Metabolism

B-cell Receptor Signaling Regulates Metabolismin Chronic Lymphocytic LeukemiaHima V. Vangapandu1,2, Ondrej Havranek2,3, Mary L. Ayres1,Benny Abraham Kaipparettu4, Kumudha Balakrishnan1,2,William G.Wierda5,Michael J. Keating5, R. Eric Davis2,3, Christine M. Stellrecht1,2, and Varsha Gandhi1,2,5

Abstract

Peripheral blood chronic lymphocytic leukemia (CLL) cells arequiescent but have active transcription and translation processes,suggesting that these lymphocytes are metabolically active. Basedon this premise, the metabolic phenotype of CLL lymphocyteswas investigated by evaluating the two intracellular ATP-generating pathways. Metabolic flux was assessed by measuringglycolysis as extracellular acidification rate (ECAR) andmitochon-drial oxidative phosphorylation as oxygen consumption rate(OCR) and then correlated with prognostic factors. Further, theimpact of B-cell receptor signaling (BCR) on metabolism wasdetermined by genetic ablation and pharmacological inhibitors.Compared with proliferative B-cell lines, metabolic fluxes ofoxygen and lactate were low in CLL cells. ECAR was consistentlylow, but OCR varied considerably in human patient samples(n ¼ 45). Higher OCR was associated with poor prognosticfactors such as ZAP 70 positivity, unmutated IGHV, high b2M

levels, andhigher Rai stage.Consistentwith the associationof ZAP70 and IGHV unmutated status with active BCR signaling, geneticablation of BCR mitigated OCR in malignant B cells. Similarly,knocking out PI3Kd, a critical component of the BCR pathway,decreased OCR and ECAR. In concert, PI3K pathway inhibitorsdramatically reduced OCR and ECAR. In harmony with adecline in metabolic activity, the ribonucleotide pools inCLL cells were reduced with duvelisib treatment. Collectively,these data demonstrate that CLL metabolism, especially OCR,is linked to prognostic factors and is curbed by BCR and PI3Kpathway inhibition.

Implications: This study identifies a relationship betweenoxidative phosphorylation in CLL and prognostic factorsproviding a rationale to therapeutically target these processes.Mol Cancer Res; 15(12); 1692–703. �2017 AACR.

IntroductionUnlike solid tumors, which are highly proliferative, chronic

lymphocytic leukemia (CLL) is an indolent malignancy charac-terized by the relentless accumulation of quiescent, immunolog-ically dysfunctional mature B cells that fail to undergo apoptosis.These cells reside indifferent compartments such as bonemarrow,spleen, lymph nodes, and peripheral blood, which providediverse microenvironments. Although the population is eitherslowly proliferating or quiescent (1), these cells are transcription-ally and translationally active, suggesting that CLL cells are notinert and should have an active metabolic profile (2). Further-more, this metabolome pr�ecis should correspond to the aggres-

siveness of the disease, which is categorized based on prognosticfactors such as ZAP 70 positivity (3, 4), unmutated nature ofimmunoglobulin variable region heavy chain (IGHV) status (5),higher Rai stage (6), and increased abundance of b2 microglobu-lin (b2M; ref. 7).

Changes in themetabolome, which has been intensively inves-tigated in solid tumors and is initiated and activated by growthfactors through growth-factor-receptor nexus, which invariablyincludes the PI3Ka isoform–specific signal transduction pathway.Themaintenance andproduction of healthy andmalignant B cellsoccur through the B-cell receptor (BCR) axis. A primary node inthe BCR pathway is the PI3K/AKT cassette, which affects down-stream activation of survival factors in CLL cells. Among the fourisoforms of PI3K,malignantCLL andother B cells rely onPI3Kd/g ,the primary effector of the BCR network. Our recent study sug-gested that in B-cell malignancies, PI3Kd mimicked a signalingpathway that was previously identified in solid tumors withPI3Ka (8). Several investigations have established that thePI3Ka-mediated signaling cascade influences the cellular meta-bolome, including glycolysis and energy production (9). Newerstudies further demonstrated a role for AKT in this pathway andAKT-dependent and AKT-independent activation of the cellularmetabolome (10, 11). However, the role of PI3Kd/g in regulatingthe metabolome is not yet elucidated.

Based on these reports, we hypothesized that malignant CLLlymphocytes should have an active metabolism and may showdifferential metabolome pr�ecis that are in line with the aggres-siveness of the disease based on prognostic markers. BCR and

1Department of Experimental Therapeutics, The University of Texas MD Ander-son Cancer Center, Houston, Texas. 2MD Anderson Cancer Center UT HealthGraduate School of Biomedical Sciences, Houston, Texas. 3Department ofLymphoma/Myeloma, The University of Texas MD Anderson Cancer Center,Houston, Texas. 4Department of Molecular and Human Genetics, Baylor Collegeof Medicine, Houston, Texas. 5Department of Leukemia, The University of TexasMD Anderson Cancer Center, Houston, Texas.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Corresponding Author: Varsha Gandhi, The University of Texas MD AndersonCancer Center, Unit 1950, P.O. Box 301429, Houston, TX 77230-1429. Phone: 713-792-2989; Fax: 713-745-1710; E-mail: vgandhi@mdanderson.org

doi: 10.1158/1541-7786.MCR-17-0026

�2017 American Association for Cancer Research.

MolecularCancerResearch

Mol Cancer Res; 15(12) December 20171692

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

PI3K induced changes in the metabolome should enhance thenucleotide biosynthesis needed for increased gene transcriptionand protein translation. In accordance with these expectations,genetic or pharmacological intervention in this pathway shouldimpact metabolic changes.

To test these hypotheses, we compared the metabolic pheno-gram in freshly isolated peripheral blood CLL cells from 45patients. Bioenergetic profiles of CLL samples suggested diverserange in oxidative phosphorylation (OxPhos) rates which wereassociatedwith prognostic characterization of the disease. Genetictargeting of the BCR pathway or knocking out PI3K resulted inmitigation of both OxPhos and glycolysis. Corollary to thisobservation, pharmacological inhibition induced similar resultsand correspondingly demonstrated a decrease in bioenergy.

Materials and MethodsCLL patient sample collection

Peripheral blood samples were collected from 77 CLL patients(Supplementary Table S1). All patients had given writteninformed consent in accordance with the Declaration of Helsinkiand under a protocol approved by the Institutional Review Board(IRB) of The University of Texas MD Anderson Cancer Center.

Normal peripheral blood mononuclear cells, normal andmalignant B-cell collection, and isolation

Peripheral blood (100 mL) was obtained in green top tubesfromhealthy humandonors under aMDAndersonCancer CenterIRB–approved protocol. Peripheral blood mononuclear cells(PBMC) were isolated using Ficoll–Hypaque procedure. NormalB cells were purified by negative selection using the Easy SepHuman B Cell Enrichment Kit (Stemcell Technologies). Foroptimal comparison, the same numbers of normal PBMCs (gen-erally containing T-lymphocytes), normal B lymphocytes, ormalignant CLL B cells were used for all assays.

For CLL cells, cells were isolated from peripheral blood, andPBMCs were separated by Ficoll–Hypaque density centrifugation(Atlanta Biologicals). All experiments were performed usingfreshly isolated CLL cells, and purity of this cell population was�95%. Cells were cultured in RPMI-1640 medium with L-gluta-mine þ 10% human serum. For CLL and other primary cells tostabilize in the in vitro conditions, cells were kept for 24 hours inculture. These primary cells are replicationally quiescent andremain quiescent during the 24 hours of culture.

DrugsDuvelisib (IPI-145) was obtained from Infinity Pharmaceuti-

cals and used at 1mmol/L. Idelalisib (GS1101)was obtained fromGilead Sciences and MK-2206 from Selleck Chemicals; 1 mmol/Lidelalisib and 2.5 mmol/LMK-2206 were used in the experiments.These concentrations were selected based on reported plasmaconcentrations of these drugs during clinical trials. All com-pounds were dissolved in DMSO.

B-cell line culturesWherever needed, the mantle cell lymphoma (MCL) cell lines

(JeKo-1, Sp53, and Mino) were used either as control or asproliferative cell types. These three MCL lines were obtained fromDr. Hesham Amin, MD Anderson Cancer Center and representBCR-reliant B-cell lines (12). JeKo-1 and Sp53 were grown inRPMI 1640 with 10% FBS, and Mino was grown in RPMI 1640

with 20% FBS and were used within six passages. These cell lineswere authenticated by the MD Anderson core facility using shorttandem repeat DNA profiling and were routinely tested forMycoplasma infection by the same core facility using the LonzaMycoAlert Kit.

Cytotoxicity assaysTo determine apoptotic and necrotic cells, CLL lymphocytes

were stained with annexin/propidium iodide and counted usingflow cytometry as described previously (13).

Extracellular flux assaysExtracellular flux assays (Seahorse Bioscience) were used to

measure the oxygen consumption rate (OCR) and extracellularacidification rate (ECAR) of CLL cells. In most cases, CLL cells(5 � 105) were plated in RPMI-1640 þ 10% human serum in6-well plates, with or without duvelisib for 24 hours. For eachassay, after treatment, cells were counted, and equal numbers ofviable cells were used and plated onto XFmicroplates coated withCell-Tak (BD Biosciences) and allowed to adhere for 4 to 6 hours.RPMI-1640 medium was replaced with XF base (OCR) or glycol-ysis base (ECAR)media as recommended by Seahorse Bioscience.Five technical replicates for each conditionwere plated. Glycolysisand cell mitochondrial stress tests were performed as describedpreviously (Supplementary Fig. S1; ref. 14). Generally for OCR,data were expressed as basal OCR, which is the starting level ofOCR (Supplementary Fig. S1). Oligomycin, an ATP coupler, isadded, followed by FCCP, which acts as ETC accelerator. Increasein OCR above basal respiration after FCCP addition is sparerespiratory capacity while total is maximal respiratory capacity.Addition of rotenone and antimycin A shuts downmitochondrialrespiration (Supplementary Fig. S1A). ECAR is measured underbasal condition, which increases after addition of glucose thatprovides glycolytic flux. Addition of oligomycin measures theglycolytic capacity (Supplementary Fig. S1B).

Mitochondrial reactive oxygen species, membrane potential,and mass

CLL cells were stained with MitoSOX Red, tetramethylrhoda-mine ethyl ester perchlorate (TMRE), and MitoTracker Deep RedFM (Life Technologies), and analyzed using FACS for mitochon-drial reactive oxygen species (ROS), membrane potential andmass, respectively. Geometric means of cytometric data wereobtained using FlowJo software (FlowJo).

PCR for mtDNA copy numberQiaAMP DNA mini kit (Qiagen) was used to extract DNA

from CLL samples according to the manufacturer's protocol.qPCR SYBR green master mix was used to amplify the mito-chondrial DNA from 4 CLL patient samples. All samples wererun in triplicate. These experiments were conducted in collab-oration with Dr. Benny Kaipparettu's laboratory, Baylor Collegeof Medicine, Houston.

Electron transport chain activity analysisFrozen cell pellets were lysed and then used for electron

transport chain (ETC) enzyme assays according to publishedprocedures (15, 16). Briefly, the enzymes were assayed at 30�Cusing a temperature-controlled spectrophotometer; Ultraspec6300 pro, Biochrom Ltd. Each assay was performed in triplicate.The activities of the five enzymes were measured using

The BCR Pathway Impacts CLL Metabolic Flux

www.aacrjournals.org Mol Cancer Res; 15(12) December 2017 1693

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

appropriate electron acceptors/donors. These experiments wereconducted in collaboration with Dr. Benny Kaipparettu's labora-tory, Baylor College of Medicine, Houston.

Ribonucleotide poolsPerchloric acid was used to extract nucleotide pools, and pools

were separatedusingHPLCasdescribedpreviously (14). StandardNTPs were used to quantitate nucleotide pools, and the concen-tration was determined based on mean cell volume.

ImmunoblottingCells were washed and protein extracts were probed using an

Odyssey Infrared Imaging System (LI-COR Biosciences) asdescribed previously (14). p-AKT Thr308, AKT, p-MAPK(44/42), MAPK, GAPDH (Cell Signaling Technology) andOxPhos cocktail (Abcam) primary antibodies were used.

Glucose/glutamine uptake assaysCLL cells were suspended in glucose free or glutamine-free

media and either [3H] 2-deoxy-D-glucose (0.5 mL, specific activity28 Ci/mmol) or [3H]L-glutamine (1 mL, specific activity 50.3Ci/mmol) was added (both reagents from PerkinElmer). Theradioactivity was quantified using the scintillation counter.

BCR knockoutCRISPR-Cas9 px330 plasmids with BCR target DNA sequence

constructs were donated by Dr. Davis. JeKo-1 was used forgenetic knock out experiments. This cell line expresses thecharacteristic MCL proteins including cyclin D1, cyclin E, ret-inoblastoma (Rb), c-Myc, p21Waf-1, p27Kip-1, Mcl-1, Bcl-2, Bax,and Bcl-xL. JeKo-1 overexpresses cyclin D3 and p16INK4a; how-ever, it lacks p53 (12). JeKo-1 cells were transfected (10 mg ofplasmid DNA/million cells) by electroporation (Neon trans-fection system) according to the manufacturer's protocol. Sev-enty-two hours after transfection, the cells were stained andanalyzed by flow cytometry for BCR heavy chain (IgM) andlight chain (k) expression. The knockout (KO) cells werestained and sorted by FACS on day 6 (Supplementary Fig.S2). Three KO clones were generated, where the Cas9 constructharbored DNA sequences complimentary to different regions ofCH2 domain of the IGHM gene, which encodes a vital com-ponent of the BCR (TS4: CCCCCGCAAGTCCAAGCTCATC;TS5: CAGGTGTCCTGGCTGCGCGAGGG; TS6: ACCTGCCGC-GTGGATCACAGGGG.

Fluorescence-activated cell sortingFor BCR KO experiments, IgM–FITC conjugate and light chain

(k)–PE conjugate antibodies were obtained from Life Technolo-gies. The cells were counted by Trypan Blue staining and 2 � 107

cells were stained at 1 mL of sterile antibodies (IgM–FITC and lightchain-PE)/million cells in 1 mL of media and sorted by MDAnderson Cancer Center's FACS facility. The KO cells were col-lected in RPMI 1640 containing 20% FBS and 1% penicillin andstreptomycin solution. These cells were then centrifuged at 1,500rpm for 5 minutes and resuspended in RPMI 1640 þ 10% FBS þ1% penicillin–streptomycin solution. Similarly, for PIK3CD KOexperiments, the KO cells were sorted based on GFP expression.

PIK3CD knock-in–knockoutThe CRISPR-Cas9–mediated "knock-in/knockout" approach

(17) was used to create PIK3CD knockout cells in a B-cell lym-

phoma cell line, JeKo-1. The knock-in–knockout approachenabled us to viably mark the PIK3CD KO cells by expressingthe GFP instead of PI3Kd from its DNA locus and consequentlyuse the cells for further studies. A cDNA encoding GFP, endingwith a stop codon and polyA signal sequence, was inserted at thetranslation start site of the PIK3CD gene. Cells were cotransfectedwith the pX330plasmid expressingCas9 and aPIK3CD guideRNAsequence, along with a plasmid containing flanking homologyarms and the knock-in sequence.

The general approach was to knock in (KI) the GFP-STOP-polyA cassette right after translation initiation site of thePIK3CD leading to PIK3CD promoter driven expression of GFPinstead of PIK3CD. The px330 plasmid (Addgene plasmid#42230) coding for Cas9 and gRNA targeting PIK3CD (targetsite sequence: 50-CATCTGGGAAGTAACAACGCAGG-30) wascloned according to the published protocol (17). The pSC-B-amp/kan plasmid (Agilent Technologies) was used to carry theKI template sequence that consisted of (from 50 to 30): lefthomology arm (400 bp of PIK3CD DNA sequence upstream oftranslation initiation site), kozak sequence (GCCACC), GFPwith STOP codon, bGH PolyA signal sequence, and righthomology arm (300 bp of PI3Kd sequence downstream oftranslation initiation site). The PIK3CD KO GFP-positive cellswere stained and sorted by FACS on day 6 (SupplementaryFig. S3). After sorting, the cells were placed in DMEM mediasupplemented with 20% FBS þ1 U penicillin–streptomycinsolution. As a control for KI specificity, px330 plasmids withnonspecific target site were electroporated together with tem-plate plasmid. No GFP-positive cells were detected in thespecificity control.

Statistical analysisStudent t tests (paired or unpaired, one-tailed) and ANOVA

were performed using Prism 6 software (GraphPad Software)with P > 0.05 as level of significance. For Figs. 1 and 2, data werefrom 45 CLL subjects. Because they were from different patients,a range was observed between two variables for each parametersuch as Rai stage, ZAP 70 status, etc. (Figs. 1B–G and 2A–F). Torigorously analyze these data, we compared each patient data(to incorporate broad range) rather than medians or averages.We also verified the statistical analysis using Microsoft Excelsoftware and two sample t test assuming unequal variances orpaired two sample t test for means where required. Althoughabsolute P values were slightly different in Prism versus Excelanalyses, significant or nonsignificant likelihood did not changebetween two analyses.

ResultsCLL B-cell metabolic flux is comparatively lower than that ofproliferating B-cell lines and is associated with patientprognostic factors

Most cancer cells have high metabolic requirements owing toa high proliferation index. Due to the indolent nature of CLLlymphocytes and nonadherent culture conditions, not manystudies have been conducted to decipher the bioenergeticprofile of CLL B cells. We performed a comprehensive study,encompassing the metabolic phenotype of CLL cells, its asso-ciation with prognostic features, and role of the BCR pathway.Glycolysis (measured as ECAR) and oxidative phosphorylation(OxPhos; measured as OCR) profiles were analyzed in normal

Vangapandu et al.

Mol Cancer Res; 15(12) December 2017 Molecular Cancer Research1694

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

PBMCs (n ¼ 10), normal B-lymphocytes (n ¼ 11) and malig-nant CLL B-lymphocytes (N ¼ 45) as well as malignant B celllines (three cell lines). In each case, for appropriate compar-ison, the number of cells was kept constant and for each datapoint, five technical replicate values were obtained. We usednormal PBMC and normal B-lymphocytes to compare themwith malignant B-lymphocytes (i.e., CLL cells) as all of thesecell types are replicationally quiescent. We used cell lines tocompare replicationally quiescent CLL B-lymphocytes withproliferating MCL cell lines. OCR and ECAR were lower inmalignant CLL lymphocytes (n ¼ 45), normal B lymphocytes(n ¼ 11), and PBMC (n¼ 10) compared with that in all three B-lymphoma cell lines. The latter were highly metabolic bothaerobically and anaerobically (Fig. 1A) and had two- to thirty-fold greater values for ECAR and OCR than that in the quiescentnormal or neoplastic lymphocytes.

Among the patients' malignant lymphocyte samples, therewas very little glycolytic disparity, whereas the mitochondrialrespiration varied. This was not due to heterogeneity of the cellpopulation as all samples have �95% CLL cells. The ECARvalues ranged from 1 to 15 mpH/min for 5 � 105 (median5.5; n ¼ 45) CLL cells. In contrast, for the same number of CLLlymphocytes, the median for OCR was 19 pMoles/min (range,5–190, n¼ 45; Fig. 1A). To understand the basis for this diversityin the OCR, we compared basal OCR with prognostic markers ofthe disease. Unpaired Student t test was used for statisticalanalyses and P values are listed on the graph. Rai and Binet arestaging systems used for standard classification and prognosis inCLL (6, 18). Compared with lower Rai stage (n ¼ 34), increasedmitochondrial respiration (OCR) was observed at higher Raistage (n ¼ 20; Fig. 1B). In contrast to low b2M (n ¼ 38), thepresence of high levels of b2M (>3.5 mg/mL; n ¼ 15), anotherpoor prognostic feature (19, 20), also showed increased OCR(Fig. 1C). Both ZAP 70-positive (n ¼ 29) and IGHV unmutatedsamples (n ¼ 27) had higher OCR compared with their counter-parts (Fig. 1D and E). In contrast to these prognostic character-istics, LDH, gender, age, and CD38 expression did not signifi-cantly associate with OCR (Fig. 1F and G; SupplementaryFig. S4A and S4B). Though cytogenetic lesions such as loss ofATM (11q deletion) and p53 (17p deletion) are associated withadverse prognosis, the OCR values were not significantly differ-ent among diverse cytogenetic cohorts (Fig. 1H).

While OCR accounts for mitochondrial metabolism throughthe OxPhos pathway, the ECAR represents glycolysis. UnpairedStudent t test was used for statistical analyses and P values arelisted on the graph. In comparison with OCR, prognostic factors,such as ZAP 70 and IGHV status, increased b2M and higher Raistage did not correlate with ECAR (Fig. 2A–D). Level of LDH alsodid not affect ECAR (Fig. 2E). On the other hand, the ECARreadings indicated a higher rate in male patients (n ¼ 14)comparedwith female cohorts (n¼ 12), which needs to be furtherexplored (Fig. 2F). In conclusion, CLL lymphocyte metabolomepr�ecis suggested diversity in OCR, which was higher in samplesfrom patients with greater Rai stage, increased b2M, unmutatedIGHV, and higher level of ZAP 70.

Genetic deletion of BCR receptor affects mitochondrialrespiration in JeKo-1, an MCL cell line

CLL subgroups defined by b2M overexpression, ZAP 70 pos-itivity, and unmutated IGHV locus have been associated withincreased B-cell receptor signaling (21), denoting that BCR path-

waymanipulationmay affect metabolism.We generated a knock-out (KO) of BCR in amalignant B-cell line, JeKo-1, to determine ifabrogating B-cell signaling impacts OxPhos and ECAR. CRISPR-Cas9 technique was used to generate three clones (MC4, MC5,and MC6) of BCR KO by targeting the CH2 region of the geneencoding the heavy chain of the IgM. All three clones demon-strated significantly reduced OCR levels when compared withWTcells both for basal OCR; 15% decrease (Fig. 3A), and sparerespiratory capacity; �50% decline (Fig. 3B), demonstrating thatBCR signaling plays an important role in regulating B-cell metab-olism. TheBCRKOcell lineswere further validated for their lack ofability to respond to IgM stimulation. BCR WT cells displayed anincrease in p-AKT Thr308 and p-MAPK Thr 202/Tyr 204, whereasin the KO clones, these residues were minimally phosphorylated,compared with WT cells (Fig. 3C) confirming abrogation of theBCR pathway. The decrease in OCR was not due to change ingrowth, as both WT and BCR KO cells had a similar population-doubling time (Fig. 3D). Similar to OCR, ECAR was also reducedin BCR KO clones (not shown).

PI3K p110d knockout in MCL cell line (JeKo-1) affectsglycolysis and OxPhos

A pivotal node in the BCR pathway is PI3Kd. Hence, we furthertested if genetic ablation (KO) of PIK3CD (coding for p110d)would also impact OxPhos in malignant B cells (JeKo-1). JeKo-1PIK3CD KO cells were analyzed for glycolysis and OxPhos, alongwith unmodified cells (WT) from a parallel culture. The PIK3CDKO cells displayed 20% reduction in both glycolytic flux (Fig. 4Aand B) and glycolytic capacity (Fig. 4A and C) as compared withthe WT cells. A more profound decrease in respiration levels, i.e.,25% decline in basal OCR (Fig. 4D) and 40% reduction in sparerespiratory capacity (Fig. 4F) as comparedwith thePI3KdWTcells,was observed. Real-time RT-PCR assays in these cells confirmedfor reduced transcript levels of PI3KCD (not shown). Similarto BCR KO cells, compared with PI3K WT cells, the PIK3CDKO cells did not differ in proliferation ability (Fig. 4G) or cellsize (not shown).

Pharmacological inhibition of the PI3K/AKT pathwaydiminishes CLL mitochondrial OxPhos and intracellular NTPpools

Because PI3Kd knockout isoform demonstrated lowerOxPhos and glycolysis in malignant B cells, we evaluated if asimilar result is obtained in CLL lymphocytes by employingPI3K isoform–specific pharmacological inhibitors. UnpairedStudent t test was used for statistical analyses and P values arelisted on the graph (Fig. 5). The PI3Kd/g inhibitor, duvelisib(IPI-145), is currently in phase III clinical trials for CLL (Duotrial, NCT02004522; NCT02049515; www.clinicaltrials.gov).We tested ability of duvelisib to alter the OxPhos pathway inCLL cells. Duvelisib treatment of CLL cells mitigated bothglycolysis and aerobic respiration (Fig. 5A–D). Both glycolyticflux and capacity were mitigated in 4 of 5 samples tested(Fig. 5A and B). Although there was heterogeneity in reductionof basal OCR (7/9), maximum respiratory capacity was signif-icantly reduced upon duvelisib treatment in all samples tested(Fig. 5C and D). Again, the most profound effect was onmaximum respiratory capacity. Similar to basal OCR andmaximum respiratory capacity, spare respiratory capacity wasalso reduced after treatment with duvelisib (SupplementaryFig. S5). Decline in ECAR and OCR was not due to duvelisib-

The BCR Pathway Impacts CLL Metabolic Flux

www.aacrjournals.org Mol Cancer Res; 15(12) December 2017 1695

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

induced modest cell death (data not shown) as equal numberof untreated and duvelisib-treated CLL cells were plated for theassay. Because glycolysis is hampered by inhibition of AKT,whose role in glucose uptake and utilization is well established,

we hypothesized that duvelisib treatment would inhibit glu-cose uptake. Surprisingly, an assessment of the uptake of [3H]2-deoxy-D-glucose demonstrated that glucose uptake was notsignificantly impacted by duvelisib treatment (Supplementary

800A B C

ED

H

F G

00,1 £3.5 >3.5

b2M (mg/mL)2–4

Rai stage

025

5050

200200

200

150

100

50

0

Cytogenetic status

11q-

13q-

17p-

CK O U+12

125

100

75

50

25

200 200

100

50

25

0Male Female

Gender

150

100

75

50

25

0L M HLDH (mg/mL)

0Neg PosZAP 70 Status

150

100

50

0M UIGHV Status

75

100100

150150

200 200P = 0.038 P = 0.007

P = 0.0023

P = 0.233

P = 0.4

P = 0.15

P = 0.035

200

150

100

OC

R (p

mol

/L/m

in/5

¥ 1

05 ce

lls)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)OC

R (p

mol

/L/m

in)

ECAR (mpH/min/5 × 105 cells)

50

0

0 20 40 60 200

600

Figure 1.

The CLL bioenergetics profile and relationship of CLL OCR with disease prognostic markers. Bioenergetics was measured for 5 � 105 freshly isolated CLLcells after 24 hours of culture. Five technical replicates were used for ECAR and OCR assays. A, Bioenergetic profile of CLL cells from 45 patients (redcircles) compared with PBMCs (n ¼ 10, blue triangles), B cells from healthy donors (n ¼ 11, inverted green triangles), and B-lymphoma cell lines(JeKo-1 (maroon), Mino (purple) and Sp53 (orange), squares). B, OCR correlation with patient Rai stage. Basal OCR of CLL cells was compared withdisease Rai stage: low grade (stages 0, 1, n ¼ 34), high grade (stages 2–4, n ¼ 20). C, OCR correlation with patient b2 microglobulin (b2M) levels.Basal OCR from CLL cells was compared according to b2M cutoff levels determined by CLL International Prognostic Index �3.5 mg/mL (n ¼ 38), >3.5 mg/mL(n ¼ 15). D, OCR correlation with ZAP 70 status. Basal OCR of CLL cells obtained from ZAP 70-negative (neg; n ¼ 20) and positive (pos; n ¼ 29)patients was compared. E, OCR correlation with IGHV mutational status. Basal OCR of CLL cells was compared based on the mutational status of IGHV:mutated (M; n ¼ 19) or unmutated (U; n ¼ 27). F, OCR correlation with patient lactate dehydrogenase (LDH) levels. Basal OCR from CLL cells was comparedfor patients with different LDH levels: low (L; 300–500 mg/mL, n ¼ 8), medium (M; 501–700 mg/mL, n ¼ 26), high (H; >700 mg/mL, n ¼ 17). G, OCR correlationwith patient gender. Basal OCR of CLL cells was compared based on the gender of the patient, male (n ¼ 27) or female (n ¼ 27). Statisticalsignificance was calculated using unpaired Student t test for B–G. H, Basal OCR of CLL cells were compared for patients with various chromosomalabnormalities by extracellular flux analysis: 11q deletion (n¼ 8), 13q deletion (n¼ 9), trisomy 12 (þ12; n¼ 8), 17p deletion (n¼ 5). C.K. (n¼ 7) indicates complexkaryotype with 2 or more of these deletions, O (n ¼ 16) indicates other chromosomal abnormalities and U (n ¼ 21) indicates unknown karyotype.Statistical significance was calculated using ANOVA P ¼ 0.4.

Vangapandu et al.

Mol Cancer Res; 15(12) December 2017 Molecular Cancer Research1696

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

Fig. S6A). Furthermore, glutamine uptake (Supplementary Fig.S6A), as well as mitochondrial ROS, mitochondrial membranepotential, mitochondrial mass (Supplementary Fig. S6B), andmitochondrial DNA copy number (Supplementary Fig. S6C),were not affected. No significant changes in the protein levels orthe enzyme activity of respiratory chain complexes (I–V) wereobserved after duvelisib treatment (Supplementary Fig. S6Dand S6E). However, PI3Kd/g inhibition resulted in 25% to 50%decreases in intracellular ribonucleotide triphosphate poolsmeasured in 7 patient samples (Fig. 5E). Because duvelisibinhibits both PI3Kd and g , we tested if a PI3K d isoforminhibition or downstream AKT is responsible for the decreasein overall energy metabolism. We, therefore, examined theeffects of a PI3Kd inhibitor, idelalisib, and an AKT inhibitor,MK-2206. Each of these two inhibitors were used as singleagent. Idelalisib mitigated glycolysis in all samples (5/5) tested(Fig. 5F and G) and lowered basal OCR in 5 of 6 samples and

maximum respiration in all samples (Fig. 5H and I); similarly,MK2206 alone curbed glycolysis (5/6; Supplementary Fig. S7Aand S7B) and OCR (basal OCR was reduced in 4/6 samples andmaximum respiration capacity in 5/6 samples; SupplementaryFig. S7C and S7D), suggesting that inhibition of the AKTpathway at least in part underlies the mitigation of glycolysisand OxPhos pathways.

DiscussionMost cancer cells have high metabolic requirements owing to a

high proliferation index. Due to the indolent nature of CLLlymphocytes and nonadherent culture conditions, not manystudies have been conducted to decipher the bioenergetic profileof CLL B cells. Transcriptome characterization has found thatgenes involved in metabolic pathways were upregulated in CLLcells comparedwith normal lymphocytes (22).Markedmetabolic

Figure 2.

CLL ECAR correlation with disease prognostic factors. Glycolytic flux of CLL cells (5 � 105) was compared based on different prognostic factors.A, ECAR correlation with ZAP 70 status. Glycolytic flux of CLL cells obtained from ZAP 70-negative (n ¼ 9) and positive (n ¼ 19) patients wascompared. B, ECAR correlation with IGHV status. Glycolytic flux of CLL cells obtained from IGHV mutated (n ¼ 11) and unmutated (n ¼ 18) patientswas compared. C, ECAR correlation with patient Rai stage; glycolytic flux of CLL cells were compared based on Rai stage: low grade (0, 1, n ¼ 25), highgrade (2–4, n ¼ 11). D, ECAR correlation with patient b2M levels. Glycolytic flux from CLL cells was compared according to b2M cutoff levels �3.5 mg/mL(n ¼ 18), >3.5 mg/mL (n ¼ 7). E, ECAR correlation with LDH levels. Glycolytic flux from CLL cells was compared for patients with different LDH levels:low (L; 300–500 mg/mL, n ¼ 5), medium (M; 501–700 mg/mL, n ¼ 11), high (H; >700 mg/mL, n ¼ 9). F, ECAR correlation with patient gender.Glycolytic flux from CLL cells was compared for male (n ¼ 14), female (n ¼ 12) patients. Statistical significance was calculated using unpaired student'st-test for A–D and F; one-way ANOVA used for E.

The BCR Pathway Impacts CLL Metabolic Flux

www.aacrjournals.org Mol Cancer Res; 15(12) December 2017 1697

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

activity in noncycling (quiescent) CLL cells was recently demon-strated (23). Additionally, free oxygen radicals in cells are het-erogeneous among patients with CLL but significantly higher inCLL cells from patients with prior chemotherapy (24). CLLbioenergetic rewiring is also associated with kinase sensitivity;for example, CLL was classified into subsets based on the dasa-tinib-induced differential dependency on mitochondrial respira-tion to cope with cellular stress and meet the ATP demands (25).

Prevalence of oxidative stress resulting in increased ROSproduction in CLL cells (24) and targeting this by naturalcompounds (26) has been reported before. These observationswere further confirmed recently by Jitschin and colleagues (27).They further identified that altered mitochondrial metabolismin CLL contributes to oxidative stress. Focusing on normalversus malignant B-cell biology, they compared ATP levels(n ¼ 5), as well as ECAR and OCR values (n ¼ 4), in healthysubjects and CLL patients. Their data suggested that increasedoxidative phosphorylation, rather than aerobic glycolysis, wascoupled to bioenergy synthesis in CLL cells.

Our current investigation evaluated the metabolic character-istic to comprehensively determine ECAR and OCR profiling offreshly isolated malignant lymphocytes from peripheral blood

of 45 CLL patients. We further focused to identify if prognosticfactors and cytogenetics are associated with this broad range ofOCR values. We extended the work to establish the role of theBCR pathway in CLL mitochondrial metabolism. The bioener-getics phenogram showed a relatively low metabolic profilefor CLL cells compared with proliferating B-lymphoma cells(Fig. 1A). Moreover, the oxidative profile measured as OCR wassignificantly higher. For OCR, our data demonstrate a range of5 to 200 pmol/min/5 � 105 cells. This range is similar to whatwas reported in 4 CLL subjects (27). However, in normal B cells,both OCR and ECAR values were lower in their investiga-tions compared with what was observed in the present study.This could be due to highly stressed B cells as reflected in theabnormally low endogenous ATP pool, which is less than 10%of the malignant CLL cells.

Higher number of CLL samples allowed us to compare OCRand ECAR values based on prognostic factors. Rai and Binet arestaging systems used for standard classification and prognosis inCLL (6, 18). In our study, increased mitochondrial respiration(OCR) was observed at higher Rai stage (Fig. 1B). Higher meta-bolic state was also reported with increased Binet stage using anNMR-based metabolic monitoring assay (23). The presence of

150A B

60

Spare respiratory capacity

40

20

0

Basal OCR

P = 0.0001 P = 0.003

100

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

50

0

BCR KO BCR KO

BCR KO

WT

- - - - ++++lgM

p-AKT

AKT

GAPDH

p-MAPK

MAPKGAPDH

WT+10%FBS

MC4 MC5 MC6 30WTMC4MC5MC6

20

10

00 1 2 3 4 5 6

Days

Cel

l num

ber (

×105 )

WTMC4

MC5MC6 WT

MC4MC5

MC6

C D

Figure 3.

Impact of BCR knockout in MCL cell line on OxPhos and signaling. A and B,Mitochondrial OxPhos in WT and BCR KO JeKo-1 cells. WT and BCR KO clones (MC4,MC5, MC6) were analyzed for A, basal OCR and B, spare respiratory capacity (n ¼ 6 technical replicates, n ¼ 3 biological replicates; total 18 datapoints). One-way ANOVA without pairing, nonparametric, Kruskal–Wallis test was used to compare these data points in WT with that of KO cells. C,Immunoblot analysis of whole-cell extracts of JeKo-1 WT and BCR KO � IgM stimulation. WT and BCR KO clones were serum starved (RPMI 1640media supplemented with 0.5% serum) for 2 hours followed by the addition of 10 mmol/L IgM for 20 minutes. Lysates were analyzed by twoimmunoblot analyses. The p-AKT Thr308 and total AKT were probed using antibodies from two different species. The p-MAPK p(44/42) Thr202/Tyr204and total MAPK were probed using antibodies from two different species followed by GAPDH immunogenicity. D, WT and BCR KO JeKo-1 clones(MC4, MC5, MC6) were plated at a concentration of (2 � 105)/mL in RPMI 1640 media supplemented with 10% FBS and 1% penicillin–streptomycinsolution on day 1, and the cell numbers were measured on days 2, 3, 4, and 5.

Vangapandu et al.

Mol Cancer Res; 15(12) December 2017 Molecular Cancer Research1698

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

high levels of b2M, another poor prognostic feature (19, 20), alsoshowed a trend for increased OCR (Fig. 1C). In contrast, thecytogenetic abnormalities did not affect OCR values (Fig. 1H).While we do not know why cytogenetic lesions did not associatewith increased OCR, we can provide some explanations. Forexample, the gene p53 or ATM may be fully functional in thesecond allele. Also, in vivo in human body, these features areassociated with aggressive/more proliferative tumor. Duringin vitro culture of blood CLL cells, this characteristic is lost, asmore than 98% of the cells are in G0–G1 phase and do notreplicate. Among patients with CLL, there are two major cohorts,

one with an indolent course that does not require treatment andwith patients surviving for more than two decades and anotherwith aggressive disease that requires immediate therapeutic inter-vention. Several prognostic factors and risk stratification havebeen proposed for therapeutic intervention (19). While geneticlesions such as loss of ATM(11qdeletion) andp53 (17pdeletion)are associated with adverse prognosis, these anomalies are notcommon in previously untreated patient populations (28).Recent genome analyses have revealed limited additionalmarkersof poor prognosis that were identified in whole exome andgenome sequencing (22, 28, 29).

200

GlucoseA B COligomycin 2-DG

FCCPOligomycin A&R

Glycolytic flux Glycolytic capacity

Spare respiratory capacityBasal OCREC

AR

(mpH

/min

)

ECA

R (m

pH/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

Cel

l num

ber (

¥106 )

OC

R (p

mol

/L/m

in)

ECA

R (m

pH/m

in)

150

100

50

0

200

150

100

50

0WT PIK3CD KO WT PIK3CD KO

P = 0.005

200

150

100

50

0

200

150

100

50

0WT

Ctrl

4

3

2

1

00 1 2 3 4 5 6

Days

PIK3CD KO

PIK3CD KO

P = 0.0001

P = 0.74

WT PIK3CD KO

P = 0.003

P = 0.006

D

G

E F

ECAR

OCR

2222011801591381179675543312

Time (min)

Time (min)

0 10 20 30 40 50 60 70 80 89 99

0 10 20 30 40 50 60 70 80 89 99

263235207179151122

94663810

–18

Figure 4.

Impact of PIK3CD knockout in MCL cell line on glycolysis and OxPhos. A, Graphical representation of glycolysis stress profile of WT and PIK3CD KO JeKo-1cells. WT (blue curve) and PIK3CD KO (red curve) cells were analyzed for B, glycolytic flux and C, glycolytic capacity. D, Mitochondrial OxPhos inwild-type and PIK3CD KO JeKo-1 cells. Graphical representation of WT (blue curve) and PIK3CD KO (red curve) JeKo cell mitochondrial stressprofile. WT and PIK3CD KO cells were analyzed for E, basal OCR and F, spare respiratory capacity. Student paired two-tailed t test was used in thestatistical analysis for B, C, E, F. G, WT and PIK3CD KO JeKo-1 clones were plated at a concentration of (2 � 105)/mL in RPMI 1640 media supplementedwith 10% FBS and 1% penicillin–streptomycin solution on day 1, and the cell numbers were measured on days 2, 3, 4, and 5.

The BCR Pathway Impacts CLL Metabolic Flux

www.aacrjournals.org Mol Cancer Res; 15(12) December 2017 1699

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

Among the molecular markers that consistently surface inrisk stratification analyses is the mutational status of immu-noglobulin heavy chain (IGHV; ref. 19). Earlier studies estab-lished that unmutated IGHV was associated with more aggres-sive disease (5), high CD38 expression (30) and correlated withZAP 70 expression (3, 31). Patients with unmutated IGHVgenes had far inferior median survival than patients withmutated IGHV genes (32). Gene expression profiling investiga-tions identified a multitude of genes differentially expressed inthese two subsets of CLL (33). Both ZAP 70–positive and IGHVunmutated samples had higher OCR compared with theirnormal counterparts (Fig. 1D and E). IGHV unmutated samplesshowed significantly higher OCR, which may reflect on theaggressiveness of this subtype of CLL. Serum metabolomeanalyses from patients with CLL also suggested differencesbetween these two molecular subgroups (34). ZAP 70 is typ-ically present in normal T cells and is involved with T-cell

signaling (35). However, its presence in malignant B cells aswell as its prognostic importance has been established for CLL(3). ZAP 70 expression in CLL cells is associated with the BCRsignaling pathway (21) and IGHV unmutated status (33).IGHV-unmutated status responded differently to during B-cellactivation with a higher preponderance and increase in nucle-otide metabolism genes. These markers (ZAP 70 positivity andIGHV unmutated status) correlate with progression-free surviv-al (36). Akin to their role in aggressiveness of the disease, CLLcells from these patients had relatively higher OCR. Because westudied these cells in culture and they were obtained fromperipheral blood, this difference was not due to proliferationindex, as all cells were quiescent. In summary, OCR valuesshowed wide variability in CLL subjects, and this heteroge-neous range correlated with prognostic markers such as Raistage, b2M expression level, and status of IGHV mutation andZAP 70.

30Glycolytic fluxA B

E

F G H I

C DGlycolytic capacity Basal OCR Max. respiration capacity150100

300200

100

50

0Ctrl IPI

75

50

25

0

10060

40

20

0Ctrl IPI Ctrl IPI

P = 0.04 P = 0.02 P = 0.03

15

10

ECA

R (m

pH/m

in)

ECA

R (m

pH/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

5

0Ctrl IPI

P = 0.04

20 Glycolytic flux Glycolytic capacity Basal OCR Max. respiration capacity40

IPI-145, 1 mmol/L

CTP

ATP

GTP

UTP30

20

10

7550

30

20

10

0Ctrl GS0

80

0

25

50

75

100

% o

f Con

trol

60

40

20

0Ctrl Ctrl GS

P = 0.02P = 0.01

P < 0.05

P = 0.001

15

10

ECA

R (m

pH/m

in)

ECA

R (m

pH/m

in)

OC

R (p

mol

/L/m

in)

OC

R (p

mol

/L/m

in)

5

0Ctrl GS GS

P = 0.02

Figure 5.

Effect of PI3K inhibitors on cellular metabolism in primary CLL lymphocytes. CLL cells were assayed for cell survival 24 hours after drug treatment andequal numbers of untreated or duvelisib-treated CLL cells were plated for the assay. Five technical replicates were used for ECAR and OCR assays.A, Duvelisib-induced changes in glycolytic flux. CLL cells were treated with 1 mmol/L duvelisib for 24 hours (n ¼ 5 patient samples) and assayed forglycolytic flux along with untreated controls. B, Duvelisib-treated patient samples in A were analyzed for glycolytic capacity (n ¼ 5 patient samples).C and D, Duvelisib induced alterations in mitochondrial respiration. C, Basal OCR and D, maximum respiration capacity were compared in untreatedCLL cells and cells treated for 24 hours with 1 mmol/L duvelisib (n ¼ 9 patient samples). E, Influence of duvelisib on the intracellular nucleotide pools inCLL lymphocytes. NTP pools were extracted from CLL cells either untreated or treated for 24 hours with duvelisib (n ¼ 7 patient samples) andanalyzed using HPLC. F and G, Effect of PI3Kd inhibitor on CLL glycolysis. Cells either untreated or treated for 24 hours with PI3Kd inhibitor 1 mmol/Lidelalisib (n ¼ 5 patient samples) and were compared for changes in F, glycolytic flux and G, glycolytic capacity. H and I, Effect of PI3Kd inhibition onCLL OxPhos. CLL cells either untreated or treated for 24 hours with PI3Kd inhibitor, 1 mmol/L idelalisib, (n ¼ 6 patient samples) were compared for changes inH, basal OCR (and I, maximum respiratory capacity. Ctrl, control untreated; IPI, IPI-145 (duvelisib); GS, GS-1101 (idelalisib).

Vangapandu et al.

Mol Cancer Res; 15(12) December 2017 Molecular Cancer Research1700

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

The presence of ZAP 70 and unmutated IGHV is known toenhance cell signaling through the BCR pathway that is pivotal tothemaintenance of B cells (33). Abrogating the BCR pathway (viaBCR knockout) affected OxPhos, demonstrating that BCRsignaling plays an important role in regulating CLL cell metab-olism (Fig. 3A and B). Two major players in the BCR pathway arePI3K and BTK. Increased active BTK (phosphorylated BTK) hasbeen reported for unmutated IGHV harboring CLL cohort (37).The PI3K axis is constitutively active in CLL cells that are influ-enced by the microenvironment. Inhibiting PI3K signaling byPIK3CDKOmitigated both glycolysis andOxPhos ofmalignant Bcells (Fig. 4A–F). KO of both the BCR and PI3K pathway withoutmuch effect on cell growth (Figs. 3 and 4) in JeKo cellsmay be dueto presence of cMyc in this cell line. Furthermore, additional celllines such as LY19 andMinodid not proliferate after genetic KOofPIK3CD, and such manipulations would be challenging in CLLlymphocytes. While we are extending data fromMCL cell lines toCLL cells, we understand that the biology would be different inthese two B-cell malignancies. We are extrapolating MCL cell linedata to CLL given the similarity between the two for dependenceon the BCR signaling. To further evaluate our results, we usedthree pharmacological inhibitors in CLL cells. Pharmacologicalinhibition of PI3Kd by idelalisib has shown efficacy in the clinicfor patients with B-cell malignancies (38, 39). Duvelisib binds tothe ATP-binding site of the kinases, thereby preventing activationof the PI3Kd/g isoforms (40). This antagonist mitigated glycolysisas well as mitochondrial OxPhos (Fig. 5A–D). PI3Kd signals todownstream AKT, which plays a major role in glycolysis bydirectly regulating glucose uptake (41), which is in line withduvelisib-mediated diminished ECAR in CLL cells. However,glucose uptake in CLL malignant lymphocytes was not signifi-cantly affected by the drug (Supplementary Fig. S5A). It can bespeculated that glucose utilization by CLL cells is being affectedbecause uptake of glucose did not decrease, and yet glycolysis andOxPhos were significantly downregulated.

Decline in the intracellular ATP pool is consistent withmitigation of OxPhos by the drug (42, 43). Decrease in otherNTP pools suggest that overall energy metabolism is affectedby inhibiting the PI3K pathway (Fig. 5E). While we have notevaluated mechanisms for changes in other intracellular NTPlevels, CTP and UTP pools may be affected as pyrimidinenucleotide biosynthesis is linked to mitochondrial electrontransport chain by the enzyme dihydroorotate dehydro-genase (DHODH) that resides in the inner mitochondrialmembrane, the only enzyme in that pathway that is located inthe mitochondria. AKT, downstream effector of PI3K, alsoregulates purine nucleotide biosynthesis. It reduces ubiqui-none to ubiquitol and converts dihydroorotate to orotate(44). Additionally, AKT activity promotes mTOR pathwaysignaling, a known regulator of pyrimidine and purinesynthesis (45).

Not much is known about the PI3K/AKT pathway and its rolein mitochondrial respiratory function in CLL cells; however,hyperactivation of AKT leading to increased mitochondrialrespiration and thereby ATP synthesis by the 4E-BP1–mediatedprotein translation pathway has been reported (46). Inhibitionof this mitochondrial respiration by the above-mentionedtarget-specific drugs further supports the notion that mitochon-drial respiration is regulated by AKT. Collectively, our PI3Kinhibition data in malignant CLL lymphocytes and its role inmetabolomics are in concert with prior reports with healthy

mature B lymphocytes. Survival of B lymphocytes was mitigat-ed by BCR knockout but rescued exclusively by PI3K signaling(47). Suppression of this pathway was pivotal for anergy (48)and anergic or activated B cells required a change in metabolicstatus (49).

The fact that CLL with poor prognostic factors such as IGHVunmutated status, presence of ZAP 70, and higher Rai stage etc.were associated with increased OCR suggests that for thissubgroup, inhibition of oxidative phosphorylation should betested as a strategy. Inhibitors of OxPhos have been designedand tested in preclinical setting (50) and one is already in theclinic (NCT02882321; ClinicalTrials.Gov).

In conclusion, the key features of our current investigationare as follows. First, metabolic phenograms of quiescent CLLcells suggest an active OxPhos pathway, and this was stronglycorrelated with the aggressiveness of the disease and adverseprognostic factors such as ZAP 70 positivity, IGHV mutationstatus, Rai stage, and b2M levels. Finally, OxPhos, glycolysis,and nucleotide biosynthesis were abrogated by PI3K/AKT path-way inhibition.

Disclosure of Potential Conflicts of InterestW. Wierda reports receiving a commercial research grant from Gilead

Sciences. V. Gandhi reports receiving a commercial research grant fromInfinity Pharmaceuticals and Gilead Sciences. No conflicts of interest weredisclosed by the other authors.

Authors' ContributionsConception and design: H.V. Vangapandu, M.J. Keating, V. GandhiDevelopmentofmethodology:H.V. Vangapandu,O.Havranek, K. Balakrishnan,R.E. DavisAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): H.V. Vangapandu, B.A. Kaipparettu, W.G. Wierda,R.E. DavisAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): H.V. Vangapandu, O. Havranek, B.A. Kaipparettu,M.J. Keating, C.M. Stellrecht, V. GandhiWriting, review, and/or revision of the manuscript: H.V. Vangapandu,O. Havranek, B.A. Kaipparettu, K. Balakrishnan, R.E. Davis, C.M. Stellrecht,V. GandhiAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): H.V. Vangapandu, B.A. Kaipparettu,M.J. KeatingStudy supervision: B.A. Kaipparettu, C.M. Stellrecht, V. GandhiOther (analyzed samples to quantitate nucleotide pools using HPLC):M.L. AyresOther (obtained funding): V. Gandhi

AcknowledgmentsThe authors thank Mr. Michael Worley for critically editing the manuscript

and Mark Nelson for coordinating the CLL sample distribution.

Grant SupportThis work was supported in part by grant CLL PO1 CA81534 and by a

Cancer Center Support Grant, P50 CA16672, from the NCI, Department ofHealth and Human Services; a CLL Global Research Foundation Alliancegrant; and Sponsored Research Agreements from Infinity Pharmaceuticalsand Gilead Sciences.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received January 24, 2017; revised June 16, 2017; accepted August 15, 2017;published OnlineFirst August 23, 2017.

The BCR Pathway Impacts CLL Metabolic Flux

www.aacrjournals.org Mol Cancer Res; 15(12) December 2017 1701

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

References1. Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. N Engl J

Med 2005;352:804–15.2. Balakrishnan K, Burger JA, Fu M, Doifode T, Wierda WG, Gandhi V.

Regulation of Mcl-1 expression in context to bone marrow stromalmicroenvironment in chronic lymphocytic leukemia. Neoplasia 2014;16:1036–46.

3. Rassenti LZ, Huynh L, Toy TL, Chen L, Keating MJ, Gribben JG, et al.ZAP-70 compared with immunoglobulin heavy-chain gene mutationstatus as a predictor of disease progression in chronic lymphocyticleukemia. N Engl J Med 2004;351:893–901.

4. Orchard JA, Ibbotson RE, Davis Z, Wiestner A, Rosenwald A, Thomas PW,et al. ZAP-70 expression and prognosis in chronic lymphocytic leukaemia.Lancet 2004;363:105–11.

5. Hamblin TJ,Davis Z, Gardiner A,OscierDG, Stevenson FK.Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lympho-cytic leukemia. Blood 1999;94:1848–54.

6. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS.Clinical staging of chronic lymphocytic leukemia. Blood 1975;46:219–34.

7. Wierda WG, O'Brien S, Wang X, Faderl S, Ferrajoli A, Do KA, et al.Prognostic nomogram and index for overall survival in previouslyuntreated patients with chronic lymphocytic leukemia. Blood 2007;109:4679–85.

8. Yang Q, Chen LS, Ha MJ, Do KA, Neelapu SS, Gandhi V. Idelalisib impactscell growth through inhibiting translation regulatory mechanisms inmantle cell lymphoma. Clin Cancer Res 2017;23:181–92.

9. Engelman JA, Luo J, Cantley LC. The evolution of phosphatidylinositol 3-kinases as regulators of growth and metabolism. Nat Rev Genet 2006;7:606–19.

10. Arvisais EW, Romanelli A, Hou X, Davis JS. AKT-independent phos-phorylation of TSC2 and activation of mTOR and ribosomal protein S6kinase signaling by prostaglandin F2alpha. J Biol Chem 2006;281:26904–13.

11. Hahn-Windgassen A, Nogueira V, Chen CC, Skeen JE, Sonenberg N, HayN. Akt activates the mammalian target of rapamycin by regulatingcellular ATP level and AMPK activity. J Biol Chem 2005;280:32081–9.

12. Amin HM, McDonnell TJ, Medeiros LJ, Rassidakis GZ, Leventaki V,O'Connor SL, et al. Characterization of 4 mantle cell lymphoma celllines. Arch Pathol Lab Med 2003;127:424–31.

13. BalakrishnanK, PelusoM, FuM, RosinNY, Burger JA,WierdaWG, et al. Thephosphoinositide-3-kinase (PI3K)-delta and gamma inhibitor, IPI-145(Duvelisib), overcomes signals from the PI3K/AKT/S6 pathway and pro-motes apoptosis in CLL. Leukemia 2015;29:1811–22.

14. Stellrecht CM, Vangapandu HV, Le XF, Mao W, Shentu S. ATP directedagent, 8-chloro-adenosine, induces AMP activated protein kinase activity,leading to autophagic cell death in breast cancer cells. J Hematol Oncol2014;7:23.

15. Vu TH, Sciacco M, Tanji K, Nichter C, Bonilla E, Chatkupt S, et al. Clinicalmanifestations of mitochondrial DNA depletion. Neurology 1998;50:1783–90.

16. Enns GM, Hoppel CL, DeArmond SJ, Schelley S, Bass N, Weisiger K,et al. Relationship of primary mitochondrial respiratory chain dysfunc-tion to fiber type abnormalities in skeletal muscle. Clin Genet 2005;68:337–48.

17. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9 system. Nat Protoc 2013;8:2281–308.

18. Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, et al. Anew prognostic classification of chronic lymphocytic leukemia derivedfrom a multivariate survival analysis. Cancer 1981;48:198–206.

19. Pflug N, Bahlo J, Shanafelt TD, Eichhorst BF, Bergmann MA, Elter T, et al.Development of a comprehensive prognostic index for patients withchronic lymphocytic leukemia. Blood 2014;124:49–62.

20. Hallek M, Wanders L, Ostwald M, Busch R, Senekowitsch R, Stern S, et al.Serum beta(2)-microglobulin and serum thymidine kinase are indepen-dent predictors of progression-free survival in chronic lymphocytic leuke-mia and immunocytoma. Leuk Lymphoma 1996;22:439–47.

21. Chen L, Widhopf G, Huynh L, Rassenti L, Rai KR, Weiss A, et al. Expressionof ZAP-70 is associated with increased B-cell receptor signaling in chroniclymphocytic leukemia. Blood 2002;100:4609–14.

22. Ferreira PG, Jares P, Rico D, Gomez-Lopez G, Martinez-Trillos A, VillamorN, et al. Transcriptome characterization by RNA sequencing identifies amajor molecular and clinical subdivision in chronic lymphocytic leuke-mia. Genome Res 2014;24:212–26.

23. Koczula KM, Ludwig C, Hayden R, Cronin L, Pratt G, Parry H, et al.Metabolic plasticity in CLL: adaptation to the hypoxic niche. Leukemia2016;30:65–73.

24. Zhou Y, Hileman EO, Plunkett W, Keating MJ, Huang P. Free radical stressin chronic lymphocytic leukemia cells and its role in cellular sensitivity toROS-generating anticancer agents. Blood 2003;101:4098–104.

25. Martinez Marignac VL, Smith S, Toban N, Bazile M, Aloyz R. Resistanceto Dasatinib in primary chronic lymphocytic leukemia lymphocytesinvolves AMPK-mediated energetic re-programming. Oncotarget 2013;4:2550–66.

26. Trachootham D, Zhou Y, Zhang H, Demizu Y, Chen Z, Pelicano H, et al.Selective killing of oncogenically transformed cells through a ROS-mediated mechanism by beta-phenylethyl isothiocyanate. Cancer Cell2006;10:241–52.

27. Jitschin R, Hofmann AD, Bruns H, Giessl A, Bricks J, Berger J, et al.Mitochondrial metabolism contributes to oxidative stress and revealstherapeutic targets in chronic lymphocytic leukemia. Blood 2014;123:2663–72.

28. Dohner H, Stilgenbauer S, Benner A, Leupolt E, Krober A, Bullinger L, et al.Genomic aberrations and survival in chronic lymphocytic leukemia.N Engl J Med 2000;343:1910–6.

29. Landau DA, Carter SL, Stojanov P, McKenna A, Stevenson K, Lawrence MS,et al. Evolution and impact of subclonal mutations in chronic lymphocyticleukemia. Cell 2013;152:714–26.

30. Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL, et al. Ig V genemutation status and CD38 expression as novel prognostic indicators inchronic lymphocytic leukemia. Blood 1999;94:1840–7.

31. Wiestner A, Rosenwald A, Barry TS, Wright G, Davis RE, Henrickson SE,et al. ZAP-70 expression identifies a chronic lymphocytic leukemiasubtype with unmutated immunoglobulin genes, inferior clinicaloutcome, and distinct gene expression profile. Blood 2003;101:4944–51.

32. Oscier DG, Gardiner AC, Mould SJ, Glide S, Davis ZA, Ibbotson RE, et al.Multivariate analysis of prognostic factors in CLL: clinical stage, IGVH genemutational status, and loss or mutation of the p53 gene are independentprognostic factors. Blood 2002;100:1177–84.

33. Rosenwald A, Alizadeh AA, Widhopf G, Simon R, Davis RE, Yu X, et al.Relation of gene expression phenotype to immunoglobulin mutationgenotype in B cell chronic lymphocytic leukemia. J Exp Med 2001;194:1639–47.

34. MacIntyre DA, Jimenez B, Lewintre EJ, Martin CR, Schafer H, BallesterosCG, et al. Serum metabolome analysis by 1H-NMR reveals differencesbetween chronic lymphocytic leukaemia molecular subgroups. Leukemia2010;24:788–97.

35. Chan AC, Iwashima M, Turck CW, Weiss A. ZAP-70: a 70 kd protein-tyrosine kinase that associates with the TCR zeta chain. Cell 1992;71:649–62.

36. Del Principe MI, Del Poeta G, Buccisano F, Maurillo L, Venditti A,Zucchetto A, et al. Clinical significance of ZAP-70 protein expression inB-cell chronic lymphocytic leukemia. Blood 2006;108:853–61.

37. Guo A, Lu P, Galanina N, Nabhan C, Smith SM, Coleman M, et al.Heightened BTK-dependent cell proliferation in unmutated chronic lym-phocytic leukemia confers increased sensitivity to ibrutinib. Oncotarget2016;7:4598–610.

38. Herman SE, Gordon AL, Wagner AJ, Heerema NA, Zhao W, Flynn JM,et al. Phosphatidylinositol 3-kinase-delta inhibitor CAL-101 showspromising preclinical activity in chronic lymphocytic leukemia byantagonizing intrinsic and extrinsic cellular survival signals. Blood2010;116:2078–88.

39. Furman RR, Sharman JP, Coutre SE, Cheson BD, Pagel JM, Hillmen P, et al.Idelalisib and rituximab in relapsed chronic lymphocytic leukemia. N EnglJ Med 2014;370:997–1007.

40. Winkler DG, Faia KL, DiNitto JP, Ali JA, White KF, Brophy EE, et al. PI3K-delta and PI3K-gamma inhibition by IPI-145 abrogates immune responsesand suppresses activity in autoimmune and inflammatory disease models.Chem Biol 2013;20:1364–74.

Vangapandu et al.

Mol Cancer Res; 15(12) December 2017 Molecular Cancer Research1702

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

41. Elstrom RL, Bauer DE, Buzzai M, Karnauskas R, Harris MH, Plas DR,et al. Akt stimulates aerobic glycolysis in cancer cells. Cancer Res2004;64:3892–9.

42. Henderson JF, Fraser JH, McCoy EE. Methods for the study ofpurine metabolism in human cells in vitro. Clin Biochem 1974;7:339–58.

43. Carlucci F, Rosi F, Di Pietro C, Marinello E, Pizzichini M, Tabucchi A.Purine nucleotide metabolism: specific aspects in chronic lympho-cytic leukemia lymphocytes. Biochim Biophys Acta 1997;1360:203–10.

44. Jones ME. Pyrimidine nucleotide biosynthesis in animals: genes,enzymes, and regulation of UMP biosynthesis. Annu Rev Biochem1980;49:253–79.

45. Ben-Sahra I, Hoxhaj G, Ricoult SJ, Asara JM, Manning BD. mTORC1induces purine synthesis through control of the mitochondrial tetrahy-drofolate cycle. Science 2016;351:728–33.

46. Goo CK, Lim HY, Ho QS, Too HP, Clement MV, Wong KP. PTEN/Aktsignaling controls mitochondrial respiratory capacity through 4E-BP1.PLoS One 2012;7:e45806.

47. Srinivasan L, Sasaki Y, Calado DP, Zhang B, Paik JH, DePinho RA, et al.PI3 kinase signals BCR-dependent mature B cell survival. Cell 2009;139:573–86.

48. Browne CD, Del Nagro CJ, Cato MH, Dengler HS, Rickert RC. Suppres-sion of phosphatidylinositol 3,4,5-trisphosphate production is a keydeterminant of B cell anergy. Immunity 2009;31:749–60.

49. Caro-Maldonado A, Wang R, Nichols AG, Kuraoka M, Milasta S, Sun LD,et al. Metabolic reprogramming is required for antibody productionthat is suppressed in anergic but exaggerated in chronically BAFF-exposed B cells. J Immunol 2014;192:3626–36.

50. Protopopova M, Bandi M, Bardenhagen J, Bristow C, Carroll C, Chang E,et al. IACS-10759: a novel OXPHOS inhibitor which selectively kill tumorswith metabolic vulnerabilities. Cancer Res 2015;75:abstract nr 4380.

www.aacrjournals.org Mol Cancer Res; 15(12) December 2017 1703

The BCR Pathway Impacts CLL Metabolic Flux

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026

2017;15:1692-1703. Published OnlineFirst August 23, 2017.Mol Cancer Res   Hima V. Vangapandu, Ondrej Havranek, Mary L. Ayres, et al.   Lymphocytic LeukemiaB-cell Receptor Signaling Regulates Metabolism in Chronic

  Updated version

  10.1158/1541-7786.MCR-17-0026doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://mcr.aacrjournals.org/content/suppl/2017/08/23/1541-7786.MCR-17-0026.DC1

Access the most recent supplemental material at:

   

   

  Cited articles

  http://mcr.aacrjournals.org/content/15/12/1692.full#ref-list-1

This article cites 49 articles, 20 of which you can access for free at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.org

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/15/12/1692To request permission to re-use all or part of this article, use this link

on February 8, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst August 23, 2017; DOI: 10.1158/1541-7786.MCR-17-0026