A Direct Role for Interferon-Alpha in the

Disruption of B Cell Tolerance in Systemic

Lupus Erythematosus

By

Dario Ferri

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Immunology

University of Toronto

© Copyright by Dario Ferri 2019

ii

ABSTRACT

A Direct role for Interferon-Alpha in the Disruption of B Cell Tolerance

in Systemic Lupus Erythematosus

Dario Ferri

Master of Science

Graduate Department of Immunology

University of Toronto

2019

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by the

production of pathogenic anti-nuclear antibodies (ANA). A central mediator of SLE is Interferon-

Alpha (IFNα), which is elevated in the blood of SLE patients. IFNα is thought to contribute to

ANA production indirectly through the activation of T cells and dendritic cells; however, IFNα

has been shown to have a number of direct stimulatory effects on B cells in vitro. This thesis

examined the direct impact of elevated IFNα levels on B cell tolerance mechanisms in vivo. It was

found that the elevation of IFNα alone in murine models of B cell tolerance was associated with

significant increases in autoantibody production and impairment of many B cell tolerance

mechanisms. These results suggest that elevated IFNα levels in SLE patients may directly drive

the production of pathogenic ANA, and highlight IFNα as a potential therapeutic target in this

disease.

iii

ACKNOWLEDGEMENTS

There are several individuals I would like to thank for their time, patience, guidance and

support during my degree. Firstly, I would like to extend a sincere thank you to my supervisor Dr.

Joan Wither for not only supporting me and allowing me to pursue my interests and ideas as a

researcher, but also for helping me to grow professionally, academically, and supporting my career

goals. Dr. Wither’s unbridled commitment to her patients and research program has served as a

major source of inspiration for me, and my time in the lab has had a lasting impact on my life. I

will never forget the guidance and mentorship that I received as a student here.

I am also very appreciative of the Wither lab members, past and present, who have helped

to shape my experience as a graduate student and provided unending support and friendship

throughout my time in the lab. I would like to especially thank Dr. Yuriy Baglaenko and Dr. Kieran

Manion for both serving as amazing role models and sources of inspiration for me early on in my

degree. The work presented in this thesis would not have been possible without their amazing help

and guidance. I would also like to acknowledge Dr. Carolina Munoz-Grajales, whose drive to

improve the lives of patients with rheumatic disease, and commitment to her research and family,

has served as a major source of inspiration for me towards the end of my degree.

Finally, I would like to acknowledge my parents, Fabio and Maria, for supporting me in

my academic and professional goals. All that I have accomplished would not be possible without

your unending love, support, and guidance.

iv

TABLE OF CONTENTS ABSTRACT………………………………………………………………………………............ii

ACKNOWLEDGEMENTS………………………………………………………………………iii

INTRODUCTION……………………………………………………………………………...…1

1 Systemic Lupus Erythematosus…………………………………………………………1

1.1.1 Epidemiology………………………………………………………………..1

1.1.2 Clinical Manifestations……………………………………………………...2

1.2 Genetics, Environment, and Sex Bias…………………………………………………3

1.2.1 Genetic Factors……………………………………………………………...3

1.2.2 Environmental Factors………………………………………………………5

1.2.3 Sex Bias……………………………………………………………………..6

1.3 SLE Therapeutics……………………………………………………………………...7

2 Immune Mechanisms leading to autoantibody production……………………….……..9

2.0.1 Immunopathogenesis of autoantibody production…………………………..9

2.1 Immune Mechanisms limiting autoantibody production…………………………….12

2.1.1 Central Tolerance Mechanisms…………………………………………….12

2.1.2 Peripheral Tolerance Mechanisms…………………………………………14

2.2 Defective Immune Tolerance Mechanisms in SLE………………………………….16

2.2.1 B Cell Defects……………………………………………………………...17

2.2.2 T Cell Defects……………………………………………………………...18

2.2.3 Innate Immunity Defects…………………………………………………...19

3 Type I IFN in SLE……………………………………………………………………..21

4 Mouse Models of B Cell Tolerance……………………………………………………23

v

4.1 HEL Mouse Model of B Cell Anergy……………………………………......23

4.2 3H9 Mouse Model of B Cell Tolerance……………………………...………25

5 Thesis Objectives…………………………………………………………………...….27

MATERIALS AND METHODS………………………………………………………………...29

Mice……………………………………………………………………………………...29

Adenoviral Vectors………………………………………………………………………29

Quantifying serum IFNα and IFIG signature…………………………………………….29

Autoantibody ELISA…………………………………………………………………….30

Flow Cytometry………………………………………………………………………….31

Immunofluorescence……………………………………………………………………..31

Quantitative PCR…………………………………………………………………….......32

Statistics………………………………………………………………………………….33

RESULTS………………………………………………………………………………………..34

Infection with mDEF201 leads to sustained elevation of IFNα in vivo…………………34

Abnormal B Cell homeostasis in 3H9 mice occurs with elevated IFNα levels………….37

Enhanced B cell activation and germinal center formation in 3H9 mice with

elevated IFNα levels……………………………………………………………………..40

Enhanced autoantibody production in 3H9 mice with elevated IFNα levels……………43

Minimal alterations to T cell homeostasis in 3H9 mice following elevated IFNα levels..44

Expansion of pathogenic T and B cell subsets in 3H9 mice with elevated IFNα levels...46

Decreased receptor editing in 3H9 mice following elevated IFNα levels……………….47

Impaired B cell anergy in 3H9 mice following elevated IFNα levels…………………...50

Altered B cell homeostasis in HEL mice following elevated IFNα levels………………54

vi

Disruption of B cell anergy in HEL mice following elevated IFNα levels……………...55

Expansion of pathogenic T, but not B cells, in HEL mice following elevated

IFNα levels……………………………………………………………………………….57

DISCUSSION……………………………………………………………………………………58

REFERENCES…………………………………………………………………………………..70

vii

LIST OF TABLES

Table 1: SLE SUSCEPTIBILITY GENES…………………………………………………..……4

Table 2: ENVIRONMENTAL TRIGGERS FOR SLE…………………………………………...5

Table 3: COMMONLY USED ANTI-INFLAMMATORY SLE THERAPEUTICS…………….8

Table 4: PROMISING SLE BIOLOGIC THERAPEUTICS AND TRIAL STATUS……………8

viii

LIST OF FIGURES Figure I: Classical model of SLE immunopathogenesis…………………………………………11

Figure 1: Elevated serum IFNα and IFNα-induced gene expression following infection with

mDEF201………………………………………………………………………………………...35

Figure 2: Altered B cell homeostasis following elevation of IFNα in B6 mice…………………36

Figure 3: Influence of elevated IFNα on the B cell compartment of 3H9 mice…………………38

Figure 4: Influence of elevated IFNα levels of splenic B cell subsets…………………………...39

Figure 5: Influence of elevated IFNα levels on B cell activation………………………………..40

Figure 6: Influence of elevated IFNα levels on spontaneous germinal center recruitment

in 3H9 mice………………………………………………………………………………………42

Figure 7: Tolerance to nuclear antigens is lost in 3H9 mice with elevation of IFNα……………44

Figure 8: Minimal alterations to the T cell compartment following elevated IFNα in

3H9 mice…………………………………………………………………………………………45

Figure 9: Expansion of pathogenic T and B cell subsets in 3H9 mice following elevation of

IFNα levels……………………………………………………………………………………….47

Figure 10: Decreased frequency of splenic Igλ1+ B cells in 3H9 mice with elevated IFNα….…48

Figure 11: Decreased frequency of immature Igλ1+ B cells within the bone marrow of 3H9

mice following elevation of IFNα levels………………………………………………………...49

Figure 12: Decreased receptor editing in 3H9 mice following elevation of IFNα levels………..50

Figure 13: Impaired follicular exclusion in 3H9 mice following elevation of IFNα levels……..52

Figure 14: Partially impaired B cell anergy in 3H9 mice following elevation of IFNα levels…..53

Figure 15: Altered B cell homeostasis in HEL mice following elevation of IFNα levels……….55

Figure 16: Disruption of B cell anergy in HEL mice following elevation of IFNα levels………57

Figure 17: Expansion of T-peripheral helper cells in HEL mice following elevation of IFNα

levels……………………………………………………………………………………………..58

ix

LIST OF ABBREVIATIONS ABC Age-associated B cell

ANA Anti-nuclear autoantibodies

APC Antigen-presenting cells

ASC Antibody-secreting cells

autoAb Autoantibodies

B6 C57BL/6

BCR B cell receptor

BM Bone marrow

DC Dendritic cell

dsDNA Double-stranded DNA

dTg Double transgenic

GC Germinal centre

GWAS Genome wide association studies

VH Heavy chain

HEL Hen egg lysozyme

HLA Human leukocyte antigen

IC Immune complexes

IFN Interferon

IFNα Interferon Alpha

Ig Immunoglobulin

Igλ Immunoglobin lambda light chain

IL Interleukin

LPS Lipopolysaccharide

mDC Myeloid dendritic cell

MHC Major histocompatibility complex

MRL Murphy Roths Large

MZ Marginal zone

x

NZB New Zealand Black

PCR Polymerase chain reaction

PNA Peanut agglutinin

RBC Red blood cell

SHM Somatic hypermutation

SLE Systemic lupus erythematosus

SNP Single nucleotide polymorphism

ssDNA Single-stranded DNA

T1/2/3 Transitional stage 1/2/3

TCR T cell receptor

TFH T follicular helper

TFR T follicular regulatory

TPH T peripheral helper

TH T helper

TLR Toll-like receptor

1

INTRODUCTION

1 – Systemic Lupus Erythematosus

Systemic Lupus Erythematosus (SLE) is a chronic, relapsing, and potentially fatal multi-system

autoimmune disease that predominantly affects women during their child-bearing years. The

disease, first described in antiquity, has long fascinated physicians and biomedical scientists due

to its complex etiology, widespread effects on immunological and organ systems, and diverse and

unpredictable clinical manifestations. SLE is best characterized by the breakdown of immune

tolerance towards self-antigens normally sequestered inside of cellular nuclei, and the subsequent

production of self-reactive anti-nuclear antibodies (ANA). These ANAs can form immune

complexes (IC) that transit throughout the body and deposit within diverse tissues and organs.

Clinical disease ultimately occurs as a consequence of inflammatory tissue damage from IC-

induced immune activation. SLE clinical management is currently focused on controlling

symptoms and minimizing tissue damage from disease activity; however, in recent years, there has

been a shift towards discovering earlier detection methods and preventative therapies for SLE.

These factors, combined with the important lessons in basic immunology and genetics that can be

derived from better understanding SLE etiology and pathogenesis, continue to make SLE an

important area of research in the field of autoimmunity.

1.1 Epidemiology

Consistent epidemiological data on SLE currently remains elusive due to extensive variation in

the reported incidence and prevalence rates of SLE between geographically distinct studies. The

annual reported incidence of SLE in the United States ranges from 2 to 7.6 per 100,000 persons

2

and the prevalence varies considerably from 19 to 159 per 100,0001. Similar variation has been

observed in European populations, where the incidence is reported at 1 to 4.9 per 100,000 and the

prevalence at 28 to 97 per 100,0001. While this variation may be attributed to differences in

diagnostic criteria between studies, it also highlights the significant inter- and intra-population

variation that is observed in many aspects of SLE epidemiology, including disease prevalence,

severity of symptoms, peak age of onset, and sex ratio2.

SLE predominantly affects females at the peak of their reproductive and employable years

(20-45). The female/male ratio of SLE incidence is around 9/1, although some studies report this

ratio to be as high as 15/11. Although the disease displays extreme sex skewing, longitudinal

studies have shown no differences in disease severity or clinical outcomes between males and

females1,3. SLE is also known to disproportionally affect certain racial and ethnic groups. In the

United States, people of African-American, Afro-Caribbean, Hispanic, and Asian ancestry tend to

have the highest disease prevalence and incidence rates1,4.

1.1.2 Clinical Manifestations

SLE presents as a very heterogeneous, progressive disease with multi-organ involvement

and several serological abnormalities. The diagnosis of SLE depends on the presence of 4 or more

items that meet the American College of Rheumatology (ACR) classification criteria, which are

based on 11 common SLE clinical manifestations. These criteria include: Malar Rash, Discoid

Rash, Photosensitivity, Oral Ulcers, Non-Erosive Arthritis, Pleuritis or Pericarditis, Renal

Disorder, Neurological Disorder, Haematological Disorder, Immunological Disorder, and a

positive ANA test1. Individuals of African, Hispanic and Asian ancestry tend to have enhanced

severity of several of these symptoms, including a greater rate of disease progression, more

3

frequent renal disease, more flares, and a greater positivity of 4 or more autoantibodies (anti-

chromatin, anti-Sm, anti-RNP and anti-dsDNA) than individuals of European ancestry5,6.

Substantial progress has been made in terms of SLE clinical management and survival. In

the 1940s, more than 40% of all SLE patients died within the first 3 years of diagnosis7. Currently,

the 10-year survival of SLE patients sits at greater than 90%7. Despite these improvements, SLE

patient mortality and morbidity remains considerably higher than in healthy individuals. In the

United States, SLE was ranked as one of the leading causes of death among young women from

2000-20157. As with disease incidence and severity, individuals of African, Hispanic, and Asian

ancestry are at the greatest risk of mortality due to active SLE; this risk is further exacerbated in

individuals from a low socioeconomic background1,2,7. Taken together, the variation in SLE

epidemiology, symptoms, and clinical outcomes hint at the complex interplay of genetics,

environmental triggers, and socioeconomic factors in disease development and progression.

1.2 – Genetic, Environmental, and Sex Bias

1.2.1 – Genetic Factors

Early familial studies, and later extensive genome-wide association studies (GWAS), made it clear

that specific genetic factors confer a predisposition towards the initiation, progression, and

pathogenesis of SLE1,8. SLE is thought of as a complex genetic disease, where multiple risk alleles

or genetic defects contribute to overall disease development1. This is true for most instances of the

disease; however, it is important to note that there are certain single-gene defects that confer a

significant risk for developing SLE. Most of these single gene defects result in deficiency of the

complement system or nucleic acid sensing pathways which leads to SLE by impairing the

clearance of apoptotic debris9.

4

Currently, GWAS have identified more than 80 genetic susceptibility loci with a strong

association with SLE10. Most of the single nucleotide polymorphisms (SNPs) associated with SLE

occur within intronic or regulatory regions of genes, suggesting altered transcription rates or

aberrant gene function1. Advances in transcriptomic techniques such as microarrays and next-

generation sequencing have accelerated the rate at which novel loci, alternative splicing events,

and noncoding RNAs associated with SLE are identified. Broadly speaking, genetic variants

associated with SLE can be classified into 3 areas related to disease development: 1) the

availability of self-antigens, 2) activation of innate immunity, and 3) dysfunction of adaptive

immunity (Table 1).

TABLE 1. SLE SUSCEPTIBILITY GENES

CATEGORY GENE FUNCTION Ref

Apoptotic Debris

Availability/Clearance

C1q, C2, C4, CIR, C1S, CYBB Apoptotic debris binding/clearance 1,11,12

FcγRIIA/IIB/IIIA/IIIB IC phagocytosis 1

TREX1, DNASE1,

DNASE1L3, RNASEH2

DNA/RNA degradation 1

ATG5 Autophagy 11

MSH5 DNA mismatch repair 11

ITGAM Complement-mediated phagocytosis 11

BAX, CASP3 Apoptosis 13

LYST, CLE16A IC/waste clearance 12

NCF2 ROS production 11

Innate Immunity

IFIH1, MAVS, SAMHD1,

ACP5, ADAR, DDX58, TLR7

Nucleic acid sensing, type I IFN

production

1,11,12

STAT4, miR146a Cytokine signalling 11

IRF5, IRF7, IRF8, TYK2 Type I IFN signalling 11,12

SLC15A4 Type I IFN signalling/Metabolism 11

TNIP1, TNFAIP3, UBE2L3,

IRAK1

NFkB pathway, inflammation 11,12

PRDM1 IFN β expression 11

RASGRP Type I IFN production 11

Adaptive Immunity

HLA region Antigen presentation, T Cell restriction 1,11

PTPN22, BLK, LYN, BANK1,

CSK

TCR/BCR Signalling 1,11,12

IL10, IL21, IL12A Immunoregulatory/Stimulatory Cytokines 11

SPRED2 MAPK regulation 12

CD80 T Cell Costimulation 11

AFF1 Lymphocyte differentiation/Survival 11

5

1.2.2 Environmental Triggers

While genetic factors certainly play a major role in SLE susceptibility, they alone cannot explain

the disease phenotype. SLE disease heritability is estimated at 66%, and the concordance rates for

monozygotic and dizygotic twins are around 25% and 2% respectively1,14. This, combined with

the low disease penetrance observed for many SLE risk alleles suggests a clear role for

environmental triggers in disease development15. Many of the well-described environmental

triggers for SLE (Table 2) act through similar mechanisms observed for genetic risk variants; by

increasing the availability of apoptotic debris, or by altering the function of innate and adaptive

immunity15. For example, chronic exposure to certain toxins, such as respirable silica dust, has

been strongly linked to the development of SLE and is thought to act by enhancing the release of

pro-inflammatory cytokines and inducing apoptosis15,16.

TABLE 2 – ENVIRONMENTAL TRIGGERS FOR SLE

CATEGORY Trigger Effect Ref

Drugs/Toxins

Silica, Asbestos Induction of pro-inflammatory cytokines, apoptosis 15,16

Particulate air

pollution

Pulmonary inflammation, oxidative stress 15

Pesticides Associated with increased ANA, SLE, and risk of mortality 17

Hydrocarbons Immune dysfunction through binding arylhydrocarbon receptor 17

Exogenous

Hormones

Associated with increased risk of SLE 15

Heavy metals Induction of pro-inflammatory cytokines 15

Hydralazine Altered DNA methylation, T/B cell activation 18,19

IKZF1, IZKF2, IZKF3, ETS1,

TCF7, TNFSF4, ARID5B

Lymphocyte differentiation 11,12

ELF1 T/B cell transcription factor 11

PRKCB B Cell signalling/survival 11

CIITA MHC regulation 11,12

PXK Synaptic Transmission/growth factor

regulation

11

CD44 Lymphocyte adhesion, maturation,

activation

11

Unknown ABHD6, RAD51B, MECP2, TMEM39A, PITG1, TNXB, JAZF1, XKR6,

FAM167A–AS1, WDFY4, rs1167796, rs463128, rs7186852, rs7197475, UHRF1BP1, DRAM1

11,12

6

TNF inhibitors Associated with ANA production, interference with apoptotic

debris clearance

20

Procainamide T cell autoreactivity, altered expression of LFA-1 18,19

Viral/Bacterial

Exposure

Epstein-Barr Virus Induction of I IFN, promotes ANA production via epitope

spreading/cross-reactivity

21

Cytomegalovirus Induction of pro-inflammatory cytokines, promotes ANA

production epitope spreading/cross-reactivity

22

LPS Induction of pro-inflammatory cytokines via TLR4 23

E. gallinarium Altered gut permeability, induction of pro-inflammatory genes

and ANA

24

Microbiome ANA production via epitope spreading/cross-reactivity 25

Biofilms Induction of I IFN via TLR1/TLR2 26

Lifestyle

Cigarette Smoking Oxidative stress, DNA/protein damage, non-specific pulmonary

inflammation

1,15

Diet Low dietary intake of immunosuppressive omega-3 fatty acids

associated with SLE

27

UV-B radiation DNA damage, apoptosis 1,15

1.2.3 Sex Bias

As mentioned previously, one of the most striking features of SLE is its extreme sex skewing.

While the exact mechanisms behind the female predominance in SLE are still not fully understood,

new insights into hormonal contributions and X-chromosome silencing have shed some light on

this phenomenon. Several female sex hormones are known to modulate the function of the immune

system. Prolactin, a peptide hormone responsible for inducing the production of breast milk, is

capable of activating immune cells through the binding of the prolactin receptor28. Prolactin has

been shown to be elevated in the serum of SLE patients compared to healthy controls, and has

been correlated with more severe disease activity28. Similarly, the estrogen receptor is expressed

ubiquitously throughout the body, including on cells of the innate and adaptive immune system.

Estrogen signalling has been shown to alter the threshold of B cell activation and apoptosis, which

may contribute to sex skewing1,29. Several epidemiological studies have also suggested that

exogenous sources of hormones, such as oral contraceptives or hormone replacement therapies,

are associated with an increased risk of developing SLE30,31. These findings suggest that

7

hormonally-induced modulation of immunity may be a significant contributing factor towards sex

skewing in SLE.

The extremely high prevalence of Klinefelter syndrome in SLE patients, a 14-fold increase

over controls, also suggests a role for the X chromosome and gene dosage effects in SLE1.

Stemming from this important observation, it has recently been shown that TLR7, a known genetic

risk factor for SLE, partially escapes X-inactivation in individuals with more than one copy of the

X chromosome32. This confers immune cells with enhanced responsiveness to TLR7 ligands,

which, in combination with other genetic or environmental factors that promote the availability of

nucleic acids, may be a significant contributing factor to SLE pathogenesis.

1.3 – SLE Therapeutics

Due to its unpredictable clinical presentation and variable organ involvement, SLE is very difficult

to treat, with no definitive cure currently available. Standard SLE treatment is focused on

addressing symptoms and controlling disease progression. For patients presenting with mild to

moderately active SLE, treatment may include an array of non-steroidal anti-inflammatory drugs

(NSAIDs), antimalarials, and corticosteroids to suppress symptoms33. In more severe cases, high

doses of corticosteroids and immunosuppressive drugs may be used in an attempt to control

disease33. While these drugs may be effective in temporarily suppressing symptoms, they are also

associated with several adverse outcomes (Table 3), and do nothing to address the underlying

immunological mechanisms driving disease progression.

Small molecule biologic therapies have been shown to be very effective in the treatment of

other rheumatic diseases, such as rheumatoid arthritis, by targeting the specific cellular events that

underlie disease. While basic research in the field of SLE has identified numerous potential

8

molecular targets for drug development, small molecule biologic treatment options for SLE remain

extremely limited. In most cases, newly developed biologic therapies for SLE show limited

efficacy or are poorly tolerated in patients, and thus do not progress past the clinical trial phase

(Table 4). Currently, the only FDA-approved biologic for SLE is Belimumab (Anti-BAFF

therapy), which despite demonstrating safety and tolerability, has shown only moderate efficacy

in a small subset of patients, highlighting the need for the development of more effective targeted

therapies in SLE34.

TABLE 3 – COMMONLY USED ANTI-INFLAMMATORY SLE THERAPEUTICS

CLASS OF DRUG MECHANISM ADVERSE EFFECTS Ref

NSAIDs

(Various agents)

Blockade of prostaglandin

production by cyclooxygenase

Bleeding, renal/hepatic toxicity,

irritation, hypertension

33

Corticosteroids

(ex: Prednisone,

Methylprednisone)

Multiple immunosuppressive

effects (ex: inhibition of

TNFa/IFNγ mediated activation)

Hypertension, weight gain, osteoporosis,

edema, muscle weakness, glaucoma,

hyperglycemia, hyperlipidemia

33

Antimalarials

(ex:

Hydroxychloroquine)

Interferes with T cell activation,

TLR/cytokine signalling

Macular damage, muscle weakness 33

Immunosuppressants

(ex: Cyclophosphamide,

Azathioprine,

Mycophenolate)

Multiple immunosuppressive

effects (ex: inhibition of T/B cell

proliferation, DNA/RNA

disruption)

Myelosuppression, risk of infection,

renal/hepatic toxicity

33

TABLE 4 – PROMISING SLE BIOLOGIC THERAPEUTICS AND TRIAL STATUS

DRUG TARGET CLINICAL TRIAL STATUS Ref

Abaticept T Cell Costimulation Ineffective in Phase III trials, terminated 35,36

Anifrolimumab IFNα Receptor (IFNAR) Phase II positive data, Phase III terminated by

pharmaceutical company

35,36

Atacicept BAFF/APRIL Terminated due to increased infection rate 35,36

Baricitinib Selective JAK1/2 inhibitor Phase II positive data, Phase III ongoing 35,36

Belimumab BAFF Ongoing Phase III, approved for non-renal SLE 36

Eparitizumab CD22 Phase III failed 36

Low dose IL-2 Selectively promotes Treg,

TFH, and TH17 cells

Ongoing phase I/II, positive data 35,36

Rituximab CD20 Phase III failed, currently used in severe lupus 36

Sifalimumab IFNα Limited efficacy in II/III, no further development 36

Sirukumab IL-6 Phase II failed 36

Ustekinumab IL-12/23 Phase II positive data, Phase III ongoing 36

9

2 – Immune Mechanisms leading to Autoantibody Production in SLE

As mentioned in the previous section, the presence of autoantibodies (autoAb) is a defining

serological feature of SLE. Currently, autoAb for over 180 self-antigens have been identified in

SLE patients; however, those specific for nuclear antigens (ANAs) are most common, appearing

in essentially all (99%) of patients at some point during disease development37,38. While they

certainly play a role in SLE disease pathogenesis, the mere presence of ANAs alone is not enough

to be predictive of disease. Up to 25% of individuals in the general population have at least low

levels of ANA positivity and will never progress to autoimmunity, further emphasizing the

important role of genetic factors and environmental triggers in SLE disease progression37.

Some major differences do exist in the autoantibody profile of SLE patients when

compared to healthy non-progressing individuals. Certain ANAs, such as anti-dsDNA, anti-Sm,

anti-Ro/La, and anti-histone, are very specific for SLE, and are associated with certain aspects of

disease activity39. ANAs in SLE patients also tend to be class switched to IgG and be of very high

affinity40. These differences suggest that while low levels of autoantibodies may be a normal

feature of immunity, specific defects associated with SLE alter this process and promote the

production of high-affinity pathogenic ANAs.

2.0.1 Immunopathogenesis of ANA production

As mentioned previously, SLE immunopathogenesis is a multifactorial process consisting of

complex interactions between genetic and environmental risk factors that drive disease

susceptibility and progression. The net result of these interactions is the dysfunction of innate and

adaptive immunity and the loss of tolerance towards self-antigens. The currently accepted model

of SLE immunopathogenesis places defects associated with the availability or clearance of

10

apoptotic debris at the apex of disease progression (Fig. 1)41. These defects, in combination with

environmentally-induced triggers of cell death, lead to the accumulation of cellular debris over

time. This cellular debris, rich in nucleic acids and various other nuclear-associated molecules,

results in the activation of innate immune cells and the production pro-inflammatory cytokines,

such as IFNα, a molecule with widespread immune-activating effects41.

While many cell types are capable of producing IFNα, plasmacytoid dendritic cells (pDCs)

are the chief IFNα-producing cells of the human body12. pDCs become activated following the

uptake of cellular debris and engagement of endosomal TLR7/9 by nucleic acids. pDC activation

results in the production of copious amounts of IFNα, which has various stimulatory effects

capable of enhancing the self-directed immune response12. IFNα stimulates mDCs to produce high

levels of B cell activating factor (BAFF), which has a central role in SLE by promoting the

activation and survival of autoreactive B cells12. IFNα stimulation also enhances the ability of

mDCs to present antigen, further facilitating the presentation of nuclear antigen to autoreactive T

cells12,41. This results in the broad activation and expansion of autoreactive T cells. In the context

of SLE, CD4+ helper T cells (TH) are the primary T cell type involved with pathogenesis1,12.

Activated TH cells produce stimulatory molecules such as IL-21 and CD40L which provide potent

signals to drive the activation and differentiation of autoreactive B cells. TH cells also play a key

role in SLE pathology. A specific subtype of TH cell, TH17 cells, are elevated in SLE patients and

produce large amounts of IL-17, helping to recruit immune cells to tissues and mediating

inflammatory tissue damage12.

Upon activation by a cognate T cell, autoreactive B cells are recruited into germinal centers

(GC) and begin differentiation40. Within the GC, autoreactive B cells interact with T follicular

helper cells (TFH) and undergo rapid clonal expansion, somatic hypermutation (SHM), affinity

11

maturation, and class switching, to ultimately produce the high affinity class switched ANAs

characteristic of SLE40. These ANAs can then complex with nuclear antigens to form ICs and

provide additional stimulatory signals to pDCs through Fc receptors, further augmenting the

production of IFNα. The continued stimulation of pDCs by nuclear debris/ICs and subsequent

activation of T/B cells sets in motion a positive feedback loop that functions to maintain chronic

autoimmunity (Fig. 1). This inflammatory cycle eventually results in localized inflammatory tissue

damage mediated through the deposition of ICs and the onset of clinical symptoms.

Figure I: Classical model of SLE immunopathogenesis. Genetic and environmental factors result in the

accumulation apoptotic debris, a rich source of nuclear antigens. These nuclear antigens are taken up by pDCs,

activating them to begin producing IFNα. IFNα then acts on mDCs to enhance antigen presentation and subsequently

activate autoreactive T cells. Stimulatory signals from both T/mDCs drive B cell activation and differentiation towards

plasma cells and the production of high affinity ANAs.

12

2.1 Immune Mechanisms Limiting Autoantibody Production

It has been shown that a staggering 50-70% of all newly generated B cells within the bone marrow

(BM) express self-reactive BCRs, yet most individuals will never go on to develop autoimmunity.

This is because B cell development is a heavily regulated process, with several intricate steps and

checkpoints designed to prevent the survival and further development of autoreactive cells. These

tolerance mechanisms, both central and peripheral, represent an extremely important aspect of

immunity and are essential in preventing autoreactive B cells from mounting a functional immune

response. Genetic abnormalities that either directly or indirectly impact these processes are thought

to be major contributing factors to SLE susceptibility and progression.

2.1.1 Central Tolerance Mechanisms

B cells begin development within the BM, where cells undergo VDJ gene rearrangement in order

to generate a unique BCR. This stochastic process results in the formation of an extremely diverse

B cell repertoire, estimated to contain up to 1012 distinct specificities42. As mentioned previously,

with this incredible variation comes the potential to generate receptors with self-reactivity; thus,

developing B cells within the BM are subject to several central tolerance checkpoints to prevent

the egress of these autoreactive cells to the periphery.

Development begins at the pro-B cell phase, where cells upregulate recombination

machinery (RAG1/2) and initiate the rearrangement of the heavy chain (IgH). Following heavy

chain rearrangement is the large pre-B phase, where the newly rearranged IgH chain pairs with the

surrogate light chain (SLC), composed of VpreB and λ5, to form the pre-BCR43. Expression of the

pre-BCR represents one of the first important checkpoints in B cell development, as signalling

through the pre-BCR complex is required for cells to continue down the developmental pathway43.

13

Tonic engagement of the pre-BCR serves as a positive selection signal for the rearranged IgH

chain, mediating heavy chain allelic exclusion through the down regulation of RAG1/2 and

inducing the transition to the small pre-B stage43. It has also been appreciated that expression of

the pre-BCR serves as an early negative selection checkpoint. While the exact mechanism is not

yet fully understood, several studies have shown that pre-BCRs are tested for autoreactivity

towards self at this stage43,44. Following these selection events, cells expressing functional pre-

BCRs with appropriate specificity continue on the developmental pathway.

The next stage of development is the small pre-B phase where cells initiate rearrangement

of the light chain (IgL). Upon successful light chain rearrangement, IgL and IgH combine to form

IgM on the surface of the cell43. Productive signalling through this newly expressed receptor once

again serves as a positive selection signal and ensures allelic exclusion of the light chain. It is also

at this stage where functional IgH/IgL BCRs are tested for autoreactivity. Cells within the bone

marrow microenvironment display various self-antigens to developing B cells. B cells that express

receptors with high affinity for these self-antigens are negatively selected through receptor editing,

the primary method of selection within the bone marrow. Chronic engagement of self-antigens at

this stage of development results in the re-induction of RAG1/2 and further rearrangement of the

light chain locus in order to generate a new BCR specificity43. Receptor editing has been shown to

be very efficient, removing around 30-35% of B cells expressing a self-reactive BCR45.

Autoreactive cells can go through several rounds of receptor editing until they no longer react to

self or all possible light chain genes have been utilized. At this point, cells still expressing BCRs

with high affinity for self-antigens are undergo apoptosis, a process known as clonal deletion45. B

cells that are able to rearrange receptors that do not recognize self-antigens, or do so only with low

affinity, exit the bone marrow as immature cells. While central tolerance mechanisms play a crucial

14

role in restricting the early B cell repertoire, it is estimated that roughly 30-40% of the immature

B cell pool remains autoreactive, highlighting the need for additional tolerance mechanisms in the

periphery45.

2.1.2 Peripheral Tolerance Mechanisms

Newly emerging immature B cells, termed transitional cells, transit to the spleen in order to

complete development. Transitional cells go through two distinct developmental stages before

becoming mature B cells, transitional 1 (T1) and transitional 2 (T2) cells. BCR signalling plays a

key role in determining the developmental fate of transitional B cells. Moderate to strong BCR

ligation commits transitional cells towards the follicular B cell (FoB) lineage46. FoB cells retain

the ability to recirculate and transit between the B cell follicles of secondary lymphoid organs

where, upon antigen encounter, they can interact with T cells and initiate GC formation. Weaker

BCR signalling instead commits cells to the marginal zone (MZ) lineage46. MZ cells represent

innate-like B cells that reside within the outer white pulp of the spleen and are capable of rapid

differentiation into short-lived plasma cells in order to respond to lipid and bloodborne antigens46.

In contrast, B cells that react strongly to self are removed from the repertoire at the transitional

stage through clonal deletion. The T1 phase in particular, which is known to be highly prone to

spontaneous apoptosis following strong tonic BCR ligation, is thought to represent an additional

opportunity for clonal deletion in the periphery. Consistent with this idea, in humans the transition

of T1/T2 cells to the mature pool is associated with a reduction of autoreactivity from around 30-

40% to 20%43.

While cells with high-affinity BCRs specific for self-antigens are deleted at the transitional

stage, those with weaker affinity BCRs may instead be rendered anergic, a state in which the cell

becomes refractive to further stimulation and has a significantly reduced lifespan47. B cell anergy

15

is the primary mechanism of peripheral B cell tolerance, responsible for silencing and eliminating

approximately 50% of all newly emerging autoreactive B cells48. Mechanistically, B cell anergy

is dependent upon chronic engagement of the BCR by antigen in the absence of any secondary

signals or costimulation47. This instructs monophosphorylation of the normally diphosphorylated

BCR-associated signalling molecule CD79a (Igα), which leads to the preferential recruitment of

the src-family kinase Lyn in place of Syk47. Instead of recruiting downstream mediators to

facilitate further BCR signalling, as Syk does in the context of normal BCR ligation, Lyn recruits

phosphatases (SHP-1, SHIP-1) that act to inhibit further downstream signalling47,49. This inhibition

of BCR signalling leaves the cell in an impaired state, unable to mobilize calcium, upregulate

costimulatory molecules (CD86) or respond to further stimulation48. Importantly, anergic B cells

require higher concentrations of BAFF for survival than naïve B cells than are typically available,

leading to a significantly reduced lifespan47. Thanks to elegant mouse models utilizing modified

BCR transgenes, it is now understood that B cell anergy occurs alongside a process known as

follicular exclusion, whereby anergized cells are restricted from accessing the mature B cell

follicle and are instead sequestered at the T-B border of the follicle. This combination of a

refractory phenotype, reduced lifespan, and sequestration of anergic B cells effectively prevents

them from entering the mature peripheral B cell repertoire and partaking in a productive immune

response50. The induction of B cell anergy represents an extremely important aspect of peripheral

B cell tolerance as it ensures the sequestration and functional silencing of a majority of the

autoreactive B cells that manage to escape other tolerance mechanisms.

While deletion and anergy function to restrict the further development of most autoreactive

B cells in the periphery, some cells occasionally manage to escape these processes. Although

autoreactive B cells are capable of some extrafollicular activation and antibody production in the

16

context of TLR ligands, in order for a cell to differentiate towards the production of high-affinity

ANAs it must interact with a cognate T cell and form a GC. As previously mentioned, the GC is

the site of several important aspects of B cell development and antibody maturation40. A majority

of the autoreactive B cells that end up within the GC compartment are actually formed as a result

of SHM. SHM is the process by which random mutations are introduced into the CDR3

hypervariable region of the Ig gene in order to modify antibody specificity and achieve further

diversification of the B cell repertoire51. A consequence of SHM is that it can give rise to de novo

autoreactive specificities. As such, additional tolerance checkpoints exist within the GC

compartment to limit the further differentiation of autoreactive cells, many of which also likely

apply to previously autoreactive B cells that are recruited into GC responses40. Within the GC, B

cell survival is a heavily regulated process. Proliferating cells compete with each other for limited

quantities of BAFF, as well as for stimulation from TFH cells and follicular DCs (FoDC)52. Most

autoreactive B cells that make it to the GC possess BCRs with low-affinity for self-antigens and

are thus eliminated at this stage after not receiving adequate survival signals52. Additionally, SHM

can actually abrogate autoreactivity by mutating away from self-antigen specificities40.

2.2 – Defective Immune Tolerance Mechanisms in SLE

As can be appreciated from the previous section, the maintenance of B cell tolerance is an intricate

and heavily regulated process, with several checkpoints that act to restrict the development of

autoreactive cells. Given the central role of B cells in this disease, it should come as no surprise

that many of the genetic defects associated with SLE are thought to alter B cell function and disrupt

these tolerance mechanisms. The presence of specific autoantibodies in SLE years before the onset

of clinical symptoms suggests that the loss of B cell tolerance and subsequent production of ANAs

is a key first step in disease development53,54. While the exact mechanisms controlling this loss of

17

tolerance have yet to be fully defined, the identification of novel susceptibility genes and molecular

pathways regulating T/B cell and innate immune function continue to shed light on the

immunological changes associated with disease initiation and progression.

2.2.1 B Cell Defects

The majority of B cell tolerance mechanisms, such as receptor editing and the induction of anergy,

are heavily dependent upon BCR signalling thresholds54. As such, genetic abnormalities affecting

BCR signalling may significantly contribute to the observed loss of B cell tolerance in SLE. Many

of the SLE candidate genes (Table 1) are molecules that play crucial roles in BCR signalling, and

several human/mouse studies have suggested potential causal roles for these genes in SLE. For

example, SNPs in the tyrosine phosphatase PTPN22 have been shown to alter BCR

responsiveness, resulting in impaired central deletion and receptor editing55. Similarly, several

studies have demonstrated that human patients with SLE display reduced expression of Lyn, a

negative regulator of BCR signalling55,56. Abnormal expression of several other regulators of BCR

signalling, such as CD22, BTK, and BLK, have also been strongly associated with the production

of ANAs56. This concept of aberrant BCR signalling is further supported by data demonstrating

that B cells isolated from SLE patients display abnormalities associated with signalling, including

hyper-responsiveness to a variety of stimuli, enhanced calcium mobilization, and increased

phosphorylation of downstream signalling molecules56. Together, these findings suggest a clear

role for abnormal BCR signalling in the disruption of B cell tolerance in SLE.

In addition to genes directly involved with BCR signalling, several molecules responsible

for B cell differentiation and survival have also been implicated in disrupting tolerance in SLE.

BAFF is a molecule that is frequently elevated in SLE patients and has been heavily implicated in

disease pathogenesis54. Peripheral B cells depend on BAFF signalling through their BAFF-R for

18

survival, and thus compete with each other for these limited survival signals47. Self-reactive

anergic B cells, which have an increased dependence on BAFF, do not compete effectively for this

survival signal and have significantly reduced lifespans47. Therefore, elevation of BAFF in SLE

likely plays a crucial role in breaching tolerance by promoting the survival of autoreactive cells.

Consistent with this idea, overexpression of BAFF in mice results in broad tolerance escape and

autoimmunity, as well as alterations to the B cell repertoire, suggesting a role for BAFF in

promoting the survival and escape of autoreactive B cells57. Finally, restricting the terminal

differentiation of autoreactive B cells to plasma cells may represent another aberrant process in

SLE. SLE patients display elevation of B lymphocyte induced maturation protein

(BLIMP1/PRDM1), a gene which plays a critical role in plasma cell differentiation58. The

differentiation of GC-B cells to plasma cells is also carefully regulated by inhibitory signalling

through FCyRIIB. Dysregulation of FCyRIIB has been observed in human SLE and various mouse

models of lupus, suggesting that loss of this checkpoint may permit the development of

autoreactive plasma cells59.

2.2.2 T Cell Defects

As the primary source of B cell co-stimulation, T cells are known to be key contributors to the loss

of B cell tolerance in SLE, with specific T cell subtypes being strongly associated with disease.

As previously described, TFH cells play a crucial role in the generation of high-affinity antibodies

through the initiation and maintenance of the GC52. The recently described T follicular regulatory

(TFR) cells also play an important role in limiting excessive inflammation and autoimmunity by

regulating the GC reaction60. Several studies have demonstrated elevated frequencies of TFH cells

in SLE patients as well as mouse models of SLE41. It has recently been appreciated that TFR cell

numbers are also dysregulated in SLE patients, and that the ratio of TFR:TFH cells strongly

19

correlates with the number of GC B cells and ANA levels61,62. These findings suggest a clear role

for defects in the TFR:TFH axis as contributing towards the loss of B cell tolerance and autoantibody

production in SLE.

The three main types of extra-follicular TH cells include TH1, TH2, and TH17 cells. Like TFH

cells, these cells differentiate from naïve CD4+ precursors depending on the local cytokine

environment. Altered expansion and skewing of TH1/TH2/TH17 cells and their associated cytokines

have been implicated in several autoimmune diseases, including SLE41. For example, SLE patients

are known to have increased frequencies of IFNγ-producing TH1 cells, and elevated levels of IFNγ

have been shown to correlate with disease severity63. As mentioned previously (Section 2.0.1), IL-

17-producing TH17 cells are also elevated in SLE patients41. In addition to their role in mediating

tissue damage, TH17 cells may contribute to the disruption of B cell tolerance through their impact

on the relative abundance of regulatory T cells (Treg). IL-17 production has been shown to be

inversely related to IL-2 production, a molecule required for proper Treg survival and function41,64.

Treg cells represent an important subset of CD4+ T cells with potent immunosuppressive effects65.

Dysregulation of Treg cells has been strongly associated with several autoimmune diseases,

including SLE, suggesting they play an important role in restricting the activation of autoreactive

B cells in the periphery65. The relationship between TH17 and Treg cells forms the basis for low-

dose IL-2 therapy in SLE, which has been shown to re-balance the relative frequencies of TH17/Treg

cells and has demonstrated efficacy in early clinical trials41. Overall, defects altering the relative

abundance and cytokine profile of TH cells likely play a major role in promoting the activation and

survival of autoreactive B cells in SLE.

2.2.3 Innate Immunity Defects

20

Defects in several aspects of innate immunity have been described in SLE; however, recently there

has been a significant focus on the role of pattern recognition receptors (PRRs) in disease

pathogenesis. Broadly, PRRs function as innate receptors capable of activating the immune system

in the presence of microbial or viral pathogens by recognizing highly conserved pathogen-

associated molecular patterns (PAMPs) and danger-associated molecular patterns (DAMPs).

Several studies have indicated that dysregulated PRR signalling may play an important role in the

pathogenesis of SLE. For example, knockout mouse models have demonstrated a crucial role for

TLR2 and TLR4 in lupus nephritis and autoantibody production, a finding that has been replicated

in human studies66,67.

It has recently been appreciated that endosomal TLRs may play a critical role early on in

disease development. Many of the nuclear antigens recognized by autoreactive BCRs are also

recognizable by endosomal TLRs – RNA and its associated proteins by TLR7 and DNA and its

associated proteins by TLR940. TLR7 in particular has been extensively studied in mouse models

of SLE, with overexpression being associated with increased disease severity68. The role of TLR9

in SLE has remained controversial, with some mouse studies suggesting that it actually plays a

protective or regulatory role in SLE68,69. Nonetheless, other studies have demonstrated that TLR9

expression in B cells is required for the generation of anti-dsDNA antibodies, and TLR9 expression

in SLE patient PBMCs has been correlated with ANA production, suggesting a key role for

dysregulation of both TLR7 and TLR9 signalling in SLE disease pathogenesis68.

Combined BCR and TLR ligation has been shown to synergistically signal and contribute

to B cell activation40. In the context of abundant nuclear antigens, TLR/BCR signalling in

combination with other immune defects can lead to robust B cell activation and directly drive the

extra-follicular differentiation of autoreactive B cells towards antibody production40. This T-

21

independent B cell activation may play a key role in the initiation and maintenance of ANA

production early in disease, and may help explain the appearance of ANAs in the serum of SLE

patients many years before the onset of clinical symptoms53. In addition to participating in B cell

activation, TLRs also contribute to SLE immunopathogenesis through the induction of type I IFN

which will be discussed in the following section.

3 – Type I Interferons in SLE

There currently exists a multitude of evidence to support the idea that type I IFNs play an

absolutely central role in SLE immunopathogenesis70. Defined classically as anti-viral molecules,

type I IFNs are produced by a variety of cells, including macrophages, DCs, and epithelial cells,

in response to viral infection. In most cells PRRs are responsible for the detection of viral particles

and subsequent induction on type I IFN production. Of particular importance are endosomal TLR7

and TLR9 due to their specificity for nucleic acids, a hallmark of viral infection71. As previously

described, some of the highest risk SLE gene variants are those associated with the clearance of

apoptotic debris, which is rich in nucleic acids and associated proteins. The chronic recognition of

this nuclear debris by PRRs is thought to be the major driving force behind elevated type I IFN in

SLE.

The two major types of type I IFNs are IFNα and IFNβ. Many different cell types are

capable of producing IFNβ, which functions primarily to activate an anti-viral program in target

cells71. The shared receptor for IFNα and IFNβ, IFNAR, is ubiquitously expressed to ensure viral

protection in a variety of different cells and tissues. IFNβ may play a role in SLE by promoting B

cell survival and autoantibody production; however, a vast majority of the literature has focused

on the role of IFNα in this disease72. As is the case with IFNβ, the primary function of IFNα is in

22

mediating host viral immunity through the binding of IFNAR. IFNα exists as 13 distinct proteins

in humans and 14 distinct proteins in mice, the latter of which have been shown to all display

similar biological and antiviral activity in vitro, and are hypothesized to have evolved in response

to specific viral pressure73. In contrast to the widespread production of IFNβ, IFNα subtypes are

primarily produced by pDCs. Strong evidence exists to suggest that IFNαs are a dominant mediator

of SLE immunopathogenesis. Peripheral-blood mononuclear cells (PBMCs) isolated from SLE

patients demonstrate upregulation of a broad array of genes termed the interferon-sensitive genes

(ISG), many of which are genes specifically induced by IFNα74. To add to this point, the incubation

of cells with SLE patient serum in combination with polyclonal antibody against IFNα results in a

90% reduction in expression of the ISG signature, whereas incubation with antibody against IFNβ

does not result in a similar decrease, further emphasizing the important role of IFNα75.

Recombinant human IFNα administered in the therapeutic treatment of certain malignancies has

also been associated with de novo development of SLE, which in most cases is resolved when

treatment is stopped74. Finally, elevation of IFNα in several mouse models of SLE has been shown

to accelerate the disease development and exacerbate tissue damage75. Several monoclonal

antibodies against IFNα have been tested for efficacy in the clinical management of SLE in the

past; however, none have made in past the clinical trial phase. Interestingly, antibodies capable of

neutralizing numerous subtypes of IFNα displayed the most clinical improvement, especially in

patients with high IFNα levels, emphasizing the redundant contributions of the IFNα subtypes to

this disease76. For this reason, for the remainder of this thesis, the collective IFNα subtypes will

be referred to as ‘IFNα’.

In the context of the classically described mechanism of SLE immunopathogenesis

(Section 2.0.1), one of the central pathogenic roles of IFNα is thought to be the induction of BAFF

23

by mDCs. As mentioned previously, BAFF is an extremely important molecule in SLE disease

pathogenesis and currently represents the only FDA-approved biologic therapy for this disease.

While a significant portion of the literature has focused on the role of BAFF in breaching B cell

tolerance, less work has focused on the direct effects of IFNα on this process. Due to the ubiquitous

expression of its receptor, IFNα has wide-reaching immunostimulatory effects and may aid in

breaching tolerance through a variety of these interactions, including direct interactions with B

cells. In fact, IFNα has been shown to have a variety of effects on B cells in culture, including

enhancing BCR signalling, calcium mobilization, activation, as well as directly promoting

antibody production77,78. Consistent with these findings, our lab has previously demonstrated that

IFNα induces a hyper-responsive phenotype in transitional B cells, which is associated with

decreased apoptosis and increased survival/proliferation79. Interestingly, several studies have also

demonstrated the induction of TLR7 and TLR9 transcription in immune cells following

stimulation with IFNα, suggesting that IFNα may prime autoreactive B cells for enhanced

responsiveness to TLR ligands80,81. Overall, IFNα may play a critical role in the observed breach

of B cell tolerance in SLE; not only through the induction of BAFF, but also through its many

direct effects on B cell function.

4 – Mouse Models of B Cell Tolerance

Historically, studying B cell tolerance mechanisms and determining the fate of self-reactive B cells

has been a difficult task. Not only are these cells normally present at very low frequencies, but

they are also rendered anergic and are thus very short-lived and hyporesponsive to stimulation,

making them very difficult to isolate and study. However, with the advent of transgenic

technology, the creation of mouse models bearing modified BCR transgenes revolutionized the

study of B cell tolerance, providing the opportunity to follow the development, selection, and fate

24

of antigen-specific cells. These models have been particularly useful in helping to characterize and

expand the concepts of B cell anergy and receptor editing.

4.1 – The HEL Mouse Model of B Cell Tolerance

One of the most instrumental mouse models in the field of B cell tolerance has been the hen egg

lysozyme (HEL) model. Generated by Goodnow and colleagues in the late 1980s, this is a double

transgenic (dTg) mouse possessing a BCR transgene with specificity for an exogenous antigen,

HEL, in conjunction with a transgene that yields high levels of soluble HEL in the periphery82.

Thus, this model provides an in vivo environment where B cells are chronically exposed to high

levels of pseudo-self-antigen.

The HEL protein was selected as the antigen of choice due to its well-defined biochemistry,

readily available DNA clones, as well as its lack of toxicity in vivo82. A genomic fragment of HEL

was inserted into the C57BL/6 strain genome under control of the metallothionein promoter82. This

promoter was chosen due to its robust transcriptional activity, ensuring ubiquitous expression of

HEL at all stages of development82. This resulted in the creation of a C57BL/6 line with high levels

of soluble HEL detectable in the serum (ML-5). To generate a mouse capable of responding to

HEL, Goodnow and colleagues utilized an anti-HEL hybridoma (HyHEL10) as a candidate BCR.

The HyHEL10 hybridoma produced high levels of anti-HEL Ig and was originally derived from

the BALB/c strain, providing the added benefit that the transgenic Ig genes (IgHa) could be easily

differentiated from endogenous C57BL/6 Ig (IgHb) by anti-allotypic antibodies82. Genomic clones

encoding both the heavy and light chains of the HyHEL10 BCR were constructed and co-injected

into C57BL/6 embryos for genomic insertion82. The resulting strain was characterized by the high

levels of circulating ant-HEL IgMa (MD4).

25

Crossing the ML-5 and MD4 lines yielded a dTg mouse in which the HEL-specific BCR

was expressed in the context of high levels of soluble HEL. Analysis of peripheral B cell

compartments demonstrated an extremely homogenous B cell repertoire in which greater than 90%

of the B cells expressed the transgenic BCR and bound HEL; however, unlike the MD4 single

transgenic mice, these mice produced very little anti-HEL antibody82. Further analysis

demonstrated several other abnormalities, such as decreased surface IgM, unresponsiveness to

stimulation, decreased proliferative and signalling capacity, and a shortened lifespan. These

observations represented the first descriptions of anergic B cells, and have since gone on to

represent the standard phenotypic changes associated with B cell anergy47,48,82.

While the HEL model serves as an incredibly powerful tool for studying the underlying

mechanisms of B cell anergy, it does have some limitations with respect to its use in the study of

other B cell tolerance mechanisms. In the classical HEL dTg model (ML-5/MD4), the entire

endogenous Ig locus is replaced with the pre-rearranged μ and δ heavy chain genes derived from

HyHEL10, and thus the BCR is unable to take part in several aspects of normal B cell development

and maturation, such as receptor editing, SHM, affinity maturation, and class-switching82. To add

to this, the antigen in this model is extremely highly expressed and has very high affinity for its

cognate BCR, making this model unsuitable for the study of B cells with low-affinity BCRs or less

abundant antigen82. Finally, as an exogenously introduced antigen, HEL is of low physiological

relevance in SLE82. Nevertheless, following the important lessons learned from the transgenic

HEL system, several additional mouse tolerance models were created with a heavy focus on DNA-

reactivity due to the important role of ANAs in driving human SLE pathology.

26

4.2 – 3H9 Mouse Model of B Cell Tolerance

In the 1990s, Weigert and colleagues studied B cell tolerance to nuclear-antigens using the

MRL/lpr mouse strain83, which possesses a defect in Fas and displays widespread autoimmunity.

Several hybridomas were derived from this model to study the characteristics of DNA-reactivity

and ANA production in vitro83. A distinctive feature of the BCR expressed by these hybridomas

was the presence of specific mutations within the complementary determining regions (CDR),

typically the introduction of arginine residues, which heightened their affinity for DNA, resulting

in high levels of circulating ANAs. One hybridoma in particular, 3H9, displayed a strong

specificity for several nuclear antigens, including some self-antigens commonly targeted in SLE

patients such as dsDNA and cardiolipin83. Given its strong affinity for several nuclear antigens and

relevance to human SLE, Weigert and colleagues decided to utilize the 3H9 hybridoma to generate

a novel mouse model for the investigation of DNA-specific B cell tolerance. To do this, they cloned

only the 3H9 heavy chain and utilized a targeting vector to insert it into the heavy chain locus of

the non-autoimmune C57BL/6 line84.

The 3H9 model has several distinct advantages over the HEL system in terms of its

application towards the study of B cell tolerance. Firstly, a key distinguishing factor between this

and the HEL system is that in the 3H9 model the entire endogenous light chain locus remains

intact. This allows the DNA-reactive VH3H9 heavy chain to pair with endogenous light chains to

form BCRs that are exposed to normal B cell tolerance and maturation checkpoints84. The net

result is a polyclonal B cell repertoire that is enriched for DNA-reactivity. Due to the fixed heavy

chain, another major advantage of this model is that it allows for the easy tracking of light chain

usage to study receptor editing and the contributions of specific light chains to self-reactivity84.

Several groups have characterized specific VH3H9/endogenous light chain pairings as conferring

27

specificity to certain nuclear antigens. The pairing of VH3H9 and endogenous Igλ1 light chain is

of particular importance because this combination results in a BCR with high affinity for dsDNA85.

Igλ1+ B cells in 3H9 mice have been shown to be functionally anergic, providing an opportunity

to study a specific population of anergic B cell in this model85. Thus, the 3H9 model represents a

very physiologically relevant model for studying the breakdown of B cell tolerance mechanisms

in SLE due to the heavy emphasis on DNA-reactivity84.

5 – Thesis Hypothesis and Objectives

SLE is a chronic, multi-system autoimmune disease in which genetic and environmental factors

lead to the widespread breach of immune tolerance towards self, ultimately resulting in the

production of ANA and inflammatory tissue damage. As suggested by the presence of ANA in

this disease, factors that impair B cell tolerance mechanisms represent important aspects of disease

pathogenesis that may serve as attractive targets for future therapeutics. Currently, targeted

biologic treatment options for SLE remain extremely limited, with anti-BAFF therapy

(Belimumab) representing the only FDA-approved therapy, which is only effective in a subset of

SLE patients – emphasizing the need for additional targeted therapies in SLE86. As discussed in

the introduction, IFNα has long been known as a central mediator of SLE pathogenesis. IFNα has

been shown to be elevated in the serum of SLE patients, and SLE patient PBMCs display

upregulation of a broad array of genes that are preferentially or specifically induced by IFNα71.

IFNα has also been shown to have a number of direct stimulatory effects on B cells in vitro, such

as enhanced BCR signalling, activation, survival, and differentiation77,87. Despite this, according

to the current classical model of SLE immunopathogenesis, IFNα mainly acts through the

induction of BAFF by mDCs and the priming of T cells. While past studies have heavily explored

the effects of BAFF on B cell tolerance, little work has focused on how IFNα itself may directly

28

affect this process in SLE. Given the effects of IFNα on B cell function and its strong association

with SLE, we hypothesize that elevated levels of IFNα directly contribute to the observed breach

of B cell tolerance in SLE. Further research into the effect of IFNα on B cell tolerance mechanisms

may help to define IFNα and its signalling pathway as effective targets for future SLE therapies.

We aim to test this hypothesis using an adenoviral vector (mDEF201) that produces IFNα, with

the following objectives:

1. Determine the utility of mDEF201 as a tool for the study of the effect of sustained

elevated levels of IFNα on the immune system in vivo

2. Determine the impact of elevated IFNα on DNA-specific B cell tolerance and

autoantibody production in 3H9 mice

3. Assess whether elevated levels of IFNα are sufficient to overcome B cell anergy in

IgHEL/sHEL mice

29

MATERIALS & METHODS

Mice

C57BL/6 (B6) mice expressing knock-in genes for the VH3H9 heavy chain (IgHa) chain were

acquired from Dr. Martin Weigert (University of Chicago). B6 mice expressing transgenes

encoding sHEL (ML5) or IgMa/IgDa heavy and light chains specific for HEL (MD4; IgTg) were

purchased from The Jackson Laboratory (Bar Harbor, ME) and intercrossed to produce ML5/MD4

double transgenic (dTg) mice. All mice were housed in specific pathogen free microisolators at

the Krembil Research Institute animal facility, fed a normal rodent diet, and euthanized by CO2 or

cervical dislocation. Both male and female mice aged 6-8 weeks were used for all experiments as

no differences were seen between the sexes. Experiments which were conducted under protocol

#123 according to the provisions laid out by the Canadian Council on Animal Care.

Adenoviral Vectors

A replication-deficient adenoviral vector (Ad5) expressing murine interferon alpha subtype 5

(mDEF201) as well as an empty control vector (Ad-dI70-3) were obtained from Dr. Jack Gauldie

(McMaster). Experimental mice were injected with either 107 plaque forming units (PFU) of

mDEF201 or Ad-dI70-3 diluted in PBS via the tail vein88. A separate control group also received

200uL PBS tail vein injections. Following injections, mice were housed in a Biosafety level 2

(BSL-2) secured virus room.

Quantifying serum IFN levels and IFIG signature

Serum levels of IFNα were measured using the VeriKine Mouse IFN Alpha ELISA Kit (PBL

Assay Science, NJ), which is capable of detection all 14 subtypes of murine IFNα. Mice were bled

30

at 48h, 1w, 2w, and 4w post infection and blood was centrifuged to obtain serum. Serum was

diluted 1/100 as recommended by the kit manufacturer. Quantitative PCR was utilized to assess

IFN-inducible gene expression. RNA isolation and reverse transcription were performed according

to the manufacturer’s protocols. Briefly, mice were sacrificed and tissue from the liver, bone

marrow, and spleen was obtained. RNA was extracted using a RNeasy Mini Kit (Qiagen,

Germany). RNA was then converted into cDNA with the High-Capacity cDNA Reverse

Transcription Kit (Thermo Fisher Scientific, MA). Real-time quantitative PCR (qPCR) was

performed in triplicates using an ABI 7900 HT (Applied Biosystems, CA) with SYBR green

master mix (Thermo Fisher Scientific, MA), and quantification of relative amounts of mRNA were

performed by the comparative standard curve method and normalized to the housekeeping gene

beta-actin. Primer sequences were obtained through NCBI Primer-BLAST:

GENE FORWARD PRIMER (5’-3’) REVERSE PRIMER (5’-3’)

B-actin TTGCTGACAGGATGCAGAAG GTACTTGCGCTCAGGAGGAG

Baff TTCCATGGCTTCTCAGCTTT CGTCCCCAAAGACGTGTACT

Pkr GGCTCCTGTGTGGGAAGTCA TATGCCAAAAGCCAGAGTCCTT

Ifit1 TGGCCGTTTCCTACAGTTTC GTGAGCCTCAGTGCCTTCTC

Isg15 TGGGACCTAAAGGTGAAGATGCTG TGCTTGATCACTGTGCACTGGG

Irf7 GAAGACCCTGATCCTGGTGA CCAGGTCCATGAGGAAGTGT

2-5’ Oas TGAGCGCCCCCCATCT CATGACCCAGGACATCAAAGG

Mx1 GGTCCAAACTGCCTTCGTAA AACCTGGTCCTGGCAGTAGA

Autoantibody ELISAs

The serum levels of anti-DNA and anti-HEL autoantibodies were measured by ELISA as

previously described89. Briefly, 96-well Immulon 2 HB plates (Thermo Fisher Scientific, MA)

were coated with ssDNA (20 µg/ml) or dsDNA (40μg/mL) derived from calf thymus DNA (Sigma

Aldrich, Germany), or HEL (50μg/mL) (Sigma Aldrich, Germany). Following blocking, plates

were incubated with sera from mice treated with mDEF201, Ad-dI70-3, or PBS at a dilution of

1:50 for 1 hr at room temperature. Wells were then washed with PBS/Tween 20 and incubated at

31

room temperature for 1 hr with either alkaline phosphatase-conjugated IgG or biotinylated anti-

mouse IgMa/ Igλ1. For biotinylated antibodies, plates were incubated for 1 hr with alkaline

phosphatase-conjugated streptavidin (BD Biosciences, CA). Following further washing, p-

nitrophenyl phosphate substrate was added (Sigma-Aldrich, Germany) and the OD (405nm) was

quantified using a Wallac 1420 spectrophotometer (Perkin Elmer, Finland).

Flow Cytometry

Splenocytes and bone marrow cells were stained and analyzed, as previously described89. Briefly,

5x105 RBC-depleted splenocytes were blocked with mouse IgG (Sigma-Aldrich, Germany) for 20

min at 4°C prior to staining with directly-conjugated mAbs, including: PE-labelled anti-CD24

(M1/69), -GL7 (GL7), -CD44 (IM7), -CD86 (GL-1), -CD138 (281-2), FITC-labelled anti-IgMa

(MA-69), -IgG2a (RMG2a-62), -CD62L (MEL-14), -IgD (11-26c.2a), -CD44 (IM7), APC-

labelled anti-CD86 (GL-1), -CD21 (7E1), -PD1 (29F.1A12), -B220 (RA3-6B2), -CD43 (S11),

PeCy7-labelled anti-B220 (RA3-6B2), -CXCR5 (L138D7), -CD11c (N418), -IgM (RMM-1), PB-

labelled anti-CD4 (GK1.5), -SiglecH (551), APC/Cy7-labelled anti-CD23 (B3B4), -B220 (RA3-

6B2), (H1.2F3), -CD11b (M1/70), BV605-labelled anti-CD19 (6D5), -Fas (SA367H8), -CD3

(17A2), all obtained from BioLegend, as well as PE-labelled anti-CD93 (AA4.1) and Biotin-

conjugated anti-Igλ1 (R11-153) from BD-Biosciences. Live cells were detected using 0.6g/mL

propidium iodide (Sigma-Aldrich) or far-red fixable viability stain (ThermoFisher Scientific).

Stained cells were acquired using a BD Canto II flow cytometer (BD Biosciences) and analyzed

using FlowJo software (TreeStar, San Carlos, CA).

Immunofluorescence

32

Splenic tissue was sectioned and stained as previously described89. Briefly, spleens were snap-

frozen in OCT compound (Sakura Finetek, Torrance, CA) at the time of sacrifice. Cryostat spleen

sections (6 µm) were fixed in acetone, washed with PBS, and blocked with 5% fetal bovine serum

in PBS prior to staining with Alexa-Fluor 647-anti-IgD (BioLegend), FITC-anti-IgMa

(BioLegend) and biotin-conjugated anti-PNA (Sigma-Aldrich). Biotinylated Ab staining was

revealed with 7-amino-4-methylcoumarin-3-acetic acid (AMCA)-conjugated streptavidin

(Jackson ImmunoResearch) as a secondary reagent. Stained sections were mounted with

Fluorescent Mounting Medium (Sigma Aldrich, Germany) and tissue fluorescence was visualized

after 24-48 hr using a Zeiss Axio-Observer imaging microscope (Zeiss, Oberkochen, Germany).

Final images were processed using ImageJ software (ImageJ, National Institutes of Health,

Bethesda, Maryland).

Assessing Light Chain Receptor Editing by qPCR

Bone marrow cell suspensions were obtained from mouse femurs, stained with appropriate

fluorescent mAbs, and the late pre-B population (CD43-B220+CD93+IgM-) was sorted using a BD

FACSAria (BD Biosciences) from experimental mDEF201/Ad-dI70-3 infected mice. Sorted

B220+IgM+Igκ+ bone marrow cells from B6 uninfected mice were used as a negative control 90.

Genomic DNA was isolated from sorted B Cells using a DNeasy Tissue Kit (Qiagen). Real-time

qPCR was used to amplify Vκ-RS rearrangement sequences. Briefly, purified genomic DNA (15-

25ng) was mixed with SYBR-green master mix (Thermo Fisher Scientific, MA) and 1μM primers

in a 20μL reaction volume. Cycling conditions were: 95°C for 15 min, followed by 50 cycles at

95°C for 15 s, 60°C for 15 s, and 72°C for 30 s90. The amount of Vk-RS product in each sample

was normalized to the amount of -actin product and then compared with the normalized value in

33

uninfected B6 B220+IgM+Igκ+ B cells to determine relative quantity. Primer sequences are listed

below90.

GENE FORWARD PRIMER (5’-3’) REVERSE PRIMER (5’-3’)

B-actin TGGAAGGGAACAGCCTTCTT GCTGTATTCCCCTCCATCGT

VkRS GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC ACATGGAAGTTTTCCCGGGAGAATATG

Statistics

A Mann–Whitney U non-parametric test was used for comparisons between two treatment groups.

For statistical tests, asterisks indicate a p value of <0.05 (*), <0.01 (**), <0.001 (***) and <0.0001

(****).

34

RESULTS

Infection with mDEF201 leads to sustained elevation of IFNα in vivo

To determine the impact of elevated IFNα on B cell function and tolerance mechanisms, a

replication defective adenovirus encoding murine interferon-alpha subtype 5 (mDEF201) was used

to induce robust elevation of serum IFNα (Fig. 1A). In previous studies, this vector had primarily

been utilized to study the effectiveness of type I IFN in clearing pulmonary viral infections (Yellow

Fever, SARS); thus, its classically described administration route was via intranasal inhalation88,91.

Therefore, it was first necessary to determine whether IV administration of mDEF201 results in

sustained elevations of IFNα. To this end, healthy C57BL/6 (B6) mice were injected with 107 PFU

of mDEF201 and then bled at 48h, 1 week, 2 weeks, and 4 weeks post infection to assess serum

IFNα levels. To control for possible vector-mediated elevation of IFNα, a control group was

injected with 107 PFU of empty Ad5 control vector (Ad-dI70-3), which has the same adenoviral

backbone as mDEF201. A second control group received vehicle (PBS) injections alone.

Mice receiving vehicle control or empty control vector had virtually undetectable levels of

IFNα at all time points assayed (Fig. 1B). These results are consistent with the extremely low

reported levels of serum IFNα in healthy control B6 mice (between 1-5pg/mL), which fell below

the detection limit of the ELISA kit (12.5pg/mL)92,93. In contrast to the control groups, mice

receiving mDEF201 displayed robust elevations of serum IFNα at all time points assayed (Fig.

1B), consistent with reports demonstrating sustained adenoviral gene expression for several weeks

following intravenous injection94,95.

35

To determine whether the immune cells in mDEF201 injected mice were responding

appropriately to this exogenous source of IFNα, the tissue-specific expression of several genes that

are specifically or preferentially regulated by IFNα (2-5’ Oas, Pkr, Mx1, Ifit1, Irf7, Isg15, Baff)

was assessed at two weeks post infection. Consistent with the observed IFNα levels, infection with

empty control vector resulted in no change in the IFNα gene signature; however, infection with

mDEF201 resulted in significant upregulation of many of these genes in the liver, bone marrow,

and spleens of infected mice (Fig. 1C). The liver displayed the greatest upregulation of these genes,

consistent with the role of hepatocytes in the biological sequestration of replication-defective

adenoviral vectors96.

In these preliminary experiments, infection with mDEF201 resulted in several cellular

changes in the B cell compartment at two weeks post infection (Fig. 2). At the time of sacrifice,

mDEF201-treated mice possessed enlarged spleens and a greater number of total splenocytes and

Figure 1: Elevated serum IFNα and IFNα-induced gene expression following infection with mDEF201. (A)

Structural representation of mDEF201, which consists of an Ad5 backbone with deletions in E1/E3 with murine IFNα

inserted under the control of the CMV promoter. (B) Levels of serum IFNα in mDEF201/Ad-dI70-3/PBS treated B6

mice at 48h, 1w, 2w, and 4w post infection. (C) Relative expression of IFNα-inducible genes (2-5’ Oas, Pkr, Mx1,

Ifit1, Irf7, Isg15, Baff) in the liver (left), bone marrow (middle), and spleen (right) at 2 weeks post infection with

mDEF201 or Ad-dI70-3. mRNA levels were normalized to the housekeeping gene B-actin and expressed relative to

PBS-injected mice. Dashed line represents baseline gene expression. Statistical significance was assessed using the

Mann-Whitney U non-parametric test. Asterisks show significance for p<0.05 (*).

36

total B cells when compared to control groups. CD19+ B cells in mDEF201-treated mice also

displayed significant upregulation of CD86 on their surface, a classical marker of B cell activation.

These findings suggest a role for IFNα in promoting B cell survival, differentiation, and activation

– all of which are consistent with the documented effects of IFNα on B cell biology77,87. Given

these findings in healthy B6 mice, mDEF201 was deemed as an appropriate tool for examination

of the effects of elevated levels of IFNα on immune function in-vivo. The 2 week time point was

selected as the experimental time point for all future experiments to allow us to observe the impact

of acute elevation of IFNα on B cell tolerance given that there was no observed differences in

serum IFNα-levels at 2 and 4 weeks post infection (Fig. 1B).

Figure 2: Altered B cell homeostasis following elevation of IFNα in B6 mice. (A) Representative gating strategy

CD19+ B Cells. (B) Representative gating strategy for the gating of CD86+ B Cells. Cells have been pre-gated on

CD19+ cells as shown in panel A. (C) Representative image of splenomegaly in mDEF201-treated C57Bl/6 mice at

two weeks post infection and scatter plots showing the total number of splenocytes, total number of B cells, and

frequency of CD86+ B cells following injection with PBS, control vector (designated empty) or mDEF201

(designated IFNa). Significance was determined using the Mann-Whitney non-parametric test with p values shown

as p<0.05 (*), p<0.01 (**).

37

Abnormal B cell homeostasis in 3H9 mice occurs with elevated IFNα levels

Expression of the 3H9 heavy chain on a B6 genetic background has previously been shown to

cause a significant reduction in the total number of peripheral B cells57. This reduction is thought

to occur largely due to peripheral tolerance mechanisms restricting the survival and differentiation

of autoreactive B cells in these mice50,84,97. To determine if elevated levels of IFNα affect these

processes, the total number of splenic B cells was quantified for PBS, empty vector, and

mDEF201-treated 3H9 mice. Compared to PBS and empty vector treated mice, mice receiving

mDEF201 had splenomegaly and a significant increase in the total number of splenocytes as well

as CD19+B220+ B cells (Fig. 3A). This finding is consistent with the role of IFNα in promoting B

cell survival and proliferation87.

IFNα has been shown to interfere with the early stages of lymphocyte development by

impairing IL-7-dependent proliferation of pro-B cells98. Consistent with this, we observed a

blockade of B cell development within the bone marrow following elevated IFNα levels.

Compared to PBS and empty vector treated mice, mDEF201-treated mice displayed increased

frequencies of Pre-Pro and Pro-B cells and decreased frequencies of Pre-B cells, signifying a

blockade at earlier developmental stages (Fig. 3B). While this finding suggested that elevated

levels of IFNα might result in fewer B cells capable of egressing the bone marrow to join the

immature peripheral pool, no difference in the total number of CD93+B220+ peripheral immature

B cells was found between PBS, empty, and mDEF201-treated 3H9 mice (Fig. 3C). This finding

raised the possibility that elevated levels of IFNα may enhance the capacity of immature B cells

to survive in the periphery in 3H9 mice.

38

To further explore whether elevated IFNα levels conferred a survival advantage to the

immature B cells in mDEF201 injected mice, the relative frequencies and total numbers of splenic

B cell subsets were assessed. Compared to PBS and empty vector treatment, mDEF201-treated

mice displayed a striking shift in the frequencies of splenic B cells from more immature

phenotypes (T1 & T2) towards more mature phenotypes (MZ & FoB). Consistent with this,

mDEF201-treated mice also displayed significant increases in the total numbers of mature FoB

Figure 3: Influence of elevated IFNa on the B cell compartment of 3H9 mice. (A) Representative image of

splenomegaly in mDEF201-treated 3H9 mice at two weeks post infection and scatter plots showing the total number

of splenocytes, spleen weight, and total number of CD19+B220+ B cells in each treatment group. B cells were pre-

gated on live cells (PI-) as shown in figure 2. (B) Representative gating strategy for the gating of Pre-Pro (CD43+CD19-

), Pro (CD43+CD19+), and Pre (CD43-CD19+) B cells within the bone marrow of 3H9 mice and a scatter plot depicting

the summed frequencies of developmental B cell stages in each experimental group. Representative plots are pre-gated

on live B220+IgD- cells to capture immature cells. (C) Representative gating strategy for the gating of CD93+B220+

immature B cells in the spleens of 3H9 mice two weeks post infection and a scatter plot depicting the number of

immature B cells within the spleen in each experimental group. Significance was determined using the Mann-Whitney

non-parametric test with p values shown as p<0.05 (*), p<0.01 (**), <0.001 (***) and <0.0001 (****).

39

and MZ B cells (Fig. 4B). Expansion of the follicular compartment was of particular interest due

to several studies demonstrating a key role for follicular exclusion in restricting the B cell

repertoire in non-autoimmune 3H9 mice, suggesting this process may be impaired with elevation

of IFNα levels84,99. Interestingly, although the total number of T1 B cells was decreased in

mDEF201-treated mice, these mice displayed a significant increase in the total number of T2 B

cells, suggesting an enhanced capacity of immature B cells to survive the T1-T2 transition in the

periphery. Taken together, these findings emphasize a role for elevated IFNα levels in promoting

the survival of immature B cells, allowing them to reach the mature B cell compartment.

Figure 4: Influence of elevated IFNa levels on splenic B cell subsets (A) Representative gating strategy for the

gating of Transitional 1 (CD24+CD21-), Transitional 2 (CD24+CD21int), Marginal Zone (CD24+CD21hi), and

Follicular (CD24loCD21int) B cells in PBS, empty vector, and mDEF201-treated mice at 2 weeks post infection. Cells

were pre-gated on live CD19+ cells as depicted in figure 2. (B) Scatter plots depicting the frequency and total number

of transitional 1, transitional 2, marginal zone, and follicular B cells as gated in panel A Significance was determined

using the Mann-Whitney non-parametric test with p values shown as p<0.05 (*), p<0.01 (**).<0.001 (***) and

<0.0001 (****).

40

Enhanced B cell activation and germinal center formation in 3H9 mice with elevated IFNα

levels

To determine if elevated levels of IFNα had any impact on the baseline activation of B cells in

vivo, the surface expression of CD86, a classical B cell activation marker, was assessed. Compared

to PBS and empty vector treatment, CD19+ B cells in mDEF201-treated mice displayed a

significant increase in CD86 expression (Fig. 5A). This enhanced level of activation was seen in

both the immature and mature B cell compartments, signifying a global increase in B cell activation

(Fig. 5B). These findings are consistent with the stimulatory effects of IFNα on B cells in vitro77.

Previous studies have demonstrated that in addition to survival and differentiation, the

recruitment of DNA-reactive B cells to germinal centers in non-autoimmune 3H9 mice is also

restricted100. Given the enhanced activation and differentiation state of splenic B cells in 3H9 mice

Figure 5: Influence of elevated IFNa on B cell activation (A) Scatter plot depicting the upregulation of CD86 on

the surface of CD19+ B cells in PBS, empty vector, and mDEF201-treated mice and representative flow plots

demonstrating upregulation of CD86 with mDEF201-treatment. CD86 staining was determined with an FMO as

shown in figure 2. (B) Scatter plots showing the upregulation of CD86 on the surface of B cells in PBS, empty vector,

and mDEF201-treated mice within the immature (left) and mature (right) compartment. CD86 staining was

determined with an FMO as shown in panel A and figure 2. Significance was determined using the Mann-Whitney

non-parametric test with p values shown as p<0.05 (*), p<0.01 (**).<0.001 (***) and <0.0001 (****).

41

in the context of elevated IFNα, we examined whether IFNα had any impact on the capacity of

these cells to form spontaneous germinal centers. mDEF201-treated mice had a significant increase

in the proportion of IgMa+ germinal center B cells compared to control groups (Fig. 6A).

Interestingly, mDEF201-treated mice also displayed a significant increase in the proportion of

IgG2aa+ germinal center B cells, suggesting an enhanced capacity for B cell Ig class-switching

with elevated levels of IFNα (Fig. 6B). Immunofluorescence microscopy confirmed the presence

of B cells expressing the DNA-reactive 3H9 heavy chain within germinal centers (Fig. 6C). Given

the crucial role of germinal centers in the production of high-affinity classed switched antibodies

in SLE, these data suggest that elevation of IFNα may set the stage for the production of highly

pathogenic autoantibodies.

42

Enhanced autoantibody production in 3H9 mice with elevated IFNα levels

Given the observed increases in B cell survival, activation, differentiation, and germinal center

recruitment in the context of elevated IFNα levels, all suggestive of impaired immune tolerance

Figure 6: Influence of elevated IFNa on spontaneous GC recruitment in 3H9 mice. (A) Scatter plot showing the

frequency of IgMa+B220+GL7+CD95+ germinal center B cells in PBS, empty vector, and mDEF201-treated mice

(left). Representative gating strategy for the gating of IgMa+ germinal center B cells (GL7+CD95+) (Right). Cells are

pre gated on Live (PI-) B220+IgMa+ cells. (B) Scatter plot showing the frequency of IgG2aa+B220+GL7+CD95+

germinal center B cells in PBS, empty vector, and mDEF201-treated mice (left). Representative gating strategy for

the gating of IgG2aa+ germinal center B cells (GL7+CD95+ (right). Cells are pre gated on live (PI-) B220+IgG2aa+

cells. (C) Representative 10X and 20X magnification (inset) IF microscopy images of splenic sections taken from

empty vector and mDEF201-treated mice showing the absence (left) and presence (right) of germinal centers (Red:

IgD Alexa Fluor-647, Green: FITC IgMa, Blue: PNA-AMCA). Significance was determined using the Mann-

Whitney non-parametric test with p values shown as p<0.05 (*), p<0.01 (**), <0.001 (***) and <0.0001 (****).

43

mechanisms, we were interested to see if these changes coincided with increased proportions of

antibody-secreting cells and serum autoantibody levels. As previously mentioned, B6 mice

expressing the 3H9 heavy chain normally have extremely low levels of circulating anti-nuclear

antibodies; thus, increases in circulating ANAs can be interpreted as a hallmark of breached B cell

tolerance in this model.

mDEF201-treated mice had a significant increase in the proportion of long-lived CD138+

plasma cells within the bone marrow when compared to control groups, although no differences

were seen in splenic CD138+ plasma cells or plasmablasts (Fig. 7A&B). Consistent with the

observed expansion of antibody-secreting cells within the bone marrow, mDEF201-treated mice

had significant increases in the levels anti-ssDNA and anti-ssDNA IgMa autoantibodies (Fig. 7C).

Significant but less marked increases in the levels of IgG anti-ssDNA and anti-dsDNA

autoantibodies were also seen, confirming the idea that elevated levels of IFNα promote class

switching of DNA-reactive B cells that was suggested by the presence of IgG2aa+ germinal center

B cells (Fig. 6B). Taken together, these findings strongly suggest a role for IFNα in promoting a

breach of B cell tolerance in 3H9 non-autoimmune mice.

44

Minimal alterations to T cell homeostasis in 3H9 mice following elevated IFNα levels

Since T cells provide stimulatory and survival signals to B cells, we questioned whether the

observed breach of B cell tolerance following elevation of IFNα was the result of increased T cell

help. To assess this possibility, the CD4+ T cell compartment was examined for changes in

differentiation or activation. Consistent with enlargement of the spleen and an increase in the total

number of splenocytes, mice treated with mDEF201 had a significant increase in the total number

of CD3+CD4+ T cells compared to control groups (Fig. 8A). Despite the expansion of the T cell

Figure 7: Tolerance to nuclear antigens is lost in 3H9 mice with elevation of IFNa. (A) Representative gating

strategy and FMO for the gating of B220-CD138+ plasma cells and B220+CD138+ plasmablasts in 3H9 mice two

weeks post treatment with PBS, empty control vector, or mDEF201. Pre-gated on live cells. (B) Scatter plots showing

the frequency of plasma cells and plasmablasts in the bone marrow (left) and spleen (right) for the 3 treatment groups.

(C) Scatter plots showing the levels of IgMa and IgG anti-ss/dsDNA autoantibodies in the serum of 3H9 mice two

weeks post injection with PBS, empty control vector, or mDEF201, as measured by ELISA. Serum samples were

diluted 1:50 for all assays and OD values are shown. Significance was determined using the Mann-Whitney non-

parametric test with p values shown as p<0.05 (*), p<0.01 (**).<0.001 (***) and <0.0001 (****).

45

compartment, comparable proportions of naïve/effector/memory T cells were observed across all

3 treatment groups (Fig. 8B). Nevertheless, the elevated levels of IFNα in mDEF201-treated mice

did result in a significant increase in T cell activation as measured by upregulation of CD69 (Fig.

8C); however, the magnitude of this increase was small. These findings suggest that the effects of

IFNα on the T cell compartment are less generalized that those on the B cell compartment and

appear to affect a relatively minor proportion of these cells.

Figure 8: Minimal alterations to the T cell compartment following elevated IFNa in 3H9 mice. (A) Representative

gating strategy for the gating of CD3+CD4+ T cells and a scatter plot showing the total number of CD3+CD4+ T cells

in 3H9 mice treated with PBS, empty control vector, and mDEF201. (B) Representative gating strategy for naïve

(CD62L+CD44lo), effector (CD62L-CD44lo) and memory (CD62L-CD44hi) T cells in PBS, empty vector, and

mDEF201-treated 3H9 mice and a scatter plot showing the frequency of naïve/effector/memory T cells across the 3

treatment groups. Cells were pre-gated on CD3+CD4+ cells as shown in panel A. (C) Representative gating strategy

and FMO for the gating of CD69+ T cells and a scatter plot showing the frequency of CD69+ CD3+CD4+ T Cells. T

cells were pre-gated on CD3+CD4+ as shown in panel A. Significance was determined using the Mann-Whitney non-

parametric test with p values shown as p<0.05 (*), p<0.01 (**).<0.001 (***) and <0.0001 (****).

46

Expansion of pathogenic T and B cell subsets in 3H9 mice with elevated IFNα levels

Given the lack of large scale changes in the T cell compartment, we investigated whether the

elevated levels of IFNα in mDEF201-treated mice had an effect on specific T cell populations that

have previously been shown to provide support for autoantibody producing cells in mice and

humans. Therefore, the frequency of CD4+PD-1hiCXCR5+ Tfh cells that provide help in germinal

centres and CD4+PD-1hiCXCR5- T peripheral helper cells (Tph) that provide help for extra-

follicular responses were examined. Tph cells function in a similar fashion to Tfh cells, expressing

several costimulatory molecules and cytokiens that act to provide B cell help. These cells have

been shown to be expanded within the joints of patients within rheumatoid arthritis, where they

are thought to promote the activation and differentiation of autoreactive B cells101. While no

differences in the relative frequency of Tfh cells were observed between the three treatment groups,

an expansion of Tph cells was seen in 3H9 mice treated with mDEF201 (Fig. 9A). Therefore, IFNα

may have a role in promoting the differentiation of these cells, which may in turn contribute to the

peripheral activation of autoreactive B cells.

Recently, the expansion of a unique population of B cells called age-associated B cells

(ABCs) has been shown to occur in a subset of SLE patients, particularly those with high levels of

disease activity and ANAs102,103. ABCs have also been identified in mice and have been shown to

expand normally with age; however, they accumulate prematurely in an autoimmune setting104.

Surprisingly, mDEF201-treated mice displayed significant expansion of CD11c+CD11b+ ABCs at

just 6-8 weeks of age (Fig. 9B). This finding was particularly interesting in the context of our

previous findings demonstrating increased autoAb production due to the potential link between

elevated serum IFNα levels, ABC expansion, and ANAs in SLE patients. Also of interest is the

fact that ABC expansion occurred alongside Tph expansion, as Tph cells produce high levels of IL-

47

21, a cytokine which has been shown to promote the development of ABCs103. To conclude, these

findings suggest that IFNα may play a crucial role promoting breaches of B cell tolerance through

the induction of pathogenic T and B cell subsets, such as Tph and ABCs.

Decreased Receptor Editing in 3H9 mice following elevated IFNα levels

One of the major strengths of the 3H9 model is the fixed nature of the BCR heavy chain, allowing

for the specificities and properties of various endogenous light chain and 3H9 heavy chain pairings

to be extensively studied. Pairing of the 3H9 heavy chain with the endogenous Igλ1 light chain

results in a BCR with high-affinity for dsDNA85. This population of Igλ1+ B cells has been shown

to display some of the characteristics of anergic B cells, such as a reduced lifespan and reduced

capacity for proliferation85. Thus, by focusing on Igλ1+ B cells, the 3H9 model gave us the

opportunity to examine the impact of elevated IFNα on B cell anergy. Given its observed impact

Figure 9: Expansion of pathogenic T and B cell subsets in 3H9 mice following the elevation of IFNa levels (A)

Representative gating strategy for the gating of CXCR5+PD-1hi T follicular helper cells and CXCR5-PD-1hi T peripheral

helper cells in PBS, empty vector, and mDEF201-treated 3H9 mice and scatter plots showing the frequency of T

follicular helper and T peripheral helper cells across the 3 treatment groups. Pre-gated on CD3+CD4+ T cells as shown

in figure 8A. (B) Representative gating strategy for the gating of CD11c+CD11b+ age associated B cells from PBS,

empty vector, and mDEF201-treated mice and a scatter plot showing the frequency of ABCs across the 3 treatment

groups. Pre-gated on CD19+B220+. Significance was determined using the Mann-Whitney non-parametric test with p

values shown as p<0.05 (*), p<0.01 (**), <0.001 (***) and <0.0001 (****).

48

on B cell survival, activation, and differentiation, we anticipated that elevated IFNα levels may

also lead to the expansion of the Igλ1+ anergic B cell population. This turned out to not be the case,

as mice treated with mDEF201 actually had a decrease in the frequency of Igλ1+ B cells within the

spleen compared to control groups (Fig. 10A).

Previous studies have demonstrated that Igλ1+ B cells in 3H9 mice are subject to clonal

deletion; therefore, the relative frequencies of immature Igλ1+ B cells within the bone marrow and

spleens of mDEF201-infected mice were compared to determine if there was enhanced peripheral

deletion of these cells following the elevation of IFNα levels85. However, the same decrease in

frequency of immature Igλ1+ B was seen within the bone marrow of mDEF201-treated mice (Fig.

11A), suggesting that these cells are not experiencing further deletion in the periphery but are

instead being generated to a lesser extent in the context of elevated IFNα levels.

Figure 10: Decreased frequency of splenic Igλ1+ B cells in 3H9 mice with elevated IFNa (A) Representative

gating strategy for the gating of splenic CD19+ Igλ1+ B cells in PBS, empty vector, and mDEF201-treated 3H9 mice

and a scatter plot showing the frequency of Igλ1+ B cells across the 3 treatment groups. Pre-gated on live cells as

shown in figure 2. Significance was determined using the Mann-Whitney non-parametric test with p values shown as

p<0.05 (*), p<0.01 (**).

49

In mice, exhaustive receptor editing at the Igκ light chain locus is required before B cells

begin to rearrange Igλ light chain genes105. Previous studies have demonstrated that specific factors

and cytokines capable of altering the strength of BCR signalling may in turn alter receptor editing

within the bone marrow57,77; thus, the elevated levels of IFNα in mDEF201-treated mice which are

known to enhance BCR signalling, may be having an effect on receptor editing, which could in

turn explain the decrease in proportion of immature Igλ1+ B cells following mDEF201 treatment.

To quantify the relative levels of receptor editing between each treatment group, the

frequency of the VκRS rearrangement sequence within sorted pre-B cells was measured, which

forms within the Igκ light chain locus following exhaustive editing of the kappa locus (Fig. 12A).

Compared to empty-vector infected mice, mDEF201-treated mice displayed a significant decrease

in the relative abundance of the VκRS rearrangement sequence (Fig. 12B), signifying a decrease

in the overall level of B cell receptor editing within the bone marrow. These findings are consistent

with the sharp decrease in the relative frequency of Igλ1+ immature B cells within the bone marrow

and peripheral B cell compartment, suggestive of a role for IFNα in altering the BCR signalling

threshold leading to reduced receptor editing, and thus potentially allowing self-reactive cells to

egress to the periphery.

Figure 11: Decreased frequency of immature Igλ1+ B cells within the bone marrow of 3H9 mice following

elevation of IFNa levels (A) Representative gating strategy for the gating of immature CD19+ Igλ1+ B cells within

the bone marrow of empty vector, and mDEF201-treated 3H9 mice and a scatter plot showing the frequency of bone

marrow immature Igλ1+ B cells across the 3 treatment groups. Pre-gated on live B220+IgD- cells. Significance was

determined using the Mann-Whitney non-parametric test with p values shown as p<0.01 (**).

50

Impaired B Cell Anergy in 3H9 mice following elevated IFNα levels

While the generation of Igλ1+ B cells was observed to be impaired due to decreased levels of

receptor editing, this population of highly DNA-reactive B cells was still present in the periphery

of the IFNα treatment group and thus could be examined for abnormalities in B cell anergy.

Previous studies have demonstrated that on a non-autoimmune background, in addition to

experiencing deletion, Igλ1+ B cells are subject to follicular exclusion50,84. Thus, the frequency of

Igλ1+ cells within the various peripheral B cell compartments was examined to determine if

elevated levels of IFNα had any impact on the follicular exclusion of these cells.

Figure 12: Decreased receptor editing in 3H9 mice following elevation IFNa (A) Representative schematic of B

cell receptor editing and formation of the VκRS. Exhaustive rearrangement of the Igκ locus results in the

rearrangement of an upstream Vκ with the RS, which results in the formation of the VκRS sequence, signalling the

initiation of lambda chain rearrangement. (B) Representative gating strategy for the sorting of pre-B cells (Left). Pre-

gated on live B220+CD43- Fr. D and then sorted on the CD93+IgM- Fr. D pre-B cell population. A scatter plot showing

the relative abundance of VκRS rearrangement sequences within pre-B cells between empty vector and mDEF201-

treated 3H9 mice. Amount of VκRS product was normalized to β-actin expression and expressed relative to the amount

of VκRS detected within B220+IgM+Igk B cells sorted from control B6 mice. Significance was determined using the

Mann-Whitney non-parametric test with p values shown as p<0.05 (*).

51

Compared to control groups, mDEF201-treated mice displayed decreased frequencies of

Igλ1+ B cells within the T1, T2, and MZ compartment; however, no difference was observed in

the follicular compartment (Fig. 13A). In terms of total cell numbers, the mDEF201-treatment

group demonstrated a significant loss of Igλ1+ cells from within the immature T1 compartment,

consistent with our previous finding demonstrating reduced egress of these cells from the bone

marrow (Fig. 13A). Interestingly, this large loss of Igλ1+ T1 cells coincided with a significant

increase in the total number of Igλ1+ follicular B cells. As follicular exclusion is thought to take

place during the transition from the transitional to follicular B cell compartment, the simultaneous

loss of T1 cells and expansion of FoB cells suggests that increased levels of IFNα may impair this

important tolerance checkpoint. The ratio of total Igλ1+ follicular mature:transitional 1 B cells is

significantly increased in the mDEF201-treatment group, further emphasizing the idea of impaired

follicular exclusion in these mice (Fig. 13B).

52

In addition to follicular exclusion, some of the other hallmarks of B cell anergy include

impaired upregulation of CD86, impaired recruitment into germinal centers, and downregulation

of surface Ig due to chronic BCR engagement106. Given the abnormal follicular exclusion of Igλ1+

B cells in the context of elevated IFNα levels, we examined whether these other aspects of B cell

anergy were also disrupted in Igλ1+ B cells. Consistent with this possibility, Igλ1+ B cells in mice

treated with mDEF201 had significantly higher levels of surface Ig, were more activated, and

demonstrated enhanced germinal center recruitment as compared to control groups (Fig. 14A&B).

Despite this, we did not observe an increase in the levels of anti-dsDNA Igλ1 autoantibody levels

in these mice (Fig. 14C), suggesting that while B cell anergy may be impaired, other peripheral

Figure 13: Impaired follicular exclusion in 3H9 mice following elevation of IFNa levels (A) Scatter plots showing

the frequency (left) and total numbers (right) of Igλ1+ B cells within the splenic T1, T2, MZ, and FoB cell

compartments. T1/T2/Mz/Fo cells were gated as shown in figure 5, and within these sub-populations, CD19+Igλ1+

cells were gated as shown in figure 9. (B) A scatter plot showing the ratio of total Igλ1+ follicular B cells to total Igλ1+

transitional 1 B cells, as shown in figure 13A. Significance was determined using the Mann-Whitney non-parametric

test with p values shown as p<0.05 (*).

53

tolerance mechanisms appear to remain intact preventing a full-scale breach of B cell anergy in

these mice.

Figure 14: Partially impaired B cell anergy in 3H9 mice following elevation of IFNa levels (A) Representative

gating strategy for the gating of CD19+Igλ1+ IgMahi B Cells. Cells were pre-gated on live CD19+Igλ1+ cells as shown

in figure 9. (B) Scatter plots showing the summed frequencies of IgMahi CD19+Igλ1+ B cells (left), CD86-expressing

CD19+Igλ1+ B cells (middle), and CD95+GL7+ CD19+Igλ1+ germinal center B cells (right). All cells were pre-gated

on CD19+Igλ1+ as shown in figure 10, with subsequent IgMahi gating shown in panel A, CD86+ gating shown in

figure 2, and germinal center gating shown in figure 6. (C) Scatter plot showing the levels of Igλ1 anti-dsDNA

autoantibodies in the serum of 3H9 treated with PBS, empty control vector, or mDEF201, as measured by ELISA.

Serum samples were diluted 1:50 for all assays and OD values are shown. Significance was determined using the

Mann-Whitney non-parametric test with p values shown as p<0.05 (*), p<0.01 (**).<0.001 (***) and <0.0001 (****).

54

Altered B Cell Homeostasis in IgHEL/sHEL mice following elevated IFNα levels

To determine whether the impaired central and peripheral B cell tolerance mechanisms in the 3H9

model could be generalized to other non-nuclear antigens, the IgHEL/sHEL double transgenic

mouse model was examined. As mentioned in the introduction, this is a classical mouse model of

B cell anergy where the B cell compartment is significantly contracted, even more so than in the

3H9 model, due to the impaired survival and maturation of B cells expressing the highly reactive

HEL-specific BCR when in the presence of sHEL, expressed as a pseudo self-antigen82,107.

Elevation of IFNα levels in HEL/sHEL double transgenic mice resulted in several changes

to the peripheral B cell compartment that were consistent with our findings in the 3H9 model.

Compared to PBS and empty vector treatment, mDEF201-treated mice had a significant increase

in the total number of splenocytes, enlarged spleens, and an increase in the total number of B cells

(Fig. 15A). mDEF201-treatment was also associated with a significant increase in B cell activation

as measured by upregulation of CD86 (Fig. 15A). The expansion and enhanced activation of a

highly self-reactive and classically anergic population of B cells provides further support for the

role of elevated IFNα levels in disrupting B cell tolerance mechanisms. Consistent with what was

observed for Igλ1+ B cells inmDEF201-treated 3H9 mice, IgHEL/sHEL mice treated with

mDEF201 had a significant decrease in the overall frequency of immature transitional 1 and 2 B

cells in the periphery, as well as a significant increase in the frequency of mature follicular B cells

(Fig. 15B). This relative expansion of the follicular compartment was also seen in terms of total

cell numbers (Fig. 15B). These findings provide further evidence that elevated levels of IFNα

disrupt the follicular exclusion of autoreactive B cells, an important aspect of B cell tolerance.

Again, these alterations to the B cell compartment occurred alongside minimal alterations to T cell

55

activation and homeostasis, suggesting that they occur largely independent of T cell help (Fig.

15C).

Disruption of B cell anergy in IgHEL/sHEL mice with elevated IFNα levels

Consistent with our findings in 3H9 mice, treatment of HEL mice with mDEF201 resulted in

increased recruitment of HEL-specific B cells to germinal centers when compared to control

groups (Fig. 16A). This expansion occurred alongside a significant increase in the frequency of

Figure 15: Altered B cell homeostasis in IgHEL/sHEL mice following elevation of IFNa levels (A) Scatter plots

showing the total number of splenocytes (left), spleen weight (middle left), total number of CD19+B220+ B cells

(middle right) and frequency of activated CD86+ B cells (right) in PBS, empty vector, and mDEF201-treated

IgHEL/sHEL mice. CD19+B220+ B cells and CD86+ expression was gated as shown in figure 2. (B) Scatter plots

showing the frequency (left) and total numbers (right) of T1/T2, follicular, and marginal zone B cells at 2 weeks post

infection. Cells were gated as shown in figure 5. (C) Scatter plots showing the total numbers of CD3+CD4+ T cells

(left), frequency of CD69+ T cells (middle), and frequencies of naïve, effector, and memory T cells (right) at 2 weeks

post infection. T cells were gated as shown in figure 8. Significance was determined using the Mann-Whitney non-

parametric test with p values shown as p<0.05 (*), p<0.01 (**), <0.001 (***) and <0.0001 (****).

56

long lived CD138+ plasma cells within the bone marrow of mDEF201-treated mice; although, as

was the case in the 3H9 model, no differences were seen in splenic plasma cell frequencies (Fig.

16B). Crucially, treatment with mDEF201 was also associated with a significant increase in the

levels of anti-HEL IgMa antibodies, signifying a breach of B cell anergy in this model (Fig. 16B).

Due to the monoclonality of the BCR repertoire, virtually all of the B cells within HEL

mice are subject to the same tolerance mechanisms, including the induction of anergy82,106.

Because of this, IgHEL/sHEL mice have been shown to display significant expansion of

transitional 3 (T3) B cells, a population that appears at a very low frequency in non-transgenic

mice106. T3 B cells have been shown to represent anergic B cells in the periphery, which are

shunted off the normal T1→T2→mature B cell pathway and prevented from further

maturation48,108. Interestingly, HEL mice treated with mDEF201 displayed a significant decrease

in the relative frequency of T3 B cells when compared to PBS and empty vector-treated mice (Fig.

16C). This result is consistent with previous findings demonstrating that T3 B cells are reduced in

murine models of lupus, and suggests a role for IFNα in disrupting or rescuing autoreactive B cells

following the induction of anergy108.

57

Expansion of pathogenic T, but not B cells, in HEL mice following elevated IFNα levels

Consistent with our previous findings, elevation of IFNα levels had no impact on the overall

frequency of Tfh cells; however, it was again associated with a significant increase in the frequency

of Tph cells (Fig. 17A). Despite this expansion of Tph cells, no differences were seen in the

frequency of ABCs in mDEF201-treated HEL mice (Fig. 17B). This finding suggests that while

elevated IFNα levels may help to promote the development of ABCs, other factors or signals that

Figure 16: Disruption of B cell anergy in HEL mice following elevation of IFNα (A) Representative gating strategy

for the gating of GL7+CD95+ germinal center B cells and a scatter plot showing the frequency of germinal center B

cells in PBS, empty vector, and mDEF201-treated HEL mice. Cells were pre-gated on live B220+IgMa+ cells. (B)

Scatter plots showing the frequency of CD138+ plasma cells within the bone marrow (left) and spleen (middle) of PBS,

empty vector, and mDEF201-treated HEL mice. Plasma cells were gated as shown in figure 7. (Right) Scatter plot

showing the levels of IgMa anti-HEL antibodies in the serum of HEL post injection with PBS, empty control vector,

or mDEF201, as measured by ELISA. Serum samples were diluted 1:50 for all assays and OD values are shown.

Significance was determined using the Mann-Whitney non-parametric test with p values shown as p<0.05 (*), p<0.01

(**), <0.001 (***) and <0.0001 (****).

58

are present in the 3H9 model, such as synergistic TLR signalling, are also required to induce the

premature accumulation of these cells.

Figure 17: Expansion of T peripheral helper cells in IgHEL/sHEL mice following elevation of IFNa levels (A)

Representative gating strategy for the gating of CXCR5hiPD-1+ T follicular helper cells and CXCR5-PD-1+ T

peripheral helper cells in HEL mice treated with PBS, empty vector, or mDEF201 at 2 weeks post infection (left)

and scatter plots showing the frequency of Tfh (middle) and Tph (right) cells. Cells were pre gated on live CD3+CD4+

cells. (B) Representative gating strategy for the gating of CD11c+CD11b+ age associated B cells in HEL mice treated

with PBS, empty vector, or mDEF201 at 2 weeks post infection (left) and a scatter plot showing the summed

frequency of ABCs across the 3 treatment groups. ABCs were pre-gated on live B220+CD19+ cells. Significance was

determined using the Mann-Whitney non-parametric test with p values shown as p<0.05 (*).

59

DISCUSSION

Our lab has previously demonstrated elevated levels of serum IFNα as well as increased expression

of IFN-inducible genes in SLE patients71,109,110. While it has been very well established that IFNα

plays an important role in SLE, its exact role in immunopathogenesis with respect to breaching

immune cell tolerance has not yet been fully elucidated. Here, we have utilized two murine models

possessing self-reactive BCR repertoires in combination with an adenoviral vector to further study

the direct effects of elevated IFNα levels on B cell tolerance mechanisms in vivo.

As discussed in the introduction, IFNα has been shown to have a number of direct

stimulatory effects on B cell function, including enhanced activation, signalling, and

differentiation, that may potentially contribute directly to the disruption of B cell tolerance seen in

SLE77,78. Despite this, a significant amount of research has focused on other immune cytokines,

particularly BAFF, as potential therapeutic targets or drivers of disease. Due to its crucial role in

promoting B cell survival, BAFF has been heavily implicated in modulating autoimmunity, and

currently represents the only FDA-approved targeted therapy in SLE111. As a result, the current

classical model of SLE emphasizes the role of BAFF, in addition to T cell co-stimulation, as the

major drivers of disease pathogenesis, whereas IFNα plays more of a priming role, helping to

activate myeloid DCs and T cells54. While the role of BAFF in SLE cannot be understated, we

believe that IFNα and BAFF may share a number of redundant effects on B cell function, and that

IFNα itself may contribute significantly to the breach of B cell tolerance in SLE through direct

interactions with B cells. In support of this idea, our lab has already published data demonstrating

that B cells isolated from SLE patients display several abnormalities, such as BCR hyper-

responsiveness, reduced apoptosis, and enhanced proliferation, that may be related to IFNα

60

signalling. These abnormalities could be replicated in healthy control B cells following incubation

with IFNα or SLE patient serum, and abrogated by the addition of anti-IFNα Ab79. This thesis

aimed to expand on these findings and further investigate the mechanisms by which IFNα may

directly disrupt B cell tolerance mechanisms.

For the purposes of this thesis we decided to utilize BCR-modified mice, the 3H9 and HEL

models, which both possess clean readouts of breached B cell tolerance, that being increases in

anti-DNA and anti-HEL autoAb respectively. By treating these mice with an adenoviral vector

encoding murine IFNα, we were able to replicate the elevation of serum IFNα and induction of

IFN-inducible gene expression that is seen in human SLE patients. These model systems allowed

us to examine the impact of elevated IFNα on B cell repertoires enriched for autoreactivity on an

otherwise non-autoimmune B6 genetic background. The genetic background of these mice is

crucial to our observations, as it has previously been demonstrated that the 3H9 Ig heavy chain

and the HEL-specific transgenic BCR, in the presence of cognate antigen alone, is not enough to

induce autoAb production in non-autoimmune mice82,84. Thus, these models have been heavily

utilized for the study of B cell tolerance mechanisms that function to limit autoAb

production50,57,82,89,100. Interestingly, elevating IFNα levels to those seen in lupus in these mice was

sufficient to significantly increase the levels of both anti-DNA and anti-HEL antibodies after just

two weeks post infection. These findings indicate that the elevation of IFNα levels alone, in the

absence of lupus susceptibility genes known to alter B cell function, leads to significant

impairment of otherwise intact immune tolerance mechanisms. Notably, this occurred in the

absence of elevated levels of BAFF gene expression, suggesting that IFNα is directly modulating

B cell tolerance.

61

To better understand the immunological changes associated with these increases in

autoantibody production, we monitored immune cell populations at the 2 week time point for other

signs consistent with a breach in the various tolerance checkpoints that have been shown to

regulate self-reactivity and autoantibody production. One of the most striking observations at the

time of sacrifice was the significant enlargement of the spleens in mDEF201-treated 3H9 mice. A

defining feature of the 3H9 IgH model is the significant reduction in both size and cellularity of

secondary lymphoid organs, including the spleen57,85,106. As alluded to earlier, it has been well

established that this restriction in size of the peripheral B cell compartment in non-autoimmune

3H9 mice occurs as a result of functioning B cell tolerance checkpoints. Receptor editing and

deletion of autoreactive cells within the bone marrow, coupled with the induction of anergy and

follicular exclusion in the periphery, act to severely restrict the survival and maturation of cells

with a DNA-reactive BCR50,85,97. Immunophenotyping of the splenic B cell compartment revealed

that this expansion of peripheral B cells occurred almost exclusively within the mature B cell

compartment, indicative of an enhanced capacity for transitional B cells to survive and

differentiate towards a more mature state.

As mentioned in the introduction, the T1 B cell stage is highly prone to spontaneous

apoptosis following BCR engagement, where an additional 10% of autoreactive cells are deleted

in the periphery of healthy individuals43. Importantly, B cells only gain full BAFF responsiveness

at the T2 stage; thus, BAFF is unable to rescue highly autoreactive T1 cells from this deletion112.

However, as previously mentioned, work by our lab has already demonstrated that T1 B cells from

SLE patients display several IFNα-mediated abnormalities, including reduced apoptosis79. This

previous work, in combination with our findings here, suggest a role for IFNα in directly enhancing

62

the survival of autoreactive cells during the T1 stage and allowing them to progress to the mature

compartment.

Confirming that this enhanced survival affects self-reactive B cells, the highly DNA-

reactive Igλ1+ B cell population was similarly increased within the mature B cell compartment of

mDEF201-treatment 3H9 mice. These cells also demonstrated increased activation and germinal

center recruitment, suggestive of a further breakdown of immune tolerance checkpoints beyond

just abnormalities at the transitional stage. As discussed in the introduction, B cell anergy is one

of the most important aspects of peripheral B cell tolerance, and is a process which has been shown

to be defective in SLE patients113,114. It has been well established that on a non-autoimmune genetic

background, B cells expressing the dsDNA-reactive VH3H9/Igλ1 BCR that make it to the

periphery are subject to follicular exclusion, impaired germinal center responses, and are refractory

to stimulation and activation; all classical hallmarks of B cell anergy50,85,100. Elevation of IFNα

levels was associated with abnormalities in all of these anergy-related phenomena. Elevation of

IFNα in the HEL model, where B cell anergy was first described, resulted in similar changes to

the B cell compartment and an overall decrease in the relative frequency of anergic T3 B cells,

again consistent with impaired induction or rescue of anergic cells. These findings have important

implications given the crucial role of B cell anergy in peripheral immune tolerance, and the

potential for IFNα to directly disrupt this process in human SLE. B cells with an anergic phenotype

have been shown to persist in both healthy mice and humans and have been suggested as a potential

reservoir of recruitable autoreactive cells in SLE-prone individuals108,115–117. B cell anergy is

known to be a reversible process that is heavily dependent upon BCR ligation, and IFNα is known

to directly modulate several aspects of BCR signalling; thus, it is possible that this observed

disruption of anergy is due to direct of IFNα on B function47,77,87.

63

Despite strong data demonstrating the significant impairment of many of the classical

hallmarks of B cell anergy in both 3H9 and HEL mice, we were hesitant to label these changes as

a full-scale breach of B cell anergy. While we did observe a marked increase in the total levels of

anti-DNA antibodies in 3H9 mice treated with mDEF201, we did not observe the same increase

in antibody production from anergic Igλ1 B cells. Similarly, the extent of autoantibody production

observed in the HEL model of anergy, although increased compared to control mice, was still very

low. These results weren’t entirely unexpected given our model system and the strong anergic

silencing of high-affinity self-reactive cells in each respective model. It has previously been

demonstrated that a full-scale breach of anti-dsDNA Igλ1 reactivity in 3H9 mice is heavily

dependent upon T cell defects and source of T cell costimulation100,118. Similarly, by crossing the

IgHEL/sHEL transgenes onto the NZB mouse model of autoimmunity, our lab has previously

shown that the complete breakdown of B cell anergy and production of high levels of anti-HEL

antibodies in these mice required the presence of CD4+ T cells89. Taken together, these findings

clearly illustrate an important role for autoreactive T cells and breaches in T cell tolerance in

mediating the complete rescue of anergic B cells in vivo.

It is likely that relatively intact T cell and GC tolerance mechanisms in non-autoimmune

B6 mice explain the low levels of IgG anti-DNA antibodies in 3H9 mice and anti-HEL antibodies

in IgHEL/sHEL mice, despite the elevation of IFNα levels. In support of this idea, although we

observed broad increases in B cell activation, maturation, and germinal center recruitment with

elevated levels of IFNα, all consistent with impaired peripheral B cell tolerance, we observed

minimal alterations to the T cell compartment, consistent with relatively intact T cell tolerance.

For these reasons, we concluded that while elevated IFNα levels certainly lead to disruption of B

cell anergy, it alone is unable to fully rescue anergized B cells. With that being said, our

64

observations with respect to the impact of IFNα on B cell anergy still remain very relevant to SLE.

As mentioned in the introduction, SLE is an incredibly complex disease associated with various

immune defects. Abnormalities in several aspects of T cell tolerance have been identified in SLE

patients, highlighting the important role for T cells in this disease54. Therefore, the IFNα-induced

changes to anergic B cells that we observed, such as impaired follicular exclusion and enhanced

activation, may play a crucial role in contributing to the overall breach of B cell anergy seen in

SLE by acting in concert with T cell defects or other immune-related abnormalities in susceptible

individuals.

While the anergic silencing of high-affinity self-reactive BCRs appears to be partially

intact, the significant increase in total anti-DNA antibody levels in the 3H9 model clearly

demonstrates that other aspects of B cell tolerance are profoundly breached. The induction of

peripheral B cell tolerance checkpoints, such as T1 deletion and anergy, are known to depend

heavily on the specificity and affinity of the BCR for self-antigen106,119,120. Due to the polyclonal

nature of its BCR repertoire, the majority of B cells within the 3H9 model that do bind DNA only

do so with moderate to low affinity, and thus experience a much lower stringency of deletion and

anergy than that of the Igλ1+ B cell population or the HEL-specific B cells within the HEL model.

Therefore, these cells may be preferentially rescued or activated by elevated IFNα. In support of

this idea, elevation of BAFF has also been shown to induce autoantibody production in several

mouse models of B cell tolerance; however, this elevation was associated with the preferential

survival of cells possessing low-affinity self-reactive BCRs112. Our observations in 3H9 mice are

very consistent with these findings, and further support the idea of potential redundancies between

the effects of IFNα and BAFF in modulating B cell tolerance in SLE.

65

In our attempt to determine why 3H9 mice treated with mDEF201 had lower levels of

detectable anti-dsDNA Igλ1 antibodies compared to controls, we discovered that there was a

decrease in frequency of Igλ1+ B cells within the bone marrow. This led to the very surprising

discovery that mDEF201-treated 3H9 mice displayed an impairment of receptor editing, resulting

in the production of fewer light chain-edited Igλ-expressing cells. As discussed in the introduction,

receptor editing is one of the most important aspects of B cell tolerance and is responsible for

removing roughly 30-35% of newly generated autoreactive B cells; therefore, defects in this

process may have a significant impact on the potential autoreactivity of the peripheral B cell

repertoire45. Interestingly, defects in receptor editing have been identified in lupus-prone mice as

well as in SLE patients, leading some lupus researchers to suggest that impairment of this

important checkpoint may be a major contributing factor to the observed breach of B cell tolerance

in this disease; however, the exact mechanisms behind this impairment of editing have yet to be

identified121–123. Our findings suggest a potential novel role for IFNα in mediating this impairment,

leading to the enhanced escape of autoreactive cells from the bone marrow.

IFNα is known to perturb B cell development within the bone marrow through the

impairment of IL-7 signalling, which may also represent the potential mechanism by which IFNα

influences receptor editing98. To avoid the potential overlap between light chain editing and

cellular proliferation, the pre-B cell checkpoint is a highly regulated process that is carefully

orchestrated by mutually exclusive signalling networks. Two of the most important signalling

pathways at this stage are the pre-BCR and IL-7R pathways124. While pre-BCR signalling is

required for the induction of RAG1/2 and receptor editing, IL-7R signalling inhibits these

processes and instead activates genes involved with survival and proliferation which facilitate

further differentiation124. Given its inhibitory effects on IL-7R signalling, we would therefore

66

expect IFNα to be associated with an increase in receptor editing, which is the opposite of what

we observed. This discrepancy may be explained by the direct effects of IFNα on BCR signalling.

As discussed above, IFNα has been shown to directly enhance BCR signalling and calcium

mobilization in vitro77. Given the important role of the pre-BCR in the induction of receptor

editing, IFNα-mediated enhancement of pre-BCR signalling may also contribute to the observed

impairment of editing. Overall, while further studies will be required to fully interpret this result,

we believe that elevation of IFNα may directly impair receptor editing by altering the intricate

regulatory balance between the pre-BCR and IL-7 signalling.

The recent identification of ABCs has begun to shed some light on the immune

mechanisms leading to development of autoAb-producing cells in SLE. These cells have been

shown to be expanded in a subset of SLE patients, particularly those with high disease activity,

and are highly correlated with levels of circulating antibody-secreting cells and pathogenic

autoAb102,103. These findings have led some lupus researchers to suggest ABCs as an attractive

therapeutic target in SLE; thus, a significant amount of recent research has focused on trying to

better understand the signals controlling the accumulation of these cells in diseased individuals125.

Transcriptional profiling of ABCs has revealed that these cells share a similar transcriptional

signature to both naïve B cells and plasmablasts; therefore, they have been hypothesized to

represent plasmablast precursors that are recruited directly from the immature B cell

compartment102,126. According to the current literature, the recruitment of autoreactive immature

B cells into the ABC population is thought to be heavily dependent upon antigen engagement in

the context of TLR activation and T-cell derived co-signals, such as CD40L and IL-21102,103,127.

Surprisingly, the elevation of IFNα levels in 3H9 mice was associated with the significant

67

expansion of ABCs in mice at just 8 weeks of age, suggestive of a potential novel role for IFNα in

this process.

Our data suggesting impaired immune tolerance at the transitional stage in the context of

elevated IFNα strongly supports the idea of direct recruitment of immature autoreactive B cells

into the ABC compartment. In addition to this, although we observed minimal alterations to T cell

activation and homeostasis, we did observe a significant increase in the frequency of Tph cells

following elevated IFNα levels in 3H9 mice. As Tph cells are known to be potent sources of CD40L

and IL-21, IFNα-mediated Tph expansion may represent an important mechanism by which IFNα

indirectly promotes ABC accumulation. In terms of direct effects, recent work has demonstrated

that type I IFN signalling in immature B cells induces a gene expression pattern that may be

conducive to ABC development, mainly through the upregulation of IL-21R transcript and

downregulation of IL-4R transcript128. As IL-4 has been shown to inhibit ABC differentiation, this

change in gene expression may represent a more direct mechanism of IFNα-mediated ABC

accumulation129. Despite the significant expansion of ABCs in 3H9 mice treated with IFNα, we

did not observe any changes in the frequency of plasmablasts, suggesting that while IFNα may

play a role in ABC development additional signals are required for the complete differentiation of

these cells towards plasmablasts. It is notable that despite demonstrating the same expansion of

Tph cells as 3H9 mice, the frequency of ABCs was not increased in HEL mice treated with

mDEF201. As endosomal TLR7/9 activation has been heavily implicated in ABC development,

this finding emphasizes the important contributions of synergistic nucleic acid-specific BCR/TLR

signalling to the observed expansion of ABCs in the 3H9 mice102,127. To further explore this finding

we are currently in the process of generating 3H9 mice deficient in TLR signalling, which will

68

provide further insight into the role of endosomal TLRs in ABC differentiation and B cell

tolerance.

As the main goal of this thesis is to further emphasize a direct role for IFNα in breaching

B cell tolerance, one of the major limitations of our current findings is the inability to show that

our observations are actually dependent upon type I IFN signalling in B cells. To address this, we

are currently in the process of generating 3H9 mice with B cell-specific deficiency of IFNAR. In

addition to this, we are also combining adenoviral vector treatment with T cell depletion as well

as BAFF blockade. These experiments will allow us to further elucidate the relative importance of

direct IFNα signalling in B cells in our results, as well as further assess the role of BAFF signalling

and T cell costimulation in our results. Another point of criticism of our findings is the

physiological relevance of the observed IFNα levels post treatment with adenoviral vector. While

we acknowledge that the IFNα levels observed in the majority of mDEF201-treated mice are

significantly higher than those seen in SLE patients, our gene expression data indicates that IFNα

activity is highly comparable. Elevation of type I IFN inducible genes is a classic hallmark of SLE,

and while most gene expression microarrays cap changes at 2 or 4 fold intervals, individual IFN-

inducible genes have been reported to be overexpressed by 10-, 20-, and even 100-fold compared

to controls130–132. Depending on the gene and tissue, we observed anywhere from 2- to 40-fold

increases in IFN-inducible gene expression, which is highly comparable to that seen in SLE. To

add to this, comparison of experimental mice that had the lowest (~200pg/mL) and highest

(~3500pg/mL) levels of serum IFNα yielded no differences in autoAb levels or cellular changes.

Finally, to further complement the findings of this thesis, future studies will utilize next-generation

sequencing of sorted B cell subsets to better understand the cellular and transcriptional changes

associated with IFNα signalling in B cells at various developmental stages.

69

To conclude, this thesis has shown that the elevation of IFNα levels alone is enough to

promote the disruption of B cell tolerance and the induction of autoAb in non-autoimmune mice.

Immunophenotyping revealed that this breach of tolerance was associated with abnormalities in

many B cell developmental checkpoints, both centrally and peripherally. From these findings, in

conjunction with our clinical data and previous work, it is clear that elevated IFNα levels contribute

significantly to the observed impairment of B cell tolerance seen in SLE. Further research into

IFNα and its direct effects on B cells may help to define IFNα and its signalling pathways as

effective targets for future SLE therapies.

70

REFERENCES

1. Kaul, A. et al. Systemic lupus erythematosus. Nat. Rev. Dis. Prim. 2, 1–21 (2016).

2. Rees, F., Doherty, M., Grainge, M. J., Lanyon, P. & Zhang, W. The worldwide incidence

and prevalence of systemic lupus erythematosus: A systematic review of epidemiological

studies. Rheumatol. (United Kingdom) 56, 1945–1961 (2017).

3. Renau, A. I. & Isenberg, D. A. Male versus female lupus: A comparison of ethnicity,

clinical features, serology and outcome over a 30 year period. Lupus 21, 1041–1048

(2012).

4. Pons-Estel, G. J., Alarcón, G. S., Scofield, L., Reinlib, L. & Cooper, G. S. Understanding

the epidemiology and progression of systemic lupus erythematosus. Semin. Arthritis

Rheum. 39, 257–68 (2010).

5. Lewis, M. J. & Jawad, A. S. The effect of ethnicity and genetic ancestry on the

epidemiology, clinical features and outcome of systemic lupus erythematosus.

Rheumatology (Oxford). 56, i67–i77 (2017).

6. Bruner, B. F. et al. Comparison of autoantibody specificities between traditional and bead-

based assays in a large, diverse collection of patients with systemic lupus erythematosus

and family members. Arthritis Rheum. 64, 3677–86 (2012).

7. Singh, R. R. & Yen, E. Y. SLE mortality remains disproportionately high, despite

improvements over the last decade. Lupus 27, 1577–1581 (2018).

8. Tsokos, G. C. Systemic lupus erythematosus. N. Engl. J. Med. 365, 2110–21 (2011).

9. James, J. A. Clinical perspectives on lupus genetics: advances and opportunities. Rheum.

Dis. Clin. North Am. 40, 413–32, vii (2014).

10. Chen, L., Morris, D. L. & Vyse, T. J. Genetic advances in systemic lupus erythematosus:

an update. Curr. Opin. Rheumatol. 29, 423–433 (2017).

11. Dai, C. et al. Genetics of systemic lupus erythematosus: immune responses and end organ

resistance to damage. Curr. Opin. Immunol. 31, 87–96 (2014).

12. Tsokos, G. C., Lo, M. S., Costa Reis, P. & Sullivan, K. E. New insights into the

immunopathogenesis of systemic lupus erythematosus. Nat. Rev. Rheumatol. 12, 716–730

(2016).

13. Cui, J.-H. et al. Increased apoptosis and expression of FasL, Bax and caspase-3 in human

lupus nephritis class II and IV. J. Nephrol. 25, 255–61

14. Guerra, S. G., Vyse, T. J. & Cunninghame Graham, D. S. The genetics of lupus: a

functional perspective. Arthritis Res. Ther. 14, 211 (2012).

15. Parks, C. G., de Souza Espindola Santos, A., Barbhaiya, M. & Costenbader, K. H.

Understanding the role of environmental factors in the development of systemic lupus

71

erythematosus. Best Pract. Res. Clin. Rheumatol. 31, 306–320 (2017).

16. Pollard, K. M. Silica, Silicosis, and Autoimmunity. Front. Immunol. 7, 97 (2016).

17. Parks, C. G. & De Roos, A. J. Pesticides, chemical and industrial exposures in relation to

systemic lupus erythematosus. Lupus 23, 527–36 (2014).

18. Ho, C. H. & Chauhan, K. Lupus Erythematosus, Drug-Induced. StatPearls (2018).

19. Yung, R., Chang, S., Hemati, N., Johnson, K. & Richardson, B. Mechanisms of drug-

induced lupus. IV. Comparison of procainamide and hydralazine with analogs in vitro and

in vivo. Arthritis Rheum. 40, 1436–43 (1997).

20. Almoallim, H., Al-Ghamdi, Y., Almaghrabi, H. & Alyasi, O. Anti-Tumor Necrosis

Factor-α Induced Systemic Lupus Erythematosus(). Open Rheumatol. J. 6, 315–9 (2012).

21. Draborg, A. H., Duus, K. & Houen, G. Epstein-Barr virus and systemic lupus

erythematosus. Clin. Dev. Immunol. 2012, 370516 (2012).

22. Guo, G. et al. The cytomegalovirus protein US31 induces inflammation through mono-

macrophages in systemic lupus erythematosus by promoting NF-κB2 activation. Cell

Death Dis. 9, 104 (2018).

23. Mu, Q., Zhang, H. & Luo, X. M. SLE: Another Autoimmune Disorder Influenced by

Microbes and Diet? Front. Immunol. 6, 608 (2015).

24. Manfredo Vieira, S. et al. Translocation of a gut pathobiont drives autoimmunity in mice

and humans. Science 359, 1156–1161 (2018).

25. Greiling, T. M. et al. Commensal orthologs of the human autoantigen Ro60 as triggers of

autoimmunity in lupus. Sci. Transl. Med. 10, (2018).

26. Gallo, P. M. et al. Amyloid-DNA Composites of Bacterial Biofilms Stimulate

Autoimmunity. Immunity 42, 1171–84 (2015).

27. Elkan, A.-C. et al. Diet and fatty acid pattern among patients with SLE: associations with

disease activity, blood lipids and atherosclerosis. Lupus 21, 1405–11 (2012).

28. Jara, L. J. et al. Prolactin has a pathogenic role in systemic lupus erythematosus. Immunol.

Res. 65, 512–523 (2017).

29. Grimaldi, C. M., Cleary, J., Dagtas, A. S., Moussai, D. & Diamond, B. Estrogen alters

thresholds for B cell apoptosis and activation. J. Clin. Invest. 109, 1625–33 (2002).

30. Lateef, A. & Petri, M. Hormone replacement and contraceptive therapy in autoimmune

diseases. J. Autoimmun. 38, J170-6 (2012).

31. Costenbader, K. H., Feskanich, D., Stampfer, M. J. & Karlson, E. W. Reproductive and

menopausal factors and risk of systemic lupus erythematosus in women. Arthritis Rheum.

56, 1251–62 (2007).

32. Souyris, M. et al. TLR7 escapes X chromosome inactivation in immune cells. Sci.

Immunol. 3, (2018).

72

33. Maidhof, W. & Hilas, O. Lupus: an overview of the disease and management options. P T

37, 240–9 (2012).

34. Navarra, S. V et al. Efficacy and safety of belimumab in patients with active systemic

lupus erythematosus: a randomised, placebo-controlled, phase 3 trial. Lancet (London,

England) 377, 721–31 (2011).

35. Touma, Z. & Gladman, D. D. Current and future therapies for SLE: obstacles and

recommendations for the development of novel treatments. Lupus Sci. Med. 4, e000239

(2017).

36. Vukelic, M., Li, Y. & Kyttaris, V. C. Novel Treatments in Lupus. Front. Immunol. 9,

2658 (2018).

37. Olsen, N. J. & Karp, D. R. Autoantibodies and SLE: the threshold for disease. Nat. Rev.

Rheumatol. 10, 181–6 (2014).

38. Yaniv, G. et al. A volcanic explosion of autoantibodies in systemic lupus erythematosus: a

diversity of 180 different antibodies found in SLE patients. Autoimmun. Rev. 14, 75–9

(2015).

39. Cozzani, E., Drosera, M., Gasparini, G. & Parodi, A. Serology of Lupus Erythematosus:

Correlation between Immunopathological Features and Clinical Aspects. Autoimmune Dis.

2014, 321359 (2014).

40. Suurmond, J. & Diamond, B. Autoantibodies in systemic autoimmune diseases: specificity

and pathogenicity. J. Clin. Invest. 125, 2194–202 (2015).

41. Rose, T. & Dörner, T. Drivers of the immunopathogenesis in systemic lupus

erythematosus. Best Pract. Res. Clin. Rheumatol. 31, 321–333 (2017).

42. Brink, R. & Phan, T. G. Self-Reactive B Cells in the Germinal Center Reaction. Annu.

Rev. Immunol. 36, 339–357 (2018).

43. Melchers, F. Checkpoints that control B cell development. J. Clin. Invest. 125, 2203–10

(2015).

44. Mårtensson, I.-L., Almqvist, N., Grimsholm, O. & Bernardi, A. I. The pre-B cell receptor

checkpoint. FEBS Lett. 584, 2572–9 (2010).

45. Pelanda, R. & Torres, R. M. Central B-cell tolerance: where selection begins. Cold Spring

Harb. Perspect. Biol. 4, a007146 (2012).

46. Pillai, S. & Cariappa, A. The follicular versus marginal zone B lymphocyte cell fate

decision. Nat. Rev. Immunol. 9, 767–77 (2009).

47. Yarkoni, Y., Getahun, A. & Cambier, J. C. Molecular underpinning of B-cell anergy.

Immunol. Rev. 237, 249–63 (2010).

48. Merrell, K. T. et al. Identification of anergic B cells within a wild-type repertoire.

Immunity 25, 953–62 (2006).

49. O’Neill, S. K. et al. Monophosphorylation of CD79a and CD79b ITAM motifs initiates a

73

SHIP-1 phosphatase-mediated inhibitory signaling cascade required for B cell anergy.

Immunity 35, 746–56 (2011).

50. Paul, E., Nelde, A., Verschoor, A. & Carroll, M. C. Follicular exclusion of autoreactive B

cells requires FcgammaRIIb. Int. Immunol. 19, 365–73 (2007).

51. Teng, G. & Papavasiliou, F. N. Immunoglobulin somatic hypermutation. Annu. Rev.

Genet. 41, 107–20 (2007).

52. Gatto, D. & Brink, R. The germinal center reaction. J. Allergy Clin. Immunol. 126, 898-

907; quiz 908–9 (2010).

53. Arbuckle, M. R. et al. Development of autoantibodies before the clinical onset of systemic

lupus erythematosus. N. Engl. J. Med. 349, 1526–33 (2003).

54. Zharkova, O. et al. Pathways leading to an immunological disease: systemic lupus

erythematosus. Rheumatology (Oxford). 56, i55–i66 (2017).

55. Han, S., Zhuang, H., Shumyak, S., Yang, L. & Reeves, W. H. Mechanisms of

autoantibody production in systemic lupus erythematosus. Front. Immunol. 6, 228 (2015).

56. Korganow, A.-S. et al. Peripheral B cell abnormalities in patients with systemic lupus

erythematosus in quiescent phase: decreased memory B cells and membrane CD19

expression. J. Autoimmun. 34, 426–34 (2010).

57. Ota, M. et al. Regulation of the B cell receptor repertoire and self-reactivity by BAFF. J.

Immunol. 185, 4128–36 (2010).

58. Luo, J. et al. Up-regulation of transcription factor Blimp1 in systemic lupus

erythematosus. Mol. Immunol. 56, 574–82 (2013).

59. Woods, M., Zou, Y.-R. & Davidson, A. Defects in Germinal Center Selection in SLE.

Front. Immunol. 6, 425 (2015).

60. Sage, P. T. & Sharpe, A. H. T follicular regulatory cells. Immunol. Rev. 271, 246–59

(2016).

61. Fu, W. et al. Deficiency in T follicular regulatory cells promotes autoimmunity. J. Exp.

Med. 215, 815–825 (2018).

62. Liu, C. et al. Increased circulating CD4+CXCR5+FoxP3+ follicular regulatory T cells

correlated with severity of systemic lupus erythematosus patients. Int. Immunopharmacol.

56, 261–268 (2018).

63. Masutani, K. et al. Predominance of Th1 immune response in diffuse proliferative lupus

nephritis. Arthritis Rheum. 44, 2097–106 (2001).

64. Barron, L. et al. Cutting edge: mechanisms of IL-2-dependent maintenance of functional

regulatory T cells. J. Immunol. 185, 6426–30 (2010).

65. Giang, S. & La Cava, A. Regulatory T Cells in SLE: Biology and Use in Treatment. Curr.

Rheumatol. Rep. 18, 67 (2016).

66. Lartigue, A. et al. Critical role of TLR2 and TLR4 in autoantibody production and

74

glomerulonephritis in lpr mutation-induced mouse lupus. J. Immunol. 183, 6207–16

(2009).

67. Ma, K. et al. TLR4+CXCR4+ plasma cells drive nephritis development in systemic lupus

erythematosus. Ann. Rheum. Dis. 77, 1498–1506 (2018).

68. Celhar, T. & Fairhurst, A.-M. Toll-like receptors in systemic lupus erythematosus:

potential for personalized treatment. Front. Pharmacol. 5, 265 (2014).

69. Celhar, T., Magalhães, R. & Fairhurst, A.-M. TLR7 and TLR9 in SLE: when sensing self

goes wrong. Immunol. Res. 53, 58–77 (2012).

70. Hooks, J. J. et al. Immune interferon in the circulation of patients with autoimmune

disease. N. Engl. J. Med. 301, 5–8 (1979).

71. Elkon, K. B. & Stone, V. V. Type I interferon and systemic lupus erythematosus. J.

Interferon Cytokine Res. 31, 803–12 (2011).

72. Hamilton, J. A. et al. Cutting Edge: Intracellular IFN-β and Distinct Type I IFN

Expression Patterns in Circulating Systemic Lupus Erythematosus B Cells. J. Immunol.

201, 2203–2208 (2018).

73. van Pesch, V., Lanaya, H., Renauld, J.-C. & Michiels, T. Characterization of the murine

alpha interferon gene family. J. Virol. 78, 8219–28 (2004).

74. Crow, M. K. Type I interferon in the pathogenesis of lupus. J. Immunol. 192, 5459–68

(2014).

75. Hua, J., Kirou, K., Lee, C. & Crow, M. K. Functional assay of type I interferon in

systemic lupus erythematosus plasma and association with anti-RNA binding protein

autoantibodies. Arthritis Rheum. 54, 1906–16 (2006).

76. Lauwerys, B. R., Ducreux, J. & Houssiau, F. A. Type I interferon blockade in systemic

lupus erythematosus: where do we stand? Rheumatology (Oxford). 53, 1369–76 (2014).

77. Braun, D., Caramalho, I. & Demengeot, J. IFN-alpha/beta enhances BCR-dependent B

cell responses. Int. Immunol. 14, 411–9 (2002).

78. Giordani, L. et al. IFN-alpha amplifies human naive B cell TLR-9-mediated activation

and Ig production. J. Leukoc. Biol. 86, 261–71 (2009).

79. Chang, N.-H. et al. Interferon-α induces altered transitional B cell signaling and function

in Systemic Lupus Erythematosus. J. Autoimmun. 58, 100–10 (2015).

80. Miettinen, M., Sareneva, T., Julkunen, I. & Matikainen, S. IFNs activate toll-like receptor

gene expression in viral infections. Genes Immun. 2, 349–55 (2001).

81. Sirén, J., Pirhonen, J., Julkunen, I. & Matikainen, S. IFN-alpha regulates TLR-dependent

gene expression of IFN-alpha, IFN-beta, IL-28, and IL-29. J. Immunol. 174, 1932–7

(2005).

82. Goodnow, C. C. et al. Altered immunoglobulin expression and functional silencing of

self-reactive B lymphocytes in transgenic mice. Nature 334, 676–82 (1988).

75

83. Shlomchik, M. J., Aucoin, A. H., Pisetsky, D. S. & Weigert, M. G. Structure and function

of anti-DNA autoantibodies derived from a single autoimmune mouse. Proc. Natl. Acad.

Sci. U. S. A. 84, 9150–4 (1987).

84. Erikson, J. et al. Expression of anti-DNA immunoglobulin transgenes in non-autoimmune

mice. Nature 349, 331–4 (1991).

85. Mandik-Nayak, L., Bui, A., Noorchashm, H., Eaton, A. & Erikson, J. Regulation of anti-

double-stranded DNA B cells in nonautoimmune mice: localization to the T-B interface of

the splenic follicle. J. Exp. Med. 186, 1257–67 (1997).

86. Srivastava, A. Belimumab in Systemic Lupus Erythematosus. Indian J. Dermatol. 61,

550–3

87. Kiefer, K., Oropallo, M. A., Cancro, M. P. & Marshak-Rothstein, A. Role of type I

interferons in the activation of autoreactive B cells. Immunol. Cell Biol. 90, 498–504

(2012).

88. Damjanovic, D. et al. Type 1 interferon gene transfer enhances host defense against

pulmonary Streptococcus pneumoniae infection via activating innate leukocytes. Mol.

Ther. Methods Clin. Dev. 1, 5 (2014).

89. Chang, N.-H., MacLeod, R. & Wither, J. E. Autoreactive B cells in lupus-prone New

Zealand black mice exhibit aberrant survival and proliferation in the presence of self-

antigen in vivo. J. Immunol. 172, 1553–60 (2004).

90. Chang, S.-H. et al. The lupus susceptibility locus Sle1 facilitates the peripheral

development and selection of anti-DNA B cells through impaired receptor editing. J.

Immunol. 192, 5579–85 (2014).

91. Kumaki, Y. et al. Single-dose intranasal administration with mDEF201 (adenovirus

vectored mouse interferon-alpha) confers protection from mortality in a lethal SARS-CoV

BALB/c mouse model. Antiviral Res. 89, 75–82 (2011).

92. Stockinger, S. et al. Characterization of the interferon-producing cell in mice infected with

Listeria monocytogenes. PLoS Pathog. 5, e1000355 (2009).

93. Bauer, E. M., Zheng, H., Lotze, M. T. & Bauer, P. M. Recombinant human interferon

alpha 2b prevents and reverses experimental pulmonary hypertension. PLoS One 9,

e96720 (2014).

94. Wu, J. Q. H. et al. Pre- and post-exposure protection against Western equine encephalitis

virus after single inoculation with adenovirus vector expressing interferon alpha. Virology

369, 206–13 (2007).

95. Demers, G. W. et al. Interferon-alpha2b secretion by adenovirus-mediated gene delivery

in rat, rabbit, and chimpanzee results in similar pharmacokinetic profiles. Toxicol. Appl.

Pharmacol. 180, 36–42 (2002).

96. Shayakhmetov, D. M., Li, Z.-Y., Ni, S. & Lieber, A. Analysis of adenovirus sequestration

in the liver, transduction of hepatic cells, and innate toxicity after injection of fiber-

modified vectors. J. Virol. 78, 5368–81 (2004).

76

97. Kuraoka, M. et al. Activation-induced cytidine deaminase mediates central tolerance in B

cells. Proc. Natl. Acad. Sci. U. S. A. 108, 11560–5 (2011).

98. Lin, Q., Dong, C. & Cooper, M. D. Impairment of T and B cell development by treatment

with a type I interferon. J. Exp. Med. 187, 79–87 (1998).

99. Pelanda, R. et al. Receptor editing in a transgenic mouse model: site, efficiency, and role

in B cell tolerance and antibody diversification. Immunity 7, 765–75 (1997).

100. Paul, E., Lutz, J., Erikson, J. & Carroll, M. C. Germinal center checkpoints in B cell

tolerance in 3H9 transgenic mice. Int. Immunol. 16, 377–84 (2004).

101. Rao, D. A. et al. Pathologically expanded peripheral T helper cell subset drives B cells in

rheumatoid arthritis. Nature 542, 110–114 (2017).

102. Jenks, S. A. et al. Distinct Effector B Cells Induced by Unregulated Toll-like Receptor 7

Contribute to Pathogenic Responses in Systemic Lupus Erythematosus. Immunity 49,

725–739.e6 (2018).

103. Wang, S. et al. IL-21 drives expansion and plasma cell differentiation of autoreactive

CD11chiT-bet+ B cells in SLE. Nat. Commun. 9, 1758 (2018).

104. Manni, M. et al. Regulation of age-associated B cells by IRF5 in systemic autoimmunity.

Nat. Immunol. 19, 407–419 (2018).

105. Tiegs, S. L., Russell, D. M. & Nemazee, D. Receptor editing in self-reactive bone marrow

B cells. The Journal of Experimental Medicine. 1993. 177: 1009-1020. J. Immunol. 186,

1313–24 (2011).

106. Cambier, J. C., Gauld, S. B., Merrell, K. T. & Vilen, B. J. B-cell anergy: from transgenic

models to naturally occurring anergic B cells? Nat. Rev. Immunol. 7, 633–43 (2007).

107. Silveira, P. A. et al. B cell selection defects underlie the development of diabetogenic

APCs in nonobese diabetic mice. J. Immunol. 172, 5086–94 (2004).

108. Teague, B. N. et al. Cutting edge: Transitional T3 B cells do not give rise to mature B

cells, have undergone selection, and are reduced in murine lupus. J. Immunol. 178, 7511–

5 (2007).

109. Landolt-Marticorena, C. et al. Lack of association between the interferon-alpha signature

and longitudinal changes in disease activity in systemic lupus erythematosus. Ann. Rheum.

Dis. 68, 1440–6 (2009).

110. Landolt-Marticorena, C. et al. Increased expression of B cell activation factor supports the

abnormal expansion of transitional B cells in systemic lupus erythematosus. J. Rheumatol.

38, 642–51 (2011).

111. Vincent, F. B., Morand, E. F., Schneider, P. & Mackay, F. The BAFF/APRIL system in

SLE pathogenesis. Nat. Rev. Rheumatol. 10, 365–73 (2014).

112. Thien, M. et al. Excess BAFF rescues self-reactive B cells from peripheral deletion and

allows them to enter forbidden follicular and marginal zone niches. Immunity 20, 785–98

(2004).

77

113. Cappione, A. et al. Germinal center exclusion of autoreactive B cells is defective in

human systemic lupus erythematosus. J. Clin. Invest. 115, 3205–16 (2005).

114. Pieterse, E. & van der Vlag, J. Breaking immunological tolerance in systemic lupus

erythematosus. Front. Immunol. 5, 164 (2014).

115. Quách, T. D. et al. Anergic responses characterize a large fraction of human autoreactive

naive B cells expressing low levels of surface IgM. J. Immunol. 186, 4640–8 (2011).

116. Rosenspire, A. J. & Chen, K. Anergic B Cells: Precarious On-Call Warriors at the Nexus

of Autoimmunity and False-Flagged Pathogens. Front. Immunol. 6, 580 (2015).

117. Duty, J. A. et al. Functional anergy in a subpopulation of naive B cells from healthy

humans that express autoreactive immunoglobulin receptors. J. Exp. Med. 206, 139–51

(2009).

118. Mandik-Nayak, L. et al. Functional consequences of the developmental arrest and

follicular exclusion of anti-double-stranded DNA B cells. J. Immunol. 164, 1161–8

(2000).

119. Nemazee, D. Mechanisms of central tolerance for B cells. Nat. Rev. Immunol. 17, 281–

294 (2017).

120. Shlomchik, M. J. Sites and stages of autoreactive B cell activation and regulation.

Immunity 28, 18–28 (2008).

121. Lamoureux, J. L. et al. Reduced receptor editing in lupus-prone MRL/lpr mice. J. Exp.

Med. 204, 2853–64 (2007).

122. Panigrahi, A. K. et al. RS rearrangement frequency as a marker of receptor editing in

lupus and type 1 diabetes. J. Exp. Med. 205, 2985–94 (2008).

123. Liu, Y. et al. Lupus susceptibility genes may breach tolerance to DNA by impairing

receptor editing of nuclear antigen-reactive B cells. J. Immunol. 179, 1340–52 (2007).

124. Clark, M. R., Mandal, M., Ochiai, K. & Singh, H. Orchestrating B cell lymphopoiesis

through interplay of IL-7 receptor and pre-B cell receptor signalling. Nat. Rev. Immunol.

14, 69–80 (2014).

125. Rubtsova, K. et al. B cells expressing the transcription factor T-bet drive lupus-like

autoimmunity. J. Clin. Invest. 127, 1392–1404 (2017).

126. Tipton, C. M. et al. Diversity, cellular origin and autoreactivity of antibody-secreting cell

population expansions in acute systemic lupus erythematosus. Nat. Immunol. 16, 755–65

(2015).

127. Sindhava, V. J. et al. A TLR9-dependent checkpoint governs B cell responses to DNA-

containing antigens. J. Clin. Invest. 127, 1651–1663 (2017).

128. Mountz JD, Liu S, Yang P, Wu Q, Luo B, Chatham WW, H. H. Endogenous Ifnβ

Production Is Required for Efficient BCR Crosslinking and Survival of SLE B Cells

[abstract]. Arthritis Rheumatol. 70, (suppl 10). (2018).

78

129. Naradikian, M. S. et al. Cutting Edge: IL-4, IL-21, and IFN-γ Interact To Govern T-bet

and CD11c Expression in TLR-Activated B Cells. J. Immunol. 197, 1023–8 (2016).

130. Baechler, E. C. et al. Interferon-inducible gene expression signature in peripheral blood

cells of patients with severe lupus. Proc. Natl. Acad. Sci. U. S. A. 100, 2610–5 (2003).

131. Bennett, L. et al. Interferon and granulopoiesis signatures in systemic lupus erythematosus

blood. J. Exp. Med. 197, 711–23 (2003).

132. Crow, M. K. & Wohlgemuth, J. Microarray analysis of gene expression in lupus. Arthritis

Res. Ther. 5, 279–87 (2003).