekessy, D.A., and J.D. Piguet. 1970. New method for detecting bacteriocin

production. Appl. Microbiol. 20:282-3.

37. Klaenhammer, T.R. 1993. Genetics of bacteriocins produced by lactic acid

bacteria. FEMS Microbiol. Rev. 12:39-85.

38. Klein, C., Kaletta, C., Schnell, N., and K.D. Entian. 1992. Analysis of genes

involved in biosynthesis of the lantibiotic subtilin. Appl. Environ. Microbiol.

58:132-42.

39. Kuipers, O.P., Beerthuyzen, M.M., de Ruyter, P.G.G.A., Luesink, E.J., and

W.M. de Vos. 1995. Autoregulation of nisin biosynthesis in Lactococcus lactis

by signal transduction. J. Biol. Chem. 270:27299-304.

40. Lipinska, E. 1977. Nisin and its application. In “Antibiotics and antibiosis in

Agriculture” pp 103-130.

44

41. Martín, B., Jofré, A., Garriga, M., Pla, M., and T. Aymerich. 2006. Rapid

Quantitative Detection of Lactobacillus sakei in Meat and Fermented Sausages by

Real-Time PCR. Appl. Environ. Microbiol. 72(9): 6040–6048.

42. McAuliffe, O., Ross, R.P., and C. Hill. 2001. Lantibiotics: structure,

biosynthesis and mode of action. FEMS Microbial. Rev. 25:285-308.

43. Ming, X., Weber, G., Ayres, J., and W. Sandine. 1997. Bacteriocins applied to

food packaging materials to inhibit Listeria monocytogenes on meats. J. Food Sci.

62:413-5.

44. Modi, K.D., Chikindas, M.L., and T.J. Montville. 2000. Sensitivity of nisin-

resistant Listeria monocytogenes to heat and the synergistic action of heat and

nisin. Lett. Appl. Microbiol. 30:249- 53.

45. Mugochi, T., Nandakumar, M.P., Zvauya, R., and B. Mattiasson. 2001.

Bioassay for the rapid detection of bacteriocins in fermentation broth. Biotechnol.

Lett. 23:1243-7.

46. Natrajan, N., and B. Sheldon. 2000. Efficacy of nisin-coated polymer films to

inactivate Salmonella typhimurium on fresh broiler skin. J. Food Prot. 63:1189-

96.

47. Nazarenko, I. A., Bhatnagar, S.K., and R. J. Hohman. 1997. A closed tube

format for amplification and detection of DNA based on energy transfer. Nucl.

Acid. Res. 25:2516-2521.

45

48. Nes, I.F., Diep, D.B., Havarstein, L.S., Brurberg, M.B., Eijsink, V., and H.

Holo. 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie van

Leeuwenhoek 70:113-28.

49. Nes, I.F., and H. Holo. 2000. Class II antimicrobial peptides from lactic acid

bacteria. Biopolymers 55:50-61.

50. Nilsson, L., Huss, H.H., and L. Gram. 1997. Inhibition of Listeria

monocytogenes on cold smoked salmon by nisin and carbon dioxide atmosphere.

Int. J. Food Microbiol. 38:217-27.

51. Nissen-Meyer, J., Holo, H., Havarstein, L.V., Sletten, K., and I.F. Nes. 1992.

A novel lactococcal bacteriocin whose activity depends on the complementary

action of two peptides. J. Bacteriol. 174:5686–5692.

52. Nissen-Meyer, J., Havarstein, L.S., Holo, H., Sletten, K., and I.F. Nes. 1993.

Association of the lactococcin A immunity factor with the cell membrane:

purification and characterization of the immunity factor. J. Gen. Microbiol.

139:1503–1509.

53. Parente, E., Giglio, M.A., Ricciardi, A., and F. Clementi. 1998. The combined

effect of nisin, leucocin F10, pH, NaCl and EDTA on the survival of Listeria

monocytogenes in broth. Int. J. Food Microbiol. 40:65-75.

54. Parkinson, J.S. 1993. Signal transduction schemes of bacteria. Cell 73:857-71.

46

55. Pawar, D.D., Malik, S.V.S., Bhilegaonkar, K.N., and S.B. Barbuddhe. 2000.

Effect of nisin and its combination with sodium chloride on the survival of

Listeria monocytogenes added to raw buffalo meat mince. Meat Sci. 56:215-9.

56. Piard, J.C., Muriana, P.M., Desmazeaud, P.J., and T.R. Klaenhammer. 1992.

Purification and partial characterization of lacticin 481, a lanthionine containing

bacteriocin produced by Lactococcus lactis subsp. lactis CNRZ 481. Appl.


57. Piddock, L.J.V. 1990. Techniques used for the determination of antimicrobial

resistance and sensitivity in bacteria. J. Appl. Bacteriol. 68:307-18.

58. Pugsley, A.P. 1984. The ins and outs of colicins. I. Production and translocation

across membranes. Microbiol. Sci. 1:168–175.

59. Pugsley, A.P. 1984. The ins and outs of colicins. II. Lethal action, immunity and

ecological implications. Microbiol. Sci. 1:203–205.

60. Quadri, L.E., Kleerebezem, M., Kuipers, O.P., de Vos, W.M., Roy, K.L.,

Vederas, J.C., and M.E. Stiles. 1997. Characterization of a locus from

Carnobacterium piscicola LV17B involved in bacteriocin production and

immunity: evidence for global inducer-mediated transcriptional regulation. J.

Bacteriol. 179:6163-71.

61. Ray, B. 1993. Sublethal injury, bacteriocins, and food microbiology. ASM News

59:285–291.

47

62. Reis, M., Eschbach-Bludau, M., Iglesias-Wind, M.I., Kupke, T., and H.G.

Sahl. 1994. Producer immunity towards the lantibiotic Pep5: identification of the

immunity gene pepI and localization and functional analysis of its gene product.

Appl. Environ. Microbiol. 60:2876-83.

63. Rodriguez, E., Martinez, M.I., Medina, M., Hernandez, P.E., and J.M.

Rodriguez. 1998. Detection of enterocin AS-48-producing dairy Enterococci by

dot-blot and colony hybridization. J. Dairy Res. 65:143-8.

64. Rodriguez, J.M., Cintas, L.M., Casaus, P., Suarez, A., and P.E. Hernandez.

1995. PCR detection of the lactocin S structural gene in bacteriocin-producing

lactobacilli from meat. Appl. Environ. Microbiol. 61:2802-5.

65. Rose, N.L., Sporns, P., and L.M. McMullen. 1999. Detection of bacteriocins by

matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

Appl. Environ. Microbiol. 65:2238- 42.

66. Ross, R.P., Galvin, M., McAuliffe, O., Morgan, S.M., Ryan, M.P., Twomey,

D.P., Meaney, W.J., and C. Hill.1999. Developing applications for lactococcal

bacteriocins. Antonie van Leeuwenhoek 76:337-46.

67. Ryser, E.T., and E.H. Marth. 1999. Listeria, listeriosis and food Safety. 2nd ed.

New York: Marcel Dekker, Inc. 738 p.

68. Sablon, E., Contreras, B., and E. Vandamme. 2000. Antimicrobial peptides of

lactic acid bacteria: mode of action, genetics and biosynthesis. Adv. Biochem.

Engin/Biotechnol. 68:21-60.

48

69. Sawyer, J., Wood, C., Shanahan, D., Gout, S., and D. McDowell. 2003. Real-

time PCR for quantitative meat species testing. Food Control. 14: 579-583.

70. Schillinger, U., Geisen, R., and W.H. Holzapfel. 1996. Potential of antagonistic

microorganisms and bacteriocins for the biological preservation of foods. Trends

Food Sci. Technol. 7:158-64.

71. Schlyter, J.H., Glass, K.A., Loeffelholz, J., Degnan, A.J., and J.B. Luchansky.

1993. The effects of diacetate with nitrite, lactate, or pediocin on the viability of

Listeria monocytogenes in turkey slurries. Int. J. Food Microbiol. 19:271-81.

72. Schnell, N., Engelke, G., Augustin, J., Rosenstein, R., Ungermann, V., and

K.D. Götz. 1992. Analysis of genes involved in the biosynthesis of lantibiotic

epidermin. Eur. J. Biochem. 204:57-68.

73. Schuller, F., Benz, R., and H.G. Sahl. 1989. The peptide antibiotic subtilin acts

by formation of voltage-dependent multistate pores in bacterial and artificial

membranes. Eur. J. Biochem. 182:181–186.

74. Siragusa, G.R., Cutter, C.N., and J.L. Willett. 1999. Incorporation of

bacteriocin in plastic retains activity and inhibits surface growth of bacteria on

meat. Food Microbiol. 16:229-35.

75. Skaugen, M., Abildgaard, C.I.M., and I.F. Nes. 1997. Organization and

expression of a gene cluster involved in the biosynthesis of the lantibiotic lactocin

Mol. Gen. Genet. 253:674-86.

49

76. Song, H.J., and J. Richard. 1997. Antilisterial activity of three bacteriocins used

at subminimal inhibitory concentrations and cross-resistance of the survivors. Int.

J. Food Microbiol. 36:155–61.

77. Stevens, K.A., Sheldon, B.W., Klapes, N.A., and T.R. Klaenhammer. 1991.

Nisin treatment for inactivation of Salmonella species and other Gram-negative

bacteria. Appl. Environ. Microbiol. 57:3613–3615.

78. Stock, J.B., Ninfa, A.J., and A.M. Stock. 1989. Protein phosphorylation and

regulation of adaptive responses in bacteria. Microbiol. Rev. 53:450-90.

79. Tagg, J.R., Dajani, A.S., and L.W. Wannamaker. 1976. Bacteriocins of Gram-

positive bacteria. Bacteriol. Rev. 40:722–756.

80. Tyagi, S., and F.R. Kramer. 1996. Molecular beacons: probes that fluorescence

upon hybridization. Nat. Biotechnol. 14: 303-308.

81. Van Belkum, M.J., Hayema, B.J., Jeeninga, R.E., Kok, J., and G. Venema.

1991. Organization and nucleotide sequence of two lactococcal bacteriocin

operons. Appl. Environ. Microbiol. 57:492–498.

82. Van Belkum, M.J., Kok, J., Venema, G., Holo, H., Nes, I.F., Konings, W.N.,

and T. Abee. 1991. The bacteriocin lactococcin A specifically increases the

permeability of lactococcal cytoplasmic membranes in a voltage-independent

protein mediated manner. J. Bacteriol. 173:7934-7941.

50

83. Venema, K., Abee, T., Haandrikman, A.J., Leenhouts, K.J., Kok, J.,

Konings, W.N., and G. Venema. 1993. Mode of action of lactococcin B, a thiol-

activated bacteriocin from Lactococcus lactis. Appl. Environ. Microbiol.

59:1041–1048.

84. Vignolo, G., Palacios, J., Farias, M.E., Sesma, F., and U. Schillinger. 2000.

Combined effect of bacteriocins on the survival of various Listeria species in

broth and meat system. Curr. Microbiol. 41:410–16.

85. Vogel, H., Nillson, L., Rigler, R., Meder, S., Boheim, G., Beck, W., Kurth,

H.H., and G. Jung. 1993. Structural fluctuations between two conformational

states of a transmembrane helical peptide are related to its channel forming

properties in planar lipid membranes. Eur. J. Biochem. 212:305– 313.

86. Yang, R., Johnson, M.C., and B. Ray. 1992. Novel method to extract large

amounts of bacteriocins from lactic acid bacteria. Appl. Environ. Microbiol.

58:3355–3359.

87. Zajdel, J.K., Ceglowski, P., and W.T. Dobranski. 1985. Mechanism of action

of lactostrepcin 5, a bacteriocin produced by Streptococcus cremoris 202. Appl.

Environ. Microbiol. 49:969–974.

88. Zapico, P., Medina, M., Gaya, P., and M. Nuñez. 1998. Synergistic effect of

nisin and the lactoperoxidase system on Listeria monocytogenes in skim milk. Int.

J. Food Microbiol. 40:35-42.

51

89. Zhang, Y., Zhang, D., Li, W., Chen, J., Peng, Y., and W. Cao. 2003. A novel

real-time quantitative PCR method using attached universal template probe. Nucl.

Acid. Res. 31(20): 1-8.

52

CHAPTER III

SEQUENCE ANALYSIS OF THE CURVATICIN FS47 BACTERIOCIN OPERON OF

LACTOBACILLUS CURVATUS FS47.

S. Macwana1 and P.M. Muriana1,2

1Department of Animal Sciences &

2The Food & Agricultural Products Research & Technology Center,

Oklahoma State University

Stillwater, Oklahoma 74078

53

INTRODUCTION

Bacteriocins are ribosomally synthesized antimicrobial peptides produced by

many living organisms including bacteria and constitute the most abundant and diverse

group of bacterial defense systems (Nes and Holo, 2000, Eijsink et al., 2002 and Riley

and Wertz, 2002). In recent years, bacteriocins from lactic acid bacteria (LAB) have been

the focus of extensive studies due to their potential application in foods (Cleveland et al.,

2001). Many bacteriocins produced by LAB inhibit not only closely related species but

also a variety of species of Gram-positive spoilage bacteria and food-borne pathogens.

Most antimicrobial peptides from LAB are synthesized with an N-terminal leader

sequence. They are cationic, amphiphilic/hydrophobic membrane permeabilizing

peptides, usually consisting between 30 and 60 amino acids. Bacteriocins produced by

Lactobacillus curvatus and the closely related Lactobacillus sakei are classified as class

II bacteriocins; small, heat-stable, non-lantibiotics. These are further divided into three

subgroups: (IIa) listeria-active peptides, (IIb) poration complexes consisting of two

proteinaceous peptides for activity, and (IIc) thiol-activated peptides requiring reduced

cysteine residues for activity (Nes and Holo, 2000, Ennahar et al., 2000). The largest

group in Class II bacteriocins is subclass IIa. These bacteriocins share an overall amino

acid sequence identity of over 70% with the conserved sequence motif

(YYGNGVxCxKxxCxVD) in the N-terminal part of the molecule (Eijsink et al., 2002).

Curvaticin FS47 is a Listeria-active bacteriocin produced by Lactobacillus

curvatus FS47 that was isolated from retail meats (Garver and Muriana, 1993).

Lactobacillus curvatus, is a psychrotroph which can grow at temperatures as low as 5oC

and is known for the production of several different bacteriocins (curvacin, curvaticin)

54

that are inhibitory to Listeria monocytogenes and some spoilage microorganisms

(Tichaczek, et al., 1993; Vogel et al., 1993; Garver and Muriana, 1993, 1994). Curvaticin

FS47 has a molecular weight of 4.07 kDa as determined by mass spectrometry (Garver

and Muriana, 1994). Although curvaticin FS47 does not contain the consensus sequence

shared by Class IIa Listeria-active peptides, it inhibits the growth of L. monocytogenes,

suggesting that it may prevent the growth of L. monocytogenes by a different mechanism.

In this study, we completed the sequencing of the curvaticin FS47 operon (9.6-kb) and

performed sequence analysis to identify homology with other known bacteriocin

sequences.

55

MATERIALS AND METHODS

Bacterial strains, plasmids, and media.

Strains of Lactobacillus were maintained as frozen stocks held at -20oC in de

Man-Rogosa-Sharpe (MRS) broth (Difco Laboratories, Detroit, MI) with 10% glycerin

(Fisher Scientific Co., Raleigh, NC). Cultures of Lactobacillus were grown in MRS

broth or on MRS agar (1.5% agar) at 30oC. Indicator overlay agar was prepared by

adding 0.75% agar to MRS broth. Frozen stocks of strains of E. coli were maintained in

Luria-Burtani (LB) broth with 10% glycerin.

DNA isolation and manipulation.

Isolation of plasmid DNA from strains of Lactobacillus was performed by the

method of O’Sullivan and Klaenhammer (1993). Plasmid DNA from strains of E.coli

was prepared by alkaline lysis. Total DNA of strains of L. curvatus was isolated by the

procedure of Wu and Muriana (1995). Plasmid DNA required for sequencing was further

purified by CsCl-ethidium bromide density gradient ultracentrifugation.

Genomic clones, sequencing and PCR walking.

Two overlapping clones in the plasmid cloning vector, pBluescript, encompassing

the structural gene (cutA) and additional subclones obtained previously (in a related study

in our laboratory) were made available for sequencing. Sequences were obtained directly

from subclones, by PCR walking, or by using vectorette PCR (see below). PCR walking

was done for each clone initially by using the pBluescript universal primers and thereby

followed with using the gene specific primers and the universal primers. Sequencing of

56

DNA was performed at the Dept. of Biochemistry and Molecular Biology Recombinant

DNA/Protein Resource Facility (Oklahoma State University) using an automated DNA

sequencer via "BigDye™"-terminated reactions analyzed on an ABI Model 3700 DNA

Analyzer.

Vectorette PCR.

The vectorette sequences and methods are modified from a protocol at the Bostein

Lab website http://genome-www.stanford.edu/group/botlab/protocols/vectorette.html.

Briefly, genomic DNA of L. curvatus FS47 (~6µg) was digested with EcoR1. The

digested DNA was ligated with the annealed vectorette oligos (2µM each oligo) at 37oC

for 2hrs. The primers used are listed in Table 2. For the PCR, each reaction mixture

consisted of 5µl of ligation mix, 1.0µl (10pM ‘R’ gene specific primer), 0.5µl (200mM of

the universal vectorette primer 224 ‘F’), 1.5µl of 2.5mM deoxynucleotide triphosphate,

0.5U of Taq polymerase and nuclease free water to a final volume of 20µl. This reaction

allowed for the highly specific amplification of the 2-kb fragment in the 9.6-kb curvaticin

bacteriocin operon. The PCR conditions were 22 cycles of denaturation (92oC, 10sec),

annealing (60oC, 1min) and extension (72oC, 3min). The final product was separated on a

1.5% agarose gel. The 2-kb fragment obtained was purified and sequenced.

Differentiation of L. sakei and L. curvatus.

Polymerize Chain Reaction amplification: Species-specific primer combinations

have been identified to differentiate L. curvatus from the related L. sakei which involves

a primer for the common sequence of the 16S rRNA gene in both and another for a

57

species-specific spacer region (Table 1). Amplification consisted of 20 cycles (for primer

pairs 16/Lc, 16/Ls) of: denaturation for 1min at 94oC, annealing for 30 sec at 45oC and an

extension for 1min at 72oC. The first cycle was incubated for 5 min at 94oC. A 10µl

aliquot of the PCR products were electrophoresed in a 1% agarose gel and visualized by

UV illumination after ethidium bromide staining.

Sequence analysis.

Open reading frames (ORFs) and BLAST that was used to obtain protein

sequence similarity were determined using the software tools provided online at the

National Center for Biotechnology Information

(http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi)

58

RESULTS AND DISCUSSION

Detection of the curvaticin FS47 bacteriocin operon.

The location of the curvaticin FS47 operon was identified from the sequence of

purified curvaticin FS47 obtained previously (Garver and Muriana, 1994) and from

partial sequencing of the curvaticin FS47 operon that provided 4.3-kb of sequence

information (P. Muriana, personal communication). In this paper, we present additional

sequence information totaling 9.6-kb and sequence analysis of the curvaticin FS47

operon.

Sequencing of the cloned fragments.

The partial 4.3-kb sequence information for curvaticin FS47 was obtained from

two overlapping clones: i) pBHX (3.6-kb, HindIII-XbaI) and pBAcE (3.9-kb, Acc651-

EcoRI) that were cloned into pBluescript encompassing the structural gene, cutA (P.

Muriana, personal communication). A restriction map of the cloned fragments was used

for subcloning smaller fragments. The restriction map as well as the clones and subclones

are shown in (Fig. 1). These smaller fragments were then purified, and submitted for

sequencing using universal primers for the common sequencing primer regions in the

multiple cloning site of pBluescript. In all, approximately 8-kb of the curvaticin FS47

operon was sequenced starting from the curvaticin FS47 proximal EcoRI site. The

remaining 2-kb of the operon, upto the distal EcoRI site was obtained by the vectorette

PCR approach. A PCR reaction was performed using a forward primer designated as ‘the

universal vectorette primer’ which has the specific EcoRI site incorporated and a reverse

primer designed from the known bacteriocin sequence designated as ‘the gene specific

59

primer’. Thus there was specific amplification of the 2-kb fragment. This approach was

employed to efficiently sequence orthologous gene regions. Thus 9.6-kb of the curvaticin

operon from one EcoRI site to the other EcoRI site was obtained.

Identifying the Open reading frames (ORF’s) related to the curvaticin FS47 operon.

The sequence of a 9.6-kb chromosomal region containing at least 26 open reading

frames (ORFs), 10 of which are predicted to play a role in curvaticin biosynthesis, is

presented. The operon shows the presence of two bacteriocins: i) a two component

bacteriocin structural gene (T-alpha and T-beta subunits), associated with its immunity

protein, these bacteriocin peptides are similar to the Sakacin T bacteriocin complex; ii) a

single component bacteriocin (curvaticin 47) structural gene associated with its immunity

protein. The inducing factor prepetide is also involved in biosynthesis. Most class II

bacteriocins produce a bacteriocin like peptide with no antimicrobial activity and use it as

an inducing factor (IF) to activate the transcription of the regulated genes. Two ORF’s

correspond to a well known two-component regulatory signal transduction system, the

histidine protein kinase (HPK) and the response regulator. The HPK when it senses a

certain concentration of bacteriocin in the environment autophosphorylates the histidine

residue and transfers the phosphate group to the response regulator which inturn activates

the transcription of the regulatory genes. A predicted protein was found homologous to

the ABC (ATP-binding cassette) transporter system of several other bacteriocin systems.

They are known to process the inducing factor prepetide and concomitantly export the

mature bacteriocin peptide to the outside of the cell. Apart from the bacteriocin

biosynthesis genes it is interesting to notice the presence of transposon related genes

(integrase and transposase like protein) at the flanking regions of the fragment. The

60

transposons maybe involved in the exchange of genetic material from other related

bacteriocin producing strains because several of these strains share the same cluster of

genes, e.g. L.curvatus and L.sakei (Fig. 2).

Comparing the curvaticin FS47 bacteriocin operon with other bacteriocin operons.

The curvaticin FS47 bacteriocin operon showed high homology (95%) to the L.

sakei IP-TX gene cluster. L. curvatus and L. sakei are known to be closely related

phylogenetically, thus high homology exists between the two. Homology of the

curvaticin FS47 gene cluster is also seen with other L.sakei bacteriocin gene clusters like

Sakacin P and Sakacin A (Fig. 3). Thus there is a probability that more than one

bacteriocin can co-exist in L. curvatus FS47.

Identifying the bacteriocin producing species.

Since the bacteriocin gene cluster between L. curvatus FS47 and L.sakei show

extremely high homology it was important to reconfirm the genomic identity of L.

curvatus FS47 (Fig. 3). A species-specific PCR DNA amplification was done to

distinguish between the bacteriocin producing FS47 strain and L.sakei. Amplification was

carried out using two sets of primers; one is the 16S rRNA-gene specific primer and the

other is the 16S/23S rDNA spacer region specific primers for L. curvatus and L. sakei

(Table 1). For the PCR amplification assay, each of the species-specific primers was

paired with the forward primer 16 from the 16S rRNA gene. The DNA from each strain

was PCR amplified in the presence of each pair of primers. For L. curvatus, amplification

was observed with the 16S/Lc primer pair only and not the 16S/Ls pair. Whereas, using

the L.sakei as the target DNA, amplification was seen only with the 16S/Ls primer pair

61

and not the 16S/Lc pair (Fig. 4). The primers developed thus allowed for the rapid

differentiation of species within two phylogenetically related groups. This proved that the

bacteriocin producing strain FS47 is different from L.sakei.

CONCLUSION

Sequence analysis of the 9.6-kb curvaticin operon revealed the presence of several genes

related to bacteriocin biosynthesis, regulation and transport. The bacteriocin related genes

are organized in several operons. There were two bacteriocins identified, i) a two

component bacteriocin (T alpha and beta subunits) and ii) a single component bacteriocin

(curvaticin FS47). There is high homology between the bacteriocin gene clusters of L.

curvatus FS47 and L. sakei. The identification of transposon-related sequences flanking

the curvaticin FS47 bacteriocin operon (and their involvement in other bacteriocin

operon) has been suggested as a possible vehicle for distribution of bacteriocin sequences

among LAB.

ACKNOWLEDGMENT

We like to thank Li Ma and M.A. Cousin for providing us with the clones and subclones

for the partial sequencing of the curvaticin FS47 operon. We would like to extend our

thanks to Dr. Desilva (OSU Animal Science Faculty) and his lab members for guiding us

with the vectorette PCR approach.

62

REFERENCES

1. Cleveland, J., T. J. Montville, I. F. Nes, and M. L. Chikindas. 2001.

Bacteriocins: safe, natural antimicrobials for food preservation. Int J Food

Microbiol 71:1-20.

2. Eijsink, V. G., L. Axelsson, D. B. Diep, L. S. Havarstein, H. Holo and I. F.

Nes. 2002. Production of class II bacteriocins by lactic acid bacteria; an example

of biological warfare and communication. Antonie Van Leeuwenhoek 81(1-

4):639-54.

3. Ennahar, S., N. Deschamps, and J. Richard. 2000. Natural variation in

susceptibility of Listeria strains to class IIa bacteriocins. Curr. Microbiol. 41:1-4.

4. Garver, K.I., and P.M. Muriana. 1993. Detection, identification, and

characterization of bacteriocin-producing lactic acid bacteria from retail food

products. Int. J. Food Microbiol. 19:241-258.

5. Garver, K.I. and P.M. Muriana. 1994. Purification and partial amino acid

sequence of curvaticin FS47, a heat-stable bacteriocin produced by Lactobacillus

curvatus FS47. Appl. Environ. Microbiol. 60(6):2191-5.

6. Nes, I.F., and H. Holo. 2000. Class II antimicrobial peptides from lactic acid


63

7. O'sullivan, D. J., and T. R. Klaenhammer. 1993. Rapid Mini-Prep Isolation of

High-Quality Plasmid DNA from Lactococcus and Lactobacillus spp. Appl.

Environ. Microbiol. 59(8):2730-2733.

8. Riley, M.A. and J. E. Wertz . 2002. Bacteriocins: evolution, ecology, and

application. Annu. Rev. Microbiol. 56:117-37.

9. Tichaczek, P. S., R. F. Vogel and W. P. Hammes. 1993. Cloning and

sequencing of curA encoding curvacin A, the bacteriocin produced by

Lactobacillus curvatus LTH1174. Arch Microbiol. 160(4):279-83.

10. Vogel, R.F., M. Lohmann, M. Nguyen, A. N. Weller and W. P. Hammes.

1993. Molecular characterization of Lactobacillus curvatus and Lactobacillus

sake isolated from sauerkraut and their application in sausage fermentations. J.

Appl. Bacteriol. 74:295-300.

11. Wu, F.M., and P.M. Muriana. 1995. Genomic subtraction in combination with

PCR for enrichment of Listeria monocytogenes-specific sequences. Int. J. Food


64

Table 1. Sequences of oligonucleotide primers used to differentiate L.curvatus and L. sakei.

Primer Location 5’- 3’ sequence Specificity16 16S rRNA gene, 3’ end, forward GCTGGATCACCTCCTTTC 16S rRNA gene

Lc 16S/23S spacer region of L. curvatusDNA, reversed TTGGTACTATTTAATTCTTAG L. curvatus

Ls 16S/23S spacer region of L. sakei DNA,reversed ATGAAACTATTAAATTGGTAC L. sakei

Table 2. Sequences of oligonucleotide primers used in the Vectorette PCR Approach

Primer 5’- 3’ sequenceBlunt end vectorettebubble Oligo1. BPB I CAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGAAGGGAGAG2. BPH II CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTG

Universal vectoretteprimer 224 CGAATCGTAACCGTTCGTACGAGAATCGCT

Curvaticin Genespecific primer AACCTTAGATAGCACTGAAAGCTCA

65

Figure 1. Schematic of restriction map of L.curvatus FS47 chromosomal DNA. Only restriction enzyme sites relevant for theconstruction of the various subclones are shown. The sizes of the cloned fragments are indicated on the right. Asterisksrepresent subclones used for nucleotide sequencing.

66

Figure 2. Representation of the major open reading frames (ORFs) related to the curvaticin FS47 bacteriocin operon.The arrows represent the ORFs and their orientation indicates their direction of transcription. The vertical line in thecurvaticin T-alpha ORF represents the region where the probe hybridized.

Curvaticin FS47 Operon9673 bp

Transposase (Integrase)Transport Accessory Protein

Inducing PeptideResponse Regulator

Histidine Protein Kinase

ABC Transporter

Curvaticin T-alphaCurvaticin T-beta

Immunity ProteinCurvaticin 47 Bacteriocin

Curvaticin 47 ImmBrochocin Imm-like Protein

Transposase-like Protein

Eco RI (2) Eco RI (9669)

67

Figure 3. Comparison of the curvaticin FS47 operon with other known bacteriocin operons. Grey regions show highhomology with the Curvaticin FS47 gene cluster. The numbers indicate the base pairs.

1 2503

Lb. sakei IP-TX gene cluster

11,342 17,652

Lb. curvatus FS47 (9673 bp)

792 928 9,629 9,673

Lb. sakei Lb790 sakacin P gene cluster

1562 24891 13,181

1

Lb. sakei sakacin A gene cluster

86881482 2409

1

68

Figure 4. PCR amplification of species-specific DNA targets to help identify the bacteriocin-producing strain FS47. A combination of 16S rRNA-gene specific primers and primers for the 16S/23S rDNA spacer regions specific for either Lactobacillus curvatus (16S/Lc) or for L. sakei (16S/Ls) were used in the PCR reaction. L. curvatus FS47 PCR product (lanes 2); L. sakei 790 PCR product (lanes 6); 1--kb DNA ladder (lane 1)

1 2 3 4 5 6

Primer Combinations:16S/Lc -- 16S/Ls

DNA from: Lc Ls - Lc Ls

[ [1 2 3 4 5 61 2 3 4 5 6

Primer Combinations:16S/Lc -- 16S/Ls

DNA from: Lc Ls - Lc Ls

[ [

69

CHAPTER IV

USE OF ACQUIRED SPONTANEOUS RESISTANCE TO SCREEN BACTERIOCINS

OF LACTIC ACID BACTERIA INTO FUNCTIONAL INHIBITORY GROUPS

Sunita Macwana1 and Peter M. Muriana1,2





70

INTRODUCTION

Bacteriocins are ribosomally-synthesized peptides produced by many types of

bacteria that are inhibitory to sensitive organisms. There are so many bacteriocins

identified among members of lactic acid bacteria (LAB), that they have been classified

into 4 distinct classes (and additional subclasses) based on biochemical composition and

physical attributes (Klaenhammer, 1993). Since LAB are generally recognized as safe

(GRAS) for use in foods, bacteriocins produced by LAB have been proposed for use in

the biopreservation of food products by eliminating or controlling spoilage

microorganisms and pathogens (De Vuyst et al. 1994; Cleveland et al. 2001). Nisin is the

only bacteriocin to date approved for food preservation as a direct food additive (Thomas

et al. 2000), however pediocin-like bacteriocins are also used by virtue of GRAS

ingredients such as cultured milk or whey (Deegan et al. 2006). One concern regarding

the use of bacteriocins as food preservatives would be the possible occurrence of natural

or spontaneously-acquired bacteriocin resistance (BacR). Natural resistance to class IIa

bacteriocins has been reported in 1 to 8% of tested wild-type strains of LAB (Ennahar et

al. 2000, Larsen and Norrung, 1993, Rasch and Knochel, 1998) and variations in natural

sensitivity to nisin have also been observed in frequencies ranging from <10−9 to 10−5

(Bouttefroy and Milliere, 2000, De Martinis et al. 1997, Ming and Daeschel, 1993).

Innate, or inherent resistance, may be due to the inability of the target strain to bind

bacteriocin or due to production of proteinase(s) which may provide partial protection by

cleaving extracellular molecules of bacteriocins. Spontaneous resistant mutants have also

been observed at low frequency (10-8-10-9) upon first exposure of sensitive strains to

71

bacteriocin and in which sensitivity to bacteriocin was diminished upon subsequent

exposure (Guinane et al. 2006).

Efforts to improve bacteriocin functionality as a biopreservative have included

proposals to use mixtures of multiple bacteriocins (Muriana, 1996). The occurrence of

cross-resistance to multiple bacteriocins has also been observed which may defeat the

intention of using multiple bacteriocins (Deegan et al. 2006). However, by characterizing

bacteriocins into groups based on same-type mutational resistance may be a useful

functional approach to selecting which mixtures of bacteriocins are best suited for

application in foods without the development of resistance. Spontaneously-acquired

resistance to bacteriocins does not make the organism immune to all bacteriocins, but

only to those that are affected by the same mutational event, and therefore belong to the

same ‘resistance class’. By screening and grouping bacteriocins based on resistance class,

we should be able to classify them into different functional inhibitory groups (i.e., groups

for which spontaneous resistance would give cross-resistance) and therefore allow for the

selection of ideal mixtures of bacteriocins that would belong to different resistance

classes. In this paper, L. monocytogenes 39-2 and BacR variants derived from it, were

used as indicator strains to screen for bacteriocin-producing LAB from food samples.

These bacteriocins were then categorized into different ‘resistance classes’ based on their

inhibitory profiles against specific spontaneously-acquired bacteriocin resistance events.

The use of mixtures of bacteriocins from different ‘resistance classes’ would have greater

likelihood to overcome spontaneous resistance based on a single mutational event.

72


Bacterial growth conditions.

Bacterial strains used in this study were either from our culture collection or were

isolated from food products. Lactic acid bacteria were grown in MRS broth (Difco

Laboratories, Detroit, Mich.) or on 1.5% (w/v) MRS agar and incubated at 30°C under

static conditions. Cultures were transferred three times in MRS broth before use. Our

LAB cultures were maintained as frozen stocks at -80°C in MRS (or in BHI for Listeria)

broth with 10% glycerin. Listeria monocytogenes 39-2, Scott A, and subsequent BacR

derivatives used as indicator strains, were propagated in Brain Heart Infusion (BHI) broth

(VWR Laboratories, Suwanee, GA) or on 1.5% (w/v) BHI agar and incubated at 30°C.

Bacteriocin detection and assay.

Bacteriocin activity was assayed by the spot-on-lawn method (Muriana and

Klaenhammer, 1991). Five ml of 0·75% (w/v) tryptic soy (TS) soft agar, inoculated with

1% (v/v) of an overnight culture of the sensitive indicator strain was overlaid onto

prepoured TS agar (1·5%, w/v) plates. Two-fold serial dilutions of each pH-adjusted (pH

7.0) and filter-sterilized bacteriocin sample were made in 0.1% buffered peptone water

(BPW) in 96-well microtiter plates (Falcon, Fischer Scientific, Pittsburgh, PA). Ten µl of

each serial dilution was spotted onto the soft seeded agar overlays; these plates were

marked in ‘pie’ sections and provided for 8 spot assays per plate. Assay plates were

incubated at 30°C for 18 h. Activity was defined as the reciprocal of the highest dilution

73

exhibiting complete inhibition of the indicator lawn, expressed in arbitrary units (AU) per

milliliter.

Isolation of bacteriocin-producing Lactic Acid Bacteria from foods.

Various foods including raw/ground meats, produce, and dairy products were

purchased from a local supermarket and sampled within 48 h. Samples (50 g) were

weighed aseptically into sterile stomacher bags, diluted 1:10 with MRS broth, stomached,

sealed, and incubated overnight at 30°C for enrichment of LAB. Dilutions of these

samples were spread plated onto MRS agar, covered with a 5-ml layer of sterile MRS

agar ‘sandwich’ layer to cover plated cells (so that the subsequent indicator overlay

would not smear exposed surface colonies), and incubated at 30°C for 14-24 h until

small-colony growth was evident. Deferred antagonism was used for the detection of

colonies producing bateriocins as previously described by Muriana and Klaenhammer

(1987). Plates with ‘sandwiched’ colonies were overlayed with 5 ml of soft MRS agar

seeded with a 1% inoculum of Lactobacillus delbrueckii subsp lactis 4797 as the

indicator strain and further incubated overnight at 30°C. Bacteriocins produced by the

underlying colonies would diffuse through the sandwich layer and appear as zones of

inhibition in the indicator layer above. Bacteriocin-producing colonies were recovered by

flipping the agar into the cover and recovering cells from the colonies through the sterile

backside agar. This colony was streaked onto MRS agar for isolation and confirmed for

bacteriocin production by patch-plating multiple colonies from the streak onto plates that

would be overlayed with the indicator strain, Lactobacillus delbrueckii subsp lactis 4797.

The confirmed bacteriocin-producing isolate would be recovered from duplicate plates

74

not overlayed with indicator. Based on the testing with proteolytic enzymes to inactivate

proteinaceous bacteriocins, these inhibitors were identified as bacteriocins.

Identification of bacteriocin-producing Lactic Acid Bacteria.

The identification and biochemical characterization of the bacteriocin producing

isolates was determined using API 50 CH panels (bioMerieux Inc., Fischer Sci.). Briefly,

bacteriocin-producing LAB cultures from overnight growth in broth were harvested by

centrifugation (4000 RPM) and the supernatant fraction was discarded. The cell pellet

was washed twice with 10 ml of Carbohydrate Lactic Acid (CHL) broth used in

conjuction with the API 50CHL test assay and the final resuspension was aliquoted into

the API 50 CH panels. The panel strips (consisting of various substrates) were incubated

aerobically at 30°C and scored at 24- and 48 hrs. The carbohydrate fermentation patterns

were scored and checked against the manufacturer’s computerized CHL database to

obtain results.

Preparation of bacteriocin culture supernatants.

Bacteriocin-producing strains (Bac+) were inoculated into MRS at a 1% inoculum

level and propagated twice overnight at 30°C before use and then harvested after 15 hrs

incubation for use in recovering bacteriocin-containing supernatant fractions. The

supernatant was adjusted to pH 7.0 with 0.5 M NaOH. A cell-free supernatant was

obtained by centrifuging (4000 RPM) the culture, followed by filtration of the

supernatant through a 0.2 µm-pore-size cellulose acetate filter. Inhibitory activity from

any hydrogen peroxide that may have been produced by the culture was eliminated by the

addition of catalase (10 IU/ml). Activity was determined as described earlier.

75

Derivation of spontaneous bacteriocin-resistant strains of L. monocytogenes.

Cell-free filter-sterilized bacteriocin fractions produced by various bacterial

genera of LAB were spotted onto indicator overlays containing L. monocytogenes 39-2 or

Scott A-2. After 3-5 days of extended incubation, colonies of L. monocytogenes 39-2 and

Scott A-2 appeared in the inhibition zones. These colonies were additionally streaked

onto TS agar plates upon which 1-ml of the respective bacteriocin extract (105-106

AU/ml) was spread prior to streaking. The indicator isolate recovered from the

bacteriocin inhibition zone and bacteriocin streak plate was then compared to the wild-

type indicator in comparative spot tests with serial dilutions of bacteriocin extracts (to

confirm bacteriocin resistance) and checked on both MOX agar and antibiotic-containing

TS agar to antibiotics (100 µg Streptomycin/ml and 10 µg Rifamycin/ml) against which

the original indicator strain was resistant (to confirm identity as the original indicator

strain). Resistance in BacR L. monocytogenes 39-2 was compounded to include resistance

to additional bacteriocins against which the BacR derivative was still sensitive by

repeating this process.

Bacteriocin inhibitory assay in culture broth.

Bacteriocin inhibitory assays were tested against the wild-type L. monocytogenes

39-2 strain in liquid culture. Listeria monocytogenes 39-2 was inoculated into BHI broth

at ~106 CFU/ml and assays included the addition of pH-adjusted filter-sterilized spent

media from a non-bacteriocin producing lactic (i.e., control), pH-adjusted and filter-

sterilized filtrates for each of 3 different ‘resistance-class’ groupings of bacteriocins we

identified (individually), as well as a combination of the 3 bacteriocins belonging to 3

76

different resistance classes. The combination was obtained by addition of an equal

amount of each bacteriocin and then using 1 ml for inoculation (the same amount of each

of the individual bacteriocins). Addition of 1 ml of bacteriocin-free media or bacteriocin

preparation was then added to 9 ml broth of each of the solutions mentioned above.

Samples of each were retrieved at 0, 1, 2, 6, 12, 24, 48, 72, and 96 hrs for plate counts of

L. monocytogenes 39-2. Trials were performed in duplicate.

Statistical analysis.

All trials were performed in duplicate and the data were subjected to one-way

repeated measures analysis of variance (RM ANOVA) to determine the differences

between the different treatments using Sigma Stat 3.1 (Systat Software, Inc., Richmond,

USA). All pair-wise, multiple comparisons were by the Holm-Sidak method.

77


Bacteriocin resistance and cross-resistance.

During routine ‘spot-on-lawn’ assays, we noticed that for some indicator

organisms, including L. monocytogenes, bacteriocin-resistant (BacR) colonies would

often appear within inhibition zones upon extended incubation. We compared the

sensitivity of wild-type and spontaneous BacR derivatives obtained individually against 4

bacteriocins (nisin produced by L. lactis ATTC 11454, curvaticin FS47 produced by

Lactobacillus curvatus FS47, pediocin PA-1 produced by Pediococcus acidilactici

PAC1.0, and lacticin FS56 produced by Lactococcus lactis FS56) with L. monocytogenes

39-2 and Scott A-2 against five bacteriocin preparations: nisin, curvaticin FS47, pediocin

PA-1, lacticin FS56, and lacticin FS92. The wild-type strains of L. monocytogenes, Scott

A-2 and 39-2, were sensitive to all 5 bacteriocins tested (Table 3). We were not able to

isolate a derivative that was completely insensitive to nisin, but only one which had a

reduced MIC. However, with both L. monocytogenes Scott A-2 and 39-2, we were able to

isolate BacR derivatives that were completely resistant in spot-on-lawn tests using the

highest concentration of bacteriocins that we obtained from culture supernatant fractions

(Table 3). The BacR variants not only had resistance to the bacteriocin against which they

were obtained against, but several demonstrated cross-resistance reactions to other

bacteriocins (Table 3). This trend was obtained with both L. monocytogenes Scott A-2

and 39-2.

78

Functional classification into ‘resistance groups’ or ‘classes’.

The practical implications of this are that a resistance event against one of this

group of bacteriocins would provide resistance against all three since cross-resistance

was obtained for 2 bacteriocins without the strain having had exposure to them. An

important consideration to make is that if one, or several, of these bacteriocins were

intended for use as biopreservatives in foods, how readily such an event would occur. We

determined that the frequency of spontaneous resistance was in the range of 10-6-10-7, and

is consistent with the range observed by Graveen et al. (2002). The independent

mutational event that occurred upon selection against each of the individual bacteriocins

must be a common mechanism for all three bacteriocins, since the change that affected

inhibition was previously demonstrated by all three of them. We choose to refer to this

situation as having identified three bacteriocins of the same ‘resistance class’ because we

used resistant variants to identify the occurrence. The cross-resistance observed between

pediocin PA-1-, lacticin FS56-, and curvaticin FS47-resistant isolates of L.

monocytogenes and these three bacteriocins did not extend to nisin or lacticin FS92,

indicating that either the mode of inhibition by these bacteriocins and/or their mechanism

of resistance/immunity, is not the same. Lacticin FS92 did not blot with a nisin gene

probe and both bacteriocins inhibit the respective producer organism demonstrating that

they are not the same bacteriocin or share the same immunity (data not shown). This

suggests that nisin, lacticin FS92, and the group comprising lacticin FS56, curvaticin

FS47, and pediocin PA-1 belong to three different ‘resistance’ groups. We felt that it was

possible to use the spontaneous-resistant isolates as a ‘screen’ for bacteriocins that were

of a different ‘resistance class’ (i.e., those that would demonstrate inhibitory activity

79

against the resistant isolate) and therefore, cross-resistance would only be observed by

different bacteriocins of the same resistance class.

Use of spontaneously-derived bacteriocin-resistant isolates as indicators for

different resistance classes of bacteriocins.

When all five bacteriocins that inhibited L. monocytogenes 39-2 (Fig. 5A) were

spotted on the lacticin FS56R variant, activity from three bacteriocins that belonged to the

same ‘resistance class’ was eliminated (Fig. 5B). We consider the bacteriocins that were

still inhibitory to the FS56R strain of L. monocytogenes 39-2 as belonging to a different

‘resistance class’. Furthermore, we were able to generate variants that were resistant to

multiple resistance classes by re-selection of resistant variants against bacteriocins of a

different resistance class. The new resistant variants were able to compile multiple

resistances to additional bacteriocins (Fig. 5C). Using the L. monocytogenes strain that

was resistant to two resistance classes of bacteriocins (FS56R and Bac3R), we screened

for bacteriocins in our collection that were still inhibitory to this variant (lacticin FS97,

Fig. 5C). When we again selected for resistance to lacticin FS97 using the strain of L.

monocytogenes 39-2 that was resistant to two bacteriocins (comprising two different

resistance classes, lacticin FS56R and pediocin Bac3R), we were able to further eliminate

inhibitory activity from lacticin FS97, and consider this bacteriocin as belonging to a 3rd

resistance class (Fig. 5D). The compounding of multiple resistances in aggregate is

presumably due to different mutational events specific to the particular ‘resistance class’

addressed. This bacteriocin resistant strain was resistant to all 5 bacteriocins comprising 3

‘resistance classes’ and yet was still sensitive to nisin (i.e., a 4th resistance class; data not

shown). However, we were not able to isolate a variant that demonstrated complete

80

resistance against nisin. We propose the use of these BacR strains with aggregate

accumulation of multiple resistances, may be useful in screening for bacteriocins that

would still inhibit them and to assist in the identification of bacteriocins of different

resistance classes (i.e., of different mechanisms of inhibition against which different

mutations may afford protection). The identification of what resistance class an unknown

bacteriocin belongs to would only be accommodated by a series of resistance isolates,

each derived against a different resistance-class bacteriocin (as in Table 3), or, unless

tested against the entire series of indicators we have derived, each having resistance

against an additional class (as in Fig. 5).

Anti-listerial bacteriocins and ‘resistance classes’ of Lactic Acid Bacteria isolated

from foods.

Using this approach of resistance-class indicators, we examined Bac+ LAB

isolated from retail foods for presence of multiple resistance class bacteriocins that we

previously identified. Thirty-eight Bac+ LAB were isolated from seventy-five samples of

retail foods via deferred antagonism using Lb. delbrueckii 4797, one of the most sensitive

indicators of bacteriocins from LAB that we have tested (Table 4). The Bac+ LAB were

then tested for inhibition of L. monocytogenes 39-2 and the various bacteriocin-resistant

mutant strains we isolated to screen and group the bacteriocins into resistance classes. Of

the 38 Bac+ LAB detected with our sensitive lactic indicator, only 16 were inhibitory to

L. monocytogenes 39-2 (Table 4). Of these 16 bacteriocins, activity against 14 was

eliminated using the lacticin FS56R variant (also the same as the pediocin PA-1 and

curvaticin FS47-resistant variants). When tested against the double resistance class L.

monocytogenes 39-2 indicator strain (FS56R Bac3R), activity was only demonstrated by 2

81

of the 4 that inhibited the single resistance class indicator strain, and no activity was

observed against the triple resistance class isolate (Table 4). The data indicate that

bacteriocins produced by LAB that are generally present on food products, can be

grouped according to mutational resistance events as presented in our typing scheme. The

practical significance is that this information may provide a method by which one can

design a mixture of bacteriocins that may be used to reduce, or eliminate, the possibility

of spontaneous resistance occurring against bacteriocins when used as preservatives in

foods.

Inhibitory assay demonstrating the practical functionality of different resistance-

class groupings.

The concept of combining different bacteriocins is not new. Genetically modified

L. lactis FI5876, containing both pediocin PA-1 and nisin A which are unrelated

bacteriocins was developed by Horn et al. (1998, 1999). When used as a starter culture in

fermented dairy products, this modified strain prevented the emergence of any

bacteriocin-resistant isolates of L. monocytogenes because the frequency for emergence

of a strain resistant to both peptides was low. Treatment with a combination of

bacteriocins, for instance, nisin and a class IIa bacteriocin, would theoretically reduce the

incidence of resistance (Bouttefroy and Milliere 2000, Vignolo et al. 2000). There is

currently conflicting evidence as to whether resistance to one class of LAB bacteriocins

can result in cross-resistance to another class (Bouttefroy et al. 2000, Song and Richard,

1997). To our knowledge, there have been no reports on grouping of bacteriocins into

different resistance classes. The novelty of using mixtures of bacteriocins of different

resistance classes would be that they would require a separate mutational event to render

82

the strain resistant against the mixture. A single spontaneous resistance event may occur

at a frequency of 10-6-10-7 (our estimates with the resistances we obtained) when faced

with a population of Listeria. When the Listeria would come up against a mixture of 3

bacteriocins of the same ‘resistance class’, a spontaneous mutant would render that

mutant resistant to all 3 bacteriocins. However, if the 3 bacteriocins were of different

resistance classes and used in combination, it would require that event to occur

simultaneously for 3 different mutational targets in the same target cell, a less-likely

event. We examined this by performing liquid inhibition assays using individual and a

combination assay of bacteriocins belonging to 3 resistance classes against wild-type

(sensitive) strain, L. monocytogenes 39-2 (Fig. 6). Our data shows that the strain grew

unimpeded in the inoculated medium (as expected), however cultures to which each of

the individual resistance-class bacteriocins were added were inhibited followed by quick

recovery and regrowth. However, a mixture of all 3 bacteriocins containing only 1/3 the

amount of any one of the bacteriocins used in the individual assays, provided a

significant difference in treatment that was sufficient to prevent regrowth of Listeria for

an extended period of time (Fig. 6). Although we may have used too high an inoculum of

Listeria for which there may not have been enough bacteriocin to accommodate all of the

cells, the difference in the outgrowth of the population of L. monocytogenes in the

individual and combination treatments gives a good demonstration of the utility of

selecting mixtures of bacteriocins that belong to different resistance classes. This may

also demonstrate that there is some synergy involved with the mixture, as it contained

only 1/3 the amount of each bacteriocin in the individual assays.

83

Although there are reports of the development of resistance towards single

bacteriocins, this study suggests that a combination of different resistance-class

bacteriocins, used as ‘biopreservatives’, could minimize or eliminate the appearance of

BacR variants in food applications, thus providing the broadest immunity and protection

from pathogens or spoilage microorganisms. Selection for bacteriocin-resistant (BacR)

variants of L. monocytogenes resulted in strains that were resistant to one or more

bacteriocins and demonstrated that resistance to one bacteriocin can provide cross-

resistance to others (Fig. 5). Cross-resistance is well known in the medical community

with regards to antibiotic treatment of bacterial infections, whereby different antibiotic

classes are often required to effectively combat stubborn microorganisms. We have

demonstrated that cross-resistance also occurs for various groups of bacteriocins and the

same approach of different ‘resistance classes’ can best inhibit strains that may otherwise

develop resistance to a single bacteriocin.

ACKNOWLEDGEMENTS

This work was supported in part by the VPR Homeland Security Fellowship program, the

FAPC Research Assistantship program, and the Oklahoma Agricultural Experiment

Station, Oklahoma State University (HATCH project no. 2335), Stillwater, OK. We

thank Ms. Janet Rogers (OSU Core Facility) in assistance with DNA sequencing

reactions and obtaining sequence information.

84

REFERENCES

1. Bouttefroy, A., and J. B. Milliere. 2000. Nisin-curvaticin 13 combinations for

avoiding the regrowth of bacteriocin resistant cells of Listeria monocytogenes

ATCC 15313. Int J Food Microbiol 62:65-75.


Bacteriocins: safe, natural antimicrobials for food preservation. Int J Food

Microbiol 71:1-20.

3. Deegan, L.H., P.D. Cotter, C. Hill, and P. Ross. 2006. Bacteriocins: Biological

tools for bio-preservation and shelf-life extension. Intl. Dairy J. 16:1058-1071.

4. De Martinis, E. C. P., A. D. Crandall, A. S. Mazzotta, and T. J. Montville.

1997. Influence of pH, salt, and temperature on nisin resistance in Listeria

monocytogenes. J. Food Prot. 60:420-423.

5. De Vuyst, L., and E. J. Vandamme. 1994. Bacteriocins of lactic acid bacteria:

microbiology, genetics and applications. Blackie Academic & Professional,

London, United Kingdom.


susceptibility of Listeria strains to class IIa bacteriocins. Curr Microbiol 41:1-4.

7. Gravesen, A., A. M. Jydegaard Axelsen, J. Mendes da Silva, T. B. Hansen,

and S. Knochel. 2002. Frequency of bacteriocin resistance development and

85

associated fitness costs in Listeria monocytogenes. Appl Environ Microbiol

68:756-64.

8. Guinane, C.M., P.D. Cotter, C. Hill, and R.P. Ross. 2006. Spontaneous

resistance in Lactococcus lactis IL1403 to the lantibiotic lacticin 3147. FEMS

Microbiol. Lett. 260:77-83.


Rodriguez, J.M., and H.M. Dodd. 1998. Production of pediocin PA-1 by

Lactococcus lactis using the lactococcin A secretory apparatus. Appl. Environ.



Rodriguez, J.M., and H.M. Dodd. 1999. Enhanced production of pediocin PA-1

and coproduction of nisin and pediocin PA-1 by Lactococcus lactis. Appl.


11. Klaenhammer, T. R. 1993. Genetics of bacteriocins produced by lactic acid

bacteria. FEMS Microbiol Rev 12:39-85.

12. Larsen, A. G., and B. Nørrung. 1993. Inhibition of Listeria monocytogenes by

bavaricin A, a bacteriocin produced by Lactobacillus bavaricus MI401. Lett.

Appl. Microbiol. 17:132-134.

13. Ming, X., and M. A. Daeschel 1993. Nisin resistance of foodborne bacteria and

the specific resistance responses of Listeria monocytogenes Scott A. J. Food Prot.

56:944-948.

86

14. Muriana, P.M. 1996. Bacteriocins for control of Listeria. J. Food Prot.

59(suppl.):54-63.

15. Muriana, P.M., and T.R. Klaenhammer. 1987. Conjugal transfer of plasmid-

encoded determinants for bacteriocin production and immunity in Lactobacillus

acidophilus 88. Appl. Environ. Microbiol. 53:553-560.

16. Muriana, P.M., and T.R. Klaenhammer. 1991. Purification and partial

characterization of lactacin F, a bacteriocin produced by Lactobacillus acidophilus

11088. Appl. Environ. Microbiol. 57:114-121.

17. Rasch, M., and S. Knochel. 1998. Variations in tolerance of Listeria

monocytogenes to nisin, pediocin PA-1 and bavaricin A. Lett Appl Microbiol

27:275-8.

18. Song, H.J., and J. Richard. 1997. Antilisterial activity of three bacteriocins used

at subminimal inhibitory concentrations and cross-resistance of the survivors. Int.

J. Food Microbiol. 36:155–61.

19. Thomas, L., M. R. Clarkson, and J. Delves-Broughton. 2000. Nisin, In A. S.

Naidu (ed.). Natural food antimicrobial systems CRC Press, Boca Raton, Fla.

463-524.

20. Vignolo, G., Palacios, J., Farias, M.E., Sesma, F., and U. Schillinger. 2000.

Combined effect of bacteriocins on the survival of various Listeria species in

broth and meat system. Curr. Microbiol. 41:410–16.

87

Table 3. Sensitivity reactions of bacteriocins spotted on various indicator lawns of L. monocytogenes, including those for which spontaneous bacteriocin resistance was acquired.

Cell-free Bacteriocins Extracts (spotted on indicator lawn) Indicator Lawn Bacteria1

Nisin Curvaticin FS47

Pediocin PAC1.0

Lacticin FS56

Lacticin FS92

L. monocytogenes Scott A S S S S S L. monocytogenes Scott A (NisinR) S2 S S S S

L. monocytogenes Scott A (curvaticin FS47R) S R R R S

L. monocytogenes Scott A (pediocin PACR) S R R R S

L. monocytogenes Scott A (lacticin FS56R) S R R R S

L. monocytogenes 39-2 S S S S S L. monocytogenes 39-2 (NisinR) S* S S S S

L. monocytogenes 39-2 (curvaticin FS47R) S R R R S

L. monocytogenes 39-2 (pediocin PACR) S R R R S

L. monocytogenes 39-2 (lacticin FS56R) S R R R S1 Resistance to specific bacteriocin is denoted with a superscript “R” (NisinR). 2Note: Reduced MIC was observed to nisin, but not complete resistance. Reactions: S = sensitive (zone of inhibition obtained); R = resistant (no inhibition detected).

88

Table 4. Lactic acid bacteria (LAB) and Bac+ LAB isolated from retail foods. Sensitivity to L.monocytogenes

(indicator strain) Food

Sample No. Food Samples

No. of Bac+

Isolatesa 39-2 W-T

39-2 FS56R

39-2 FS56R

Bac3R

39-2 FS56R

Bac3R

FS97R

Raw Meat:

Ground Beef 8 3 3 - - -Ground Pork 26 12 5 1 - -

Ground Turkey 18 9 5 1 - - Ground Chicken 5 2 - - - -

Raw Beef 2 - - - -Raw Pork 2 1 1 1 1 -Raw Chicken 1 1 - - - -

Diary: Cheese 6 3 - - - -

Produce: Vegetables 4 4 1 1 1 -Mushrooms 1 1 1 - - -Fruits 2 2 - - - -

Total 75 38 16 4 2 0 a Lb. delbrueckii 4797 used as the indicator strain

89

Figure 5. Inhibitory zones of select filter-sterilized, pH-adjusted (pH 7.0) bacteriocin extracts on indicator lawns of L.monocytogenes 39-2 (wild-type) and bacteriocin-resistant derivatives (as listed above the plates). Panel A, inhibition zonesagainst L. monocytogenes 39-2 using 5 bacteriocins: curvaticin FS47 (Lactobacillus curvatus FS47), pediocin PAC1.0(Pediococcus acidilactici PAC1.0), lacticin FS56 (Lactococcus lactis FS56), lacticin FS97 (L. lactis FS97), and pediocin Bac3(P. acidilactici Bac3). Panel B, activity of the same 5 bacteriocins against L. monocytogenes 39-2 resistant to lacticin FS56(FS56R). Panel C, activity of the same bacteriocins against L. monocytogenes 39-2 resistant to lacticin FS56 and pediocinBac3 (FS56RBac3R). Panel D, activity of the same bacteriocins against L. monocytogenes 39-2 resistant to lacticin FS56,pediocin Bac3, and lacticin FS97 (FS56R Bac3R FS97R).

A B C D

Wild-Type Class 1 Resistance Class 2 Resistance Class 3 ResistanceL.mono 39-2 L. mono 39-2 L. mono 39-2 L. mono 39-2(wild type) (FS56R) (FS56R Bac3R) (FS56R Bac3R FS97R)

90

Figure 6. Liquid inhibition assay of inidividual bacteriocins or in combination against L. monocytogenes 39-2. Panel A,cultures of L. monocytogenes 39-2 alone (control), or to which each of 3 resistance class bacteriocins or mixture of the 3resistance classes were added (lacticin FS56, pediocin Bac3, or lacticin FS97). Panel B, similar to panel A but comparing twocombination assays: one combination contains 3 of the same resistance class bacteriocins (lacticin FS56, curvaticin FS47,pediocin PA-1) whereas the other has 3 different resistance class bacteriocins (lacticin FS56, pediocin Bac3, and lacticinFS97). Treatments with different lowercase letters are significantly different (P < 0.05).

Time (hrs)0 12 24 36 48 60 72 84 96

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10

ControlClass 1 BacClass 2 BacClass 3 BacCombo (1+2+3)

Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10

Control3x Class-1 ComboClass 1+2+3 Combo

A B

a a

b

bb

c

b

c

Time (hrs)0 12 24 36 48 60 72 84 96

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10


Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10


A B

Time (hrs)0 12 24 36 48 60 72 84 96

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10


Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10


Time (hrs)0 12 24 36 48 60 72 84 96

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10


Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144

Log

CFU

/ml

0

1

2

3

4

5

6

7

8

9

10


A B

a a

b

bb

c

b

c

91

CHAPTER V

USE OF PCR ARRAYS TO QUICKLY IDENTIFY BACTERIOCIN-RELATED

SEQUENCES IN BACTERIOCINOGENIC LACTIC ACID BACTERIA.

Sunita Macwana1 and Peter M. Muriana1,2





92

INTRODUCTION

Bacteriocins are ribosomally-synthesized peptides produced by many types of

bacteria that are inhibitory to sensitive organisms. Since lactic acid bacteria (LAB) are

generally recognized as safe (GRAS) for use in foods, those produced by LAB have been

proposed for use in the biopreservation of food products by eliminating or controlling

spoilage microorganisms and pathogens (De Vuyst and Vandamme, 1994). Due to

potential food-related applications, many bacteriocins of LAB have been identified and

characterized, both biochemically and genetically (Cleveland et al. 2001). Since 1984

through 2006, more than 1000 papers have been published characterizing bacteriocins

from LAB. Each newly identified Bacteriocin-positive (Bac+) strain that shows promising

phenotypic traits presents a challenge in determining whether it has already been studied

and characterized.

Bacteriocins of LAB have been classified into four distinct classes based on

biochemical and functional characteristics (Klaenhammer, 1993). Class I (or lantibiotics)

are bacteriocins characterized by the presence of unusual amino acids such as

lanthionine. Nisin is a well characterized and broadly used bacteriocin in this class. Class

II bacteriocins are small, heat-stable, non-lanthionine peptides (Nes et al. 1996), which

are divided into three subgroups: class IIa or pediocin-like bacteriocins with strong

antilisterial activity, class IIb bacteriocins whose activity depends on the complementary

action of two peptides which form poration complexes and class IIc are Thiol-activated

peptides in which reduced cysteine residues are required for activity and are sec-

dependent secreted bacteriocins. Class III bacteriocins are large, heat-labile bacteriocins

93

(M.W.>30 kDa). Class IV bacteriocins are complex compounds claimed to consist of an

undefined mixture of chemical moieties such as proteins, carbohydrates, and lipids that

are required for activity. Most of the bacteriocins that have been defined belong to class I

or II.

Class II bacteriocins of LAB have emerged in recent years as the most promising

bacteriocin candidates for food preservation as they display overall better performance in

biological activity and physicochemical properties than most bacteriocins from other

classes (Klaenhammer, 1993; Nes et al. 1996; Ennahar et al. 1999, 2000; Nes and Holo,

2000; Garneau et al. 2002). Class II bacteriocin gene clusters are typically built up of

three gene modules: (1) a module that encompasses the structural and immunity genes,

(2) a transport gene module and (3) a regulatory gene module. The latter module encodes

a three-component regulatory system, responsible for the control of bacteriocin

production and consisting of a secreted bacteriocin-like, cationic peptide pheromone, a

histidine protein kinase (HPK), and a response regulator (RR) (Nes and Eijsink, 1999).

The genes that code for the LAB bacteriocins vary in size from 100- 250 bp in length.

In this paper, the DNA from Bac+ strains and new food isolates were subjected to

a bacteriocin-specific PCR array in individual reactions with primers for forty-two known

structural genes of bacteriocins from LAB. Sequencing of the amplimers followed by

sequence analysis helped determine if the identify of the sequences were pre-existent

with others currently available in GenBank or were new sequences. This study uses a

bacteriocin structural gene PCR array to amplify and obtain sequence information to

allow for quick and facile discovery of new bacteriocins among LAB.

94


Bacterial strains and growth conditions

Bacterial strains used in this study are described in Table 5. LAB were grown in

MRS broth (Difco Laboratories, Detroit, Mich.) or on MRS agar and incubated at 30°C

under static conditions. Cultures (0.1%) were transferred three times in MRS broth

incubated at 30°C for 24 h before use. LAB cultures were maintained as frozen stocks at -

80°C in MRS broth with 10% glycerin.

Isolation of bacteriocin-producing Lactic Acid Bacteria from foods

Various foods including raw/ground meats, produce, and dairy products were

purchased from a local supermarket and sampled within 48 h. Samples (50 g) were

weighed aseptically into sterile stomacher bags, diluted 1:10 with MRS broth, stomached,

sealed, and incubated overnight at 30°C for enrichment of LAB. Dilutions made in 0.1%

peptone water were plated onto MRS agar, covered with a 5-ml layer of sterile MRS agar

‘sandwich’ layer to cover plated cells, and incubated at 30°C for 14-24 h until small-

colony growth was evident. Plates with the sandwiched colonies were then overlayed

with 5 ml of soft MRS agar seeded with a 1% inoculum of Lactobacillus delbrueckii

subsp lactis 4797 as the indicator strain and further incubated overnight at 30°C.

Bacteriocins produced by the underlying colonies would diffuse through the sandwich

layer and appear as zones of inhibition in the indicator layer above. Bacteriocin-

producing colonies (Bac+) were recovered by flipping the agar into the cover and

95

recovering cells from the colony through the sterile backside agar. This colony was

streaked onto MRS agar for isolation and confirmed for bacteriocin production.

Identification of bacteriocin-producing Lactic Acid Bacteria

The identification and biochemical characterization of the bacteriocin-producing

isolates was determined using API 50 CH panels (bioMerieux Inc., Fischer Sci.). The

manufacturer’s directions were modified by using overnight growth in broth instead of

cells recovered from agar plates. The broth cultures were harvested by centrifugation and

the supernatant fraction was discarded. The cell pellet was washed twice with 10 ml of

Carbohydrate Lactic Acid (CHL) broth and the final resuspension was aliquoted into the

API 50 CH panels. The panel strips (consisting of various substrates) were incubated

anaerobically (GasPak) at 30°C for 48 h. If a carbohydrate was fermented, the acids

generated produced a yellow color, indicating a positive reaction. Negative reactions did

not show a color change. These carbohydrate-fermented positives were scored and

subjected to the manufacturer’s computerized database to obtain results.

PCR array for bacteriocin structural genes

The coding strand sequences for forty-two known LAB bacteriocin structural

genes were retrieved from GenBank (Table 6). Primers were designed using the Primer

Express Software (Applied Biosystems, Foster City, CA). The criteria for the primer

design included optimum length of 25 bp and melting temperature (Tm) of 58°C - 60°C.

A total of 42 pairs of primers were designed from the coding strands for all known

bacteriocin structural genes targeting Lactobacillus spp., Pediococcus spp., Lactococcus

spp., and Leuconostoc spp. Prior to PCR, the DNA from the bacteriocin-producing strains

96

isolated by our Bac+ screening process was extracted by the BAXTm procedure (Qualicon,

Wilmington, Delaware): 5 µl of overnight culture was mixed with 200 µl of BAXTm lysis

reagent containing protease, and cell lysis was performed by incubating this mixture at

55°C for 60 min and then 95°C for 10 min. The PCR reaction mix consisted of 5 µl of

lysate (i.e., DNA template), 12.5 µl of Absolute SYBR Green PCR mix (ABgene,

Rochester, NY; contains the buffer, MgCl2, dNTPs and DNA polymerase), and the

individual array of primers designed for use in this bacteriocin PCR array. The final

concentration of primers used was 50 nM and the final reaction volume was 25 µl. The

reaction mix was placed in PCR reaction tubes [MJ white low profile tubes (MJ

Research, Hercules, CA)] and then subjected to real time PCR detection using the

Opticon-2 DNA engine (MJ Research) with the following cycling profiles: initial

denaturation at 95°C for 15 min (genome denaturation), followed by 40 cycles of 95°C

for 15 sec (denaturation), 62°C for 60sec (annealing), 72°C for 60 sec (extension),

followed by a final hold at 4°C. All PCR runs included a blank control consisting of

PCR-grade water and a non-template control (no DNA) which was run in parallel to

determine amplification efficiency within each experiment. At the end of each run a

melting curve analysis was performed from 58°C to 90°C at 0.2°C/s to confirm the

specificity of amplification and demonstrate the lack of primer dimer formation.

Sequence analysis

Bacteriocin sequence information was analyzed by using the BLAST algorithm

through the National Center for Biotechnology Information

(www.ncbi.nlm.nih.gov/blast). Nucleotide multiple sequence alignment (MSA) was

performed using the BCM Search Launcher online utility from the Baylor College of

97

Medicine (Smith et al. 1996). DNA sequencing of amplified DNA was performed at the

Dept. of Biochemistry and Molecular Biology Recombinant DNA/Protein Resource

Facility (Oklahoma State University) using an automated DNA sequencer via

"BigDye™"-terminated reactions analyzed on an ABI Model 3700 DNA Analyzer.

98


The LAB are widely used in the manufacture of fermented or cultured foods, they

are considered GRAS, and are also present as a prevalent indigenous contaminating flora

on most non-sterile foods, including cheese, luncheon meats, fruits, and vegetables

(Garver and Muriana, 1993). The production of lactic acid has already afforded their

recognition as bacteria contributing to food preservation, but in recent decades the

identification of numerous bacteriocin-producing strains that can inhibit foodborne

pathogens has enhanced their roles in applications of food preservation and safety

(Cleveland et al. 2001). Due to the ubiquitous nature of these organisms, it is possible

that the same strains/bacteriocins are being investigated in different locations, and their

common identity may go unnoticed until much effort has been spent towards their

molecular characterization.

The identity of bacteriocin gene sequence information is usually obtained after

tedious work to purify and obtain amino acid sequence information of bacteriocin

peptides for further molecular characterization and comparison with database sequences.

We opted for the use of an inexpensive PCR array over the more costly approach of

micro-/macro-arrays for examining a bacterial strain against a bank of target bacteriocin

genes. Reminger et al. (1996), identified and characterized bacteriocins from thirteen

Bac+ LAB strains by designing primers based on the sequences of four well known

bacteriocins; curvacin A, sakacin P, plantaricin A, and plantaricin S. Our initial intention

was to establish an array of primers specific to every bacteriocin coding sequence of LAB

that has been identified. However, this would be difficult due to the high degree of

homology and short coding sequences (100-175 bp) for these bacteriocin genes and the

99

fact that a new bacteriocin sequence may show up as only a negative PCR reaction. We

therefore contemplated the possibility that the homology between the sequences may

assist by way of non-specific priming of bacteriocin genes using stretches of homologous

primer sequences to initiate priming of heterologous bacteriocin sequences in which the

intra-primer sequence information would be specific to the bacteriocin gene of the target

strain. Using this approach, we designed primer sets for 42 structural genes of known

bacteriocin from LAB utilizing most of the full length of the coding sequence as possible

given their small size (Table 6). Although real-time PCR is primarily used for

quantification of target DNA being amplified, we used it as a means of providing visual

(PCR profiles) and diagnostic discrimination (melting curves) to our analyses and is very

efficient when examining large numbers of samples. We examined a Bac+ isolate from

ground turkey, “Bac3” identified as Pediococcus acidilactici, known to produce pediocin

that was recently shown to belong to a different ‘resistance class’ than pediocin PA-1,

lactocin FS56, and curvaticin FS47 in which cross-resistance to all of these were

demonstrated by several strains of Listeria monocytogenes that were made resistant to

one of these bacteriocins, yet was still inhibited by P. acidilactici Bac3 (Macwana and

Muriana, 2007). When this strain was subjected to our bacteriocin PCR array, we

obtained real-time amplification with 4 sets of primers designed from 4 bacteriocin

structural genes (Fig. 7): papA (Pediococcus pentosaceous), pedB (Pediococcus

acidilactici), plnA (Lactobacillus plantarum), and sakX (Lactobacillus sakei). When

amplimers generated by these different primer-pairs were sequenced and analyzed by

multiple sequence alignment, the intra-primer regions generated with P. acidilactici Bac3

as template were identical (Fig. 7). However, when these sequences were compared to the

100

bacteriocin structural genes from which the primers were derived, there were obvious

differences in among the intra-primer regions and those pertaining to P. acidilactici Bac3

(Fig. 7). These data were exciting in that they allowed the identification of specific

bacteriocin sequence information from an, as yet, unknown lactic strain (i.e., we had not

yet done API Identification on the strain, except for isolation as a Bac+ lactic acid

bacteria).

Another Bac+ isolate from ground pork (sausage) was identified as Lactobacillus

sakei (strain JD) by API identification. When DNA from Lb. sakei JD was subjected to

the bacteriocin PCR array, we again obtained successful amplification by primers to

bacteriocins from other Lb. sakei bacteriocin genes as well as from closely related Lb.

curvatus (Fig. 8). When we compared the sequences obtained from our amplifications to

each other after amplifying strain JD with the various primers, we were confused at the

differences observed when comparing intra-primer sequences by multiple sequence

alignment (data not shown). Previously, amplimers obtained from the same strain, but

with different primers, showed the same intra-primer sequence. Upon further examination

of the intra-primer sequences with a Blast search of GenBank, we found that three

different intra-primer amplimer sequences obtained with different bacteriocin array

primers each showed close homology to a different bacteriocin structural gene, all three

of which have been previously shown to exist within a single strain (Fig. 8). Two of these

bacteriocins (Sakacin T and Sakacin X) showed high homology to bacteriocins found in

Lb. sakei while the third bacteriocin showed homology to one produced by Lb. curvatus

(Curvacin A). Further analysis showed that the three sequences were homologous to 3

bacteriocins that already co-exist in the same strain of Lb. sakei (Vaughan et al. 2004).

101

The data suggests that this isolate may be a different (or related) strain of Lb. sakei

because sequence comparison of all 3 sequences to those in GenBank were not

completely identical (Fig. 8).

The prospects for multiple bacteriocin genes within individual strains confirmed

the need to sequence all successful amplimers obtained with different primers sets. We

also did this with 2 Bac+ strains of Lactococcus lactis isolated from raw pork (RP1) and

vegetables (FS97). In both cases, we again identified three bacteriocin genes in each

strain identified with primers that correlated to a two-component ltnA/ltnB bacteriocin

and additional lcnB bacteriocin that has previously been identified in Lc. Lactis (Kojic et

al. 2006) (Fig. 9). Lc. Lactis FS97 was of interest because it was unique in being able to

inhibit L. monocytogenes strains that had acquired bacteriocin resistance to 2 different

bacteriocin resistance mechanisms and was categorized as a bacteriocin belonging to a

3rd resistance class (Macwana and Muriana, 2007).

In an effort to further demonstrate the utility of the method we tested Lc. lactis

FS92, a bacteriocinogenic strain for which we had spent numerous attempts trying to

obtain amino acid sequence information with purified bacteriocin but without success,

presumably due to an N-blocked amino terminus that prevented amino acid sequencing

by Edman Degradation analysis, and further attempts to recover internal peptides for

sequencing were also unsuccessful (Mao et al. 2001). Amplification of the lacticin FS92

bacteriocin with primers from the lacA gene of Lc. lactis resulted in the identity of a

structural gene sequence sharing homology with that in FS92 (Fig. 10).

102

The data demonstrate that not only can the ‘bacteriocin PCR array’ quickly

amplify and allow sequence identify and analysis of bacteriocin structural genes from

Bac+ LAB, but it can also help to identify multiple bacteriocin-related genes occurring in

the same strain. By more traditional methods, this could have taken months to identify,

yet with the PCR array we have been able to identify the existence and sequence identity

of 3 bacteriocin genes within 3 different strains or sequences of bacteriocin genes that

were impervious to protein sequence analysis within 2 days (1 day to run PCR, 1 day to

sequence and run sequence analyses). The utility of such an array can be enlarged by

automated methods to include immunity or other processing genes that would further

help identify and characterize bacteriocin operons and/or whether they have previously

been studied. We have already tested a preliminary version of this as well, using a

‘bacteriocin immunity gene PCR array’ that was effective in eliciting PCR amplification

of bacteriocin immunity gene sequence information for P. acidilactici Bac3 (data not

shown). The use of these approaches to identifying newfound bacteriocinogenic strains

would be helpful to those laboratories interested in non-repetitive research in new and

novel bacteriocins.

103

CONCLUSION

This study demonstrates the rapidity with which novel bacteriocin sequences can be

identified using a PCR array to quickly amplify and provide definitive DNA sequence

information for unknown bacteriocins. This process may minimize duplicative efforts to

study bacteriocins that are already well-characterized and for which sequence information

exists in GenBank. Every bacteriocin-producing strain of LAB that was subjected to the

PCR array provided amplification with more than one pair of primers and sequence data

quickly demonstrated whether the bacteriocin was previously characterized.

ACKNOWLEDGEMENTS

This work was supported in part by the VPR Homeland Security Fellowship program, the

FAPC Research Assistantship program, and the Oklahoma Agricultural Experiment

Station, Oklahoma State University (HATCH project no. 2335), Stillwater, OK. We

thank Ms. Janet Rogers (OSU Core Facility) in assistance with DNA sequencing

reactions and obtaining sequence information.

104

REFERENCES


Bacteriocins: safe, natural antimicrobials for food preservation. Int. J. Food

Microbiol. 71:1-20.

13. De Vuyst, L., and E. J. Vandamme. 1994. Bacteriocins of lactic acid bacteria:

microbiology, genetics and applications. Blackie Academic & Professional,

London, United Kingdom.


susceptibility of Listeria strains to class IIa bacteriocins. Curr. Microbiol. 41:1-4.

15. Ennahar, S., K. Sonomoto, and A. Ishizaki. 1999. Class IIa bacteriocins from

lactic acid bacteria: antibacterial activity and food preservation. J. Biosci. Bioeng.

87:705-16.

16. Garneau, S., N. I. Martin, and J. C. Vederas. 2002. Two-peptide bacteriocins

produced by lactic acid bacteria. Biochimie 84:577-92.

17. Garver, K.I., and P.M. Muriana. 1993. Detection, identification, and

characterization of bacteriocin-producing lactic acid bacteria from retail food

products. Int. J. Food Microbiol. 19:241-258.

18. Kojic M., Strahinic I., Fira D., Jovcic B., Topisirovic L. 2006. Plasmid content

and bacteriocin production by five strains of Lactococcus lactis isolated from

semi-hard homemade cheese. Can. J. Microbiol. 52(11):1110-20.

105

19. Klaenhammer, T. R. 1993. Genetics of bacteriocins produced by lactic acid

bacteria. FEMS Microbiol. Rev. 12:39-85.

20. Macwana, S., and P.M. Muriana. 2007. Use of acquired spontaneous resistance

to screen bacteriocins of LAB into functional inhibitory groups. Appl. Environ.

Microbiol. (Dissertation, Chapter IV).

21. Mao, Y., Muriana, P.M., and M.A. Cousin. 2001. Molecular characterization

and transpositional inactivation of lacticin FS92, a broad spectrum bacteriocin

produced by Lactococcus lactis. Food Microbiol. 18:165-175.

22. Nes, I. F., D. B. Diep, L. S. Havarstein, M. B. Brurberg, V. Eijsink, and H.

Holo. 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie Van

Leeuwenhoek 70:113-28.

23. Nes, I. F., and H. Holo. 2000. Class II antimicrobial peptides from lactic acid


24. Nes, I. F., V.G.H. Eijsink. 1999. Regulation of group II peptide bacteriocin

synthesis by quorum-sensing mechanisms. In: Cell-Cell Signalling in Bacteria

(Dunny, G. M., Winans, S.C., Eds.), pp. 175-192 American Society for

Microbiology, Washington DC.

25. Reminger, A., Ehrmann, M. A., Vogel, R. F. 1996. Identification of

bacteriocin-encoding genes in Lactobacilli by polymerase chain reaction (PCR).

Syst. Appl. Microbiol. 19:28-34.

106

26. Smith, R.F., Wiese, B.A., Wojzynski, M.K., Davison, D.B., Worley, K.C.

1996. BCM Search Launcher--An integrated interface to molecular biology data

base search and analysis services available on the world wide web. Genome Res.

6:454-62.

27. Vaughan, A., O’ Mahony, J., V. G. Eijsink, O’ Connell-Motherway, M., and

D. van Sinderen. 2004. Transcriptional analysis of bacteriocin production by

malt isolate Lactobacillus sakei 5. FEMS Microbiol. Lett. 235:377-84.

107

Table 5. Bacterial strains used in this study.

Bacterial Strains Source Reference Lactic Acid Bacteria

Lactobacillus delbrueckii subsp, lactis 4797 T. R. Klaenhammer Garver and Muriana, 1993

Lactobacillus curvatus FS47 Ground beef Garver and Muriana, 1993

Pediococcus acidilactici PAC1.0 J. B. Luchansky Marugg et al., 1992

Lactococcus lactis FS56 Mushrooms Garver and Muriana, 1993

Lactococcus lactis FS97 Vegetables Garver and Muriana, 1993

Lactococcus lactis FS92 Raw Pork Garver and Muriana, 1993

Pediococcus acidilactici Bac3 Ground Turkey This study

Lactobacillus sakei JD1 Ground Pork This study

Lactococcus lactis RP1 Raw Pork This study

108

Table 6. Primers used in this study ID Organism Gene For Primer (5’ – 3’) Rev Primer (5’ – 3’) Size

(-kb) S 1 Lactococcus lactis subsp lactis lclA aaaccaagtctctcgtattggc ggcacgttgtgtatccttacct 200

S 2 Lactococcus lactis Ltn A ccagttacatggttggaagaag tttacaccaagccatacattca 150

S 3 Lactococcus lactis subsp. lactis lcnB agttaatggaggaagcttgcag tagtggaatgtttttccccatc 156

S 4 Lactococcus lactis LtnB caattgggaaaataccttgaaga caagcacgtgtacattttgttgt 152

S 5 Lactococcus lactis subsp. lactis LacA agtgctattcaaaattctggcg taatccaacctccggaataaga 217

S 6 Lactococcus lactis subsp. cremoris IcpJ tggaccttattttaggtgcaaaa gagcagcaagtaaatacaaagttcc 100

S 7 Leuconostoc mesenteroides mesY agtctgtggaagcatatcagca taccaaaatccatttccaccat 172

S 8 Leuconostoc mesenteroides mesB aaacaaatttcaaaatcctttcaga atttgtggttcttgatctttgc 150

S 9 Leuconostoc mesenteroides lccK tgaactgactgcaatcactggt aagagtgcatatgtcccttggt 100

S 10 Leuconostoc carnosum B-Talla gtaacggagttcattgcacaaa taccagaaaccatttccaccat 103

S 11 Leuconostoc mesenteroides lcnS ctttggatgcctttcgatactc gctacatgaggtcgacttttcc 144

S 12 Leuconostoc gelidum lcnA gaacatgaaacctacggaaagc ccaccatttgctaaacgatgta 165

S 13 Pediococcus pentosaceus papA ttacttgtggcaaacattcctg tgattaccttgatgtccaccag 106

S 16 Pediococcus acidilactici ped A ctgccgaagaaaacaaagttct ctattggctaggccacgtattg 110

S 17 Lactobacillus plantarum plnc8A ctagaaaagatctctggcggtg catatgggtgctttaaattcca 100

S 18 Lactobacillus plantarum plnc8B ggcaagagtagcttgtctcaaa caatcgttttgcgatgcttat 106

S 19 Lactobacillus acidophilus TK8912 acd T aaagaattagcattaatttctgggg cgtcagtataacgaaggctttccc 100

S 20 Lactobacillus casei α-peptide aacaattggtggtggcatgt tatccaagacgtccctttttgt 111

S 21 Lactobacillus casei β-peptide gaaaaatttgccaatatctcgaa accattaattggtgaatggtga 150

S 22 Lactobacillus curvatus cur A acagaattacaaacaattaccggc cattccagctaaaccactagcc 150

S 23 Lactobacillus gasseri bac aatgtaatgggtggaaacaagtg tcttatatcccagatatcctccaa 154

S 24 Lactobacillus gasseri LA39 gaa A cggacgtaatttaggtttgaaca aagcccatgcaggtaatgtc 224

S 25 Lactobacillus plantarum plaA aaaaattaactgaaaaagaaatggc actttccatgaccgaagttagc 150

S 26 Lactobacillus amylovorus amy L cggtggaaatagatggactaatg tagcctttacgaacataacccg 159

S 27 Lactobacillus sakei Skg A1 aagaatacacgtagcttaacgatcc accgccattagctagatgattt 150

S 28 Lactobacillus sakei SkgA2 aaaaacgcaaaaagcctaacaa aactccatgaccgccattag 159

S 29 Lactobacillus sakei SppA aacagcaattacaggtggaaaa tatttattccagccagcgtttc 150

S 32 Lactobacillus sakei sakT- α tcggtggctatactgctaaaca tgtcctaaaaatccaccaatgc 160

S 33 Lactobacillus sakei sakT-β aagaaatgatagaaatttttggagg tgtgaaatccaatcttgtcctg 151

S 34 Lactobacillus sakei sakX agctatgaaaggtattgtcggg taagatttccagccagcagc 156

S 35 Lactobacillus salivarius abp118 α agttagcaaaggttgatggtgg aacaagtaagtgctccgcctac 156

S 36 Lactobacillus salivarius Abp118 β aatggtggtaaaaatggttatgg ttaacggcaacttgtaaaacca 150

S 38 Lactobacillus acidophilus acdA gaattagcattaatttctggggg aatgaaatgtcttgccaaaagc 199

S 40 Lactobacillus plantarum C11 pln A agcaacttagtaataaggaaatgcaaa acagtttctttacctgtttaattgcag 102

S 41 Lactobacillus sp laf agtcgttgttggtggaagaaat tcttatcttgccaaaaccacct 184

S 42 Lactobacillus plantarum TMW1.25 pln B tagcattgattgatggaggaaa gcatgccgtgtaagttgttaga 176

109

Figure 7. Primer array real-time PCR of Pediococcus acidilactici Bac3 (pediocin Bac3) isolated from ground turkey in individual PCR reactions with 42 pairs of primers. Primers that resulted in amplification were designed from bacteriocin structural genes from P. pentosaceous (S-13), P. acidilactici (S-16), Lb. plantarum (S-25), and Lb. sakei (S-34). Inset 1, melting curve of amplified products obtained from individual PCR reactions with primer pairs S-13, S-16, and S-34. Inset 2, agarose gel analysis of amplification products with S-13 (lane 3), S-16 (lane 4), S-34 (lane 5). Sequence different from strain Bac3 are highlighted in black.

L.sakei (orig_SakX) 1 AGCTATGAAAGGTATTGTCGGGGGAAAATACTACGGTAATGGATTGTCTTGTAACAAAAGP.acidi Bac3(S-34) 1 AGCTATGAAAGGTATTGTCGGGGGTAAATACTACGGTAAGGCTCTTACTTGTGGCAAACAP.acidi Bac3(S-13) 1 --------------------------------------------TTACTTGTGGCAAACAP.acidi (orig_PapA) 1 --------------------------------------------TTACTTGTGGCAAACA

L.sakei (orig_SakX) 61 TGGTTGTTCAGTTGACTGGAGTAAAGCTATTAGTATTATCGGGAATAATGCTGTAGCAAAP.acidi Bac3(S-34) 61 TTCCTGTTGTTCTGACTGGAGTGGAGCTATGGCATGGGCTATTACGCATGGAGTTGTGCCP.acidi Bac3(S-13) 17 TTCCTGTTGTTCTGACTGGAGTGGAGCTATGGCATGGGCTATTACGCATGGAGTTGTGCCP.acidi (orig_PapA) 17 TTCCTGCTCTGTTGACTGGGGTAAGGCTACCACTTGCATAATCAATAATGGAGCTATGGC

L.sakei (orig_SakX)121 TTTGACTACCGGTGGAGCTGCTGGCTGGAAATCTTAA P.acidi Bac3(S-34) 121 AACGGCCACTGGTGGAGCTGCTGGCTGGAAATCTTAA P.acidi Bac3(S-13) 77 AACGGCCACTGGTGGACATCAAGGTAATCA------- P.acidi (orig_PapA) 77 ATGGGCTACTGGTGGACATCAAGGTAATCA-------

PCR Cycle

0 5 10 15 20 25 30 35 40

RFU

0.0

0.2

0.4

0.6

0.8

1.0

S_13 papA S_16 pedB S_25_plnA S_34 SakX Other primers

DNA(kb)

1000750

500

300

15050

1 2 3 4 5

DNA(kb)

1000750

500

300

15050

1 2 3 4 5

110

Figure 8. Sequence alignment of 3 different bacteriocin sequences obtained from amplification of DNA from Lb. sakei JD against the bacteriocin primer array with sequence of the original bacteriocin gene from which the primers were derived. Panel A, sequence alignment of Lb. sakei JD DNA amplified with S-22 with original sequence for curA (Lb. curvatus). Panel B, sequence alignment of Lb. sakei JD DNA amplified with S-32 with original sequence for sakTα (Lb. sakei). Panel C, sequence alignment of Lb. sakei JD DNA amplified with S-34 with original sequence for sakX (Lb. sakei). Sequence different from strain JD is highlighted in black.

PCR Cycle

0 5 10 15 20 25 30 35 40

RFU

0.0

0.2

0.4

0.6

0.8

1.0

1.2

S_22_cuvA S_32_SakT S_33_SakT S_34_SakX Other primers

DNA(kb)

1000750

500

300150

50

1 2 3 4 5 6

DNA(kb)

1000750

500

300150

50

1 2 3 4 5 6

Lb.sakei JD(S-22) 1 ACAGAATTACAAACAATTACCGGCGGTTGCAGATCATATGGCAATGGTGTTTACTGTAACLb.curvatus(curA) 1 ACAGAATTACAAACAATTACCGGCGGTGCTAGATCATATGGCAACGGTGTTTACTGTAA-

Lb.sakei JD(S-22) 61 TAATAAAAAATGTTGGGTAAATCGGGGTGAAGGTTCGCAAAGTATTATTGGTGGTATGATLb.curvatus(curA) 60 TAATAAAAAATGTTGGGTAAATCGGGGTGAAGCAACGCAAAGTATTATTGGTGGTATGAT

Lb.sakei JD(S-22) 121 TAGCGGCTGGGCTAGTGGTTTAGCTGGAATG Lb.curvatus(curA) 120 TAGCGGCTGGGCTAGTGGTTTAGCTGGAATG _________________________________________________________________________________ Lb.sakei JD(S-32) 1 TCGGTGGCTATACTGCTAAACA--GCTTGCA-GCAATTGGCAGTTGGGGTATTGCTGGTALb.sakei SakT 1 TCGGTGGCTATACTGCTAAACAATGCTTGCAAGCAATTGGCAGTTGGGGTATTGCTGGTA

Lb.sakei JD(S-32) 58 CAGGAGCAGGAGCCAAAGCAGGAGGTCCTGCTGGAGCTTTCGTAGGCGCACACGCATCGGLb.sakei SakT 61 CAGGAGCAGGAGC---AGCAGGAGGTCCTGCTGGAGCTTTCGTAGGCGCACACG--TCGG

Lb.sakei JD(S-32)118 GGTCATTGCTGGGTCAGCGGGTATGCATTGGTGGATTTTTAGGACA Lb.sakei SakT 116 GGTCATTGCTGGGTCAGCGG-TATGCATTGGTGGATTTTTAGGACA _________________________________________________________________________________ Lb.sakeiJD(S-34) 1 AGCTATGAAAGGTATTGTCGGGGGAAA-TACTACAGGTAATGGCATTGTCCTATTGTAACLb.sakei SakX 1 AGCTATGAAAGGTATTGTCGGGGGAAAATACTAC-GGTAATGG-ATTGTC---TTGTAAC

Lb.sakei JD(S-34) 60 AAAAGTGGTTGTTCAGTTGACTGGAGTAAAGCTATTAGTATTATCGGTCGAATAATGCTGLb.sakei SakX 56 AAAAGTGGTTGTTCAGTTGACTGGAGTAAAGCTATTAGTATTATCGG--GAATAATGCTG

Lb.sakei JD(S-34)120 TAGCATATT-GACTACCGGTGGAGCTGCTGGCTGGAAATCTTAA Lb.sakei SakX 114 TAGCAAATTTGACTACCGGTGGAGCTGCTGGCTGGAAATCTTAA

111

L.lactis LtnA 1 CCAGTTACATGGTTGGAAGAAGTATCTGATCAAAATTTTGATGAAGATGTATTTGGTGCGL.lactis RP1(S-2) 1 CCAGTTACATGGTTGGAAGAAGTATCTGAAGTAAATTTAGAAGTAGATGTATTGGAATAA

L.lactis LtnA 61 TGTAGTACTAACACATTCTCGCTCAGTGATTACTGGGGAAATAACGGGGCTTGGTGTACAL.lactis RP1(S-2) 61 TGCTGTACTAACACATTCTCGCGCAGTGATTACTGGAAAAATAACGGGGCAAGGTGTACA

L.lactis LtnA 121 CTCACTCA-TGAATGTATGGCTTGGTGTAAA L.lactis RP1(S-2)121 GTGACTCAATGAATGTATGGCTTGGTGTAAA

L.lactis LtnB 1 CAATTGGGAAAATACCTTGAAGATG-ATATGATTGAATTAGCTG-AAGGGGATGAGTCTCL.lactis RP1(S-4) 1 CAATTGGGAAAATACCTTGAAGATGTATTTGACTGGATTAGCTGTAAAGGTATTAGTCTC

L.lactis LtnB 59 ATGGAGGAACAACACCAGCAACTCCTGCAATCTCTATTCTCAGTGCATATATTAGTACCAL.lactis RP1(S-4) 61 TAGGAGGAATAACACCAGCAATTGTAGCAAATTTGATTCTCAGTGGATATAGCCTTACCA

L.lactis LtnB 119 ATACTTGTCCAACAACAAAATGTACACGTGCTTG L.lactis RP1(S-4)121 GAACTTGTCCAACAACAAAATGTACACGTGCTTG

L.lactis LcnB 1 AGTTAATGGAGGAAGCTTGCAGTATGTTATGAGTGCTGGACCATATACTTGGTATAAAGAL.lactis RP1(S-3) 1 AGTTAATGGAGGAAGCTTGCAGTAC---ATG---GTTGGAAGAAGTATCTGAAGTAAATT

L.lactis LcnB 61 TACTAGAACAGGAAAAACAATA----TGTAAACAGACAAT-TGACACAGCAAGTTAT--AL.lactis RP1(S-3) 55 TAGAAGTAGATGTATTGGAATAATGCTGTACTAACACATTCTCGCGCAGTGATTACTGGA

L.lactis LcnB 114 CATTT----------GGTGTAA--TGGCAGAAGGATGGGGAAAAACATTCCACTAA L.lactis RP1(S-3)115 AAAATAACGGGGCAAGGTGTACAGTGACTCAA-GATGGGGAAAAACATTCCACTAA

A

B

C

L.lactis LtnA 1 CCAGTTACATGGTTGGAAGAAGTATCTGA-TCAAAATTTTGATGAAGATGTATTTGGTGCL.lactis FS97(S-2) 1 CCAGTTACATGGTTGGAAGAAGTATGTGAATCAATATTC-GTTGAAGCCGAATTCGCTGC

L.lactis LtnA 60 GTGTAGTACTAACACATTCTCGCTCAGTGATTACTGGGGAAATAACGGGGCTTGGTGTACL.lactis FS97(S-2) 60 GTGAAGTATTAACACAGTCGCGCTCTCTGTTAACGGGGGATATACGCGGGCATGCTGTAC

L.lactis LtnA 120 ACTCACTCATGAATGTATGGCTTGGTGTAAA L.lactis FS97(S-2)120 ACGGACATTTGAATGTATGGCTTGGTGTAAA

L.lactis LtnB 1 CAATTGGGAAAATACCTTGAAGATGATATGATTGAATTAGCTGAAGGGGA-TGAGTCTCAL.lactis FS97(S-4) 1 CAATTGGGAAAATACCTTGAAGATGATTTGATTGAATTGGCTGAAGTAGAATCGGACACT

L.lactis LtnB 60 TGGAGGAACAACACCAGCAACTCCTGCAATCTCTATTCTCAGTGCATATATTAGTACCAAL.lactis FS97(S-4) 61 TGCAGGATCAACACCTCGAACTCATGCAATCTATACTATCCGTGCACATAGTTGAACCAC

L.lactis LtnB 120 TACTTGTCCAACAACAAAATGTACACGTGCTTG L.lactis FS97(S-4)121 TACTTAGCCTACAACAAAATGTACACGTGCTTG

L.lactis lcnB 1 AGTTAATGGAGGAAGCTTGCAGTATGTTATGAGTGCTGGACCATATACTTGGTATAAAGAL.lactis FS97(S-3) 1 AGTTAATGGAGGAAGCTTGCAGTATGTTATGAGTGCTGGACCATATACTTGGTATAAAGA

L.lactis lcnB 61 TACTAGAACAGGAAAAACAATATGTAAACAGACAATTGACACAGCAAGTTATACATTTGGL.lactis FS97(S-3) 61 TACTAGAACAGGAAAAACAATATGTAAACAGACAATTGACACAGCAAGTTATACATTTGG

L.lactis lcnB 121 TGTAATGGCAGAAGGATGGGGAAAAACATTCCACTAA L.lactis FS97(S-3)121 TGTAATGGCAGAAGGATGGGGAAAAACATTCCACTAA

D

E

F

Figure 9. Bacteriocin PCR array amplification and sequence analysis of two Bac+ strains of Lc. lactis in comparison with the original bacteriocin gene sequence from which the primers were derived. Panels A-C, Lc. lactis RP1 bacteriocin PCR array sequence analysis derived from amplification with S-2 (LtnA), S-4 (LtnB), and S-3 (LcnB) primers. Panels D-F, Lc. lactis FS97 bacteriocin PCR array analysis after amplification with primers for the same bacteriocin genes.

112

Figure 4. Bacteriocin array real-time PCR and sequence identify of lacticin FS92 produced by of Lc. lactis FS92.

Figure 10. Bacteriocin array real-time PCR and sequence identify of lacticin FS92 produced by of Lc. lactis FS92.

L.lactisLacA 1 AGTGCTATTCAAAATTCTGGCGCGATATTTCCTCTCAATATGTCTCAAAAAGGAATTAGAFS92 (S-5) 1 AGTGCTATTCAAAATTCTGGCGCGATATTTCCTCTCAATATGTCTCAAACT---ATTAGA

L.lactisLacA 61 AAAACTCAAAGTAGCTCTTCTATGCAAACCTATGTAGGAACCTATACTGGTAGTGGTGGAFS92 (S-5) 58 AAAACTCAAAGTAGCTCTTCTATGCAAACCTATGTAGGAAGCGGTTTAAAGAGTGGTGGA

L.lactisLacA 121 ATTCCAACACCTTGGGGTAACGCGAATCTTATTTCACAAACACGAAGTTTGAGAACTATAFS92 (S-5) 118 ATTCCAACACCTTGGGGTAACGCGAATAATATTTCACAAACACGAAGTTTGAGAACTATA

L.lactisLacA 181 ATACATGGTAACGGTTCTTATTCCGGAGGTTGGATTA FS92 (S-5) 178 ATATCTGGTAACGGTTCTTATTCCGGAGGTTGGATTA

PCR Cycle0 5 10 15 20 25 30 35 40

RFU

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8S-5 (LacA) Other primers

VITA

SUNITA J. MACWANA

Candidate for the Degree of

Doctor of Philosophy

Dissertation: BACTERIOCINS: UNIQUE APPROACHES FOR THE CHARACTERIZATION OF PEPTIDE ANTIMICROBIALS IN LACTIC ACID BACTERIA.

Major Field: Food Science/Food Microbiology

Biographical:

Personal Data: Born in Bangalore, India, February 18, 1974, the daughter of John and Victoria Macwana. Education: Graduated from Baldwin Girls High School, Bangalore, India in May of 1989. Received my Bachelor of Science Degree in Microbiology from Saint Josephs College of Arts and Science, Bangalore, India in May of 1994. Received my Masters of Science in Medical Microbiology from Kasturba Medical College, Manipal, India in 1998. Completed the requirements for the Doctorate of Philosophy in Food Science/Food Microbiology at Oklahoma State University in May of 2007. Experience: Employed by Oklahoma State University: Oklahoma Food and Agricultural Products Research and Technology Center as a graduate research assistant under Dr. Peter Muriana. Organizations: Institute of Food Technologist and Gamma Sigma Delta Honors Society.

Name: Sunita Macwana Date of Degree: May, 2007

Institution: Oklahoma State University Location: Stillwater, Oklahoma

Title of Study: BACTERIOCINS: UNIQUE APPROACHES FOR THE CHARACTERIZATION OF PEPTIDE ANTIMICROBIALS IN LACTIC ACID BACTERIA.

Pages in Study: 125 Candidate for the Doctor of Philosophy

Major Field: Food Science

Study and Conclusions: Curvaticin FS47 is a listeria-active peptide produced by L. curvatus that was isolated from retail meats. The nucleotide sequence spanning the 9.6kb operon of curvaticin FS47 was determined from the original clones, shortened subclones and the vectorette PCR method. Sequence analysis of the 9.6-kb curvaticin operon revealed the presence of several genes related to bacteriocin biosynthesis. Two types of bacteriocins were identified, i) a two component bacteriocin (T alpha and beta subunits) and ii) a single component bacteriocin (curvaticin FS47). There is high homology between the bacteriocin gene clusters of L. curvatus FS47 and L. sakei.

A major concern in using bacteriocins as food preservatives is the occurrence of natural or spontaneous resistance. Here, L. monocytogenes 39-2 and BacR variants derived from it, were used as indicator strains to screen for bacteriocin-producing LAB from food samples and these bacteriocins were then categorized into different ‘resistance classes’ based on their ability to inhibit these spontaneously-acquired bacteriocin resistant mutants. The use of a mixture of bacteriocins from different ‘resistance classes’ would have greater likelihood to overcome spontaneous resistance.

Bacteriocin producing LAB belonging to different resistance classes were subjected to a bacteriocin-specific PCR array with primers for forty-two known structural genes of bacteriocins from LAB. Amplimers obtained were sequenced and the sequence analysis determined if the bacteriocin was novel or already existed in the GenBank database. This approach allowed for the quick and facile discovery of functionally new bacteriocins among LAB.

A combination of bacteriocins belonging to the 3 different ‘resistance classes’ were used to perform an inhibitory assay against L. monocytogenes 39-2. The results show a significant difference in treatment that was sufficient to prevent regrowth of Listeria for an extended period of time.

ADVISOR’S APPROVAL: Dr. Peter Muriana

BACTERIOCINS: UNIQUE APPROACHES FOR THE...

Documents

Transcript of BACTERIOCINS: UNIQUE APPROACHES FOR THE...