AKrebsCycleComponentLimitsCaspaseActivation Rate through ... · Developmental Cell Article A Krebs...

Article

AKrebs Cycle Component Limits Caspase Activation
Rate through Mitochondrial Surface Restriction ofCRL Activation
Graphical Abstract

Highlights

d Caspase-mediated Drosophila spermatid cytoplasmic

content extrusion is restricted

d SCSb of the Krebs cycle activates a Ub ligase on the

spermatid mitochondrial surface

d The Ub ligase limits the source of caspase activation to the

mitochondrial vicinity

d Thismoonlighting function of SCSb reduces the potential rate

of caspase activation

Aram et al., 2016, Developmental Cell 37, 15–33April 4, 2016 ª2016 Elsevier Inc.http://dx.doi.org/10.1016/j.devcel.2016.02.025

Authors

Lior Aram, Tslil Braun,

Carmel Braverman, Yosef Kaplan,

Liat Ravid, Smadar Levin-Zaidman,

Eli Arama

[email protected]

In Brief

How is caspase activity restricted in the

cell when removing large cellular

structures? Aram et al. uncover a

moonlighting function of the Krebs cycle

component SCSb during sperm

individualization in limiting activation of

the Ub ligase complex required for

caspase activity to the mitochondrial

surface and reducing caspase activation

potential rate.

mailto:[email protected]

http://dx.doi.org/10.1016/j.devcel.2016.02.025

http://crossmark.dyndns.org/dialog/?doi=10.1016/j.devcel.2016.02.025&domain=pdf

Developmental Cell

Article

A Krebs Cycle Component Limits Caspase ActivationRate through Mitochondrial SurfaceRestriction of CRL ActivationLior Aram,1 Tslil Braun,1 Carmel Braverman,1 Yosef Kaplan,1 Liat Ravid,1 Smadar Levin-Zaidman,2 and Eli Arama1,*1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100, Israel2Electron Microscopy Unit, Weizmann Institute of Science, Rehovot 76100, Israel

*Correspondence: [email protected]://dx.doi.org/10.1016/j.devcel.2016.02.025

SUMMARY

How cells avoid excessive caspase activity andunwanted cell death during apoptotic caspase-mediated removal of large cellular structures ispoorly understood. We investigate caspase-medi-ated extrusion of spermatid cytoplasmic contentsin Drosophila during spermatid individualization.We show that a Krebs cycle component, the ATP-specific form of the succinyl-CoA synthetase b sub-unit (A-Sb), binds to and activates the Cullin-3-basedubiquitin ligase (CRL3) complex required for caspaseactivation in spermatids. In vitro and in vivo evidencesuggests that this interaction occurs on the mito-chondrial surface, thereby limiting the source ofCRL3 complex activation to the vicinity of this organ-elle and reducing the potential rate of caspase acti-vation by at least 60%. Domain swapping betweenA-Sb and the GTP-specific SCSb (G-Sb), which func-tions redundantly in the Krebs cycle, show that themetabolic and structural roles of A-Sb in spermatidscan be uncoupled, highlighting a moonlighting func-tion of this Krebs cycle component in CRL activation.

INTRODUCTION

Regulated cellular destruction processes (CDPs) are instru-

mental for the development, function, and homeostasis of a

variety of tissues and organs in virtually all organisms. At the

cellular level, these processes range from complete demolition

of the cell by programmed cell death (PCD) (Lettre and Hengart-

ner, 2006; Fuchs and Steller, 2011), partial cellular destruction by

specialized cell remodeling (Raff et al., 2002; Feinstein-Rotkopf

and Arama, 2009), to the selective turnover of damaged organ-

elles (Kirkin et al., 2009; Youle and Narendra, 2011). Whereas

some CDPs are mediated by distinct mechanisms designed to

cope with the different levels of destruction required for each

process, other CDPs may utilize similar pathways to bring about

distinct mechanistic outcomes. For example, activation of cas-

pases, the executioners of the apoptotic program, usually leads

to cell death, but caspases can also mediate partial CDPs

(Abraham and Shaham, 2004; Kuranaga and Miura, 2007; Fein-

stein-Rotkopf and Arama, 2009; Yi and Yuan, 2009). How a

demolition pathway, normally used to destroy an entire cell,

can be harnessed to remodel a cell has been poorly understood.

Furthermore, it is still amystery why some cells prefer a particular

CDP pathway to another. While it is relatively easy to trigger

‘‘macro’’ CDPs such as apoptosis, inducing the more precise

or selective CDPs in ways that may recapitulate the physiological

conditions, is much more complicated. One way to overcome

some of these obstacles is to use genetically malleable model

organisms, however thus far, only very few physiological para-

digms have been available to investigate partial or selective

CDPs (Arama et al., 2003; Politi et al., 2014).

Apoptosis, the most common form of PCD, is executed by

the action of unique proteases called caspases (Yuan et al.,

1993; Salvesen, 2002). Executioner (or effector) caspases are

regulated by both activating and inhibitory proteins, such as

the apoptosome components (cytochrome c, Apaf-1, and

caspase-9) (Shi, 2002; Jiang and Wang, 2004) and members

of the inhibitor of apoptosis protein (IAP) family, respectively

(Salvesen and Abrams, 2004; Steller, 2008). Although caspase

activation has become almost synonymous with apoptosis,

accumulating evidence, mostly in the past decade, suggests

that active caspases also mediate a variety of vital cellular

processes (Abraham and Shaham, 2004; Launay et al., 2005;

Lamkanfi et al., 2007; Kuranaga and Miura, 2007; Yi and Yuan,

2009; Feinstein-Rotkopf and Arama, 2009; Crawford and Wells,

2011). To date, more than 50 vital cellular processes have been

described in diverse tissues and organisms, such as neurite

pruning and synapse remodeling in neurons (Williams et al.,

2006; Kuo et al., 2006; Huesmann and Clayton, 2006; Nikolaev

et al., 2009; Li et al., 2010) and the removal of many organelles

(including the nuclei) during terminal differentiation of lens

epithelial cells and red blood cells in mammals (Ishizaki et al.,

1998; Zermati et al., 2001; Carlile et al., 2004; Bassnett, 2009).

Likewise, apoptotic proteins, including active caspases, the

apoptosome, and the giant IAP, dBruce, are all involved in the

process of spermatid individualization in Drosophila (Arama

et al., 2003, 2006; Huh et al., 2004; Muro et al., 2006; Arama

et al., 2007; Kaplan et al., 2010; D’Brot et al., 2013). During this

partial CDP, spermatids separate from each other and acquire

the typical streamlined morphology by losing their bulk cyto-

plasmic contents and organelles. This process is driven by the

caudal movement of an actin-based individualization complex

(IC), which collects the extruded material into a membrane-

enclosed structure called the cystic bulge (CB), and is eventually

Developmental Cell 37, 15–33, April 4, 2016 ª2016 Elsevier Inc. 15

mailto:[email protected]


http://crossmark.crossref.org/dialog/?doi=10.1016/j.devcel.2016.02.025&domain=pdf

Figure 1. A-Sb Binds to the CRL3 Complex

(A) Left, schematic structures of Cul3T and Cul3S protein sequences and the TeNC domain polypeptide from Cul3T. Middle and right, two Y2H assays: (I) a

b-galactosidase filter assay and (II) a nutrient-omitted medium assay testing the interactions between the three proteins indicated at the left (baits) and the

A-Sb(ckr) polypeptide (prey).

(B) Schematic representation of the A-SbT protein and the relative locations of its major domains. The predicted mitochondrial targeting sequence (MTS) may be

partial, as its deletion could not abrogate mitochondrial localization in S2 cells (data not shown).

(C) Schematic illustration of CRL1 and CRL3 complexes and their regions of interactions with A-Sb, respectively based on Hughes et al. (2008) and the current

study. SIM, substrate interacting motif.

(D) Yeast growth assay on selective media plates. Yeast were introduced with a Klhl10 bait plasmid and either of the following prey plasmids: A-Sb(ckr), an empty

vector (control), or Klhl10 (which serves as a positive control due to its ability to homodimerize). Whereas yeast colonies containing both vectors can grow on a

medium lacking tryptophan and leucine (�2), only colonies with protein-protein interaction events grow on a medium that also lacks histidine and adenine (�4).

(legend continued on next page)

16 Developmental Cell 37, 15–33, April 4, 2016

pinching off the spermatids as awaste bag (WB) (Tokuyasu et al.,

1972; Fuller, 1993; Fabrizio et al., 1998; Noguchi and Miller,

2003). Whereas this bulk of evidence counters the old dogma

that all cells expressing active caspases are doomed to die, it re-

mains largely unclear how some cells avoid excessive caspase

activity that leads to apoptosis.

Cullin-RING ubiquitin ligases (CRLs) constitute eight groups of

evolutionarily conserved multi-subunit ubiquitin ligase (E3) com-

plexes, implicated in the ubiquitination of hundreds of proteins,

and thus have impact on essentially all basic cellular processes

(Willems et al., 2004; Petroski and Deshaies, 2005). The unique

properties of the different CRL groups are determined by the

type of Cullin protein they contain. The Cullins function as scaf-

fold for two protein units: a catalytic unit (at the C terminus) and a

substrate recruitment unit (at the N terminus). The catalytic unit is

almost invariable in all CRL groups and is composed of a small

RING domain protein, which in turn recruits the ubiquitin-conju-

gating E2 enzyme. In contrast, hundreds of different proteins are

believed to serve as substrate recruitment units, thus facilitating

CRL-substrate specificity. The composition of the substrate

recruitment units varies between the different CRL groups; for

example, Cullin-1 binds to the adapter protein Skp1 (also known

as SkpA), which in turn recruits a substrate receptor from the

F-box protein family, whereas the substrate recruitment module

in Cullin-3-based CRLs (or CRL3s) is composed of single BTB-

domain-containing proteins (Pintard et al., 2004; Willems et al.,

2004; Petroski and Deshaies, 2005; Genschik et al., 2013).

CRLs are generally activated by a reversible covalent modifica-

tion of the Cullin subunit with the ubiquitin-like protein, Nedd8,

whereas at least for CRL1 complexes (and possibly also other

CRL groups), the inactive fraction of the Cullin is associated

with Cand1, a protein that disrupts both the Cullin association

with Skp1 and neddylation (Wu et al., 2006; Bosu and Kipreos,

2008; Merlet et al., 2009; Deshaies et al., 2010; Duda et al.,

2011). However, as opposed to the dramatic progress in our

understanding of global CRL regulatory mechanisms, very little

is known about the more specific mechanisms that differen-

tially regulate distinct CRL complexes to prevent improper and

deleterious activation of hundreds of CRLs, all at the same

time (Deshaies et al., 2010).

We use theDrosophila sperm as amodel system to investigate

how apoptotic caspases are regulated during the vital process of

spermatid individualization. Previously, we discovered a CRL3

complex composed of a testis-specific Cullin-3 isoform, Cul3T,

and the substrate recruitment protein Klhl10, which is required

for caspase activation in this system (Arama et al., 2007). In a

subsequent work, we identified a pseudosubstrate inhibitor of

this complex, called Soti, which directs graded activity of the

CRL3 complex, thus helping to restrict caspase activity in time

(Kaplan et al., 2010). Although the Soti-mediated mechanism ex-

plains how the more distal regions of spermatids are protected

against excessive caspase activation and cell death, it does

not explain how spermatids, particularly the more proximal re-

gions, avoid the rapid activation of caspases. This question is

(E and F) S2 cells were transfected with one or more of the indicated constructs. (

Klhl10, Cul3T, and GFP was confirmed using the indicated antibodies. Transfecte

slower migrating, possibly neddylated, Cul3T form (upper arrow in lane 5).

See also Figure S1.

particularly puzzling, since the process time of individualization,

about 12 hr (Noguchi and Miller, 2003), is much longer than the

time it usually takes to accumulate a level of caspase activity

that induces cell death (less than 4 hr in Drosophila epithelial

cells; Florentin and Arama, 2012). Furthermore, while cytoplasm

removal is impaired in soti mutant spermatids, the IC still con-

tinues to progress about three-quarters of the spermatid length

(Kaplan et al., 2010), implying that even after 9 hr of individualiza-

tion, the caspase activity levels do not reach the threshold that

triggers apoptosis.

Here, we uncover a mitochondrial-based mechanism that

limits the rate of caspase activation in spermatids. We identified

a Krebs cycle component, the ATP-specific form of the succinyl-

CoA synthetase (SCS) b subunit (A-Sb) that specifically binds

to Cul3T and Klhl10. A-Sb is localized to mitochondria during

all stages of spermatogenesis, but its levels are significantly

increased at the onset of spermatid individualization. We

demonstrate that knockdown or mutation in A-Sb abrogates

caspase activation and spermatid individualization, a phenotype

reminiscent of mutations in the CRL3 complex. Spermatid mito-

chondrial fractionation analyses reveal that a relatively large

portion of the CRL3 complex is also localized to the mitochon-

dria, and that this depends, at least in part, on A-Sb. Moreover,

the mitochondrial portion of the complex was preferentially acti-

vated, and A-Sb could significantly enhance/induce the activity

of the CRL3 complex in a Drosophila transgenic system and in

cultured cells. We then identify two major isoforms of A-Sb,

one of which is testis specific and localized to the surface of

the mitochondria. We demonstrate that the activating arm

(i.e., A-Sb) competes with the inhibitory arm (mediated by Soti)

for binding to the CRL3 complex, suggesting an antagonistic

interplay. Finally, ubiquitination assays in cell culture followed

by in situ domain swapping experiments between the two func-

tionally redundant b subunits of SCS, A-Sb and the GTP-specific

SCSb (G-Sb), uncouple the metabolic role (Krebs cycle) and the

structural role (CRL3 activation) of A-Sb in spermatids. Collec-

tively, this work uncovers a mode of CRL regulation by a moon-

lighting function of a Krebs cycle component, which ultimately

reduces the caspase activation rate by at least 60% through

restriction of the source of caspase activation to the vicinity of

the mitochondria.

RESULTS

The Krebs Cycle Enzyme Subunit A-Sb SpecificallyInteracts with Cul3T and Klhl10The Drosophila cullin-3 locus encodes for two isoforms, somatic

(Cul3S) and testis-specific (Cul3T), both of which share the bulk of

the protein except for a unique 181 amino acid (aa) region at the

N terminus of Cul3T (also called the TeNC domain) (Figure 1A;

Arama et al., 2007). Whereas the precise function of the TeNC

domain is unknown, transgenic rescue analyses in spermatids

suggested an important role of this region in the proper activa-

tion of caspases in spermatid individualization. Interestingly,

E) Klhl10 and (F) Cul3T were immunoprecipitated and the presence of A-Sb(ckr),

d CD8-GFP construct controlled for transfection efficiency. (F) Note the slightly

Developmental Cell 37, 15–33, April 4, 2016 17

Figure 2. A-SbT Is Localized to the Mitochondria during All Stages of Spermatogenesis, and Its Expression Level Significantly Increases at

the Onset of Individualization

(A) Schematic structure of the A-SbT genomic region within a BAC clone, which was engineered to include GFP fused in-frame to the C-terminal end of A-SbT,

therefore specifically labeling A-SbT and not A-SbS. Exons are depicted by bars, while introns are indicated by thin lines. Black bars indicate coding sequences;

gray bars indicate UTRs; green bar indicates the GFP insertion.

(B–K) A-SbT expression in the testis (green) revealed by either (B–E, I–K) the GFP insertion described in (A) or (F–H) an anti-A-Sb antibody. Nuclei are in blue (DAPI)

and F-actin (phalloidin), which marks the individualization complex (IC), is in red.

(B–D) A-SbT is expressed in patterns reminiscent of mitochondria during early spermatogenesis stages. Shown are (B) pre-meiotic spermatocytes (white arrows)

and post-meiotic round spermatids (yellow arrows pointing at the nebenkerns). (C) Dividing germ cells during the anaphase/telophase stages of meiosis I (a white

arrow pointing at mitochondria between two dividing germ cells), and (D) early elongating spermatids (very early and more advanced elongating spermatid cysts

are indicated by a yellow asterisk and white arrowheads, respectively).



although the TeNC domain is not sufficient to bind to Klhl10 by

itself (and Cul3S can still bind to Klhl10 but with very low effi-

ciency), this domain significantly increases the binding efficiency

of Cul3T to Klhl10 (Arama et al., 2007). Therefore, we hypothe-

sized that the activity of the CRL3 complex might be modulated

through the regulation of the TeNC domain of Cul3T in sperma-

tids. To explore this idea, we used the yeast two-hybrid (Y2H)

approach and tested the ability of an isolated TeNC domain to

bind to candidate proteins, originally identified as binding part-

ners of Cul3T in a Y2H screen (Arama et al., 2007). We identified

a polypeptide encompassing about a third of the A-Sb protein

encoded by the CG11963 gene. This polypeptide includes the

CoA-ligase domain and was termed the Cul3/Klhl10 interacting

region or ckr (Figures 1A and 1B).

The mitochondrial enzyme succinyl-CoA synthetase or SCS is

best known for its key functions in the Krebs cycle, ketone meta-

bolism and heme synthesis (Berg et al., 2002). In the Krebs cycle,

it catalyzes the reversible conversion of succinyl-CoA and ADP

or GDP to succinate and ATP or GTP (Johnson et al., 1998).

Active SCS enzymes are heterodimers composed of a and b

subunits, in which the b subunit may be switched between

A-SCSb and G-SCSb, resulting in an ADP-forming SCS and a

GDP-forming SCS, respectively (Fraser et al., 1999, 2000).

A-Sb and G-Sb are the respective Drosophila homologs of

A-SCSb and G-SCSb, but more recent studies suggested

that A-Sbmay also have other unconventional functions outside

of the mitochondria, including at the plasma membrane and at

centrosomal microtubules in Drosophila (Gao et al., 2008;

Hughes et al., 2008). Interestingly, the latter function, which is

required for proper centrosome duplication, involves the associ-

ation of A-Sb (also dubbed Skap for SkpA-associated protein)

with Skp1, the adapter protein in CRL1 complexes (Hughes

et al., 2008). Since Skp1 is known to assume a three-dimensional

fold highly similar to that of the BTB domain (Figure 1C; Stogios

et al., 2005), we tested whether A-Sb may also interact with the

BTB domain of Klhl10. Using both Y2H and co-immunoprecipi-

tation (coIP) assays in Drosophila S2 cells, we show that the

ckr domain of A-Sb (A-Sb(ckr)) can also bind to Klhl10 in a BTB-

domain-dependent fashion (Figures 1D and 1E and data not

shown). Of note, the BTB domain is also required for the binding

of Klhl10 to Cul3T, and a single point mutation in this domain ab-

rogates the function of the CRL3 complex in spermatids (Arama

et al., 2007).

Interestingly, when we validated the binding between A-Sb

and Cul3T using a similar coIP experiment (Figure 1F), the

interaction between A-Sb and Cul3T appeared to be much

weaker than that between A-Sb and Klhl10 (namely much more

A-Sb was co-immunoprecipitated with Klhl10 than with Cul3T;

compare Figures 1E and 1F). We therefore asked whether the

(E and F) A-SbT levels dramatically increase in individualizing spermatids, as reve

are indicated by white arrows.

(G, H, J, and K) A-SbT is not extruded with the cytoplasmic contents to the WB

arrowheads point at post-individualized regions, which still contain A-SbT; white

mature sperm, which still express A-SbT), and (K) a post-individualized mature c

yellow arrow in E).

(I) A-SbT level specifically increases at the onset of individualization. Whereas jus

dramatic increase is recorded at the onset of individualization when the IC (red; wh

10 mm; (B, D, and I), 20 mm; (K), 50 mm; (E–H), 100 mm.

See also Figure S2.

binding of A-Sb to the CRL3 complex might be stronger than

to each of the single components of the complex alone. For

this, a reciprocal coIP experiment was carried out in which

A-Sb was immunoprecipitated in the presence of either Flag-

tagged Cul3T, Flag-tagged Klhl10, or both. Whereas the levels

of bound Klhl10 were similar in both setups, the Cul3T levels

dramatically increased by 70% in the context of the complex

(Figures S1A and S1B). Given that, regardless of A-Sb, Cul3Tand Klhl10 can physically interact, this result implies a role of

A-Sb as part of a tertiary complex rather than as an interactor

of each of the single components alone.

To conclude our physical interaction analyses, we explored

the ability of a transgenically expressed and functionally active

GFP fusion of A-Sb (A-SbT-GFP; see also Figure 2A) to generate

a complex with endogenous Cul3T and Klhl10 in spermatids. To

control for non-specific binding, we also tested a transgenic line

carrying the testis-specific inner mitochondrial protein (Don

Juan) DJ-GFP (Santel et al., 1998; Bazinet andRollins, 2003). Us-

ing a gel mobility retardation assay, dissected testes from these

fly lines were subjected to chemical cross-linking followed by

electrophoretic mobility analysis of the protein extracts. In this

setup, the mobility of a protein complex is slower than that of

either protein alone. Significantly, a strong mobility shift of both

Cul3T and Klhl10 was detected in the A-SbT-GFP extract but

not the DJ-GFP extract (Figure S1C). Furthermore, A-SbT-GFP

also exhibited a similar mobility shift and appeared at the same

molecular weight as Cul3T and Klhl10, indicating that A-Sb can

form a complex with Cul3T and Klhl10 in spermatids.

Expression of a Testis-Specific Isoform of A-SbSignificantly Increases at the Onset of IndividualizationTo investigate the physiological relevance of the interaction be-

tween A-Sb and the CRL3 complex, we first asked whether the

expression pattern of A-Sbmay support a role during spermatid

individualization. Gene annotation data (FlyBase) for A-Sb sug-

gest that this locus encodes for twomain, long and short, protein

isoforms (hereinafter respectively referred to as A-SbT, for testis-

specific, and A-SbS, for somatic; see also in the next paragraph).

While sharing most of the coding region, the long isoform (A-SbT)

contains a unique exon at the 30 end, encompassing extra coding

sequences at the C terminus and an alternative 30 UTR (Figures

S2A and S2B). In addition, sequencing analyses of several ex-

pressed sequence tags and RT-PCR products from different tis-

sues, revealed that A-SbT contains an additional tiny exon with

only one codon for the amino acid cysteine (Cys-253) (Figures

S2A and S2B). Both the testis-specific C-term region (tail) and

the Cys-253 are not covered by the ckr domain, implying that

they are probably not directly involved in the A-Sb/CRL3 com-

plex interaction (Figure S2B).

aled both by (E) the A-SbT-GFP expression and (F) the anti-A-Sb antibody. CBs

s during individualization. Shown are (G, J) individualizing spermatids (white

arrows point at CBs), (H) a torn seminal vesicle (SV; a yellow asterisk labels

yst on its way to the seminal vesicle (an enlargement of the cyst marked by a

t prior to individualization A-SbT-GFP level is relatively low (white arrowhead),

ite arrow) is assembled in the vicinity of the nuclei (blue). Scale bars in (C and J),


To examine which of the A-Sb isoforms is expressed in the

male germ cells, we performed comparative RT-PCR experi-

ments using specific primer pairs for the long and short isoforms

(arrows in Figure S2A), and with RNA from wild-type testis, a

germ-cell-less line (male progeny of oskar mutant females), a

control knockdown line (cont_IR), and a germ-cell-specific

A-Sb knockdown line (A-Sb_IR). Note that the wild-type RNA

was PCR amplified for saturation (35 cycles) to generate the

two reference bands (WT testes; Figures S2C and S2D). While

A-SbT was highly expressed in control testes (black asterisk),

A-SbS was only weakly expressed there (red asterisk; Figures

S2C and S2D). In accordance, knockdown of A-Sb in the pre-

meiotic germ cells specifically targeted the A-SbT isoform, as

in these testes the A-SbS band prevailed (Figures S2C and

S2D). Finally, A-SbT (but not A-SbS) was absent from the germ-

cell-less male reproductive tracts, indicating that the expression

of the long isoform is restricted to the germ cells while the short

isoform expression is mainly confined to the soma (Figure S2C).

It is noteworthy that in addition to germ cells, the testis also con-

tains some somatic cells, which may explain the (low) presence

of A-SbS in this tissue.

We next explored the protein distribution of the long A-Sb

isoform in the male germ cells. For this, we first used the recom-

bineering technique (Venken et al., 2009) to introduce the GFP

coding region at the C-terminal end of A-SbT (just prior to the

stop codon), all within a large genomic BAC clone encompassing

the entire A-Sb locus, as well as some flanking genes (this

construct is termed A-SbT-GFPR-BAC; Figure 2A). As a control,

GFP was also introduced at the A-SbS C terminus within the

same BAC clone (A-SbS-GFPR-BAC; data not shown). Transgenic

flies carrying these large clones (inserted at the same genomic

point) were generated and their testes were analyzed using

confocal microscopy. Consistent with the idea that A-SbS is

the somatic isoform, flies carrying the A-SbS-GFPR-BAC trans-

gene displayed mitochondrial GFP expression in essentially all

examined tissues (data not shown). On the other hand, GFP

expression in flies carrying the A-SbT-GFPR-BAC transgene was

restricted to the male germ cell mitochondria throughout sper-

matogenesis (Figures 2B–2D). Significantly, GFP expression in

these flies dramatically increased in elongated spermatids

undergoing individualization compared with earlier elongating

spermatids (Figure 2E). Closer examination revealed that this

elevation in GFP expression specifically occurs at the onset of

individualization (Figure 2I). Furthermore, unlike cytoplasmic

proteins such as active caspases, which are usually expelled

from the spermatids to the WB, the GFP expression persisted

in post-individualized regions of the spermatids and in mature

spermatozoa, suggesting that A-SbT may function at the mito-

chondria during the individualization stage (Figures 2J and 2K,

respectively). Finally, we also used a specific polyclonal anti-

A-Sb antibody to stain wild-type testes, which revealed an

essentially identical pattern of A-SbT distribution in individual-

izing spermatids (Figures 2F–2H).

A-Sb Is Required for Caspase Activation and SpermatidIndividualizationThe A-Sb binding assays and expression data raised the possi-

bility that similar to the CRL3 complex, this protein may also be

involved in the regulation of caspase activation in spermatids. To


explore this, we examined testes from A-Sb-deficient flies by

either specifically knocking down A-Sb (A-Sb_IR) in the male

germ cells (using the bam-Gal4 driver, which is expressed in

8-16-cell spermatogonial cysts, just prior to the accumulation

of the vast majority of RNAs in these cells) or by generating a

relatively weak (hypomorphic) A-Sb mutant allelic combination

(A-Sbcc/Df; a P element insertion in the second intron in trans to

a small chromosomal deletion of the gene locus; Figure S2A).

Of note, whereas in the knockdown, the A-SbT isoform was spe-

cifically targeted (see the reduction in the mRNA and protein

levels in Figures S2C–S2E, 3A, and 3B), the protein (but not

mRNA) levels of both the long and short isoforms were reduced

in the mutant (Figures S2D and S2E). Importantly, an almost

complete block of caspase activation was detected in sperma-

tids from both the knockdown and mutant A-Sb flies (Figures

3C–3F). Consistently, although the assembly of ICs was readily

detected in A-Sb-deficient spermatids, these ICs were unable

to move and collect the spermatids’ cytoplasmic contents, lead-

ing to individualization failure and male sterility (Figures 3C–3F

and data not shown). Finally, re-introduction of the A-SbT-

GFPR-BAC transgene to the A-Sbmutant males restored caspase

activation, spermatid individualization, and fertility of these flies

(Figure 3G). Taken together, these findings are consistent with

a role of A-SbT in the regulation of the CRL3 complex and cas-

pase activation in spermatids.

Similar to mammals, the effector caspases in Drosophila

display DEVD cleaving activity (DEVDase; Fraser et al., 1997;

Song et al., 1997; Florentin and Arama, 2012). Furthermore, the

adult testis also contains a pronounced DEVDase activity, and

this activity is significantly reducedwhen caspase activation dur-

ing spermatid individualization is blocked (i.e., in cytochrome c

and cul3T mutant testes (Arama et al., 2006, 2007)), suggesting

that individualizing spermatids are the major source of caspase

activity during spermatogenesis. To provide independent evi-

dence for a requirement of A-Sb in caspase activation in sperma-

tids, we measured DEVDase activity in extracts from A-Sb_IR

knockdown testes. Wild-type testes and cul3T homozygous

mutant (cul3mds1) testes served as positive and negative con-

trols, respectively. Portions of the testis extracts were used as

controls to determine the relative amounts of total protein in

each extract using the anti-b-tubulin antibody (Figure 3I).

Whereas lysates of wild-type testes displayed relatively high

levels of DEVDase activity, activity level in A-Sb_IR knockdown

testes was significantly reduced to a level reminiscent of that in

the cul3mds1 mutant testes, indicating compromised caspase

activation during spermatid individualization (Figure 3H). Consis-

tent with their specific role in spermatid individualization, addi-

tion of the potent caspase inhibitor Z-VAD-FMK to the lysates

further reduced the residual (low) level of caspase activity in

these mutants, suggesting that other caspase activity-associ-

ated spermatogenesis processes (e.g., apoptosis of some testis

somatic cells) are not affected by A-Sb and the CRL3 complex

(Figure 3H).

A-Sb Activates the CRL3 ComplexDuring spermatogenesis, the mitochondria undergo extensive

structural organization, beginning at the round spermatid

stage with the aggregation of all the mitochondria and subse-

quent fusion to a giant sphere called the Nebenkern. When the

Figure 3. Inactivation of A-Sb Abrogates

Caspase Activation during Spermatid Indi-

vidualization

(A–D) Germ-cell-specific knockdown of A-Sb

using the bam-Gal4 line to drive expression of

(A and C) a control RNAi transgene (cont_IR) and

(B and D) an A-Sb RNAi transgene (A-Sb_IR).

(A–D) Testes were stained to visualize the nuclei

(blue), individualization complex (IC; red), and

either (A and B) A-Sb (green) or (C and D) cleaved/

activated effector caspases (cCasp.3; green).

(E–G) Testes from (E) wild-type flies, (F) hypomor-

phic A-Sb mutants, and (G) hypomorphic A-Sb

mutants carrying the A-SbT-GFPR-BAC transgene

(described in Figure 2A), were stained to visualize

activated effector caspases (red), the nuclei (blue),

and A-SbT-GFP expression (G; green). Scale bars,

100 mm.

(A–G) To obtain high-resolution picture of the entire

testis, serial confocal images were captured and

stitched together. The reconstructed pictures were

rotated to position the elongating spermatids in

a top (nuclei)-to-bottom orientation. Gaps in the

reconstructed images (due to rectangle-shape

cropping) were filled with gray background.

(H) Thediagramdepictsacaspase-3-like (DEVDase)

activity for testes from wild-type (wt), cul3T null

mutant (cul3mds1), and A-SbT knockdown (A-Sb_IR)

flies. Note the suppression of the activity after

treatment with the caspase-3 inhibitor Z-VAD-FMK.

DEVDase activity is presented as relative activity

with respect to the activity in thewt testis. Each time

point represents an average (mean ± SEM) of three

independent experiments.

(I) Western blot analysis to control for the protein

levels in the testis extract used in the DEVDase

activity assay.

flagellum starts growing, the Nebenkern unfolds into two mito-

chondrial masses that elongate down the side of the axoneme,

giving rise to two, major and minor, �2 mm long, mitochondrial

derivatives (Fuller, 1993). To test the idea that A-Sbmay regulate

the CRL3 complex in spermatids, a modified mitochondrial frac-

tionation protocol was used to isolate the spermatid mitochon-

drial derivatives. Indeed, the efficiency of this protocol was

confirmed by western blot analysis of mitochondrial and cyto-

solic testis fractions using antibodies against the mitochondrial

inner-membrane protein, ATP synthase-a (ATPsyn-a), the endo-

plasmic reticulum (ER) protein, Sec16, and the cytosolic protein,

GAPDH. Whereas the mitochondrial fraction was highly specific,

displayingminor or no contamination by cytosolic or ER proteins,

the cytosolic fraction was somewhat less pure, containing some

contamination from the mitochondria (Figure 4A). In agreement

Dev

with the immunofluorescence data, A-Sb

was mainly present in the mitochondrial

fraction (60%; Figure 4A, lanes 1 and 4).

Critically however, relatively large por-

tions of Cul3T and Klhl10 were also local-

ized at the mitochondria (45%), and their

presence in this fraction was partially

abrogated upon knockdown of A-Sb (Fig-

ures 4A, 4B, S3A, and S3B).

Since A-SbT is required for caspase activation in spermatids

and can bind to the CRL3 complex, a plausible hypothesis is

that the CRL3 complex may get activated upon binding to

A-SbT at the mitochondria. This idea is further supported by

the finding that transfection of A-Sb(ckr) with Cul3T and Klhl10,

but not of the latter two proteins alone, resulted in an additional

(shifted) Cul3T band of slightly higher molecular mass, suggest-

ing that A-Sb binding may promote neddylation/activation of this

complex in cultured cells (the upper arrow in Figure 1F, lane 5).

More importantly, a similar phenomenon was also apparent

in spermatids, where a significant enrichment (more than

3.5-fold) of the neddylated (activated) form compared with the

unneddylated form of Cul3T was detected in the testis mito-

chondrial fraction but not in the cytosolic fraction (lanes 1 and

4 in Figure 4A and quantifications of the relative levels of the

elopmental Cell 37, 15–33, April 4, 2016 21

Figure 4. A-Sb Activates the CRL3 Complex

(A) Testis mitochondrial and cytosolic fractions from flies expressing a control RNAi or an A-Sb RNAi, and from cul3T mutant flies (cul3mds1). The blot was

sequentially exposed to several antibodies to reveal the endogenous proteins indicated at the left. ATPsyn-a, an inner mitochondrial membrane protein; Sec16,

an ER membrane protein; GAPDH, a cytosolic protein.

(B) Quantification of protein levels in the mitochondrial fractions in (A) relative to the ATPsyn-a levels. Top, the neddylated (Nedd) and unneddylated (Unnedd)

forms of Cul3T. Bottom, Klhl10 protein levels.



two forms in the mitochondrial fraction in Figure 4B, upper

graph). Note that the upper band corresponds to the neddylated

form of Cul3T, as confirmed using an anti-Nedd8 antibody (Fig-

ures 4A and S3B). Consistently, in A-Sb knockdown, the same

bands were similarly reduced using both anti-Cul3 and anti-

Nedd8 antibodies (lanes 1 and 2 in Figure 4A). In addition, in

testes from the Klhl10 mutants where no active CRL3 complex

is formed, the upper (neddylated) band of Cul3T is missing (Fig-

ure S3B), as was reported for other CRL complexes (Merlet et al.,

2009). Altogether, these data clearly indicate that the upper band

of Cul3T indeed represents the neddylated form of this protein,

which is enriched on the mitochondria. Another remarkable

piece of evidence along these lines is the stabilization (�2-fold)

of Klhl10 in the mitochondrial, but not the cytosolic, fraction of

the cul3T mutant (cul3mds1 in Figure 4A, lanes 3 and 6, and the

quantification in Figure 4B, bottom graph). This stabilization is

attributed to constant auto-ubiquitination and degradation of

the substrate recruitment proteins in CRL complexes (Bosu

and Kipreos, 2008), which we previously also demonstrated for

Klhl10 (Kaplan et al., 2010), and which therefore also reflects

the activity state of the CRL3 complex in spermatids. Consis-

tently, the accumulation of Klhl10 on the mitochondria of cul3Tmutant spermatids depends on the presence of A-SbT, as

no accumulation of Klhl10 was detected in the mitochondrial

fraction when A-Sb was further inactivated (lanes 3 and 4 in

Figure S3A). Altogether, these findings indicate that the CRL3

complex is highly activated at the mitochondria, but whether

the binding to A-SbT is sufficient for this activation or additional

factors are required was still unresolved.

To address this question, we first tested the ability of A-SbT to

activate the CRL3 complex in an ectopic system, the Drosophila

compound eye. It is noteworthy that although this system was

previously shown to reliably reflect the activity of the CRL3

complex by virtue of the eye size (Kaplan et al., 2010), eye photo-

receptor cells are distinct from spermatids and may thus reflect

induction of different molecular pathways downstream of the

CRL3 complex activity (for instance, the CRL3 complex may

engage different substrates in the different cells, but the readout,

the eye size, shall still reflect its activity state). Using the eye-

specific GMR-Gal4 driver line, several UAS-dependent trans-

genes were tested. Whereas transgenic expression of GFP and

A-SbT did not cause any gross eye defect, a highly reduced

size to complete elimination of the eye was induced following

expression of Klhl10 alone or together with Cul3T, respectively

(compare Figures 4C, I, II with 4C, III, V). The pronounced effect

obtained by individually expressing Klhl10 is attributed to its abil-

ity to also bind the endogenous somatic Cul3 isoform, albeit with

less efficiency than the binding to the Cul3T isoform (Kaplan

et al., 2010), as demonstrated by suppression of the eye effect

in the cul3S heterozygous mutant background (cul3gft06430, a

specific mutation in the cul3S but not the cul3T isoform, in Fig-

(C) Transgenesis experiments using the Drosophila adult compound eye. The tr

imaginal discs. Representative eyes from newly eclosed females are shown. Typic

did not eclose and died in their pupal stages.

(D) Ubiquitination experiment in S2 cells using Cyt-c-d as substrate. Cells were tr

ubiquitin construct, and increasing concentrations A-Sb(ckr). A CD8-GFP construc

inhibitor, Z-VAD-FMK, and the proteasome inhibitors, Velcade and MG132. Cyt

revealed by anti-ubiquitin antibody.

ure S3C). Importantly, transgenic expression of A-SbT enhanced

Klhl10-induced andKlhl10-Cul3T-induced phenotypes, suggest-

ing that A-SbT is a positive regulator of the CRL3 complex (Fig-

ure 4C). Furthermore, the facts that Cul3S lacks the TeNC

domain that is required for binding to A-SbT, and that expression

of A-SbT was sufficient to enhance the Klhl10-induced eye

phenotype, imply that binding of A-SbT to Klhl10 is sufficient

to trigger at least some activation of the CRL3 complex, even

without the binding of A-SbT to Cul3.

To ultimately test how binding to A-SbT may affect the activity

of the CRL3 complex toward its substrates, we performed ubiq-

uitination assays by transfecting S2 cells with the CRL3 complex

components (i.e., Cul3T, Klhl10, and the somatic RING domain

protein Roc1a), the testis-specific cytochrome c, Cyt-c-d, which

is required for caspase activation in spermatids (Arama et al.,

2006) and was recently found to be a bona fide target of this

complex in vivo (L.R., L.A., and E.A., unpublished data), and

either with or without A-Sb(ckr). Critically, western blot analysis

demonstrated that, whereas the CRL3 complex components

could not induce ubiquitination of Cyt-c-d (above background

levels), neither individually nor combined (Figure 4D, lane 4),

the addition of A-Sb(ckr) resulted in marked ubiquitination of

this substrate (Figure 4D, lane 5). It also appears that the stoichi-

ometry of A-Sb(ckr) and the CRL3 complex components is crit-

ical, as increased concentrations of the former failed to activate

this complex (Figure 4D, lanes 6–8). We conclude that A-Sb is an

activator of the CRL3 complex and that this may be independent

of other mitochondrial-associated factors, as A-Sb(ckr), which

can bind to the CRL3 complex but reside in the cytosol (Figure 1

and data not shown), and be sufficient for this activation.

A-Sb Mediates Localization of the CRL3 Complex to theSurface of the MitochondriaAn intriguing question regarding these findings is where, at the

subcellular level, the binding between A-SbT and the CRL3 com-

plex occurs, since A-Sb is normally localized at the matrix of the

mitochondria as part of its role in the Krebs cycle, whereas

caspase activation by the CRL3 complex occurs in the cytosol.

A reconciling hypothesis is that the interaction occurs at the sur-

face of the mitochondria, such that A-SbT is docked on the outer

membrane of the mitochondria facing the cytosol. To test this

idea, we first examined the effect of A-SbT expression on the

mitochondrial localization of the CRL3 complex in cell culture.

For this, S2 cells were transfected with Cul3T and Klhl10, with

or without A-SbT. Mitochondrial and cytosolic fractions were

then examined by western blot for the presence of these three

proteins. In agreement with the idea that A-SbT mediates mito-

chondrial localization and activation of the CRL3 complex in

spermatids (Figure 4A), increased mitochondrial levels of Cul3Tand Klhl10 were detected in cells transfected with A-SbT, and

this was accompanied by a reciprocal decrease in their levels

ansgenes indicated below each panel were ectopically expressed in the eye

al of mutants with extremely underdeveloped eyes, flies from the genotype in VI

ansfected with one or more of the indicated constructs (on the left), Drosophila

t controlled for transfection efficiency. Cells were also treated with the caspase

-c-d was immunoprecipitated and the presence of ubiquitinated Cyt-c-d was


in the cytosolic fractions (Figure 5A and the quantification at the

bottom).

We next explored the idea that the interaction between A-SbTand the CRL3 complex may occur at the mitochondrial surface.

Testis mitochondrial fractions were subjected to a Proteinase K

(PK) protection assay, which helps define compartmental locali-

zations of mitochondrial proteins based on their sensitivity to PK

proteolysis (i.e., proteins residing in internal mitochondrial com-

partments are better protected against PKproteolysis than those

localized on the mitochondrial surface; illustrated in Figure 5B).

Critically, whereas the mitochondrial inner-membrane protein

(ATPsyn-a) and the somatic A-Sb isoform (A-SbS) were highly

resistant to cleavage by this promiscuous protease, A-SbT was

highly sensitive to this treatment (Figure 5C; A-SbT and A-SbSare inblackand red text, respectively, andcorrespond to the illus-

tration in Figure 5B). Therefore, at least someportion of the A-SbTprotein is localized at an external mitochondrial compartment,

while A-SbS is found in the inner compartments. Furthermore,

the mitochondrial portions of Cul3T and Klhl10 were even more

sensitive to PK treatment than A-SbT (Figure 5C), suggesting

that their mitochondrial localization may be unstable and thus

may likely reflect localization by protein-protein interaction rather

than direct docking at the mitochondrial surface.

Because of the importance of this point to the overall model of

CRL3 complex activation by A-SbT in spermatids, we wanted to

confirm these findings using an independent approach and

obtain an estimate of the level of A-SbT at the spermatid mito-

chondrial surface. For this, we prepared testes for immunocyto-

logical localization at the electron microscopy (EM) level, a tech-

nique commonly known as immuno-EM. Using an anti-GFP

antibody, we performed immunogold labeling of A-SbT-GFP

on ultrathin testis sections from transgenic flies carrying the

A-SbT-GFPR-BAC construct (Figure 2A). To control for the

inherent inaccuracy in the position of the gold particles, which

are usually 15–30 nm away from the site to which the primary

antibody is bound (Hermann et al., 1996), we also labeled the in-

ner mitochondrial protein DJ, using flies expressing the DJ-GFP

transgene (Santel et al., 1998; Bazinet and Rollins, 2003). In addi-

tion, for the purpose of quantification, this technical limitation

was further buffered by considering an annular ring area as the

surface area (encompassing 24% of the total mitochondrial

area) and not merely themitochondrial circumference. We there-

fore hypothesized that a mitochondrial surface protein shall

display an average number of gold particles, which is signifi-

cantly above the chance level of random particle distribution

(i.e., 24%) in this ring area. Using transmission EM (TEM), we de-

tected specific labeling of gold particles over the mitochondria in

cross-sections of elongated spermatids expressing A-SbT-GFP

and DJ-GFP, but not in wild-type controls (Figure 5D and data

not shown). Importantly, quantifications of gold particle numbers

in more than 100 spermatids from each genotype revealed that

whereas more than 80% of the DJ-GFP particles were found at

the inner compartments (setting the inherent inaccuracy level

to less than 20%), half of the A-SbT-GFP was localized at the

mitochondrial surface (Figure 5E). Given the significant bias of

A-SbT-GFP at the surface area, which is highly above both the

inaccuracy level and the chance level, we conclude that about

50% ± 20% of the total A-SbT protein in elongated spermatids

is found at the mitochondrial surface.


A-SbT Antagonizes the Binding of Soti to the CRL3ComplexThe findings that the CRL3 complex is tightly regulated both by

an activating arm (i.e., A-SbT) and an inhibitory arm (mediated

by the pseudosubstrate inhibitor Soti; Kaplan et al., 2010), raised

the possibility that the binding of A-SbT to the CRL3 complex

may antagonize Soti binding to this complex. To test this idea,

we performed competition assays by transfecting S2 cells

with GFP-tagged Soti, Cul3T, Klhl10, and increasing levels of

A-Sb(ckr), followed by coIP experiments with anti-GFP anti-

bodies. Whereas both Cul3T and Klhl10 were readily present in

the Soti-GFP immunoprecipitates, their levels were dramatically

reduced upon A-Sb(ckr) transfection (Figure S4, lanes 5 and 6;

also see the quantifications at the bottom). Notably, A-Sb(ckr)caused a 50% drop in the levels of Cul3T and Klhl10 that bind

to Soti at a transfection level of 0.15 mg, which is about four times

less than the transfection levels of all the other components

(0.66 mg) (Figure S4). It is also interesting to note that, despite

the progressive reduction in the bound Cul3T and Klhl10 levels

when more A-Sb(ckr) was transfected, the bound A-Sb(ckr) levels

were also increased (Figure S4, third panel, lanes 6–9). Whereas

this increase may be partially attributed to direct binding be-

tween A-SbT and Soti (Figure S4, lane 3), it is more likely that

the increase in A-Sb(ckr) concentration may lead to an increase

in the bonding affinity between A-Sb(ckr) and the remaining

bound Cul3T and Klhl10. Collectively, these findings suggest

that A-SbT is a potent antagonist of Soti-Klhl10 interaction,

revealing amode of CRL complex regulation. Furthermore, these

results also suggest that the binding of A-SbT to the complex

may change its state from an inactive conformation (where it

prefers binding to Soti) to an active conformation (where it may

prefer binding to its true substrates), which further supports an

active role for A-Sb in promoting the activation state of the

CRL3 complex rather than merely stabilizing the complex on

the mitochondria.

A-Sb but Not the Alternative b Subunit of SCS, G-Sb,Restores Full Caspase Activation and SpermatidIndividualizationWe next wanted to further uncouple between the metabolic role

of A-Sb in the Krebs cycle and its function in the activation of the

CRL3 complex and caspases in spermatids. In the Krebs cycle,

the two SCS enzymes, which are differentiated by virtue of their b

subunits (i.e., A-Sb or G-Sb), may alternate to generate succinate

and ATP or GTP, respectively (Bridger et al., 1987; Johnson

et al., 1998; Lambeth et al., 2004). We therefore reasoned that

if the activation of the CRL3 complex by A-Sb merely occurs

through its metabolic role in the Krebs cycle, transgenic G-Sb

might be able to substitute for the loss of A-Sb in mutant sperma-

tids; whereas in the case A-Sb activates this complex in a

manner distinct from its metabolic function, no rescue of these

mutant spermatids is expected. To directly test this idea, we

generated transgenes that cover the entire coding regions of

either A-SbT or G-Sb (both tagged with a C-terminal HA) under

the control of the A-Sb promoter and 50 and 30 UTRs, and in-

serted them at a defined site of the Drosophila genome (Figures

6A, III and IV). These transgenic flies were then crossed to the

hypomorphic A-Sb mutant, A-Sbcc/Df, tested for protein expres-

sion (Figure 6B), and analyzed for their ability to rescue the

Figure 5. A-SbT Is Localized to the Spermatid’s Mitochondrial Surface

(A) Mitochondrial and cytosolic fractions of S2 cells transfected with one or more of the indicated constructs. To reveal the proteins indicated at the left, the blot

was sequentially exposed to the relevant antibodies. The quantification at the bottom represents the Cul3T and Klhl10 protein levels in the mitochondrial and

cytosolic fractions relative to the levels of the ATPsyn-a and GAPDH proteins, respectively. C, Cul3T; K, Klhl10; S, A-SbT.

(B) Schematic description of the Proteinase K (PK) protection assay used in (C).

(C) Mitochondrial testis fractions from wild-type flies were incubated with the indicated concentrations of PK. To reveal the endogenous proteins indicated at the

left, the blot was sequentially exposed to the relevant antibodies. The respective black and red colors of A-SbT and A-SbS correspond to the schematic protein

colors in (B).

(D) Representative immuno-electron (EM) micrographs of cross-sections through elongated spermatids expressing the A-SbT-GFP or DJ-GFP transgenes,

displaying specific GFP labeling with gold particles (black dots) over the mitochondria. MD, major mitochondrial derivative; Axo, axoneme. Each gold particle

represents a single protein either located at the mitochondrial surface (green arrowheads) or at the inner mitochondrial area (red arrowheads). Scale bar, 200 nm.

(E) Statistical analysis of the gold particle distributions over the mitochondrial surface and inner areas (shown in D) in more than 100 spermatids of each of the

indicated genotypes. For comparison, the chance level of random particle distribution for each of these areas is also indicated in a separate column (24% and

76% surface versus inner areas, respectively).


Figure 6. A-SbT and G-Sb Domain Swapping and Rescue Studies Reveal Both Interchangeable and Specific Domains Essential for the

Non-metabolic Function of A-SbT in Spermatids

(A) Schematic structures of full-length A-SbT (metal blue) and G-Sb (metal green) constructs (III, IV) and four additional A-SbT/G-Sb hybrid constructs (V–VIII).

Identifier Roman numerals on the left correspond to the experiments presented in (B–E).

(B) Validation of transgenic expression by western analysis of protein extracts from testes inserted with the indicated rescue constructs using the anti-HA

antibody. b-Tubulin levels served as loading controls. The numbers at the bottom represent expression levels of each transgene relative to the b-tubulin levels.

(C) Representative wild-type (I) and A-SbT mutant (II–VIII) testes were stained with anti-cleaved caspase-3 antibody (green), phalloidin (red; ICs), and DAPI (blue,

nuclei). The schematic structures of the inserted transgenes are indicated at the bottom of each image (III–VIII). Individualizing cysts are detected by the presence

of CBs and WBs (arrowheads). Scale bar, 100 mm.

(D) Quantification of cleaved caspase-3 staining levels (divided into four color-coded categories) in testes with the indicated constructs. The number of testes

examined is indicated above thecorrespondingbars,whereas the fertility status of thedifferent genotypes is indicatedbelow thebars either as fertile (F) or sterile (S).



sterility phenotypes associated with this mutant. As expected,

the A-SbT transgene fully restored caspase activation, sper-

matid individualization, and male fertility (Figures 6C and 6D).

In contrast, no rescue of spermatid individualization and male

fertility was obtained with the G-Sb transgene, albeit some

mild increase in caspase activation was observed (Figures 6C

and 6D; compare genotypes II and IV). These results are consis-

tent with our model of a Krebs-cycle-independent role of A-SbTin the activation of the CRL3 complex and consequent caspase

activation in spermatids.

The ckr Domain of G-Sb Can Bind to and Activate theCRL3 Complex in Cell Culture, but Its N-TerminalDomain Precludes Appropriate Complex Activation inSpermatidsThe fact that G-Sb cannot substitute for the loss of A-Sb sug-

gests that A-Sb might have acquired some unique sequence

properties specialized for its role in spermatids. These se-

quences were evolved to either directly affect the binding to

and activation of the CRL3 complex, or indirectly facilitate

appropriate complex activation through the acquisition of other

important sperm-specific traits (such as improved mitochondrial

surface localization, folding, binding to additional components,

etc.). In Drosophila, A-SbS and G-Sb share 46% amino acid

sequence identity (60% similarity) over the entire protein, with

55% identity and 67% similarity over the ckr domain (i.e., the

C-terminal region of the protein), and 42% identity and 57% sim-

ilarity over the N-terminal region. In addition, as aforementioned,

A-SbT also contains a unique 51 aa C-terminal tail, absent in both

A-SbS andG-Sb. To start exploring the function and specificity of

the different A-SbT domains for CRL3 complex activation, we

first tested whether the G-Sb ckr domain equivalent (G-Sb(ckr))

may also bind to and activate this complex in cell culture. Inter-

estingly, coIP assays in S2 cells revealed that G-Sb(ckr) can also

bind to Klhl10 and Cul3T (Figures S5A and S5B). Moreover,

similar to A-Sb(ckr), G-Sb(ckr) was also sufficient to activate the

CRL3 complex in S2 cells, inducing Cyt-c-d ubiquitination under

concentrations of G-Sb(ckr) which are reminiscent of those of

A-Sb(ckr) (Figure S5C). Given the inability of the full-length G-Sb

to substitute for the loss A-Sb in spermatids, these findings sug-

gest that other sequences outside of the A-Sb ckr domain may

also be essential for CRL3 complex activation in vivo.

The A-SbT N-Terminal Domain, but Not Its UniqueC-Terminal Tail or the G-Sb N-Terminal Domain, Is AlsoRequired for CRL3-Induced Caspase Activation andSpermatid IndividualizationTo investigate the structural basis for the functional differences

between A-SbT and G-Sb in spermatids, we performed domain

swapping between these two proteins followed by functional

rescue analysis in A-Sbcc/Df mutant background. The first two

rescue constructs were designed to identify which of the two

main domains of A-SbT is responsible for its unique function

(E) PK protection assay with mitochondrial testis fractions from transgenic flies e

mutant. An anti-HA antibody was used to reveal the expressed transgenic prot

mitochondrial and cytosolic fractions, respectively. The corresponding quantifica

the loading controls).

See also Figure S5.

in vivo. For this, the N-terminal domain of A-Sb was fused to

the ckr domain of G-Sb, and vice versa, and both hybrid proteins

also contained the unique A-SbT C-terminal tail (Figures 6A, V

and VI). On the other hand, to examine the significance of the

unique A-SbT C-terminal tail, termed A-Sb(C-term), for the function

of this protein in spermatids, two additional constructs were

designed. One construct was solely composed of the A-SbSprotein sequence, which lacks the A-Sb(C-term), whereas the

other construct contained the G-Sb protein sequence fused to

the A-Sb(C-term) (Figures 6A, VII and VIII). The resulting protein se-

quences were placed under the control of the A-Sb promoter

and 50 and 30 UTRs, and four transgenic lines were generated.

To equalize other possible parameters that may strongly affect

protein expression levels, these transgenes were generated

similarly to the parental transgenes (i.e., the full-length A-SbTandG-Sb; Figures 6A, III and IV) and inserted at the same defined

site of the Drosophila genome. Since all the transgenes con-

tained an HA-tag at the C terminus, the relative expression levels

were determined using an anti-HA antibody, revealing only mild

variations in the expression levels of these transgenic proteins in

spermatids (Figure 6B).

Analyzing the ability of these transgenes to restore caspase

activation, spermatid individualization, and fertility in A-Sbcc/Df

mutant males, revealed that only constructs III, V, and VII were

able to restore all these three phenotypic traits, indicating that

the N-terminal domain of A-SbT is uniquely important for its spe-

cial role in spermatids (Figures 6C and 6D). Furthermore, consis-

tent with the cell culture binding assays and ubiquitination

studies, the ckr domains of A-Sb and G-Sb are also functionally

interchangeable in vivo, whereas the unique A-SbT C-terminal

tail appears to be dispensable for the function of the protein in

spermatids (Figures 6C and 6D). Similarly, the unique A-SbTcysteine was also dispensable for this testis-specific function,

as construct VII, which restored fertility in the A-SbT mutant,

does not contain this residue. Of note, amild increase in caspase

activation levels was recorded in mutant spermatids expressing

constructs IV, VI, and VIII, but this was not sufficient to trigger

individualization and restore fertility in these flies (Figure 6D).

Collectively, these results indicate that although the ckr domain

is sufficient to bind to and activate the CRL3 complex in cell cul-

ture, additional sequences residing at the N-terminal domain are

equally important to assure the appropriate Krebs-cycle-inde-

pendent function of A-Sb in spermatids.

The finding that the A-Sb N-terminal domain, which is not

required for binding to the CRL3 complex, still has a crucial

role in promoting the non-metabolic function of A-SbT in sperma-

tids, prompted us to explore possible effects on the subcellular

localization of the protein. For this, testis mitochondrial fractions

from transgenic flies expressing the A-SbT and G-Sb parental

rescue constructs (Figures 6A, III and IV) were subjected to a

PK protection assay. Similar to the endogenous A-SbT (Fig-

ure 5C), transgenic A-SbT was also abundant in the mitochon-

drial fraction and highly sensitive to PK proteolysis (Figure 6E).

xpressing the A-SbT and G-Sb rescue constructs in the background of A-SbTeins, while the ATPsyn-a and the b-tubulin served as loading controls for the

tions are presented in graphs, showing the transgenic protein levels (relative to


Figure 7. An Integrated Model of Spatio-

temporal Restriction of the CRL3-Induced

Caspase Activation in Spermatids

(A) An illustration of a single spermatid during the

process of individualization. Different spermatidal

components (i.e., organelles and proteins) are

color coded and indicated at the bottom left.

Note that the tail end-to-sperm head descending

gradient of the CRL3’s pseudosubstrate inhibitor,

Soti (red), also reflects the dBruce protein gradient,

whereas the complementary gradient (sperm

head-to-tail end) of activated caspases (green)

also represents the active CRL3 complex gradient.

The inset provides an enlarged illustration of the

small white rectangular region, depicting the

axoneme (purple) attached to the two mitochon-

drial derivatives (sky blue), the Soti protein (red

speckles), as well as the caspase activation source

(green speckles) at the vicinity of the mitochondria.

(B and C) Illustrations of the CRL3 complex

OFF/ON states, respectively.

See also Figure S4.

In contrast, not only was transgenic G-Sb less abundant in the

mitochondria and more abundant in the cytosol compared with

transgenic A-SbT, it was also almost insensitive to PK treatment

(Figure 6E). Importantly, after PK treatment, the transgenic A-SbTmitochondrial levels were similar to the transgenic G-Sb mito-

chondrial levels with and without treatment, suggesting that

both proteins accumulate to similar levels in the inner mitochon-

drial compartment (i.e., the matrix), while A-SbT, but not G-Sb,

has the ability to also accumulate at the mitochondrial surface

(Figure 6E). Finally, note that the level of the PK-sensitive trans-

genic A-SbT portion is about 45%, which is in high agreement

with the levels of the mitochondrial surface portion of A-SbT re-

vealed by the immuno-EM (compare Figures 6E and 5E). Taken

together, these results indicate a crucial requirement of mito-

chondrial surface localization of A-SbT in spermatids, which is

likely embodied in the N-terminal domain of this protein.

DISCUSSION

An Integrated Model for Restricted Caspase Activationin SpermatidsIn this work, we uncovered a mode of CRL3 complex regulation

during the caspase-dependent process of spermatid individual-

ization in Drosophila (Figure 7A). According to this model, A-Sb

binds to and activates a fraction of the CRL3 complex at the sur-

face of the (two) spermatids’ mitochondrial derivatives, thereby

restricting activation of this complex and the consequent activa-

tion of caspases to the vicinity of the mitochondria (see inset in

Figure 7A). When overexpressed in the Drosophila eye, A-Sb

enhanced the CRL3 complex-induced small eye phenotype,

suggesting that the photoreceptor cells may be more sensitive

than spermatids to apoptosis induction through CRL3 com-

plex-mediated caspase activation. This may be due to the natu-

ral anatomical differences between these two cell types, such as

length (2-mm-long spermatids versus photoreceptor cells that

reach to the length of 80 mm) and/or molecular differences,

such as differences in the expression levels of caspase inhibitory

proteins. Quantification of the levels of the CRL3 complex in the

mitochondrial fraction suggests that approximately 40% of this


complex is associated with the mitochondria at any given time,

implying that this mechanism may limit the rate of caspase

activation in spermatids at least by 60%. Given our current find-

ings that the stoichiometry of the CRL3 complex components is

important for its activation, and the notion that CRL complexes

form dimers andmultimers in vivo (Chew et al., 2007; Wimuttisuk

and Singer, 2007; Tang et al., 2007), aswell as the finding that the

level of a caspase activator in spermatids, Cyt-c-d, is restricted

by this complex (L.R., L.A., and E.A., unpublished data), we

believe that the efficiency of this mechanism in limiting the

source of caspase activation is probably even higher.

Previous work from our lab demonstrated that activation of

the CRL3 complex and consequent caspase activation is also

restricted in time (Kaplan et al., 2010). This is primarily mediated

by a tail end-to-sperm head gradient of Soti, a pseudosubstrate

inhibitor of the CRL3 complex, which competes with true sub-

strates for binding to the complex (red in Figure 7A). Importantly,

Soti and A-Sb display an antagonistic interplay, in which binding

of A-Sb to the CRL3 complex leads to the detachment of Soti

from Klhl10, possibly as a result of conformational change in

the CRL3 complex, thus allowing binding of true substrates,

such as the IAP, dBruce, to the CRL3 complex (Figures 7B and

7C). Upon ubiquitination by the complex, dBruce is redistributed

in a tail end-to-sperm head descending gradient, which leads to

activation of caspases in an opposite graded fashion (green in

Figure 7A). The fact that individualization is a dynamic process

in which activated caspases are extruded together with the cyto-

plasmic contents in a sperm head-to-tail end direction indicates

that spermatidal regions that are the first to individualize (low

Soti/A-Sb ratio) encounter the highest levels of caspase activity

but for the shortest time, whereas the regions that are the last to

individualize (high Soti/A-Sb ratio) experience the lowest levels of

caspase activity but for the longest time. Ultimately, this spatio-

temporal restriction mechanism ensures that each spermatidal

region encounters relatively low levels of caspase activity insuf-

ficient to trigger apoptosis but sufficient to facilitate proper

removal of the cytoplasmic contents. This fine balance of cas-

pase activity levels is crucial for male fertility, as either too low

levels (CRL3 inactivation) or too high levels (Soti and dBruce

inactivation) of caspase activity can lead to individualization

failure, unwanted cell death in the latter case, and male sterility

(Arama et al., 2003, 2006, 2007; Kaplan et al., 2010).

It is noteworthy that several observations in different experi-

mental systems support the notion that caspase activity may

be restricted in space and/or time during vital non-apoptotic

cellular processes, albeit the underlying mechanisms remain

largely vague (Feinstein-Rotkopf andArama, 2009). For example,

transient caspase activation has been observed during differen-

tiation of erythrocytes (Droin et al., 2008), lens fiber cells (Bass-

nett, 2009), and PC12 cells (Rohn et al., 2004) and is required

for LTD and AMPA receptor internalization in hippocampal

neurons (Li et al., 2010), while compartmentalized expression of

active caspases has been noted during platelet formation in

megakaryocytes (De Botton et al., 2002) and for active cas-

pase-8 during T cell activation (Koenig et al., 2008). Likewise, in

addition to restriction in space and time, compartmentalized acti-

vation of caspases was also reported in the Drosophila sperm

individualization system. In particular, it was shown that the

caspase activator, Hid, and the apoptosome components, Ark

and Dronc, as well as the apoptosome activator, Tango7, are

all localized in the vicinity of the advancing IC (Huh et al., 2004;

D’Brot et al., 2013). This may indicate another layer of caspase

regulation in thisprocess, inwhich spermatids utilize lowcaspase

activity throughout the cell during the individualization process

through the CRL3 complex mechanism, whereas in order to

locally increase caspase activity, spermatids utilize additional

activation factors but in a compartmentalized manner (i.e., Hid

and Tango7). Interestingly, Cullin-3 was also shown to further

increase caspase activation in mammalian cells by promoting

polyubiquitination of caspase-8, which leads to its aggregation,

processing, and full protease activation (Jin et al., 2009). Taken

together, this growingbodyof evidence suggests that harnessing

caspase activity for vital cellular processes may be much more

abundant than has been previously appreciated, and that cells

can tolerate low to moderate levels of caspase activity, as long

as this activity is below the threshold required for cell-death in-

duction (Florentin and Arama, 2012).

The Role of the Mitochondria for Caspase Activation inSpermatids and a Possible Link to Cell MetabolismBeing at the core of the intrinsic apoptotic pathway, mitochon-

dria have emerged as central regulators of apoptosis, providing

a reservoir for pro-apoptotic protein factors, such as cyto-

chrome c (Wang, 2001; Soriano and Scorrano, 2010; Martinou

and Youle, 2011), which is also required for caspase activation

during spermatid individualization (Arama et al., 2003, 2006;

Huh et al., 2004). However, the current study uncovers another

caspase regulatory role of the spermatid mitochondria in limiting

the rate of caspase activation by compartmentalizing the source

of activation to its surface. Interestingly, protein sequestration to

mitochondrial surfaces was also suggested for the C. elegans

Bcl-2-like protein, CED-9, and the Apaf-1-like cell-death acti-

vator, CED-4. In living cells, full activation of the caspase

(CED-3) through binding to CED-4 is prevented via the seques-

tration of CED-4 to themitochondrial surface by CED-9, whereas

following apoptosis induction, CED-4 assumes a perinuclear

localization and local activation (Chen et al., 2000; Pourkarimi

et al., 2012).

It is intriguing to hypothesize that the use of a bona fide mito-

chondrial metabolic enzyme subunit such as A-Sb to promote

key molecular activities (e.g., CRL3 complex activation), may

link between the metabolic state of the cells and the induction

of fundamental cellular processes (e.g., spermatid terminal

differentiation). According to this model, A-Sb may function as

a sensor of the cell metabolic state, allowing progression to

the terminal differentiation stage only when the spermatids fulfill

the metabolic requirements. How this sensing feature may work

requires a more comprehensive study of additional metabolic

enzymes, such as other components of the Krebs cycle and

the respiratory chain. It is interesting to note that a mitochondrial

surface tethering of another CRL3 complex substrate adaptor

protein, Keap1, and its substrate, the transcription factor Nrf2,

has been also reported in human cells. Tethering of Keap1 is

mediated by binding to phosphoglycerate mutase 5 (PGAM5),

which belongs to a family of metabolic enzymes usually involved

in glucose homeostasis, and is thought to facilitate coordination

between mitochondrial function and regulation of Nrf2-depen-

dent anti-oxidant gene expression by allowing proper ubiquiti-

nation and degradation of Nrf2 (Lo and Hannink, 2008). On the

other hand, it is of high interest to note that regulation of the

CRL3 complex is not the only non-traditional function suggested

for A-Sb inDrosophila. Previous reports proposed two additional

distinct roles of A-Sb outside of the mitochondria, albeit the

exact mechanisms of these actions remained vague. In cultured

cells, A-Sb was shown to bind to and modulate the activity of a

voltage-gated KCNQ potassium channel on the cell plasma

membrane (Gao et al., 2008). Furthermore, as mentioned in the

Results section, A-Sb was also found to bind to Skp1 on centro-

somal microtubules and regulate centrosome duplication during

mitosis in embryos (Hughes et al., 2008). Significantly, this may

suggest that regulation of CRL complexes may be a more gen-

eral function of A-Sb, as Skp1 and BTB domains, which assume

similar 3D folds (Stogios et al., 2005), are found in hundreds

of different CRL complexes. Therefore, A-Sb may represent a

multifunctional protein, which could mediate several different

cellular processes in eukaryotic cells, perhaps providing a link-

age between these processes and cellular metabolism.

The Moonlighting Function of A-SbMoonlighting proteins are special multifunctional proteins that

performmultiple autonomous, often unrelated, functions without

partitioning these functions into different protein domains (Hu-

berts and van der Klei, 2010). This group contains enzymes, re-

ceptors, transmembrane channels, chaperones, and ribosomal

proteins that have multiple functions. Some of these proteins

are mitochondrial enzymes that have mitochondrial roles and

additional unrelated roles, such as the electron transport chain

protein and the apoptosome assembly inducer, cytochrome c

(Jeffery, 2003; Copley, 2003).

Our findings suggest that A-Sb also constitutes amoonlighting

protein, functioning both in the Krebs cycle and as an activator of

the CRL3 complex. At this point, it is still unclear how A-Sb alter-

nates between the two mitochondrial compartments (i.e., the

matrix and outer membrane surface), as both the somatic and

testis-specific isoforms possess identical N-terminal mitochon-

drial targeting sequence (MTS), and both could rescue the ste-

rility phenotypes associated with the A-SbT mutant. Moreover,


although the long isoform contains a unique, 51 aa C-terminal

tail, this region alone is insufficient to drive mitochondrial surface

localization, implying the involvement of other mechanisms (L.A.,

C.B., E.A., data not shown). These mechanisms likely involve the

A-Sb N-terminal domain, since as opposed to the interchange-

able ckr domain, the G-Sb N-terminal domain failed to rescue

the sterility phenotypes associated with the A-SbT mutant, and

a transgenic G-Sb expressed could not localize to the spermatid

mitochondrial surface.

The phenomenon whereby one protein can be localized to

several subcellular compartments, including the mitochondria,

has previously been documented in eukaryotic cells and termed

dual targeting, dual localization, or dual distribution (Karniely and

Pines,2005;YogevandPines,2011).Several dual targetingmech-

anisms have been proposed. For example, cytochrome P450

phosphorylation determines whether it will be localized to the

mitochondria or the ER, whereas the Krebs cycle enzyme, fuma-

rase, is localized to either themitochondria or the cytosol in yeast,

based on its folding point (Sass et al., 2003). Interestingly, when

transfected into S2 cells, an additional, slightly slower, migrating

band of A-Sb is detected by western blotting, which also resides

on the mitochondria but is much more sensitive to PK treatment

than the faster migrating band, suggesting the involvement of a

post-translationalmodification in the direction of A-Sb to themito-

chondrial surface (L.A., C.B., E.A., data not shown).

EXPERIMENTAL PROCEDURES

Fly Strains, Expression Constructs, and Transgenes

All fly strains were grown at 25�C. yw flies were used as wild-type controls. All

fly strains and the generation of all the expression constructs and transgenes

mentioned in this study are described in detail in the Supplemental Experi-

mental Procedures.

RNA Isolation and RT-PCR

Total RNA was extracted by using the Micro-to-Midi Total RNA Purification

System (Invitrogen) according to the manufacturer’s recommendations. The

RNA was stored at �80�C or immediately utilized for RT-PCR reactions as

detailed in the Supplemental Experimental Procedures.

Mitochondrial Fractionation fromTestis and S2Cells andProteinase

K Protection Assay

100 testes dissected from young adults or 48 hr post-transfected S2 cells were

used to prepare extracts in 100 ml of cold HIM buffer (200mMmannitol, 70 mM

sucrose, 10mMHEPES, 1mMEGTA, pH to 7.5with KOH supplementedwith a

cocktail of protease inhibitors [1:100; P8340; Sigma]). Samples were homog-

enized using a Pellet Pestle Motor (Kontes) on ice for 3 3 20 sec, followed by

centrifugation at 3,000 rpm for 8 min at 4�C. The supernatant was collected

and centrifuged at 12,500 rpm for 25 min at 4�C and separated to the concen-

trated cytosolic fraction (sup) and concentrated mitochondrial fraction (pellet).

The initial pellet was subjected to further homogenizing in 300 ml of cold HIM

buffer on ice, centrifuged at 3,000 rpm for 8 min at 4�C, and the supernatant

was centrifuged once again at 12,500 rpm for 25 min at 4�C. 100 ml of HIM

buffer was added to the pellet and mixed with the concentrated mitochondrial

fraction. Total protein concentration was determined by the Bradford method.

Sample buffer was added and the samples were boiled for 8 min. 5–10 mg of

each sample was loaded on an SDS-PAGE gel.

The PK protection assay was performed with mitochondrial fractions gener-

ated from 150 testes. The mitochondrial pellet was re-suspended in 300 ml of

SEM buffer (250 mM sucrose, 10 mM MOPS/KOH, 2.5 mM EDTA) and was

equally divided into three Eppendorf tubes, to which different PK concentra-

tions were added (0, 5, and 10 mg/ml). Samples were incubated at 4�C for

20 min. The reaction was stopped with 1 mM phenylmethylsulfonyl fluoride,

and the samples were centrifuged at 12,500 rpm for 10 min at 4�C. The pellet


was re-suspended in HIM buffer containing 1 mM phenylmethylsulfonyl

fluoride, and re-centrifuged at 12,500 rpm for 10 min at 4�C. The pellet was

re-suspended in 50 ml of HIM buffer, sample buffer was added, and the sam-

ples were boiled for 8 min and loaded on an SDS-PAGE gel.

Immunoprecipitation Experiments in S2 Cells

S2 cells were grown in standard Schneider’s Drosophila medium (Biological

Industries) supplemented with 10% fetal bovine serum (GIBCO). Cells (5 3

106 per 5 ml flask) were transfected using the Escort- IV reagent (Sigma-

Aldrich) according to the manufacturer’s instructions. Cells were lysed 48 hr

post-transfection in NP-40 buffer (10 mM HEPES [pH 7.4], 1 mM MgCl2,

100 mM NaCl, 1% Igepal CA-360, and protease inhibitor mix). Extracts were

incubated overnight at 4�C with Dynabeads conjugated to Protein G (Dynal,

Invitrogen), bound to mouse monoclonal anti-Flag antibody (Sigma) or to rab-

bit polyclonal anti-GFP antibody (ab290; Abcam) or tomouse anti-HA antibody

(HA.11 clone 16B12; Covance). The beads were washed, and bound proteins

were eluted by boiling in sample buffer and subjected to western blotting.

Ubiquitination Assay

S2 cells at 6 hr post-transfection were treated with 25 mM Z-VAD-FMK (Enzo

Life Sciences), and further treated with 5 mM Velcade (Selleckchem) with or

without 20 mM MG132 (Sigma-Aldrich) at 32 hr post-transfection for an addi-

tional 16 hr. Cells were then harvested and lysed by boiling for 5 min in SDS

buffer (2% SDS, 20 mM EDTA, 50 mM Tris [pH 8.0], 20 mM DTT, 20 mM

N-ethylmaleimide (NEM), and a mix of protease inhibitors). The lysates were

diluted 1/12 in TNN buffer (50 mM Tris [pH 7.5], 120 mM NaCl, 5 mM EDTA,

0.5% Igepal CA-360, 1 mM DTT, 20 mM NEM, and a protease inhibitor mix),

sonicated, and centrifuged. The supernatants were immunoprecipitated using

mouse anti-HA antibody (HA.11 clone 16B12; Covance) overnight at 4�C. Afterthree washes with TNN buffer, bound proteins were eluted by boiling in SDS-

PAGE loading buffer and subjected to western blotting.

Western Blotting and Antibodies

70 testes from young adult males were used to prepare extracts in 60 ml of HIM

buffer. Samples were homogenized and sonicated. Total protein concentra-

tion in the supernatant was determined, and 18 mg of each sample was loaded

on an SDS-PAGE gel. The ImageQuantTL software (GE Healthcare) was used

to quantify band intensities, and the levels were normalized as described in the

specific figure legends. The specific antibodies used for immunoblotting are

described in the Supplemental Experimental Procedures.

Immunofluorescence Staining and Antibodies

Young (0–2 days old) adult testes were dissected and stained either opened or

closed as described in Arama et al. (2007). More details about the staining of

the closed testes and the antibodies used in this study are found in the Supple-

mental Experimental Procedures.

DEVDase Activity Assay

150–180 testes from each genotype were homogenized, and the DEVDase ac-

tivity was detected using the Caspase-Glo 3/7 reagent (Promega) essentially

as described in Arama et al. (2007). More details are found in the Supplemental

Experimental Procedures.

Preparation of Samples for Immunogold Labeling and Electron

Microscopy Analysis

Testes were dissected from newly eclosed A-SbT-GFPR-BAC and DJ-GFP

transgenic flies. See further details of sample preparations and analyses in

the Supplemental Experimental Procedures.

Preparation of Eye Images

Heads of 0- to 2-day-old young females were disconnected from the body us-

ing a scalpel and cut again on a slide to separate the two eyes. We examined

30–50 eyes for each genotype. Images were obtained using a stereo micro-

scope (MZ16F; Leica) connected to a DS-Fi1 camera (Nikon).

Y2H Assay and Constructs

The Y2H binding assay was carried out as generally described in Arama et al.

(2007) and Kaplan et al. (2010). Generation of the bait constructs, Cul3T, Cul3S,

TeNC, and the Klhl10 prey construct was as described in Arama et al. (2007).

The A-Sb(ckr) prey construct was isolated in the original Y2H screen with Cul3Tas bait (Arama et al., 2007).

Sequence Alignment and Domain Analysis

The alignment between the A-Sb and G-Sb protein sequences was done using

EMBOSS Stretcher. The MitoProt algorithm was used to predict the A-Sb

domains.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Supplemental Experimental Procedures

and five figures and can be found with this article online at http://dx.doi.org/

10.1016/j.devcel.2016.02.025.

AUTHOR CONTRIBUTIONS

L.A. and E.A. conceived and designed the experiments, analyzed the data, and

wrote the paper. L.A. performed and/or participated in all the experiments.

T.B. participated in the experiments shown in Figures 3H, 3I, 5D, 5E, 6, and

S1. C.B. participated and helped with the experiments shown in Figures 1E,

1F, 2, 3E–3G, 4C, 4D, 5A, 6C, S2C–S2E, S3A, S3B, S4, and S5. Y.K. performed

the experiments shown in Figures 1D, 2, 3A–3G, 4C, and S3C. L.R. generated

the Cyt-c-d related constructs and advised on some of the experiments. S.L.Z.

participated in the experiments shown in Figures 5D and 5E.

ACKNOWLEDGMENTS

We are grateful to Hugo J. Bellen, Johannes Bischof, Shari Carmon,

Cheng-Ting Chien, Lilach Gilboa, Ruth Lehmann, Irwin B. Levitan, Paul M.

MacDonald, Catherine Rabouille, Ben-Zion Shilo, Allan C. Spradling,

James G. Wakefield, Mariana F. Wolfner, Shaul Yogev, Yehudit Zaltsman-

Amir, the Vienna Drosophila RNAi Center (VDRC), the Drosophila Genomics

Resource Center (DGRC; NIH grant 2P40OD010949-10A1), and the Bloo-

mington Stock Center for providing additional stocks and reagents. We are

grateful to Koen J.T. Venken for his advice on the recombineering method.

We thank the Arama laboratory members for encouragement and advice,

and in particular, Lama Tarayrah for her comments on the manuscript. We

note the rotation students, Noam Kadouri, Lia Yerushalmi, and Leore Geller,

and the summer student, Emmanuelle Kuperminc, for helping to carry out ex-

periments. We thank Genia Brodsky and Keren Katzav from the WIS Graphic

Design Department for help with the graphic illustrations, and Ofra Golani

from the Bioinformatics Unit in the Biological Services at the WIS for help

with statistical analysis of the immuno-EM quantifications. We warmly thank

Samara Brown for editing the first version of this manuscript. This research

was supported by grants from the European Research Council under the Eu-

ropean Union’s Seventh Framework Programme (FP/2007-2013)/ERC grant

agreement (616088), the Minerva Foundation with funding from the German

Federal Ministry of Education and Research, the Israel Science Foundation

(921/13), and the Ministry of Agriculture of the State of Israel. E.A. is also

supported by internal grants from the Y. Leon Benoziyo Institute for Molec-

ular Medicine, the Moross Institute for Cancer Research, and the Yeda-Sela

Center for Basic Research. E.A. is the Incumbent of the Harry Kay Profes-

sional Chair of Cancer Research.

Received: October 6, 2014

Revised: February 3, 2016

Accepted: February 25, 2016

Published: March 24, 2016

REFERENCES

Abraham, M.C., and Shaham, S. (2004). Death without caspases, caspases

without death. Trends Cell Biol. 14, 184–193.

Arama, E., Agapite, J., and Steller, H. (2003). Caspase activity and a specific

cytochrome C are required for sperm differentiation in Drosophila. Dev. Cell

4, 687–697.

Arama, E., Bader, M., Srivastava, M., Bergmann, A., and Steller, H. (2006). The

two Drosophila cytochrome C proteins can function in both respiration and

caspase activation. EMBO J. 25, 232–243.

Arama, E., Bader, M., Rieckhof, G.E., and Steller, H. (2007). A ubiquitin ligase

complex regulates caspase activation during sperm differentiation in

Drosophila. PLoS Biol. 5, e251.

Bassnett, S. (2009). On the mechanism of organelle degradation in the verte-

brate lens. Exp. Eye Res. 88, 133–139.

Bazinet, C., and Rollins, J.E. (2003). Rickettsia-like mitochondrial motility in

Drosophila spermiogenesis. Evol. Dev. 5, 379–385.

Berg, J.M., Tymoczko, J.L., and Stryer, L. (2002). The citric acid cycle. In

Biochemistry (W H Freeman).

Bosu, D.R., and Kipreos, E.T. (2008). Cullin-RING ubiquitin ligases: global

regulation and activation cycles. Cell Div. 3, 7.

Bridger, W.A., Wolodko, W.T., Henning, W., Upton, C., Majumdar, R., and

Williams, S.P. (1987). The subunits of succinyl-coenzyme A synthetase–

function and assembly. Biochem. Soc. Symp. 54, 103–111.

Carlile, G.W., Smith, D.H., and Wiedmann, M. (2004). Caspase-3 has a nona-

poptotic function in erythroid maturation. Blood 103, 4310–4316.

Chen, F., Hersh, B.M., Conradt, B., Zhou, Z., Riemer, D., Gruenbaum, Y., and

Horvitz, H.R. (2000). Translocation ofC. elegans CED-4 to nuclear membranes

during programmed cell death. Science 287, 1485–1489.

Chew, E.H., Poobalasingam, T., Hawkey, C.J., and Hagen, T. (2007).

Characterization of cullin-based E3 ubiquitin ligases in intact mammalian

cells–evidence for cullin dimerization. Cell Signal. 19, 1071–1080.

Copley, S.D. (2003). Enzymes with extra talents: moonlighting functions and

catalytic promiscuity. Curr. Opin. Chem. Biol. 7, 265–272.

Crawford, E.D., and Wells, J.A. (2011). Caspase substrates and cellular re-

modeling. Annu. Rev. Biochem. 80, 1055–1087.

D’Brot, A., Chen, P., Vaishnav, M., Yuan, S., Akey, C.W., and Abrams, J.M.

(2013). Tango7 directs cellular remodeling by the Drosophila apoptosome.

Genes Dev. 27, 1650–1655.

De Botton, S., Sabri, S., Daugas, E., Zermati, Y., Guidotti, J.E., Hermine, O.,

Kroemer, G., Vainchenker, W., and Debili, N. (2002). Platelet formation is the

consequence of caspase activation within megakaryocytes. Blood 100,

1310–1317.

Deshaies, R.J., Emberley, E.D., and Saha, A. (2010). Control of cullin-ring ubiq-

uitin ligase activity by nedd8. Subcell. Biochem. 54, 41–56.

Droin, N., Cathelin, S., Jacquel, A., Guery, L., Garrido, C., Fontenay, M.,

Hermine, O., and Solary, E. (2008). A role for caspases in the differentiation

of erythroid cells and macrophages. Biochimie 90, 416–422.

Duda, D.M., Scott, D.C., Calabrese, M.F., Zimmerman, E.S., Zheng, N., and

Schulman, B.A. (2011). Structural regulation of cullin-RING ubiquitin ligase

complexes. Curr. Opin. Struct. Biol. 21, 257–264.

Fabrizio, J.J., Hime, G., Lemmon, S.K., and Bazinet, C. (1998). Genetic dissec-

tion of sperm individualization in Drosophila melanogaster. Development 125,

1833–1843.

Feinstein-Rotkopf, Y., and Arama, E. (2009). Can’t live without them, can live

with them: roles of caspases during vital cellular processes. Apoptosis 14,

980–995.

Florentin, A., and Arama, E. (2012). Caspase levels and execution efficiencies

determine the apoptotic potential of the cell. J. Cell Biol. 196, 513–527.

Fraser, A.G., McCarthy, N.J., and Evan, G.I. (1997). drICE is an essential cas-

pase required for apoptotic activity in Drosophila cells. EMBO J. 16, 6192–

6199.

Fraser, M.E., James, M.N., Bridger, W.A., and Wolodko, W.T. (1999). A

detailed structural description of Escherichia coli succinyl-CoA synthetase.

J. Mol. Biol. 285, 1633–1653.

Fraser, M.E., James, M.N., Bridger, W.A., and Wolodko, W.T. (2000).

Phosphorylated and dephosphorylated structures of pig heart, GTP-specific

succinyl-CoA synthetase. J. Mol. Biol. 299, 1325–1339.

Fuchs, Y., and Steller, H. (2011). Programmed cell death in animal develop-

ment and disease. Cell 147, 742–758.




http://refhub.elsevier.com/S1534-5807(16)30080-6/sref1




































































Fuller, M.T. (1993). Spermatogenesis in Drosophila. In The Development of

Drosophila melanogaster, M. Bate and A.M. Arias, eds. (Cold Spring Harbor

Laboratory Press), pp. 71–147.

Gao, L., Fei, H., Connors, N.C., Zhang, J., and Levitan, I.B. (2008). Drosophila

ortholog of succinyl-CoA synthetase {beta} subunit: a novel modulator of

Drosophila KCNQ channels. J. Neurophysiol. 99, 2736–2740.

Genschik, P., Sumara, I., and Lechner, E. (2013). The emerging family of

CULLIN3-RING ubiquitin ligases (CRL3s): cellular functions and disease impli-

cations. EMBO J. 32, 2307–2320.

Hermann, R., Walther, P., and Muller, M. (1996). Immunogold labeling in scan-

ning electron microscopy. Histochem. Cell Biol. 106, 31–39.

Huberts, D.H., and van der Klei, I.J. (2010). Moonlighting proteins: an intriguing

mode of multitasking. Biochim. Biophys. Acta 1803, 520–525.

Huesmann, G.R., and Clayton, D.F. (2006). Dynamic role of postsynaptic

caspase-3 and BIRC4 in zebra finch song-response habituation. Neuron 52,

1061–1072.

Hughes, J.R., Meireles, A.M., Fisher, K.H., Garcia, A., Antrobus, P.R.,

Wainman, A., Zitzmann, N., Deane, C., Ohkura, H., and Wakefield, J.G.

(2008). A microtubule interactome: complexes with roles in cell cycle and

mitosis. PLoS Biol. 6, e98.

Huh, J.R., Vernooy, S.Y., Yu, H., Yan, N., Shi, Y., Guo,M., and Hay, B.A. (2004).

Multiple apoptotic caspase cascades are required in nonapoptotic roles for

Drosophila spermatid individualization. PLoS Biol. 2, E15.

Ishizaki, Y., Jacobson, M.D., and Raff, M.C. (1998). A role for caspases in lens

fiber differentiation. J. Cell Biol. 140, 153–158.

Jeffery, C.J. (2003). Moonlighting proteins: old proteins learning new tricks.

Trends Genet. 19, 415–417.

Jiang, X., andWang, X. (2004). CytochromeC-mediated apoptosis. Annu. Rev.

Biochem. 73, 87–106.

Jin, Z., Li, Y., Pitti, R., Lawrence, D., Pham, V.C., Lill, J.R., and Ashkenazi, A.

(2009). Cullin3-based polyubiquitination and p62-dependent aggregation of

caspase-8 mediate extrinsic apoptosis signaling. Cell 137, 721–735.

Johnson, J.D., Mehus, J.G., Tews, K., Milavetz, B.I., and Lambeth, D.O. (1998).

Genetic evidence for the expression of ATP- and GTP-specific succinyl-CoA

synthetases in multicellular eucaryotes. J. Biol. Chem. 273, 27580–27586.

Kaplan, Y., Gibbs-Bar, L., Kalifa, Y., Feinstein-Rotkopf, Y., and Arama, E.

(2010). Gradients of a Ubiquitin E3 ligase inhibitor and a caspase inhibitor

determine differentiation or death in spermatids. Dev. Cell 19, 160–173.

Karniely, S., and Pines, O. (2005). Single translation–dual destination: mecha-

nisms of dual protein targeting in eukaryotes. EMBO Rep. 6, 420–425.

Kirkin, V., McEwan, D.G., Novak, I., and Dikic, I. (2009). A role for ubiquitin in

selective autophagy. Mol. Cell 34, 259–269.

Koenig, A., Russell, J.Q., Rodgers, W.A., and Budd, R.C. (2008). Spatial differ-

ences in active caspase-8 defines its role in T-cell activation versus cell death.

Cell Death Differ. 15, 1701–1711.

Kuo, C.T., Zhu, S., Younger, S., Jan, L.Y., and Jan, Y.N. (2006). Identification of

e2/e3 ubiquitinating enzymes and caspase activity regulating Drosophila

sensory neuron dendrite pruning. Neuron 51, 283–290.

Kuranaga, E., and Miura, M. (2007). Nonapoptotic functions of caspases:

caspases as regulatory molecules for immunity and cell-fate determination.

Trends Cell Biol. 17, 135–144.

Lambeth, D.O., Tews, K.N., Adkins, S., Frohlich, D., and Milavetz, B.I. (2004).

Expression of two succinyl-CoA synthetaseswith different nucleotide specific-

ities in mammalian tissues. J. Biol. Chem. 279, 36621–36624.

Lamkanfi, M., Festjens, N., Declercq, W., Vanden, B.T., and Vandenabeele, P.

(2007). Caspases in cell survival, proliferation and differentiation. Cell Death

Differ. 14, 44–55.

Launay, S., Hermine, O., Fontenay, M., Kroemer, G., Solary, E., andGarrido, C.

(2005). Vital functions for lethal caspases. Oncogene 24, 5137–5148.

Lettre, G., and Hengartner, M.O. (2006). Developmental apoptosis in

C. elegans: a complex CEDnario. Nat. Rev. Mol. Cell Biol. 7, 97–108.


Li, Z., Jo, J., Jia, J.M., Lo, S.C., Whitcomb, D.J., Jiao, S., Cho, K., and Sheng,

M. (2010). Caspase-3 activation via mitochondria is required for long-term

depression and AMPA receptor internalization. Cell 141, 859–871.

Lo, S.C., and Hannink, M. (2008). PGAM5 tethers a ternary complex containing

Keap1 and Nrf2 to mitochondria. Exp. Cell Res. 314, 1789–1803.

Martinou, J.C., and Youle, R.J. (2011). Mitochondria in apoptosis: Bcl-2 family

members and mitochondrial dynamics. Dev. Cell 21, 92–101.

Merlet, J., Burger, J., Gomes, J.E., and Pintard, L. (2009). Regulation of cullin-

RING E3 ubiquitin-ligases by neddylation and dimerization. Cell Mol. Life Sci.

66, 1924–1938.

Muro, I., Berry, D.L., Huh, J.R., Chen, C.H., Huang, H., Yoo, S.J., Guo, M.,

Baehrecke, E.H., and Hay, B.A. (2006). The Drosophila caspase Ice is impor-

tant for many apoptotic cell deaths and for spermatid individualization, a

nonapoptotic process. Development 133, 3305–3315.

Nikolaev, A., McLaughlin, T., O’Leary, D.D., and Tessier-Lavigne, M. (2009).

APP binds DR6 to trigger axon pruning and neuron death via distinct caspases.

Nature 457, 981–989.

Noguchi, T., and Miller, K.G. (2003). A role for actin dynamics in individualiza-

tion during spermatogenesis in Drosophila melanogaster. Development 130,

1805–1816.

Petroski, M.D., and Deshaies, R.J. (2005). Function and regulation of cullin-

RING ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 6, 9–20.

Pintard, L., Willems, A., and Peter, M. (2004). Cullin-based ubiquitin ligases:

cul3-BTB complexes join the family. EMBO J. 23, 1681–1687.

Politi, Y., Gal, L., Kalifa, Y., Ravid, L., Elazar, Z., and Arama, E. (2014). Paternal

mitochondrial destruction after fertilization is mediated by a common endo-

cytic and autophagic pathway in Drosophila. Dev. Cell 29, 305–320.

Pourkarimi, E., Greiss, S., and Gartner, A. (2012). Evidence that CED-9/Bcl2

and CED-4/Apaf-1 localization is not consistent with the current model for

C. elegans apoptosis induction. Cell Death Differ. 19, 406–415.

Raff, M.C., Whitmore, A.V., and Finn, J.T. (2002). Axonal self-destruction and

neurodegeneration. Science 296, 868–871.

Rohn, T.T., Cusack, S.M., Kessinger, S.R., and Oxford, J.T. (2004). Caspase

activation independent of cell death is required for proper cell dispersal and

correct morphology in PC12 cells. Exp. Cell Res. 295, 215–225.

Salvesen, G.S. (2002). Caspases and apoptosis. Essays Biochem. 38, 9–19.

Salvesen, G.S., and Abrams, J.M. (2004). Caspase activation - stepping on the

gas or releasing the brakes? Lessons from humans and flies. Oncogene 23,

2774–2784.

Santel, A., Blumer, N., Kampfer, M., and Renkawitz-Pohl, R. (1998). Flagellar

mitochondrial association of the male-specific Don Juan protein in

Drosophila spermatozoa. J. Cell Sci. 111, 3299–3309.

Sass, E., Karniely, S., and Pines, O. (2003). Folding of fumarase during mito-

chondrial import determines its dual targeting in yeast. J. Biol. Chem. 278,

45109–45116.

Shi, Y. (2002). Apoptosome: the cellular engine for the activation of caspase-9.

Structure 10, 285–288.

Song, Z., McCall, K., and Steller, H. (1997). DCP-1, a Drosophila cell death

protease essential for development. Science 275, 536–540.

Soriano, M.E., and Scorrano, L. (2010). The interplay between BCL-2 family

proteins and mitochondrial morphology in the regulation of apoptosis. Adv.

Exp. Med. Biol. 687, 97–114.

Steller, H. (2008). Regulation of apoptosis in Drosophila. Cell Death Differ. 15,

1132–1138.

Stogios, P.J., Downs, G.S., Jauhal, J.J., Nandra, S.K., and Prive, G.G. (2005).

Sequence and structural analysis of BTB domain proteins. Genome Biol. 6,

R82.

Tang, X., Orlicky, S., Lin, Z., Willems, A., Neculai, D., Ceccarelli, D., Mercurio,

F., Shilton, B.H., Sicheri, F., and Tyers, M. (2007). Suprafacial orientation of the

SCFCdc4 dimer accommodates multiple geometries for substrate ubiquitina-

tion. Cell. 129, 1165–1176.



























































































































Tokuyasu, K.T., Peacock,W.J., and Hardy, R.W. (1972). Dynamics of spermio-

genesis in Drosophila melanogaster. I. Individualization process. Z. Zellforsch.

Mikrosk. Anat. 124, 479–506.

Venken, K.J., Carlson, J.W., Schulze, K.L., Pan, H., He, Y., Spokony, R., Wan,

K.H., Koriabine, M., de Jong, P.J., White, K.P., et al. (2009). Versatile P[acman]

BAC libraries for transgenesis studies in Drosophila melanogaster. Nat.

Methods 6, 431–434.

Wang, X. (2001). The expanding role of mitochondria in apoptosis. Genes Dev.

15, 2922–2933.

Willems, A.R., Schwab, M., and Tyers, M. (2004). A hitchhiker’s guide to the

cullin ubiquitin ligases: SCF and its kin. Biochim. Biophys. Acta 1695, 133–170.

Williams, D.W., Kondo, S., Krzyzanowska, A., Hiromi, Y., and Truman, J.W.

(2006). Local caspase activity directs engulfment of dendrites during pruning.

Nat. Neurosci. 9, 1234–1236.

Wimuttisuk, W., and Singer, J.D. (2007). The Cullin3 ubiquitin ligase functions

as a Nedd8-bound heterodimer. Mol. Biol. Cell. 18, 899–909.

Wu, J.T., Chan, Y.R., and Chien, C.T. (2006). Protection of cullin-RING E3

ligases by CSN-UBP12. Trends Cell Biol. 16, 362–369.

Yi, C.H., and Yuan, J. (2009). The Jekyll and Hyde functions of caspases. Dev.

Cell 16, 21–34.

Yogev, O., and Pines, O. (2011). Dual targeting of mitochondrial proteins:

mechanism, regulation and function. Biochim. Biophys. Acta 1808, 1012–

1020.

Youle, R.J., and Narendra, D.P. (2011). Mechanisms of mitophagy. Nat. Rev.

Mol. Cell Biol. 12, 9–14.

Yuan, J., Shaham, S., Ledoux, S., Ellis, H.M., and Horvitz, H.R. (1993). The

C. elegans cell death gene ced-3 encodes a protein similar to mammalian

interleukin-1 beta-converting enzyme. Cell 75, 641–652.

Zermati, Y., Garrido, C., Amsellem, S., Fishelson, S., Bouscary, D., Valensi, F.,

Varet, B., Solary, E., and Hermine, O. (2001). Caspase activation is required for

terminal erythroid differentiation. J. Exp. Med. 193, 247–254.

































Developmental Cell, Volume 37

Supplemental Information

A Krebs Cycle Component Limits Caspase Activation

Rate through Mitochondrial Surface

Restriction of CRL Activation

Lior Aram, Tslil Braun, Carmel Braverman, Yosef Kaplan, Liat Ravid, SmadarLevin-Zaidman, and Eli Arama

Supplemental Information

Inventory of Supplementary Materials:

Figure S1, related to Figure 1. A-Sβ forms a complex with Cul3T and Klhl10 in cell

culture and in spermatids

Figure S2, related to Figure 2. A-SβT is mainly expressed in the testis, while in

contrast A-SβS is mainly expressed in the soma

Figure S3, related to Figure 4. In vivo and in vitro CRL3 complex activation requires

A-Sβ

Figure S4, related to Figure 7. A-S antagonizes Soti binding to the CRL3 complex

Figure S5, related to Figure 6. G-Sβ(ckr) can bind to and activate the CRL3 complex in

cell culture

Supplemental Experimental Procedures

Supplemental References

SUPPLEMENTAL INFORMATION

Figure S1. A-Sβ forms a complex with Cul3T and Klhl10 in cell culture and in

spermatids, related to Figure 1

(A) S2 cells were transfected with one or more of the following constructs: Flag-

tagged Cul3T, Flag-tagged Klhl10 and/or HA-tagged A-Sβ(ckr). The cells were also

transfected with a CD8-GFP construct (to control for transfection efficiency). A-

Sβ(ckr) was immunoprecipitated using an anti-HA antibody and the presence of

transfected proteins were confirmed using the corresponding anti-HA, anti-Flag, and

anti-GFP antibodies.

(B) Quantification of the protein levels in (A) relative to the GFP levels.

(C) Testes from flies expressing either the A-SβT-GFP or the DJ-GFP transgenes were

subjected to a gel mobility retardation assay. The blot was sequentially exposed to

anti-Cul3 (I), anti-Klhl10 (II) and anti-GFP (III) antibodies to reveal the proteins

indicated at the left.

Figure S2. A-SβT is mainly expressed in the testis, while in contrast A-SβS is

mainly expressed in the soma, related to Figure 2

(A) Schematic structure of the exon-intron organization of the two main A-Sβ

isoforms in Drosophila. The isoforms differ in their 5’ UTR exons, as well as in the

addition of two alternative exons in A-SβT; an exon coding for a single cysteine (“C”)

and an exon containing coding sequences for the unique testis-specific C-term region

and noncoding 3’ UTR region. Exons are depicted by thick black (coding) and gray

(UTRs) bars and introns are indicated by thin lines. The relative position of the P

element insertion used to generate the A-Sβ hypomorphic mutant is indicated by a

purple line. The locations of the primers used in the comparative RT-PCR

experiments in (C, D) are indicated by arrows.

(B) Schematic structure of the two predicted A-Sβ protein isoforms. The unique 51

a.a. C-terminal region and the additional cysteine residue of the long isoform are

indicated in dark blue and the letter “C”, respectively. The relative location of the 153

a.a. Cul3T/Klhl10 interacting region (“ckr”) is shown in pink. Note that the “ckr”

domain is found in both of the isoforms and that it does not encompass the unique C-

terminal region and the cysteine.

(C, D) Comparative RT-PCR analysis of A-SβT versus A-SβS expression in testes from

control RNAi flies (cont_IR), A-Sβ germ cell-specific knockdown flies (A-Sβ_IR), A-

Sβ mutants (A-Sβcc/Df), and male progeny of oskar mutant females (germ cell-less

male reproductive tracts). The above primers (arrows in A), to amplify either a 342-bp

A-SβT fragment or a 286-bp A-SβS fragment, were added to one reaction master-mix.

The reaction was stopped at different cycle points to identify the linear amplification

phase. Note that the relative expression levels of A-SβT (strong; black asterisks) and

A-SβS (weak; red asterisks) in the cont_IR testis are switched in the A-Sβ_IR testis

where the RNAi is specifically targeted to the germ cells. In contrast, in the A-Sβ

mutant testis, which affects both isoforms, the long isoform still prevails.

Consistently, A-SβT but not A-SβS is completely abrogated in the germ cell-less

reproductive tracts.

(E) The protein levels of the two A-Sβ isoforms were assessed by Western blotting of

protein extracts from wild-type (wt), A-Sβ mutant, and A-Sβ germ cell-specific

knockdown testes using the anti-A-Sβ antibody. Note that whereas the expression

levels of both A-SβT and A-SβS (black and red asterisks, respectively) are affected in

the mutant testes, only the long isoform expression is reduced in the knockdown flies.

β-tubulin protein levels served as loading control.

Figure S3. In vivo and in vitro CRL3 complex activation requires A-Sβ, related to

Figure 4.

(A) Mitochondrial testis fractions from flies expressing a control RNAi (cont_IR) or

an A-Sβ RNAi (A-Sβ_IR) transgenes (under the control of the bam-Gal4 driver), as

well as cul3T mutant flies (cul3mds1) and cul3T and A-Sβ double mutant flies. The blot

was sequentially exposed to several antibodies to reveal the endogenous proteins

indicated at the left. The corresponding quantifications of Klhl10 and the activated

(neddylated; “Nedd”) versus inactivated (unneddylated; “Unnedd”) Cul3T protein

levels in the blot are shown in the graphs. Note the Klhl10 stabilization in the

mitochondrial fraction of the cul3T mutant testis (lane 3; indicating lack of auto-

ubiquitination activity) and the significant reduction in the Klhl10 levels when A-SβT

is further knocked down (lane 4; demonstrating the requirement of A-Sβ for the auto-

ubiquitination activity). ATPsyn-α, an inner mitochondrial membrane protein;

GAPDH, a cytosolic protein.

(B) Mitochondrial testis fractions from flies expressing a control RNAi (cont_IR) or

an A-Sβ RNAi (A-Sβ_IR) transgenes (under the control of the bam-Gal4 driver), as

well as cul3T (cul3mds1) and klhl10 (klhl103) mutant flies. The blot was sequentially

exposed to several antibodies to reveal the endogenous proteins indicated at the left.

Note that in the testes from the klhl10 mutant (lane 4) the upper (neddylated) band of

Cul3T is missing, as no CRL3 complex is assembled.

(C) Klhl10 overexpression-derived small eye phenotype (I) requires the endogenous

Cul3S, but not the Cul3T, isoform, as indicated by the suppression of this phenotype in

flies heterozygous for the cul3S lethal allele (cul3gft06430; II), but not in the cul3T

heterozygotes (cul3mds1; III). Note that this is consistent with our previous results

demonstrating that Cul3T is testis-specific and that Cul3S can also bind to Klhl10, but

with less efficiency.

Figure S4. A-S antagonizes Soti binding to the CRL3 complex, related to

Figure 7

Competition assays in S2 cells transfected with GFP-tagged Soti, Klhl10, Cul3T, and

increasing levels of HA-tagged A-Sβ(ckr). The amounts of transfected A-Sβ(ckr) are

indicated in micrograms. An anti-GFP antibody was used to immunoprecipitate Soti,

and the indicated proteins at the right were revealed using the corresponding

antibodies in Western blotting. The quantifications (of lanes 5-9) at the bottom

represents the Klhl10, Cul3T, and A-Sβ(ckr) protein levels relative to the Soti-GFP

levels. Note that transfection with already the lowest tested level of A-Sβ(ckr) caused a

50% drop in the level of the Soti-bound Klhl10 (and Cul3T), which suggests that

binding of A-Sβ may activate the CRL3 complex by inter alia displacing Soti, the

pseudosubstrate inhibitor of this complex.

Figure S5. G-Sβ(ckr) can bind to and activate the CRL3 complex in cell culture,

related to Figure 6

(A, B) Co-IP assays with Flag-tagged (A) Klhl10 and (B) Cul3T and either A-Sβ(ckr)

or G-Sβ(ckr). S2 cells were cotransfected with one or more of the indicated constructs

(top left), as well as CD8-GFP for transfection efficiency control. Both the

immunoprecipitates (IP) and the corresponding preincubated lysates (Input) were

analyzed by immunoblotting (IB) to reveal the proteins indicated at the right (using

the corresponding antibodies).

(C) Ubiquitination experiments performed as described in Figure 4D. Note that the G-

Sβ “ckr” equivalent domain (G-Sβ(ckr)) is as efficient as A-Sβ(ckr) in promoting CRL3-

mediated Cyt-c-d ubiquitination, and that both polypeptides most efficiently function

in the lower tested concentration levels.

Supplemental Experimental Procedures

Fly strains

Fly mutant and transgenic alleles used in this study are as follows: bam-Gal4 (this line

was always used as a combination of two copies of the driver, one on the X and one

on the 3rd chromosome, together with one copy of UAS-dicer recombined on the 3rd

chromosome) was generated by crossing lines obtained from L. Gilboa (WIS, Israel)

and M. Wolfner (Cornell University, USA); oskar mutant alleles, osk301 and oskCE4,

from R. Lehmann (NYU School of Medicine, NY); UASTattB-EGFP from B. Z. Shilo

(WIS, Israel); UAS-A-Sβ_RNAi (KK105350) and UAS-non-specific_RNAi

(KK103120; control) from the Vienna Drosophila RNAi Center (VDRC). Additional

lines are described in the following papers: P{PTT-GC}A-Sβcc06238 (Morin et al.,

2001); Df(3R)osk (Reveal et al., 2010); cul3mds1, cul3gft06430 and klhl103 (Arama et al.,

2007); GMR-Gal4 on the X chromosome (Hirose et al., 2001); UASTattB-Cul3T and

UASTattB-Klhl10 (Kaplan et al., 2010); DJ-GFP (Bazinet and Rollins, 2003).

Expression constructs and transgenes

The BDGP EST clones were all purchased from the Drosophila Genomics Resource

Center (DGRC). To generate the UAS-A-Sβ(ckr) and UAS-A-Sβ(ckr)-HA, a 459 bp

fragment containing the A-Sβ(ckr) was PCR amplified from BDGP’s EST clone

GH10480 (forward primer with added EcoRI site

CCGGAATTCATGCTGGATGGCACTATCGGCTG, and reverse primers with

added XhoI site CGGAGCTCGAGTTACTTTTGGGCATCGGGAATC or

GGGCTCGAGTTACGCATAGTCAGGAACATCGTATGGGTACTTTTGGGCAT

CGGGAATC; the HA tag is underlined) and subcloned into the corresponding sites of

the pUASTattB vector (a gift from Johannes Bischof).

To generate the UAS-G-Sβ(ckr) and UAS-G-Sβ(ckr)-HA, a 399 bp fragment was PCR

amplified from BDGP’s EST Clone LD44970 (forward primer with added BglII site

CGCAGATCTATGATGGATGGCAACATTGGCTG, and reverse primers with

added XhoI site GGGCTCGAGCTAATTAAGGGCTGCCACAGCCTTG or

GGGCTCGAGTTACGCATAGTCAGGAACATCGTATGGGTAATTAAGGGCTG

CCACAGCCTTG; the HA tag is underlined) and subcloned into the corresponding

sites of the pUAST vector.

For the UAS-A-SβT, the ORF of A-SβT (a 1512 bp fragment) was PCR amplified from

EST clone GH10480 (forward primer CCGGAATTCATGGCTTCATTCTTGGCAC,

reverse primer CGGAGCTCGAGTTACTTTTTACCTTTCTTTTC, with added

EcoRI and XhoI sites, respectively) and subcloned into the corresponding sites of the

pUASTattB vector.

For the UAS-cul3T-Flag, the ORF of cul3T (a 2805 bp fragment) was PCR amplified

from BDGP’s EST clone AT07783 (forward primer

GCAGAATTCATGCAAGGCCGCGATCCCCG, reverse primer

CGATGGTACCTTACTTGTCATCGTCATCCTTGTAATCGGCCAAGTAGTTGT

ACAC, with added EcoRI and Acc65I sites, respectively; the Flag tag is underlined)

and subcloned into the corresponding sites of the pUASTattB vector.

For the UAS-klhl10-Flag, the ORF of klhl10 (a 2304 bp fragment) was PCR amplified

from BDGP’s EST clone AT19737 (forward primer

GCCGAATTCATGAGTCGTAATCAAAACG, reverse primer

AGGGGGTACCCTACTTGTCATCGTCATCCTTGTAATCTGTACGACGACGAA

TTTC with added EcoRI and Acc65I sites, respectively; the Flag tag is underlined)

and subcloned into the corresponding sites of the pUASTattB vector.

To generate UAS-HA-cyt-c-d, the ORF of cyt-c-d (a 318 bp fragment) was PCR

amplified from EST clone LP05614 (forward primer

TAGGGAATTCATGTACCCATACGATGTTCCTGACTATGCGGGTTCTGGTGA

TGCAGAGAACG, reverse primer

TAGGGGTACCCTACTTGTTTGACTTGAGGAAG with added EcoRI and Acc65I

sites, respectively; the HA tag is underlined) and subcloned into the corresponding

sites of the pUASTattB vector.

Generation of the bait Klhl10 construct for Y2H

To generate the bait Klhl10 construct, the entire Klhl10 ORF was PCR amplified from

BDGP’s EST clone AT19737 (forward primer

GCGGAATTCAGTCGTAATCAAAACGAAAG, reverse primer

GCCCTGCAGCTATGTACGACGACGAATTT, with attached EcoRI and PstI sites,

respectively) and cloned into the corresponding sites of the pGBKT7 vector, in frame

to N-terminal Gal4-binding domain.

Generation of the rescue constructs for domain swapping

To generate the 5’3’ A-SβT:A-SβT-HA and 5’3’ A-SβT:G-Sβ-HA rescue constructs, a

500 bp fragment containing the 5' UTR and upstream promoter region of A-SβT was

PCR amplified from genomic DNA (forward primer

CGGGGGATCCGTGATCACGTTTTTTTTGTC and reverse primer

CAGACAATTGTTTGTTCTGAAATCGAATGAG with added BamHI and MunI

sites, respectively), and subcloned into the BamHI + EcoRI sites of the pattB vector.

A-SβT 3' UTR fragment (200 bp) was PCR amplified from the BDGP’s EST clone

GH10480 (forward primer

CCCCGGCCGAGGGATACAAATTTTGTAATAAACAATG and reverse primer

GGGGGGTACCCATAAATATTATGAAAATCTTTAAAAATG with added EagI

and Acc65I sites, respectively) and subcloned into the corresponding sites of the pattB

vector containing the promoter and 5' UTR insert. The ORFs of A-SβT-HA (a 1512 bp

fragment) and G-Sβ-HA (a 1251 bp fragment) were PCR amplified from BDGP’s EST

clones GH10480 and LD44970, respectively (for A-SβT-HA, forward primer

AGCGTTAACATGGCTTCATTCTTGGCACGAACTGGCG and reverse primer

GGGCGGCCGTTACGCATAGTCAGGAACATCGTATGGGTACTTTTTACCTTT

CTTTTCGC; for G-Sβ-HA, forward primer

GACGTTAACATGTCGTTCCTACTGAAAGC and reverse primer

TTGCGGCCGTTACGCATAGTCAGGAACATCGTATGGGTAATTAAGGGCTG

CCACAGCCT, with added HpaI and EagI sites, respectively; the HA tag is

underlined) and subcloned into the corresponding sites of the pattB vector in between

the 5' and 3' UTRs.

To generate the 5’3’ A-SβT:A-SβS-HA rescue construct, a 1356 bp fragment containing

the A-SβS was PCR amplified from pcDNA3-SCSβ (Gao et al., 2008) (forward primer

with added HpaI site AGCGTTAACATGGCTTCATTCTTGGCACGAACTGGCG,

and reverse primers with added EagI site

TTCCGGCCGTTACGCATAGTCAGGAACATCGTATGGGTACTTTTGGGCATC

GGGAATCT; the HA tag is underlined) and subcloned into the corresponding sites of

the pattB vector in between the 5' and 3' UTRs of A-SβT.

To generate the 5’3’ A-SβT:G-Sβ(N-term)/A-Sβ(ckr)/A-Sβ(C-term)-HA construct, two PCR

fragments were amplified; a 880 bp fragment containing G-Sβ(N-term) was PCR

amplified from BDGP’s EST Clone LD44970 (forward primer with added HpaI site

GACGTTAACATGTCGTTCCTACTGAAAGC, and reverse primer that contained

21 nucleotides from the end of G-Sβ(N-term) and 23 nucleotides from the beginning of

A-Sβ(ckr) ATGCAGCCGATAGTGCCATCCAGGGCGACGTAGTTCAGATTGTA),

and a 671 bp fragment containing the A-Sβ(ckr)/A-Sβ(C-term) was PCR amplified from

BDGP’s EST clone GH10480 (forward primer that was complementary to the reverse

primer that was used in the PCR of the first fragment, and reverse primer with added

EagI site

GGGCGGCCGTTACGCATAGTCAGGAACATCGTATGGGTACTTTTTACCTTT

CTTTTCGC; the HA tag is underlined). The two fragments were combined together

and PCR amplified in order to obtain the 1464 bp fragment of G-Sβ(N-term)/A-Sβ(ckr)/A-

Sβ(C-term)-HA (the forward primer which was the one used for the PCR of the first

fragment and the reverse primer which was used for the PCR of the second fragment)

and subcloned into the corresponding restriction sites of the pattB vector in between

the 5' and 3' UTRs of SCS.

For the 5’3’ A-SβT:A-Sβ(N-term)/G-Sβ(ckr)/A-Sβ(C-term)-HA rescue construct, we used the

restriction-free (RF) cloning method. A 456 bp fragment containing the G-Sβ(ckr) was

PCR amplified from BDGP’s EST Clone LD44970 (forward primer which contained

30 nucleotides from the end of A-Sβ(N-term) and 31 nucleotides from the beginning of

G-Sβ(ckr)

GCTGCCAAATACAATCTGAACTACATTGCCATGGATGGCAACATTGGCTG

CTTGGTTAATG, and reverse primer that contained 32 nucleotides from the end of

G-Sβ(ckr) and 31 nucleotides from the beginning of A-Sβ(C-term)

GTTTTTGATCTTTCTTGCAATCGCCCTTGCCATTAAGGGCTGCCACAGCCT

TGTGGGCGGCAT). This fragment was used as a mega-primer for an additional

PCR in which the plasmid 5’3’ A-SβT:A-SβT-HA served as template, in order to obtain

the 5’3’ A-SβT:A-Sβ(N-term)/G-Sβ(ckr)/A-Sβ(C-term)-HA construct.

To generate the 5’3’ A-SβT:G-Sβ(N-term)/G-Sβ(ckr)/A-Sβ(C-term)-HA construct we also used

the restriction-free (RF) cloning method. A 298 bp fragment containing the A-Sβ(C-term)

was PCR amplified from BDGP’s EST clone GH10480 (forward primer that

contained 36 nucleotides from the end of G-Sβ(ckr) and 25 nucleotides from the

beginning of A-Sβ(C-term)

GATGATGCCGCCCACAAGGCTGTGGCAGCCCTTAATCACTTGGCGCAAAT

CGTCAAACTGG, and reverse primer that contained 27 nucleotides from the end of

A-Sβ(C-term) and 35 nucleotides from the 3’ UTR of 5’3’ A-SβT:G-Sβ-HA construct

GGCCGTTACGCATAGTCAGGAACATCGTATGGGTACTTTTTACCTTTCTTT

TCGCAAATGTC; the HA tag is underlined). This fragment was used as a mega-

primer for an additional PCR in which the plasmid 5’3’ A-SβT:G-Sβ-HA served as

template, in order to obtain the 5’3’ A-SβT:G-Sβ(N-term)/G-Sβ(ckr)/A-Sβ(C-term)-HA

construct.

The following constructs are described in (Kaplan et al., 2010): pUAS-cul3T, pUAS-

klhl10, pUAS-soti-GFP, pAct5c-3xFlag-Ub, pUAST-Roc1a, pUAST-CD8-GFP and

pAct5-Gal4 (the latter 2 constructs were respectively used to control for transfection

efficiency and induce expression in S2 cells in all the experiments). All the transgenic

flies were generated by micro-injection into embryos performed by BestGene Inc.

Tagging genomic A-SβT with GFP using the recombineering technique

A-SβT-GFPR-BAC was generated using the recombineering technique as generally

described in (Venken et al., 2006; Venken et al., 2009). In short, a “targeting” (PCR)

fragment, containing the GFP and a kanamycin selection marker sequences flanked by

A-Sβ homology sequences, was inserted just prior to the stop codon of A-SβT within

the 24 kb BACPAC genomic clone CH322-19P9 (BACPAC resources), which

includes the A-SβT gene and two additional flanking genes. The following primers

were used to amplify the “targeting” (PCR) fragment from the pL452 C-EGFP

plasmid (Addgene), which added two 50 bp flanking A-Sβ homology sequences used

in the subsequent recombineering process: forward primer:

AAAAGAAAAAGGAAGAAAAGAAAGACATTTGCGAAAAGAAAGGTAAAA

AGGCAGCCCAATTCCGATCATATTC, reverse primer:

CACATCCGGCTCGATCCTGCATTGTTTATTACAAAATTTGTATCCCTTTATT

ACTTGTACAGCTCGTCCATG. Recombineering of the “Targeting” (PCR)

fragment with the A-Sβ BACPAC clone (found in attB-P[acman]-CmR-BW) followed

by floxing of the kanamycin resistance gene (in a Cre producing bacteria; a gift from

Stephen P. Creekmore, NCI-Frederick), resulted in the insertion of an in frame EGFP

at the C’ terminus of A-Sβ. To obtain transgenic lines, the resulting A-SβT-GFPR-BAC

construct was then micro-injected into embryos containing the attP40 landing site

(BestGene Inc.)

RNA isolation and RT-PCR

20 testes were collected in 1.5 ml Eppendorf tubes, standing on ice and containing

300 μl of the Invitrogen kit’s lysis buffer with 3 μl of 2-mercaptoethanol,

homogenized using a Pellet Pestle Motor (Kontes), and subsequently purified using

the Micro-to-Midi Total RNA Purification System (Invitrogen) kit.

Purified RNA was reversed transcribed using the One Step RT-PCR kit (Qiagen). A

Biometra TGradient PCR machine was programmed as follows: 50°C for 30 min for

the RT step followed by 94°C for 2 min, and the amplification steps of 94°C for 30

sec, 55°C for 30 sec, 68°C for 1 min. A master-mix was prepared and aliquoted to

five tubes, each of which was amplified for 17, 20, 25, 30, or 35 cycles.

Comparative RT-PCR reactions were performed using three primers in a same

reaction mix, a common forward primer (CTGGACTGAAGATTCTGGCCC) and

two different reverse primers for A-SβT (GTCTCAAACACATCCGGCTCG) and for

A-SβS (GCTCTAACTACGAACCGATGGC).

Immunofluorescence staining and antibodies

For staining of “closed” testis, dissected testes were immediately moved into ice-cold

fix solution (4% paraformaldehyde [PFA] diluted in PBS) within a glass well plate

positioned on ice. Following the dissections, the fixated testes were incubated for 20

minutes at room temperature, rinsed three times for 10 minutes with PBX (PBS with

0.1% Triton-X), blocked with PBS/BSA (1% BSA in PBS) for 45-60 minutes at room

temperature, and incubated with primary antibody (diluted in PBS/BSA) overnight at

4°C. Testes were then rinsed in PBX, incubated with secondary antibody for one hour

at room temperature, rinsed again and mounted in Vectashield mounting medium with

DAPI (Vector Laboratories).

The antibodies used in this study to detect cleaved caspase-3 are either a rabbit

polyclonal anti-cleaved Caspase-3 antibody (Asp175, Cell Signaling Technology;

1:100) or a rabbit polyclonal anti-cleaved-Drosophila Dcp1 antibody (Asp 216, Cell

Signaling Technology; 1:100). Rabbit anti-A-Sβ antibody (anti-Skap; (Hughes et al.,

2008); 1:125), and anti-Rabbit secondary antibody (Jackson Immuno-Research;

1:250). Phalloidin-TRITC (Sigma, 1:500) was used to label F-actin (i.e. the IC).

DEVDase activity assay

150-180 testes were dissected from newly eclosed wild-type, cul3mds1 homozygous or

bam::A-Sβ_IR flies, collected into 1.5 ml standard eppendorf tubes, standing on ice

and containing 90 μl of testis buffer (as described in (Arama et al., 2007)),

homogenized using a Pellet Pestle Motor (Kontes), and subsequently transferred into

three new tubes (30:30:10 μl). The tubes with 10 μl of the testes extracts were used

for Western blot analysis to control for the protein amount in the samples by probing

with mouse anti β-tubulin. Either Z-VAD-FMK (20 μM final concentration) or

DMSO was added to each of the 30 μl tubes, and the samples were transferred to a

96-well assay white plate (BD Falcon, 96 flat plate), and allowed to incubate for 10

min at RT. Caspase-Glo 3/7 reagent (Promega) was added to a final volume of 200 μl

and the signal was detected with a multiwell plate reader (Infinite M200 PRO,

NEOTEC Bio). The plate was rotated for 10 sec in 295.5 rpm (6 mm amplitude) and

the luminescence readings were obtained every 2 minutes. Three experiments were

performed that gave similar results.

Antibodies used in Western blotting

The following antibodies were used for immunoblotting in this study: mouse anti-

Drosophila β-tubulin (clone E7, Hybridoma Bank; 1:1000), Rabbit anti-GFP (ab290,

Abcam; 1:1000), mouse anti-HA (HA.11 clone 16B12, Covance; 1:1000), mouse anti-

Cul3 (BD Transduction Laboratories; 1:1000), rabbit anti-HA (Sigma-Aldrich;

1:1000), mouse anti-Flag (clone M2, Sigma-Aldrich; 1:1000), rat anti-Drosophila

Klhl10 (generated in this study, 1:1000), rabbit anti-A-Sβ (anti-Skap; (Hughes et al.,

2008); 1:500), mouse anti-ATPsynthase-α (anti-ATP5A, MitoSciences, 1:10000),

rabbit anti-GAPDH (IMGENEX, 1:500), rabbit anti-Nedd8 ((Chan et al., 2008);

1:5000), rabbit anti-Sec16 ((Ivan et al., 2008), 1:2000), mouse anti-Ub (P4D1, Santa

Cruz, 1:500). All secondary antibodies were used in a dilution of 1:10000 (Jackson

Immuno-Research).

Immunogold labeling and electron microscopy analysis

Dissected testes were fixed in 4% paraformaldehyde with 0.1% glutaraldehyde in 0.1

M cacodylate buffer (pH�=�7.4) for 1 hour at room temperature, and kept at 4°C

ON. The samples were soaked ON in 2.3 M sucrose and rapidly frozen in liquid

nitrogen. Frozen ultrathin (70-90 nm) sections were cut with a diamond knife at -

120°C on a Leica EM UC6 ultramicrotome. The sections were collected on 200-mesh

Formvar coated nickel grids and blocked with a solution containing 1% BSA, 0.1%

glycine, 0.1% gelatin, and 1% Tween 20. Immuno-labeling was performed ON at 4°C

using affinity purified anti-GFP antibody (1:50, ab6556, Abcam), followed by washes

in PBS with 0.1% glycine, and exposure to goat anti-Rabbit IgG coupled to 10-nm

gold particles (1∶20, Jackson Immuno-Research) for 30 min at RT. Contrast staining

and embedding were performed as previously described in (Tokuyasu, 1986). The

embedded sections were viewed and photographed with a FEI Tecnai SPIRIT (FEI,

Eidhoven, Netherlands) transmission electron microscope operated at 120 kV, and

equipped with an EAGLE CCD Camera. These studies were conducted at the Irving

and Cherna Moskowitz Center for Nano and Bio-Nano Imaging at the Weizmann

Institute of Science.

Generation of the anti-Klhl10 antibody

A DNA fragment encoding the C-terminal portion of the Klhl10 protein (W373-Stop)

was PCR amplified from BDGP’s EST clone AT19737 (forward primer

CCCGAATTCTGGGTAACCATTAACGCAGAGG, reverse primer

GCGCGGCCGCCTATGTACGACGACGAATTTC, with added EcoRI and NotI

sites, respectively), and cloned into the corresponding sites of the pGEX-4T-1 vector,

in frame to the N-terminal GST tag. This C-terminal portion of Klhl10, which spans

most of the Kelch domain, is completely absent in the klhl103 mutant due to a

premature stop codon (Arama et al., 2007). The expression of the GST-Klhl10

(W373-stop) polypeptide was induced by IPTG induction for 1 hour in BL21(DE3).

To raise polyclonal antibodies against this polypeptide, the protein was purified under

native conditions using Glutathione-agarose (Sigma) and injected into rats.

Gel mobility retardation assay

270 testes were dissected out from young adult flies and chemically cross-linked in 1

% Formaldehyde in PBS for 10 minutes in RT. The cross-linker was quenched by the

addition of 1.25 mM Glycine for 5 minutes in RT. Samples were homogenized and

centrifuged at 13,000 rpm for 15 minutes at 4oC. The pellet was suspended in SDS

buffer (60 mM Tris [pH 6.8], 2 % SDS) and incubated for 3 minutes at 65oC. 950 μl

of NP-40 buffer (10 mM HEPES [pH 7.4], 1 mM MgCl2, 100 mM NaCl, 1% Igepal

CA-360, and protease inhibitor mix) were added to the solution and the samples were

shaken for 2 hours at 4oC. Sample buffer was added and the samples were boiled for 8

minutes and loaded on an SDS-PAGE gradient gel.

Supplemental References

Arama,E., Bader,M., Rieckhof,G.E., and Steller,H. (2007). A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in Drosophila. PLoS Biol 5, e251.

Bazinet,C. and Rollins,J.E. (2003). Rickettsia-like mitochondrial motility in Drosophila spermiogenesis. Evol. Dev. 5, 379-385.

Chan,Y., Yoon,J., Wu,J.T., Kim,H.J., Pan,K.T., Yim,J., and Chien,C.T. (2008). DEN1 deneddylates non-cullin proteins in vivo. J. Cell Sci. 121, 3218-3223.

Gao,L., Fei,H., Connors,N.C., Zhang,J., and Levitan,I.B. (2008). Drosophila ortholog of succinyl-CoA synthetase {beta} subunit: a novel modulator of Drosophila KCNQ channels. J Neurophysiol. 99, 2736-2740.

Hirose,F., Ohshima,N., Shiraki,M., Inoue,Y.H., Taguchi,O., Nishi,Y., Matsukage,A., and Yamaguchi,M. (2001). Ectopic expression of DREF induces DNA synthesis, apoptosis, and unusual morphogenesis in the Drosophila eye imaginal disc: possible interaction with Polycomb and trithorax group proteins. Mol. Cell Biol. 21, 7231-7242.

Hughes,J.R., Meireles,A.M., Fisher,K.H., Garcia,A., Antrobus,P.R., Wainman,A., Zitzmann,N., Deane,C., Ohkura,H., and Wakefield,J.G. (2008). A microtubule interactome: complexes with roles in cell cycle and mitosis. PLoS. Biol 6, e98.

Ivan,V., de,V.G., Xanthakis,D., Spoorendonk,K.M., Kondylis,V., and Rabouille,C. (2008). Drosophila Sec16 mediates the biogenesis of tER sites upstream of Sar1 through an arginine-rich motif. Mol. Biol. Cell. 19, 4352-4365.

Kaplan,Y., Gibbs-Bar,L., Kalifa,Y., Feinstein-Rotkopf,Y., and Arama,E. (2010). Gradients of a Ubiquitin E3 Ligase Inhibitor and a Caspase Inhibitor Determine Differentiation or Death in Spermatids. Dev. Cell 19, 160-173.

Morin,X., Daneman,R., Zavortink,M., and Chia,W. (2001). A protein trap strategy to detect GFP-tagged proteins expressed from their endogenous loci in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 98, 15050-15055.

Reveal,B., Yan,N., Snee,M.J., Pai,C.I., Gim,Y., and Macdonald,P.M. (2010). BREs mediate both repression and activation of oskar mRNA translation and act in trans. Dev. Cell 18, 496-502.

Tokuyasu,K.T. (1986). Application of cryoultramicrotomy to immunocytochemistry. J. Microsc. 143, 139-149.

Venken,K.J., Carlson,J.W., Schulze,K.L., Pan,H., He,Y., Spokony,R., Wan,K.H., Koriabine,M., de Jong,P.J., White,K.P., Bellen,H.J., and Hoskins,R.A. (2009). Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nat. Methods 6, 431-434.

Venken,K.J., He,Y., Hoskins,R.A., and Bellen,H.J. (2006). P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314, 1747-1751.

AKrebsCycleComponentLimitsCaspaseActivation Rate through ... · Developmental Cell Article A Krebs...

Documents

Transcript of AKrebsCycleComponentLimitsCaspaseActivation Rate through ... · Developmental Cell Article A Krebs...