ANTICODON

CODON

tRNA

mRNA

AMINO ACID

Everything in you is made of or by proteins!

Protein Examples

Hemoglobin is a protein in your blood that transports oxygen

Collagen is a proteins that makes your cartilage and tendons

Keratin is a protein that makes up your hair & fingernails

Enzymes that break down your food are proteins

DNA is like a code that instructs the cell to make proteins

A gene is a sequence of DNA that carries the code for making one protein

RNA is like DNA except…

DNA – Deoxyribonucleic acid

RNA – Ribonucleic Acid

* 2 strands vs. 1 strand

* Thymine vs. Uracil (others are the same)

* Deoxyribose vs. Ribose

* Nucleus vs. Cytoplasm

Nitrogen Bases

Sugars

&

Phosphates

RNA DNA

Types of RNA

1. mRNA – “messenger” RNA- Carries copies of instructions from DNA for

making amino acids into proteins

2. tRNA – “transfer” RNA- Transfers each amino acid to the ribosome as

specified by the code on mRNA

3. rRNA – “ribosomal” RNA- Makes up part of the ribosome, where

proteins are made

• Both DNA and RNA are involved in protein synthesis

2 parts of protein synthesis:1. Transcription – DNA is converted to RNA

- Occurs in the nucleus

2. Translation – RNA is converted to a protein

- Occurs in the cytoplasm

• Transcription (the 1st part of Protein Synthesis)

• Converts DNA to RNA

• DNA (in the nucleus) needs to send a code to the ribosome (in the cytoplasm)

• Problem: DNA can’t fit through the nuclear pores

• A special “messenger” is used to copy and carry the code…

Transcription Cont’d

• messenger RNA (mRNA) goes into the nucleus and copies the DNA

• Uses enzyme – RNA Polymerase

• DNA AGGTATCGCAGATCGACAGATC

•RNA

UCCAUAGCGUCUAGCUGUCUAG

• The next step is that mRNA moves from the nucleus to the cytoplasm and to the ribosome

Translation (2nd part of protein synthesis)

• Amino acids – building blocks of proteins, carried to

ribosomes by ______________

• Polypeptides – long chains of ____________

• Codon – group of ____ nucleotide bases in mRNA which

carries code for making _______________________

• Ex:

• Anticodon – group of _____ nucleotide bases in tRNA which

is complementary to one ___________________

tRNAAmino Acids

3

3

ONE amino acid

codon

AUG - Methionine

Translation Cont’d

• ____________ attaches to the ribosome

• ____________ carries amino acids to the ribosome and matches them to the coded mRNA message (codon)

• Amino acids bond together, forming a long chain called a ____________________

• Finally, polypeptides fold into various types of proteins and there you have it!

mRNA

tRNA

Polypeptide chain

Translation (the 2nd part of Protein Synthesis)

• Translation – a process that converts mRNA into a protein

• Occurs on the ribosome in the cytoplasm of a cell

• ______________ - building blocks of proteins; join together into long chains called polypeptides

• ____________ - a sequence of 3 bases on mRNA that codes for a single amino acid

• _____________ – sequence of 3 bases on tRNA that is complementary to one mRNA codon

“UCU” is the codon that makes an amino acid called SERINE

Amino acids

Codon

Anticodon

•The tRNA lines up with 3 bases in mRNA (codon)

•tRNA anticodon GAA

•mRNA codon CUU

• Another form of RNA called transfer RNA (tRNA) carries amino acids to the ribosome and matches them to the coded mRNA message

mRNA attaches to the ribosome

•tRNA drops off the amino acid in the correct spot

ANTICODON

CODON

tRNA

mRNA

AMINO ACID

Any change in the DNA structure (specifically the order of nitrogen bases) is a mutation.

Mutations can be helpful, harmful, or neutral.

Helpful – can create diversity in a population

Harmful – can cause things like cancer

Neutral – can have absolutely no effect at all

A mutagen is something that causes mutations in the DNA (for example: smoking, radiation from the sun etc)

Slooze Worm

An insertion mutation is when a nitrogen base is added to the existing DNA

A deletion mutation is when a nitrogen base is subtracted from the DNA

A substitution mutation is when one nitrogen base is put in place of another.

If our DNA was AATTGGCC

An insertion would be AATTAGGCC

A deletion would be AATGGCC

A substitution would be AAATGGCC

Gene Sequencing – Determining the order of nucleotide bases within a gene

DNA Fingerprinting – technique used in criminal investigations. DNA Fingerprinting takes the DNA out of a cell and separates it. This will allow investigators to distinguish body cells of different individuals (since they are unlikely to have the same DNA)

Cloning – take the DNA out of one of your cells then take the DNA out of a zygote (fertilized egg). Put the DNA from your cell into the zygote.

Genetic engineering is the process of moving genes from the chromosomes of one organism to those of another organism.

Recombinant DNA is formed by joining DNA

molecules.from two different organisms

What would represent the strand of DNA from which the mRNA strand in the diagram was made?

A.CUCAAGUGCUUCB.GAGUUCACGAAGC.GAGTTCACGAAGD.AGACCTGTAGGA

What is the amino acid sequence in the portion of the protein molecule coded for by the piece of mRNA shown in the diagram?

A. Ser-Tyr-Arg-GlyB.Leu-Lys-Cys-PheC.Val-Asp-Pro-HisD.Pro-Glu-Leu-Val