Assignment 1 Part I: Dilutions and Concentrations 1 corr.pdf · Criteria for grading graphs: Has a...

Assignment 1

Part I: Dilutions and Concentrations (3 points/ question for a total of 60 points)

1 0.083M

2 25 mL

3 0.025%

4 5%

5 24 parts

6 6.28%

7 24:5:2:1

8 23.3:5.1:2.14:1

9 60.6%

10 50 mL

11 3 M

12 4 M

13 907.4 mL

14 2.33M

15 10 µL DNA and 3 µL Dye

16 1881.13 µg/mL

17 5.36X

18 646 µg/L

19 3.9g K and 4.75g PO4

20 158.65 mL

Part II: Lab performance and data analysis (5 points/question for a total of 40 points)

1. Indicate the absorbance readings obtained for each of the following solutions.

Solution ABS

a. A 0.2 mM solution of compound “A”. 0.72

b. A 0.72% (m/v) solution of compound “B”. 0.67

c. A 5% (v/v) solution of solution I. 0.341

d. A solution containing 0.1 mg of compound “A” and 0.1% (v/v) of compound “B”. 1.5

e. A solution with the following ratio: solution I: solution II : water : 2 : 1 : 247 1.3

1 point each for values within 10% of those indicated

0.5 point for values within 30% of those indicated

0 points for values beyond 30% of those indicated

1.3: Using micropipettors

2. Generate a standard curve from the data obtained with the volumes ranging from 50-200 µL.

(ABS Vs Vol.). Determine the R2 coefficient. (Follow the directives for figures and graphs

available on this course’s web site)

Criteria for grading graphs:

Has a title

Axis labels with units

Trend line with equation and R2 coefficient are indicated

R2 coefficient is 0.95 or greater

3. According to your standard curve, what were the average volumes for wells G1-3 or H1-3 and

wells G4-6 or H4-6? Give points if done appropriately according to data obtained

1.4: Colorimetric assay to determine phosphate concentration

4. Generate a standard curve. (ABS Vs µmoles phosphate per well). Determine the R2 coefficient.

(Follow the directives for figures and graphs available on this course’s web site)


Has a title


Curve and R2 coefficient for linear portion are indicated


2.3: Agarose gel electrophoresis

5. Submit an appropriate figure of your gel electrophoresis including an accompanying legend.

(Follow the directives for figures and graphs available on this course’s web site)

Criteria for grading gels:

Has a figure title

Lanes are labelled

Sizes of molecular weight standards are indicated

Legend with required information for interpretation of gel

o Legends should provide enough information so that the figure is understandable

and the experiment can be reproduced by someone who is familiar with molecular

biology. Define all symbols used in the figure and define all abbreviations.

Quality of migration: consistent loading, clear gel, migration distance is adequate

For plasmid isolations obtained a decent yield, with little to no RNA

2.4: Spectrophotometric quantification of DNA

6. Submit a graph representing the A260 readings Vs standard DNA concentrations. Add a

trend line of best fit. Determine the equation of the line and the R2 coefficient. (Follow the

directives for figures and graphs available on this course’s web site)

2.5 points

2.5 points

2.5 points

2.5 points

2.5

poin

ts

2.5 points


Has a title


Trend line with equation and R2 coefficient are indicated


7. According to your graph what was the DNA concentration of the undiluted unknown DNA

solution provided? Give points if done appropriately according to data obtained

8. Provide the following information for your yeast genomic DNA isolation:

ABS260

Concentration in µg/µL of undiluted preparation

o 2.5 points for conc. between 150 - 400 µg/mL

o 1 point for higher or lower conc.

Total yield in µg (2.5 points if done correctly)

2.5 points

2.5 points

Assignment #2

Part I: Restriction digests and mapping (2 points/ question for a total of 50 points)

1. Bacillus

2.

Isoschizomer: Pairs of restriction enzymes specific to the same recognition sequence and

which generate the same termini.

Neoschizomer: Pairs restriction enzymes that recognize the same nucleotide sequence but

cleave at a different site generating different termini.

Isocaudomer: Pairs of restriction enzymes with different recognition sequences but

generate identical termini.

3.

A+D

A+B

B+D

C+F

4. Any of the following

CT/AATTAG A/AATTT

CTA/ATTAG AA/ATTT

CTAATT/AG AAATT/T

CTAAT/TAG AAAT/TT

5. Neither A or B

6.

a. 1

b. 2

c. 2

d. 7

7. BamHI 1, 5 and 12

EcoRI 2, 4 and 6

BamHI + EcoRI 1, 2, 3, 4

Enzyme Recognition Sequence

A AccI GT/CGAC

B ClaI AT/CGAT

C EagI C/GGCCG

D TaqI T/CGA

E NsiI ATGCA/T

F NotI GC/GGCCGC

G PstI 5CTGC/AG

8. 6 and 11

9. 5 kb

10. 4 µg

11. BamHI

12. 13199 or 12126 or 9645 or 10701

13. 13199

14. 1425 + 11774

15. 2498 + 2129

16. 1073 + 3554

17. 3242

18. 1855 + 1387

19. 2934

20. 2934

21. 2

22. 2048

23. True

24. 29 times

25. TaqI

Part II: Restriction mapping (4 points/ question for a total of 40 points) 1. Submit a standard curve of the molecular weight ladder (Migration distance Vs. Size in Kbp)

1 points/criteria listed below

Figure number & Title provided (Title should be in caption)

Appropriate axis labels with units are provided

Y axis represents log of base pairs

Trend line provided (may be drawn by hand) which has a good linear range.

Either line of best fit or curve is acceptable.

2. Submit a table presenting the results of the restriction digests of the recombinant plasmid

Note sizes are approximate. (2 points) Accept 20% range as long as data is in agreement

between digests.

Enzyme Total cuts Cuts in insert Cuts in vector Sizes in Kb

BamHI 2 1 1 4.0, 0.7

EcoRI 2 1 1 3.5, 1.2

HindIII 2 0 2 2.9, 1.8

PstI 1 0 1 4.7

EcoRI + HindIII 3 1 2 2.9, 1.0, 0.8

Information provided in caption (2 points) Accept 20% range as long as data is in agreement with

data in table.

Total size in the range of 4.7 Kb

Size of vector in the range of 2.9 Kb

Size of insert in the range of 1.8Kb

Insertion site: HindIII

3. Submit a figure which represents a possible restriction map of the insert within the multiple

cloning site of pUC9.

Figure provided with Accompanying legend (caption)

Figure number and Figure title provided (caption)

Computer drawn or hand drawn linear map

Should be to scale

Must include scale bar

Should indicate following regions: multiple cloning site and insert

Insertion site should be easily determined from figure

Map is in agreement with data presented in table

Example:

4. Submit a table presenting the analysis of the restriction digests of the unknown you were

provided with. Your table should include: Enzyme (s) used, Total number of cuts, Number of

cuts in the vector, Number of cuts in the insert, and Fragments sizes generated.

Table provided with information requested.

Title and table number provided

5. Submit a figure of the restriction map of the insert from the recombinant plasmid you were

provided with. Your map must be linear, include the multiple cloning site, the insertion site,

the size of the insert, the positions in the multiple cloning site or the insert of all the enzymes

tested. Your figure must be to scale. (Make sure that the enzyme indicated as the insertion

site is consistent with both orientations) Follow the directives for generating such a figure

under the heading Graphs/Figures on this course's web site.


Figure number & Figure title provided (caption)


Should be to scale





6. Submit a figure of your own agarose gel electrophoresis of the predigested pUC recombinant

and the calibration of a restriction enzyme. Make sure to include an appropriate legend. Follow

the directives for figures on the Web page of this course and to include all the required

information in the legend for the understanding and interpretation of the figure.

Criteria for grading gel:

Figure provided with Accompanying legend

Figure number & Figure title provided

Lanes are labelled and easy to understand

First lane is mw ladder

Second lane is undigested control

MW sizes of standard are indicated

Gel clearly shows bands and migration is satisfactory

Legend indicates parameters of migration: Voltage, agarose concentration, samples

loaded





7. According to the experiment presented in question 6, what was the most dilute sample which

showed a complete digestion (Indicate the dilution)? Based on this information, what was the

approximate undiluted enzyme concentration in units/µL? Show how you arrived to this

conclusion.

Digestion occurred

Correct dilution was chosen to determine concentration

Units/µL should be equal to reciprocal of dilution chosen X 0.5/2

2 p

oin

ts

2 points

Submit a figure of your own agarose gel electrophoresis of the restriction digests of the

recombinant pUC plasmid you were provided with.



Figure title provided







loaded





8. BamHI (1), EcoRI (0)

9. Draw a possible restriction map of this genomic region of S. cerevisiae.


Should be to scale


Sizes are very approximate, anything relatively close is acceptable. Order is most important

Either orientation is acceptable

Bioinformatics 1-2 (1.25 points/ question for a total of 10 points) 1. AEB64941 (Decimal is unimportant)

2. Nucleotide sequence

3. polA

2 p

oin

ts

2 points

Bam Bam Bam Eco Eco

1200 650 850 appox 25 000

4. Submit the following information with regards to each of the unknown genes from the first

bioinformatics exercise.

Acc. Num. Cov. Ident. E value Definition Organism Gene name Product Pro. Acc.

NM_057444.3 100% 100% 0.0 Drosophila

melanogaster yellow

(y), mRNA

Drosophila

melanogaster

y yellow NP_476792.1

X91249.1 100% 100% 0.0 H.sapiens mRNA for

white gene protein

Homo sapiens White Non provided CAA62631.1

XM_019107967.1 99% 93% 0.0 Cyprinus carpio

mitogen-activated

protein kinase 8B-like

Cyprinus

carpio

LOC109094263 mitogen-activated

protein kinase 8B-

like

XP_018963512.1

Y00417 42% 100% 0.0 mitochondrial

cytochrome C oxidase

subunit I

Triticum

aestivum

Non indicated or

COI

cytochrome oxidase

subunit I

CAA68474.1

XM_006340335.2 99% 92% 0.0 Solanum tuberosum

uncharacterized

LOC102604569

Solanum

tuberosum

LOC102604569 uncharacterized

protein

LOC102604569

XP_006340397.1

5. Provide theoretical restriction maps of the 5 unknown genes available on this course’s Web

page. Indicate below each map the name of the gene and list the enzymes that do not cut.

Give points if done and includes required info.

6. COI or cytochrome oxidase 1

7. NcoI does not cut.

8. 645, 648, 269, 235 and 106

Assignment #2

Part I: Restriction digests and mapping (2 points/ question for a total of 50 points)

26. Bacillus

27.

Isoschizomer: Pairs of restriction enzymes specific to the same recognition sequence and

which generate the same termini.

Neoschizomer: Pairs restriction enzymes that recognize the same nucleotide sequence but

cleave at a different site generating different termini.

Isocaudomer: Pairs of restriction enzymes with different recognition sequences but

generate identical termini.

28.

A+D

A+B

B+D

C+F

29. Any of the following

CT/AATTAG A/AATTT

CTA/ATTAG AA/ATTT

CTAATT/AG AAATT/T

CTAAT/TAG AAAT/TT

30. Neither A or B

31.

e. 1

f. 2

g. 2

h. 7

32. BamHI 1, 5 and 12

EcoRI 2, 4 and 6

BamHI + EcoRI 1, 2, 3, 4

Enzyme Recognition Sequence

A AccI GT/CGAC

B ClaI AT/CGAT

C EagI C/GGCCG

D TaqI T/CGA

E NsiI ATGCA/T

F NotI GC/GGCCGC

G PstI 5CTGC/AG

33. 6 and 11

34. 5 kb

35. 4 µg

36. BamHI

37. 13199 or 12126 or 9645 or 10701

38. 13199

39. 1425 + 11774

40. 2498 + 2129

41. 1073 + 3554

42. 3242

43. 1855 + 1387

44. 2934

45. 2934

46. 2

47. 2048

48. True

49. 29 times

50. TaqI

Part II: Restriction mapping (4 points/ question for a total of 40 points) 10. Submit a standard curve of the molecular weight ladder (Migration distance Vs. Size in Kbp)

1 points/criteria listed below

Figure number & Title provided (Title should be in caption)

Appropriate axis labels with units are provided

Y axis represents log of base pairs

Trend line provided (may be drawn by hand) which has a good linear range.

Either line of best fit or curve is acceptable.

11. Submit a table presenting the results of the restriction digests of the recombinant plasmid

Note sizes are approximate. (2 points) Accept 20% range as long as data is in agreement

between digests.

Enzyme Total cuts Cuts in insert Cuts in vector Sizes in Kb

BamHI 2 1 1 4.0, 0.7

EcoRI 2 1 1 3.5, 1.2

HindIII 2 0 2 2.9, 1.8

PstI 1 0 1 4.7

EcoRI + HindIII 3 1 2 2.9, 1.0, 0.8

Information provided in caption (2 points) Accept 20% range as long as data is in agreement with

data in table.

Total size in the range of 4.7 Kb

Size of vector in the range of 2.9 Kb

Size of insert in the range of 1.8Kb

Insertion site: HindIII

12. Submit a figure which represents a possible restriction map of the insert within the multiple

cloning site of pUC9.


Figure number and Figure title provided (caption)


Should be to scale





Example:

13. Submit a table presenting the analysis of the restriction digests of the unknown you were

provided with. Your table should include: Enzyme (s) used, Total number of cuts, Number of

cuts in the vector, Number of cuts in the insert, and Fragments sizes generated.

Table provided with information requested.

Title and table number provided

14. Submit a figure of the restriction map of the insert from the recombinant plasmid you were

provided with. Your map must be linear, include the multiple cloning site, the insertion site,

the size of the insert, the positions in the multiple cloning site or the insert of all the enzymes

tested. Your figure must be to scale. (Make sure that the enzyme indicated as the insertion

site is consistent with both orientations) Follow the directives for generating such a figure

under the heading Graphs/Figures on this course's web site.


Figure number & Figure title provided (caption)


Should be to scale





15. Submit a figure of your own agarose gel electrophoresis of the predigested pUC recombinant

and the calibration of a restriction enzyme. Make sure to include an appropriate legend. Follow

the directives for figures on the Web page of this course and to include all the required

information in the legend for the understanding and interpretation of the figure.



Figure number & Figure title provided







loaded





16. According to the experiment presented in question 6, what was the most dilute sample which

showed a complete digestion (Indicate the dilution)? Based on this information, what was the

approximate undiluted enzyme concentration in units/µL? Show how you arrived to this

conclusion.

Digestion occurred

Correct dilution was chosen to determine concentration

Units/µL should be equal to reciprocal of dilution chosen X 0.5/2

2 p

oin

ts

2 points

Submit a figure of your own agarose gel electrophoresis of the restriction digests of the

recombinant pUC plasmid you were provided with.










loaded





17. BamHI (1), EcoRI (0)

18. Draw a possible restriction map of this genomic region of S. cerevisiae.


Should be to scale


Sizes are very approximate, anything relatively close is acceptable. Order is most important

Either orientation is acceptable

Bioinformatics 1-2 (1.25 points/ question for a total of 10 points) 5. AEB64941 (Decimal is unimportant)

6. Nucleotide sequence

7. polA

2 p

oin

ts

2 points

Bam Bam Bam Eco Eco

1200 650 850 appox 25 000

8. Submit the following information with regards to each of the unknown genes from the first

bioinformatics exercise.

Acc. Num. Cov. Ident. E value Definition Organism Gene name Product Pro. Acc.

NM_057444.3 100% 100% 0.0 Drosophila

melanogaster yellow

(y), mRNA

Drosophila

melanogaster

y yellow NP_476792.1

X91249.1 100% 100% 0.0 H.sapiens mRNA for

white gene protein

Homo sapiens White Non provided CAA62631.1

XM_019107967.1 99% 93% 0.0 Cyprinus carpio

mitogen-activated

protein kinase 8B-like

Cyprinus

carpio

LOC109094263 mitogen-activated

protein kinase 8B-

like

XP_018963512.1

Y00417 42% 100% 0.0 mitochondrial

cytochrome C oxidase

subunit I

Triticum

aestivum

Non indicated or

COI

cytochrome oxidase

subunit I

CAA68474.1

XM_006340335.2 99% 92% 0.0 Solanum tuberosum

uncharacterized

LOC102604569

Solanum

tuberosum

LOC102604569 uncharacterized

protein

LOC102604569

XP_006340397.1

9. Provide theoretical restriction maps of the 5 unknown genes available on this course’s Web

page. Indicate below each map the name of the gene and list the enzymes that do not cut.

Give points if done and includes required info.

10. COI or cytochrome oxidase 1

11. NcoI does not cut.

12. 645, 648, 269, 235 and 106

Assignment #3

Part I: Cloning and transformations (2.5 points/ question for a total of 50 points) 1.

Heterozygous carrier mother 7600 + 13000

Homozygous normal mother 7600

Homozygous for sickle cell anemia fetus 13000

Combined genomic DNA from a heterozygous carrier mother + homozygous normal father

7600 + 13000

2. Set 3

3. Directional cloning: StuI + SalI

4. Non directional cloning: SalI

5. EcoRI

6. 2

7. 3

8. b

9. 1.95 X 103

10. NdeI

11. NcoI

12. 7 kb

13. 1 + 6kb in either orientation

14. 0.4, 1.1, 1.5, 2.7 and 4.1kb

15. 2.3, 2.7, 3.0, 4.1 and 5.3 kb

16. 1.5, and 5.3

17. 3.4 kb

18. C + E

19. 9 times

20. A

Part II: Cloning (5 points/ question for a total of 25 points)

1. Submit a figure representing your PCR of the GFP gene. Include an appropriate legend which

includes the size of the amplicon observed.





Legends should provide enough information so that the figure is understandable and the

experiment can be reproduced by someone who is familiar with molecular biology. Size

of amplicon is indicated

Obtained an amplification product of adequate yield

2 p

oin

ts

3 points

2. Give points if done

Total number of colonies observed

Number of white colonies

Number of blue colonies

Number of green fluorescent colonies

3. Give points if calculation was done correctly

4. Submit a figure of your PCR analysis of your plasmid recombinants.







of amplicon is indicated. Briefly explains if the sizes obtained are those expected and

whether the results indicate that the amplicon was cloned in the correct orientation.

Obtained amplification products

5. Submit a figure of your restriction enzyme agarose gel electrophoresis of your plasmid

recombinant.










of amplicon is indicated. Briefly explains if the sizes obtained are those expected and

whether the results indicate that the amplicon was cloned in the correct orientation.

Loading is consistent between lanes


Digestions were adequate

3 p

oin

ts

2 points

2 p

oin

ts

2 points

Bioinformatics 3 (2.5 points/ question for a total of 25 points)

1. 5’ TAATCACACCTTTTTGTTTC 3’

2. 3’ GATAAGATGGGATCCGATC 5’

3. The following primers were used in exercise 4 to amplify and mutagenize the GFP gene using

pGFPuv as a template (the pGFPuv sequence can be obtained on this course’s Web site):

+ 230 CGCCAAGCTT-GCATGCCTGCAGGTCG 255 GFP

|||||||||| ||||||||||||||||

+ 1 CGCCAAGCTTTGCATGCCTGCAGGTCG 27 GFPfor-1

+ 230 CGCCAAGCTTGCATGCCTGCAGGTCG 255 GFP

||||||||||||||||||||||||||

+ 1 CGCCAAGCTTGCATGCCTGCAGGTCG 26 GFPfor-2

+ 230 CGCCAAGCTTG--CATGCCTGCAGGTCG 255 GFP

|||||||||| |||||||||||||||

+ 1 CGCCAAGCTTTGACATGCCTGCAGGTCG 28 GFPfor-3

+ 1130 CTGACACATGCAGCTCCCGGAGACGG 1155 GFP

||||||||||||||||||||||||||

- 26 CTGACACATGCAGCTCCCGGAGACGG 1 GFPrev

4. 925 base pairs

5. GFPSc-F1 + GFPSc-R1

6. 915 bp

7. No amplicon expected

8. Map the alignment positions of each of the following primer sequences on the sequence of the

pUC19 sequence. You may obtain the pUC19 sequence on the course’s Web site.

9. B + D

10. Sequence of forward primer and restriction site added. (SphI) GCATGC ATGGCCCTG

Sequence of reverse primer and restriction site added. (EcoRI) GAATTC CTAGTTGCA

Expected size of amplicon. 345 bp

pUC19

147 2425 2485

152

Bioinformatics 4 & 5 (1 point/ question for a total of 25 points) 1. NM_001077422.3

2. NM_001004376.3

3. NM_000559.2

4. What is the percentage of identity at the nucleotide level between the hemoglobin genes from

each of the following pairs of organisms:

A. 82.39%

B. 65.52%

C. 67%

D. 53.73%

5.

Human alpha hemoglobin to chicken hemoglobin

Cow hemoglobin to chicken hemoglobin

Human alpha hemoglobin to human fetal hemoglobin

6. None

7. What is the percentage of identity at the protein level between the hemoglobin proteins from

each of the following pairs of organisms:

A. 88.03%

B. 70.42%

C. 71.13%

D. 33.10%

8. XP_010804269.1

9. NP_033756.2

10. AAA34411.1

11.

Bos Taurus to yeast

Human to yeast

Mouse to yeast

12.

Bos Taurus to human

Bos Taurus to mouse

Mouse to human

13. AJF41183.1 and KC835294.1?

14. Orthologues

15. Orthologues

16. Mouse

17. Cytochrome oxidase

18. Influenza A virus (A/New York/492/2003(H1N2)) segment 4, complete sequence & Influenza

A virus (A/New York/492/2003(H1N2)) segment 6, complete sequence

19. Influenza A virus (A/New York/492/2003(H1N2)) for both

20. hemagglutinin & neuraminidase?

21. Reverse complement

22. 98%

23. 100%

24. T811 to G

25. Non conserved

Bioinformatics (2 points/ question for a total of 30 points)

1. Mus musculus

2. XM_023243939.1

3. 3e-127

4. orexin

5. 130 aa

6. Prepro-orexin

7. 2861 + 329 and 3015 +175

8. B

9. 1894 bp fragment

10. Capsid protein

11. NM_001037509.1

12. orthologues

13. 54.93%

14. Non conserved

15. reverse sequence

Assignment #4

Part I (2 points/ question for a total of 30 points) 1.

A. The gene you are interested in is not expressed in brain tissue.

2. 5.

3. Non-template strand

4. TTCAGG

5. 500

6. 5000

7. 1250

8. 100

9. A, B and D

10. C

11. B

12. D

13. B

14.

C. An RNA dependent RNA polymerase

D. An RNA dependent DNA polymerase

15. 5’GTGTCC 3’

Part II: Gene expression - Transcription (4.5 points/ question for a total of 45 points)

1. Indicate the ABS260, ABS280, the ABS260/ABS280 ratio and total yield of your RNA preparation.

2 points for ratio between 1.9-2.0

2.5 points for yield above 1µg/µL

2. Submit a figure of your RNA gel generated in lab exercise 6. Include an appropriate figure

legend.





Legends should provide enough information so that the figure is understandable


biology.

3. Submit a table of the densitometric analysis of this northern hybridization. Your table must

include the raw data (the values for each of the areas) for actin and YRA, the normalized values

(YRA reading/actin reading) for each of the growth conditions and the relative expression as

compared to growth in the absence of osmotic shock. Give points if done appropriately

4. Submit a figure of the RT-PCR gel 1 generated in lab exercise 7. Include an appropriate figure

legend, which indicates the sizes of the products observed in each lane.









of amplicons is indicated.


Amplification product obtained where expected (see example below)

5. Remove genomic DNA?

6. Verify presence of genomic DNA

M 1 2 3 4 5

Reaction Template

PCR-1 R (Step I)

PCR-2 DR (step II)

PCR-3 RT-R (step III)

PCR-4 RT-DR (step III)

PCR-5 Yeast genomic DNA

2 p

oin

ts

2.5 points

7. RT dependent (approx. 1.4Kb and 450 bp) and RT independent (approx. 1.4 kb)

8. Presence of an intron of approximately 900 bases

9. Submit a figure of the RT-PCR gel 2 generated in lab exercise 7. Include an appropriate figure

legend, which indicates the sizes of the products observed in each lane.








experiment can be reproduced by someone who is familiar with molecular biology. Sizes

of amplicons are indicated.

Size of Amplification product obtained are indicated

10. Submit a table of the densitometric analysis of these RT-reactions. Your table must include the

raw data (the values for each of the areas) for the largest rRNA band observed for the

corresponding condition on the corresponding ethidium bromide stained RNA gel (week 6)

and the corresponding YRA RT-PCR product observed on the RT-PCR gel 2, the normalized

values (YRA reading/rRNA reading) for each of the growth conditions and the relative

expression as compared to growth in the absence of osmotic shock. Give points if done

appropriately

Assignment #5

Part I 1. UAGGCU

2. MLFS

3. Same

4. Shorter

5. Similar

6. 34-35 b

7. 2690

8. 1890

9. 399 or 400

10. 1890

11. 215

12.

Fred and Helen’s conceived child Child ___2_

George and Helen’s conceived child Child ___3_

George and Helen’s adopted child Child ___1_

13. 1, 2 and 4

14. C3

15. 13

16. 3

17. BC

18. A, and D

19. D

20. 4 or 5

21. A. yfg1 and B

22. No effect

23. Decrease

24. Increase

25. Approx. 64%

Assignment 1 Part I: Dilutions and Concentrations 1 corr.pdf · Criteria for grading graphs: Has a...

Documents

Transcript of Assignment 1 Part I: Dilutions and Concentrations 1 corr.pdf · Criteria for grading graphs: Has a...