at Penn State University (Paterno Lib) on September 18 ...

Plant Cell Physiol. 31(6): 805-813 (1990)JSPP © 1990

Construction and Expression in Tobacco of a ^-Glucuronidase (GUS)Reporter Gene Containing an Intron Within the Coding Sequence

Shozo Ohta1, Satoru Mita, Tsukaho Hattoriand Kenzo Nakamura2

Laboratory of Biochemistry, School of Agriculture, Nagoya University,Furo-cho, Chikusa-ku, Nagoya 464-01, Japan

An Intron-GUS reporter gene which contains a modified intron of the castor bean catalasegene within the N-terminal part of the /?-glucuronidase (GUS) coding sequence was constructed.The modified 190 bp intron sequence contains a termination codon in the same reading frame asGUS coding sequence near the 3' splice site so that removal of the intron from the transcript is re-quired for the synthesis of GUS polypeptide. Unlike the original GUS reporter gene, this Intron-GUS reporter gene did not express detectable GUS activity in Agrobacterium tumefaciens cells.However, when the Intron-GUS reporter gene placed downstream of the cauliflower mosaic virus(CaMV) 35S promoter (35S-Intron-GUS) was introduced into protoplasts of tobacco suspension-cultured cells by electroporation, expression of GUS activity was observed suggesting splicing ofthe intron occured in tobacco cells. The 35S-Intron-GUS fusion gene also expressed GUS activ-ity in various organs of transgenic tobacco plants. The level of GUS activity obtained with the35S-Intron-GUS fusion gene was slightly higher than those obtained with the 35S-GUS fusiongene in both transient expression assay and stable expression in transgenic plants. However, thepresence of intron did not alter the pattern of cell-type-dependent expression of the CaMV 35Spromoter in various organs. These results indicate that the Intron-GUS reporter gene is useful tomonitor the Agrobacterium-media.ted transfer and expression of foreign genes in plant cells, andto study the mechanism of intron-splicing in plants.

Key words: GUS — Intron-splicing — Reporter gene — Ti plasmid — Tobacco (Nicotianatabacum).

Availability of transgenic plants enables the analysis polypeptides, mostly of bacterial origin, whoes enzyme ac-of expression of one particular gene in various organs, tivities are absent in plant cells have been used to developtissues or cells at various developmental stages and under reporter gene systems in plants (for review, see Herrera-various environmental conditions. Such studies are fas- Estrella et al. 1988, Scott et al. 1988). They include ocscilitated by the use of a reporter gene system. By mak- coding for octopine synthase (OCS, Herrera-Estrella et al.ing a fusion of a promoter, or the 5'-upstream regulatory 1983b), kan coding for neomycin phosphotransferaseregion, of the gene of interest with the coding sequence of a (NPTII, Simpson et al. 1985), cam coding for chloram-reporter gene, one can easily monitor the expression of the phenicol acetyltransferase (CAT, An 1986), and lacZfusion gene by assaying the activity of the reporter gene pro- coding for /?-galactosidase (LacZ, Matsumoto et al. 1988).duct. Various genes coding for easily assayable enzyme Recently, uidA gene of Escherichia coli coding for fi-

glucuronidase (GUS, Jefferson 1987, Jefferson et al. 1987)Abbreviations: CaMV, cauliflower mosaic virus; GUS, 0- became a favorable choice among many investigators,

glucuronidase; X-Gluc, 5-bromo-4-chloro-3-indolyl glucuronide. This is because both sensitive fluorometric methods for the1 Present address: Plant Breeding and Genetics Research quantitative assay of enzyme activity and the in situLaboratory, Japan Tobacco Inc., 700 Higashibara Toyoda-cho, histochemical localization of activity are available with thisIwata-gun, Shizuoka-ken, 438 Japan. system. Furthermore, the GUS polypeptide can tolerate2 To whom correspondence should be addressed. modifications in its N-terminal structure for the enzyme ac-

805

at Penn State University (Paterno L

ib) on September 18, 2016

http://pcp.oxfordjournals.org/D

ownloaded from

http://pcp.oxfordjournals.org/

806 S. Ohta, S. Mita, T. Hattori and K. Nakamura

tivity, which allows the construction of fusion genes to pro-duce protein fusions.

The Ti-plasmid vector systems of Agrobacteriumtumefaciens have been the most widely used method totransfer fusion genes into plants, especially in dicoty-ledonous plants (for review, see Draper et al. 1988). Inthis method, the modified T-DNA containing the fusiongene located between the left and right border sequences ofT-DNA is excised from the Ti-plasmid in the Agrobacte-rium cell and transferred into the plant genome during co-cultivation of Agrobacterium cells with plant cells or ex-plants. However, the mechanism of T-DNA transfer fromthe Agrobacterium cell into the plant genome is still notwell understood (Zambryski 1987). Antibiotic-resistancemarker gene, such as nos promoter:A:an fusion gene confer-ring kanamycin-resistance (Herrera-Estrella et al. 1983a,Bevan 1984) which is included in the modified T-DNAallows selection of transformed plant cells. The expres-sion of the fusion gene may be assayed after the establish-ment of the growth of transformed cells, which usuallytakes several weeks. However, since it is difficult to com-pletely eliminate bacteria from plant tissues exposed toAgrobacterium (Gould and Smith 1989, our unpublishedresults) even in the presence of antibiotics such ascarbenicillin and cefotaxime, it is necessary to examine theexpression of the fusion gene in the Agrobacterium cell.For example, Agrobacterium cells with Ti-plasmids con-taining the fusion gene with CAT or GUS reporter gene,either in the absence or presence of plant promoter such asCaMV 35S promoter, express significant level of CAT orGUS activity (Jefferson et al. 1987, Janssen and Gardner1989, Vancanneyt et al. 1990, our unpublished results).

Although the Agrobacterium-medi&ted transforma-tion has been extensively used in some plant species, suchas tobacco, petunia, potato, and Arabidopsis thaliana(Draper et al. 1988), the transformation of many other im-portant plant species by this method has been unsuccessfullor not yet been examined. In order to develop a definedsystem to transform new plant species by using Agrobacte-rium, it is desirable to have an easy method to monitortransfer and expression of the fusion gene in plant cells asearly as possible. Examination of the expression of fusiongenes in plant cells at early stages of transformation, how-ever, is hampered by their expression in the co-existingAgrobacterium cells.

In this paper, we constructed a modified GUS reportergene which contains an intron in the N-terminal part of theGUS coding sequence. This Intron-GUS reporter gene,under the control of the CaMV 35S promoter, expressedGUS activity in tobacco cells, but not in A. tumefacienscells. The level of expression of GUS activity using this In-tron-GUS reporter was similar to or even slightly higherthan those obtained with the original GUS reporter gene,while the presence of intron did not alter the pattern of cell-

type-dependent expression of the CaMV 35S promoter invarious tissues of tobacco plants. The Intron-GUS re-porter gene described in this paper should be useful tomonitor the early stage of transfer of a fusion gene frombacteria into the plant cell, and to examine the mechanismof intron-splicing in the plant cell.

Materials and Methods

Plant materials—Tobacco (Nicotiana tabacum cv.Bright Yellow No. 4) plants used for Agrobacterium-mc-diated transformation were grown axenically on MS-agarmedium with B5 vitamins at 28 °C under 16 h-light and 8 h-dark photoperiods. Tobacco suspension culture cell lineBY-2 (Ikeda et al. 1976) was obtained from Japan TobaccoCo. and grown in modified MS medium (Nagata et al.1981) with rotary shaking at 160 cpm at 28°C under dark.

Construction of an Intron-GUS reporter gene andother plasmid constructions—The first intron of the castorbean catalase gene CAT-1 (Ario, T., Nakamura, K., Ota,Y., Hattori, T. and Asahi, T. unpublished results) wasused to construct an Intron-GUS reporter gene. A DNAfragment earring the first intron of the CAT-1 gene wascloned into Bluescript M13KS(—) vector (Stratagene) andits single-stranded circular DNA was isolated. A 33-mersynthetic oligonucleotide, 5CCACTTGGTCGACGGT-TCTGTAACTATCATCAT3, was used to mutagenize thesequence by gapped duplex method of Kramer and Frits(1987) by using a Mutan-G kit from Takara-Shuzo Co.(Kyoto). This oligonucleotide was designed to introduceone base insertion of A residue to create a terminationcodon TAG in the intron, and two base changes to create anew Sal I site after the 3' splice site. The resulting mutantplasmid, after verification by sequencing, was furthermodified to eliminate extraneous restriction enzymecleavage sites and to place a termination codon TAG imme-diately upstream of the initiator ATG codon of the catalasecoding sequence by standard procedures (Maniatis et al.1982), and the resulting plasmid was designated aspAOlNBATG. A plasmid pRAJ275 carrying the GUScoding sequence (Jefferson 1987) was also modified todelete the initiator ATG codon to produce pRAJ275-4ATG. The Xbal-Sall fragment from pAOlNBATGcovering the N-terminal 5 amino acid residues, the modifi-ed first intron of 190 bp, and two codons following the in-tron was joined to the Sal I site of the initiator-less GUScoding sequence of pRAJ2754ATG using Xbal-SnaBlsites of pBI221 plasmid containing the 35S-GUS fusiongene in pUC19 vector (Jefferson 1987) to produce aplasmid pIG221 containing the Intron-GUS gene down-stream of the 35S promoter. The GUS reporter genes inthese plasmids are followed by nos polyA site. The Xba-EcoR I fragment covering the promoter-less Intron-GUSreporter gene and the Hind Ul-EcoR I fragment covering




ownloaded from


Intron-containing GUS reporter gene 807

the 35S-Intron-GUS fusion gene in pIG221 were excisedand cloned into appropriate sites in pBHOl and pBI121(Jefferson et al. 1987) to produce binary Ti plasmidspIGlOl and pIG121, respectively.

Assay of GUS activity in Agrobacterium cells—Ti-binary plasmids were mobilized from E. coli to A. tumefa-ciens LBA4404 (Bevan 1984) by triparental mating (VanHaute et al. 1983). Agrobacterium cells harboring Ti-binary plasmids were grown overnight in a medium contain-ing 50mg/liter kanamycin-sulfate, 500mg/liter strep-tomycin and 50mg/liter rifampicin and cells collectedfrom 1 ml of the culture were resuspended in 200/il ofGUS extraction buffer (Jefferson 1987). Cells were brokenby ultrasonic oscillation using Ohtake Sonicator at 30 Wfor 30 s, centrifuged at 16,000 rpm for lOmin, and thesupernatant was used for the assay of GUS activity and themeasurement of proteins. The GUS activity was assayedby the fiuorometric reaction method of Jefferson (1987) us-ing 4-methylumbelliferyl glucuronide. The amount of pro-tein was determined by the method of Bradford (1976).

Transient expression in protoplasts of tobacco sus-pension-cultured BY-2 cells by electroporation—Tobaccosuspension culture BY-2 cells after 3 days of inoculationwere converted to protoplasts by the method of Nagata etal. (1981), and plasmid DNAs were introduced into pro-toplasts by electroporation using BTX Transfector 300(Biotechnologies & Experimental Research Inc.) attachedwith Gene Pulser cuvette with electrode gap of 0.4 cm (Bio-Rad Inc.). For each electroporation, 10 fig of the ccc-formplasmid DNA was mixed with 1.5 x 106 protoplasts in0.5 ml of the buffer and electrically discharged at 100 mF,300 V once. Protoplasts were mixed with 3 ml of the pro-toplast culture medium (\% sucrose, 0 .4M mannitol, MSsalts except for the concentration of KH2PO4 was increasedto 370 mg/liter, 100 mg/liter myo-inositol, 1 mg/literthiamine-HCl, 0.2 mg/liter 2,4-dichlorophenoxyacetic acid(2,4-D), pH5.5) and incubated at 28°C under dim light(300 lux) for 24 h in a petri dish (6 cm diameter). Cellswere collected by centrifugation and GUS activity wasassayed with the extract prepared by the method describedfor Agrobacterium cells.

Agrobacterium-mediated transformation of tobacco—The Agrobacterium-mediated transformation of tobaccowas carried out by the leaf disc method (Horsch et al. 1985)essentially as described previously (Hattori et al. 1990).Regenerated plants were maintained on MS-agar me-dium containing 3% sucrose, B5 vitamins, 50 mg/literkanamycin and 500 mg/liter Claforan (sodium cefotaxime,Hoechst).

Histochemical staining of GUS activity—Tissues werehand sectioned with a razor blade and stained in 0.5 mg/ml5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) at 37°Cfor 16 h as described by Jefferson (1987). Tissue colorswere bleached by soaking in 70% ethanol for 3 h.

Results

Construction of a P-glucuronidase reporter gene con-taining an in Iron within the coding sequence—Construc-tion of an Intron-GUS reporter gene containing an intronwithin the GUS coding sequence is summarized in Figure1. The intron used in this experiment is the first intron ofCAT-1 gene, one of the castor bean catalase gene (Ario, T.,Nakamura, K., Ota, Y., Hattori, T. and Asahi, T. un-published results). The CAT-1 gene codes for a catalaseisozyme present in the endosperm of germinating seeds.The first intron of CAT-1 gene is located between codonsfor the 5th and 6th amino acid residues from the initiatorMet residue, composed of 189 bp in length, and containstandemly repeated ATG codons near the 3' splice site. Inorder to eliminate the translation of GUS polypeptide fromthe ATG codons inside of the intron, we carried out thesite-directed mutagenesis of this intron by gapped duplexmethod (Kramer and Fritz 1987) using a synthetic 33-meroligonucleotide. By this mutagenesis, we obtained amodified intron where a termination codon TAG wascreated 6bp upstream of the 3' splice site in the samereading frame as the GUS coding sequence (Fig. 1 andFig.2). At the same time, a new Sail site was generated5 bp downstream from the 3' splice site. The GUS codingsequence in pRAJ275 plasmid (Jefferson 1987) was modifi-ed to delete the initiator ATG codon and a Sal I linker wasattached. This modified GUS coding sequence was joinedwith the modified CAT-1 first intron by ligation of Sall-SnaBl fragment and Xbal-Sall fragment, respectively,between the Xba I and Sna BI sites of the plasmid pBI221(Jefferson et al. 1987). The resulting plasmid pIG221 con-tains the Intron-GUS reporter gene downstream of theCaMV 35S promoter. The fragment carrying the 35S-In-tron-GUS fusion gene was excised from pIG221 and reclon-ed in a binary Ti plasmid pBI121 (Jefferson 1987, Jeffersonet al. 1987) to obtain a binary Ti plasmid pIG121.

The nucleotide sequence of the critical parts of the In-tron-GUS and GUS genes are compared in Figure 2. TheGUS polypeptide encoded by the Intron-GUS gene aftercomplete removal of the modified intron from thetranscript is expected to be 8 amino acids longer than theauthentic GUS polypeptide at its N-terminus. An inser-tion of A residue used to create TAG termination codon inthe intron also created an AG 3' splice boundary which ispreceded by a sequence similar to consensus dicot 3' splicesite (Hanley and Schuler 1988). Splicing of the modified in-tron at this site should also yield a GUS polypeptide.

The Intron-GUS reporter gene does not express GUSactivity in Agrobacterium cells—Since the modified intronin the Intron-GUS reporter gene contains a terminatorTAG codon in the same reading frame as the GUS codingsequence, it is expected that this Intron-GUS gene wouldnot express any GUS activity in bacterial cells where int-




ownloaded from



Intron I (189bp)11,8 I B 3

CAT1 (Castor bean)

CdATgGATCCCTACAGG'GT-•

ffcol BamHl ,\ Ncol. BamHl. KlenovI Ligation to Smal s i te of Bluescript(-)

Sp.x.a S.B s

pAOlNB

•• ATGATGAT GTTACACAACCGTCCATCAAGTGG•TACTACTATCAATGTCTTGGCACCTGGTTCACC

3' ~ ~ ~ 5 (33mer)

} s i t e directed mutagenesis

Sp,X,B N,B s S

pAOlNBmut

TAG (in frame to coding sequence)

j Hcol, Henow

1 Spel, SI nuclease, Ligation

J^PlBf- pAOlNBATG

• • • G G C C G C T C T A G A A C £ X G ) G A T C C •••

H,P

-t

S.N Sn

cus

••-GTCGACQilfiPTC •

S a i l .Vcol

\ Hcol, Sail. 51 nuclease| Ligation v i t h Sail lOmer l inker

5 Sn

CUS

•GACTCGACTCCTC ••••GACTCGACT

S a i l

Xbal. Sail

XB S

S a i l , SnaBI

Sn

CaMV 35S pro.

X,B

CaMV 35S pro.

Xbal, SnaBI

Sn

pRAJ275

pRAJ275AATC

Sc Icerj1- pIG221

Sc E

|Nos « r . F - pBI221

1kb

Fig. 1 Construction of an Intron-Gus reporter gene. Detailes are described in Materials and Methods. Coding regions and intronsof the CAT-1 gene are indicated by M and GS2, respectively. The following abbreviations are used for restriction enzyme cleavage sites;B, BamH I; E, EcoR I; H, Hind III; P, Pst I; S, Sal I; Sc, Sac I; Sn, Sna B I; Sp, Sph I; X, Xba I. Lines under the nucleotide sequenceindicate the sequence recognized by restriction enzyme and modified bases in the oligonucleotide for mutagenesis. The translation initia-tion codon ATG, 5' and 3' splice sites are indicated by box, open arrowhead and closed arrowhead, respectively.

(A) GUS

Xbal BamHI Smal

-TCTAGAlGGATCCCCGGGTGGTCAGTCCCTTATGTT^GTCCTGTAGAAMetLeuArgProValGlu - GUS

(B) Intron-GUS

Xbal BamHI * * * 50 * » #

-TCTAGA|ACATGGATCCCTACAG(^AATTTCTAGTTTTTCTCCTTCATTTTCTTGOTrAGGACCCrTTTCTCT^^

MetAspProTyrArgl

* 100 * * * * 150 *TTTTGAGCTTTGATCTTTCT1TAAACTGATCTATTTTTTAATTGATTGGTTATGGTGTAAATATTACATAGCTTTAACTGAT

Modified Intron

* * * 200 ^ • Sail * »AATCTGATTACTTTATTTCGTGTGTCTATGATGATGATGATAGTTAQ^AACCGTCGACTCGTC|:GTCCTGTAGAA—

= = s JAsnArgArgLeuValArgProValGlu - GUS

Fig. 2 Nucleotide sequence of critical part of Intron-GUS reporter gene compared to GUS reporter gene. Nucleotide sequence ofthe N-terminal coding part of GUS reporter gene in pBI221 (A) and Intron-GUS reporter gene in pIG221 (B) are shown. Nucleotide se-quence identical between the two genes are indicated by boxes. The 5'- and 3'-splice boundary dinucleotides of the modified intron are in-dicated by circles. Termination codon TAG created within the intron by an insertion of A residue (V) is indicated by double underlines,and two bases modified by mutagenesis to create a Sal I site are indicated by dots.




ownloaded from



Table 1 Expression of GUS activity in Agrobacterium tumefaciens cells harboring binary Ti plasmids with various con-structs of GUS reporter gene

Binary plasmid GUS activity[ x 104 pmole M U m i n " ' ( m g protein)"1]

None

pBHOl (No promoter:GUS)

pIGlOl (No promoter:Intron-GUS)

pBI121 (CaMV 35S promoter:GUS)

pIG121 (CaMV 35S promoter:Intron-GUS)

0.01

1.18

0.01

1.87

0.01

A. tumefaciens LBA4404 harboring helper plasmid pAL4404 was a host.

ron-splicing does not occur. We compared the GUS activ-ity in cell extracts of A. tumefaciens LBA4404 harboringvarious constructs of GUS reporter gene in binary Tiplasmids (Table 1). Cells harboring pBHOl (Jefferson etal. 1987) which contair s the promoter-less GUS coding se-quence gave high act' 'ities of GUS, probably due to theread-through transcription from the lac promoter in thevector (Jefferson 1987). The presence of the 35S promoterin front of the GUS gene (pBI121; Jefferson et al. 1987)results in about 1.6-fold increase in GUS activity. By con-trast, neither pIGlOl containing the promoter-less Intron-GUS gene nor pIG121 containing the 35S-Intron-GUSfusion gene, as well as Agrobacterium cells without any bi-nary Ti plasmid, showed detectable level of GUS activity.These results indicate that the Intron-GUS gene does notconfer the expression of GUS activity in bacterial cells.

Transient expression of the Intron-GUS reporter geneunder the CaMV35S promoter in tobacco protoplasts afterelectroporation—In order to examine whether the Intron-GUS reporter gene can express functional GUS poly-peptide in plant cells, we first examined the transient ex-pression of the 35S-Intron-GUS fusion gene in tobaccoprotoplasts. The GUS activity significantly higher than

the background level of GUS activity in control protoplastswas observed with protoplasts after electroporation withpIG221 plasmid DNA containing the 35S-Intron-GUS fu-sion gene. Furthermore, GUS activities obtained withpIG221 DNA was slightly higher than those obtained withpBI221 DNA containing the 35S-GUS fusion gene. On theaverage, the level of GUS activity obtained with pIG221was about 1.7 times higher than that obtained with pBI221(Table 2).

Stable expression of the Intron-GUS reporter geneunder the CaMV 35S promoter in transgenic tobaccoplants—To examine the expression of the Intron-GUSreporter gene in stably transformed plant cells, we obtainedtransgenic tobacco plants with the 35S-Intron-GUS fusiongene. As shown in Figure 3, transgenic plants with the35S-Intron-GUS fusion gene expressed strong GUS activi-ties in all of the organs examined, leaves, stems and roots,as is the case for transgenic plants with the 35S-GUS fusiongene. The level of GUS activity seems to be slightly higherin plants with the 35S-Intron-GUS gene than in plants withthe 35S-GUS gene. Although the fluorometric assay ofGUS activity was carried out with only three plants (Fig. 3),histochemical examination of GUS expression also sug-

Table 2 Transient expression of GUS activity in protoplasts of tobacco BY-2 cells after electroporation of the CaMV35S promoter: GUS and the CaMV 35S promoter:Intron-GUS fusion genes

Plasmid DNA GUS activity[pmole MU • min~' • (mg protein)"1]

Exp. 1NonepBI221 (CaMV 35S promoter:GUS)pIG221 (CaMV 35S promoter:Intron-GUS)

Exp. 2NonepBI221 (CaMV 35S promoter.GUS)pIG221 (CaMV 35S promoter:Intron-GUS)

134260

19132226




ownloaded from



35S- ntrof>-GUS

7k

Leaf

Stem

Root

fTI1 2 3 4 1 2 3

Fig. 3 Expression of GUS activity in various organs of tobaccoplants transformed with pBI121 (35S-GUS; A) and pIG121 (35S-Intron-GUS; B). Proteins were extracted from leaves, stemsand roots of transgenic tobacco plants grown axenically andassayed for the GUS activity. Numbers indicate independentplants.

gested the stronger expression in Intron-GUS plants com-pared to GUS plants, which is consistent with the results ob-tained by transient expression in protoplasts.

Although the CaMV 35S promoter has been describedas "constitutive" promoter, recent experiments with GUSfusion genes indicate that the strength of its expression is ac-tually highly dependent on cell-types (Jefferson et al. 1987,Benfey and Chua 1989, Benfey et al. 1989). In order to ex-amine whether splicing of the modified intron occurs invarious cell-types and the presence of modified intron affectthe pattern of expression of GUS reporter under the 35Spromoter among various cell-types, we compared thehistochemical staining patterns of GUS activity in leaf andstem sections and whole roots of the 35S-Intron-GUS and35S-GUS plants. In most of the cases, the GUS staining in-tensities were stronger in tissues of the 35S-Intron-GUSplants than those of the 35S-GUS plants. However, asshown in Figure 4, the cell-type preference of GUS stainingin these organs of transgenic tobacco plants were verysimilar between the 35S-Intron-GUS plants and the 35S-GUS plants. These results suggest that the splicing of themodified intron occurs in various cell-types and the pres-ence of intron, and its splicing, does not alter the cell-typepreference patterns of the 35S promoter expression invarious organ systems of tobacco.

Discussion

In this paper, we constructed an Intron-GUS reportergene which contains an intron within the N-terminal partof the GUS coding sequence. In contrast to the GUSreporter gene, a fusion gene in which the CaMV 35S pro-

moter is placed upstream of this Intron-GUS reporter genedid not direct the expression of GUS activity in Agrobacte-rium cells (Table 1). On the other hand, the expression ofGUS activity was observed in tobacco cells by transient ex-pression assay using protoplasts (Table 2) as well as invarious organs of transgenic plants (Fig. 3). These resultsnot only suggest that the modified intron of the castor beancatalase gene inserted in a bacterial gene can be spliced inplant cells, but also indicate that the 35S-Intron-GUS fu-sion gene can be used to monitor the transfer of genes fromthe Agrobacterium cell to the plant cell, even under the con-dition where plant tissues are heavily contaminated withAgrobacterium cells. Indeed, using A. tumefaciens strainscontaining this fusion gene and the histochemical detectionof the expression of GUS activity using X-Gluc, we coulddetect the appearance of blue spots due to the localized ex-pression of GUS activity in stem and petiole segments ofsweet potato several days after co-cultivation with Agrobac-terium. These assays were used to examine various condi-tions for the Agrobacterium-medi&ted transformation ofthe sweet potato. Transformation of the sweet potatowith A. tumefaciens strains containing the 35S-Intron-GUSfusion gene and the expression of GUS activity intransformed calli will be described elsewhere (Nakamura,K. et al. unpublished results). The expression of GUS ac-tivity by the 35S-Intron-GUS fusion gene was also ob-served, in addition to tobacco and sweet potato, in potatoand in monocotyledonous rice cells (Tanaka, A., Mita, S.,Ohta, S., Kyozuka, J., Shimamoto, K. and Nakamura, K.manuscript in preparation), indicating that the Intron-GUSreporter gene can be used in various plant species.

Recently, Janssen and Gardner (1989) and Vancanneytet al. (1990) also constructed GUS reporter genes which ex-press GUS activity in plant cells, but not in bacterial cells.In the former paper, the prokaryotic ribosome binding sitesequence immediately upstream of the GUS coding se-quence of the uidA gene was modified, while strategiessimilar to those described in this paper is taken in the latterpaper. They inserted an intron from a potato gene intoSna B I site of the uidA gene which locate at a codon forthe 128th amino acid residue from the N-terminus of theGUS polypeptide. In both of these papers, the expressionof GUS activity in plant cells was detected within 2 daysafter inoculation of Agrobacterium cells.

The expression of GUS activity in tobacco cells wasslightly higher with the 35S-Intron-GUS fusion gene thanwith the 35S-GUS fusion gene. Since the nucleotide se-quence of the N-terminal coding part and hence the N-ter-minal amino acid sequence of the GUS polypeptide aredifferent between these two genes (Fig. 2), it is possible thattranslational efficiency of mRNAs, stability of mRNAs,stability of GUS polypeptides or specific enzyme activity ofGUS polypeptides are different between the two. Alter-natively, the differnce in the level of GUS activity could be




ownloaded from



(A) (D)

-»

(C)Fig. 4 Histochemical examination of GUS activity in leaf, stem and root of transgenic tobacco plants with the 35S-GUS and the 35S-In-tron-GUS fusion genes. Hand sections of leaf and stem, and the whole roots were incubated with X-Gluc at 37°C for 16-h and exam-ined under the microscope. Leaf (A), stem (B) and root (C) of the 35S-GUS tobacco plant and leaf (D), stem (E) and root (F) of the35S-Intron-GUS tobacco plant.

due to the consequence of intron-splicing. In animals,many genes require intron-splicing for their expression andintrons are incorporated in some constructs of mammalianexpression vectors to maximize the expression (Mulligan etal. 1979, Okayama and Berg 1983). In maize cells, Calliset al. (1987) demonstrated that insertion of a maize intronin the 5'-noncoding region of chimeric genes results in 50-

to 100-fold stimulation of their expression. This intron-stimulated gene expression was observed with various com-binations of promoters, introns and reporter genes.Similar intron-stimulated gene expression has also been ob-served in bread wheat cells by a maize intron (Oard et al.1989) and in rice cells by a rice intron (McElroy et al.1990). Although all of these previous observations were




ownloaded from



obtained in monocot cells by monocot introns, the resultspresented in this paper suggests that intron-stimulated geneexpression may also occur in dicot plant cells albeit atlower efficiency. In contrast to our results, the insertion ofthe second intron of a potato gene into GUS coding regiondid not affect the level of GUS activity in Arabidopsis cells(Vancanneyt et al. 1990). This differnce could be due tothe difference in the intron used or the location of intron-in-sertion within the fusion gene. The results of Callis et al.(1987) indicate that the stimulation of gene expression inmaize cells by intron-insertion is strongly dependent on thelocation of an intron with sites near the 5' end of themRNA giving more profound effects.

The differnce in intron-splicing between monocot anddicot plants (Hanley and Schuler 1988) and the mechanismby which intron-splicing stimulates gene expression in plantcells (Callis et al. 1987, McElroy et al. 1990) are largelyunknown at present. The Intron-GUS reporter genedescribed in this paper should be usefull to analyze intron-splicing and its effect on gene expression in plant cells.Comparison of splicing of transcripts from the 35S-Intron-GUS fusion gene in transgenic tobacco and rice will bedescribed elsewhere (Tanaka, A., Mita, S., Ohta, S.,Kyozuka, J., Shimamoto, K. and Nakamura, K. manu-script in preparation).

References

An, G. (1986) Development of plant promoter expression vectorsand their use for analysis of differential activity of nopaline syn-thase promoter in transformed tobacco cells. Plant Physiol.81: 86-91.

Benfey, P. N. and Chua, N.-H. (1989) Regulated genes in tran-sgenic plants. Science 244: 174-181.

Benfey, P. N., Ren, L. and Chua, N.-H. (1989) The CaMV 35Senhancer contains at least two domains which can conferdifferent developmental and tissue-specific expression patterns.EMBO J. 8: 2195-2202.

Bevan, M. (1984) Binary Agrobacterium vectors for planttransformation. Nucleic Acids Res. 12:8711-8721.

Bradford, M. M. (1976) A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72: 248-254.

Callis, J., Fromm, M. and Walbot, V. (1987) Introns increasegene expression in cultured maize cells. Genes and Develop. 1:1183-1200.

Draper, J., Scott, R. and Hamil, J. (1988) Transformation ofdicotyledonous plant cells using the Ti plasmid of Agrobacte-rium tumefaciens and the Ri plasmid of A. rhyzogenes. InPlant Genetic Transformation and Gene Expression. Editedby Draper, J., Scott, R., Armitage, P. and Walden, R. pp. 69-160. Blackwell Scientific Publications, Oxford.

Gould, J. H. and Smith, R. H. (1989) A non-destructive assay

for GUS in the media of plant tissue cultures. Plant Mol. Biol.Rep. 7: 209-216.

Hanley, B. A. and Schuler, M. A. (1988) Plant intron sequences:evidence for distinct groups of introns. Nucleic Acids Res. 16:7159-7176.

Hattori, T., Nakagawa, S. and Nakamura, K. (1990) High-levelexpression of tuberous root storage protein genes of sweetpotato in stems of plantlets grown in vitro on sucrose medium.Plant Mol. Biol. 14: 595-604.

Herrera-Estrella, L., De Block, M., Messens, E., Hernalsteens,J. P., Van Montagu, M. and Schell, J. (1983a) Chimeric genesas dominant selectable markers in plant cells. EMBO J. 2:987-995.

Herrera-Estrella, L., Depicker, A., Van Montagu, M. and Schell,J. (1983b) Expression of chimaeric genes transferred into plantcells using a Ti-plasmid-derived vector. Nature 303: 209-213.

Herrera-Estrella, L., Teeri, T. H. and Simpson, J. (1988) Use ofreporter genes to study gene expression in plant cells. In PlantMolecular Biology Manual. Edited by Gelvin, S. B. andSchilperoort, R. A., Bl. pp. 1-22. Kluwer Academic Publish-ers, Dordrecht.

Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eicholts, D., Rogers,S. G. and Fraley, R. T. (1985) Simple and general method fortransferring genes into plants. Science 277: 1229-1231.

Ikeda, T., Matsumoto, T. and Noguchi, M. (1976) Effects of nu-tritional factors on the formation of ubiquinone by tobaccoplant cells in suspension culture. Agric. Biol. Chem. 40: 1765—1770.

Janssen, B.-J. and Gardner, R. C. (1989) Localized transient ex-pression of GUS in leaf discs following cocultivation with Agro-bacterium. Plant Mol. Biol. 14: 61-72.

Jefferson, R. A. (1987) Assaying chimeric genes in plants: theGUS gene fusion system. Plant Mol. Biol. Rep. 5: 387-405.

Jefferson, R.A., Kavanagh, T. A. and Bevan, M. W. (1987)GUS fusions: yS-glucuronidase as a sensitive and versatile genefusion marker in higher plants. EMBO J. 6: 3901-3907.

Kramer, W. and Fritz, H.-J. (1987) Oligonucleotide-directed con-struction of mutations via gapped duplex DNA. Methods En-zymol. 154: 350-367.

Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982) MolecularCloning. Cold Spring Harbor Laboratory, Cold Spring Har-bor, New. York.

Matsumoto, S., Takebe, I. and Machida, Y. (1988) Escherichiacoli lacZ gene as a biochemical and histochemical marker inplant cells. Gene 66: 19-29.

McElroy, D., Zhang, W., Cao, J. and Wu, R. (1990) Isolation ofan efficient actin promoter for use in rice transformation.Plant Cell 2: 163-171.

Mulligan, R. C , Howard, B. H. and Berg, P. (1979) Synthesis ofrabbit /7-globin in cultured monkey kidney cells following infec-tion with a SV40 /7-globin recombinant genome. Nature 277:108-114.

Nagata, T., Okada, K., Takebe, I. and Matsui, C. (1981)Delivery of tobacco mosaic virus RNA into plant protoplastsmediated by reverse-phase evaporation vesicles (liposomes).




ownloaded from



Mol. Gen. Genet. 184: 161-165.Oard, J. H., Paige, C. and Dvorak, J. (1989) Chimeric gene ex-

pression using maize intron in cultured cells of breadwheat.Plant Cell Rep. 8: 156-160.

Okayama, H. and Berg, P. (1983) A cDNA cloning vector thatpermits expression of cDNA inserts in mammalian cells. Mol.Cell. Biol. 3: 280-289.

Simpson, J., Timko, M. P., Cashmore, A. R., Schell, J., VanMontagu, M. and Herrera-Estrella, L. (1985) Light inducibleand tissue specific expression of a chimaeric gene under controlof the 5' flanking sequence of a pea chlorophyl a/b binding pro-tein gene. EMBO J. 4: 2733-2739.

Scott, R., Draper, J., Jefferson, R., Dury, G. and Jacob, L.(1988) Analysis of gene organization and expression inplants. In Plant Genetic Transformation and Gene Expres-sion. Edited by Draper, J., Scott, R., Armitage, P. and

Walden, R. pp. 263-339. Blackwell Scientific Publications, Ox-ford.

Vancanneyt, G., Schmidt, R., O'Connor-Sanchez, A.,Willmitzer, L. and Rocha-Sosa, M. (1990) Construction of anintron-containing marker gene: splicing of the intron in tran-sgenic plants and its use in monitoring early events in Agrobacte-mwj-mediated plant transformation. Mol. Gen. Genet. 220:245-250.

Van Haute, E., Joos, H., Maes, S., Warren, G., Van Montagu,M. and Schell, J. (1983) Intergeneric transfer and exchangerecombination of restriction frag ments cloned in pBR322: anovel strategy for reversed genetics of the Ti plasmids of Agro-bacterium tumefaciens. EMBO J. 2: 411-418.

Zambryski, P. C. (1988) Basic processes underlying Agrobacte-num-mediated DNA transfer to plant cells. Annu. Rev. Genet.22: 1-30.

(Received May 10, 1990; Accepted May 30, 1990)




ownloaded from





ownloaded from


at Penn State University (Paterno Lib) on September 18 ...

Documents

Transcript of at Penn State University (Paterno Lib) on September 18 ...