ars.els-cdn.com · Web viewfor Progesterone: Competitive Target Recognition and Displacement of...

6
Supporting information for Lateral Flow Aptasensor for Progesterone: Competitive Target Recognition and Displacement of Short Complementary Sequences. Mohammed N. Alnajrani 1 and Omar A. Alsager 1* 1 King Abdulaziz City for Science and Technology, P.O. Box 6086, Riyadh11442, Saudi Arabia. * Dr. Omar A. Alsager (corresponding author), E. mail: [email protected] , King Abdulaziz City for Science and Technology, P.O. Box 6086, Riyadh11442, Saudi Arabia. Phone No. 00966114814881 Table S1: Sequences used in this study Name Sequence 60-mer P4 aptamer [1] SH- GCATCACACACCGATACTCACCCGCCTGATTAACATTAGCCC ACCGCCCACCCCCGCTGC-3ʹ 8-mer C1 complementary sequence- biotin ATGAGTGG(T5)-biotin -3ʹ 8-mer C2 complementary sequence- biotin TGTAATCG(T5)-biotin-3ʹ 8-mer C3 GTGTGTGA(T5)-biotin -3ʹ 1

Transcript of ars.els-cdn.com · Web viewfor Progesterone: Competitive Target Recognition and Displacement of...

Supporting information for

Lateral Flow Aptasensor for Progesterone: Competitive Target Recognition and Displacement of Short Complementary Sequences.

Mohammed N. Alnajrani 1and Omar A. Alsager1*

1 King Abdulaziz City for Science and Technology, P.O. Box 6086, Riyadh11442, Saudi Arabia.

* Dr. Omar A. Alsager (corresponding author), E. mail: [email protected], King Abdulaziz City for Science and Technology, P.O. Box 6086, Riyadh11442, Saudi Arabia. Phone No. 00966114814881

Table S1: Sequences used in this study

Name

Sequence

60-mer P4 aptamer [1]

5ʹSH-GCATCACACACCGATACTCACCCGCCTGATTAACATTAGCCCACCGCCCACCCCCGCTGC-3ʹ

8-mer C1 complementary sequence-biotin

ATGAGTGG(T5)-biotin -3ʹ

8-mer C2 complementary sequence-biotin

5ʹ TGTAATCG(T5)-biotin-3ʹ

8-mer C3 complementary sequence-biotin

5ʹ GTGTGTGA(T5)-biotin -3ʹ

70-mer random ssDNA

5ʹ SH-AGGCCTAAGGGCATAATTAGCTCGAGCTCGAAAGGGGTTATATGATGATTTGAATTCATGGGGCCCGACT-3ʹ

8-mer complementary sequence-biotin for random ssDNA

5ʹ CGGGCTGA(T5)-biotin -3ʹ

Figure S1. A) TEM image of the as prepared AuNPs. JEOL 2010 microscope (200 kV) was used to obtain the image. Small aliquots (5 µL) of AuNP sample was deposited onto a carbon-coated copper grid and evaporated under vacuum. B) Salt titration experiments confirming of the attachment of the thiolated aptamer (0.8 nmoles) on the surface of AuNPs and the hypridization of the 8-mer C1 complementary sequence (1.6 nmoles). 1µL of 0.5 M NaCl solution was increasingly added to adjust the ionic strength of 100 μL suspensions of bare AuNPs, AuNP-aptamer, or AuNP-aptamer-C1. After 2 minutes incubation, 2 μL aliquot was used to measure the UV−Visible absorption using Thermo Scientific NanoDrop™ One/On Spectrophotometer.

Figure S2 Control experiments showing the dependence of the control line formation on the presence of various complementary sequences within the AuNP-duplexed aptamer conjugates. A) Shows NC membranes with only AuNP-aptamer flowing on the strips (with 4.7 µM pre-adsorbed streptavidin) and the lack of formation of test line. B) Shows formation of test line upon duplexing with the three 8-mer complementary sequences (C1, C2, and C3).

Figure S3 Performance of the developed sensor with two 8-mer complementary sequences (A: C2 and B: C3) hybridized at different regions of P4 aptamer as shown in Scheme 1 in main article.

Figure S4 Molecular structure of P4 and the tested interfering molecules.

Figure S5 Screening different NC strips of different flow and material treatment for optimum visualization of the sensor concept. AuNP-aptamer-C1 complementary conjugate and 100 nM P4 concentration were used. NC strips with CN 95 and CN140 designations provided the best results. LF sensor performed with CN 95 was more reproducibility and was adopted throughout the study.

References

[1]G. Contreras Jiménez, S. Eissa, A. Ng, H. Alhadrami, M. Zourob, M. Siaj, Aptamer-Based Label-Free Impedimetric Biosensor for Detection of Progesterone, Anal. Chem. 87 (2015) 1075–1082. doi:10.1021/ac503639s.

4

3

C1C2C3No complimentary C1C2C3With complimentary AB

P4 aptamer with C2 complementary P4 aptamer with C3 complementary Flow direction [P4] 0 nM0.5 5 50 100 200

DoxyE2P4BPAAcetaPG

HF 135No Target + Target No Target + Target HF 120 HPHF 90No Target + Target HF 120No Target + Target CN 140No Target + Target No Target + Target CN 95

-20020406080100120140160180200

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

A650/A525

Ionic strength (mM)

Bare AuNPs

AuNP-aptamer

AuNP-aptamer- 8-mer C1

100 nmAB