3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal...
Transcript of 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal...
![Page 1: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/1.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
3. Systematic Gene Inactivation
3.1. Transposon insertion populations
3.2. T-DNA insertion populations
3.3. EMS mutant populations (TILLING)
→ by Mutagenesis
(→ by RNAi, overexpression of regulatory elements)
![Page 2: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/2.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
source:
http://www.genomics.arizona.edu/553/documents/lectures/9_12F-RGeneticsHO.pdf
![Page 3: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/3.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Forward Genetics
introduce mutations into population
screen for a phenotype
map locus through crosses
isolate gene
limitations:
• phenotypic screening slow and laborious
• recessive mutations undetectable
• rare mutations or phenotypes might be missed
Reverse Genetics
select candidate gene
disrupt or modify candidate gene by mutations or insertions
screen for modified genotypes
identify phenotype through crosses
limitations:
• appropriate candidate gene information must be available
• need for efficient screening system
• unspecific background effects must be eliminated
![Page 4: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/4.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Forward Genetics
Identify
mutants
with trait of
interest
Relate phenotype to genotype
4,6g seeds 0,6g Seeds
![Page 5: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/5.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Reverse Genetics
Identify
mutants in
candidate
genes
Test for phenotypic effect of mutant genotype
4,6g seeds 0,6g Seeds
![Page 6: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/6.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
mutagenesis advantages disadvantages
insertional
T-DNA flanking sequence tags (FST) genetically modified organism (GMO)*
transposons FST, rapid local saturation (e.g. two
component system Ac/Ds)
GMO, preferential integration
“islands”
retrotransposons FST, preferentially targeting gene
space, non-GMO
**TOS17, only system demonstrated in
Oryza sativa
chemical chromosome & point mutations random anonymous mutations, dose
related, hazardous
physical chromosome & point mutations,
safe, easy to use, high-throughput random anonymous mutations
*GMO: green- and screen-house,
public acceptance
**activated through in vitro culture
and γ-rays (S.Nielen, 2000)
Systematic gene inactivation by mutagenesis:
comparison of methods
Quelle: FAO, IAEA
![Page 7: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/7.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
3.1. Transposon insertion populations
![Page 8: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/8.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Transposons
(T. Schmidt 1998) (Miniature Inverted Transposable Elements)
Transposon family Terminal repeats or
repeats
Intermediate Excision
Class I: retrotransposons
Ty-1 copia
Ty-1 gypsy
Non-LTR
Yes (LTR)
Yes (LTR)
No
RNA
RNA
RNA
No
No
No
Class II: transposons
AcDs
CACTA
Mu
Yes (11bp)
Yes (13 bp)
Yes (200 bp)
DNA
DNA
DNA
Yes
Yes
Yes
Unclassified Transposons
(MITE)
Yes (11-14 bp) DNA (?) ?
2001:
Transposon family Terminal repeats or
repeats
Intermediate Excision
Helitrons no DNA yes
(Barbagia et al., Genetics 190, 965 (2012)
![Page 9: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/9.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Transposition mechanisms
http://www.pharmazie.uni-frankfurt.de/PharmBiol/Winckler_Pub/DAZ_Abb1.jpg
![Page 10: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/10.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Observations of Barbara McClintock (1948)
in Maize
At certain chromosome positions, so called
Dissociation elements (Ds), regularly chromosomal breakage occurs
the occurrence of these chromosomal breakages is related to the
presence of an Activator element (Ac) at any other position in the
genome
Ds elements and Ac elements spontaneously change their position on
the chromosome (Transposition).
![Page 11: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/11.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Ac/Ds
Ac
1.
2.
Ac
activates translocates
Ac
1.
2.
translocates
![Page 12: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/12.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Mutation caused by Ac/Ds
Ac
kernel
backmutation by Ac
activates
color gene Ds
1
2
kernel
kernel
stabile mutation without Ac
translocates
![Page 13: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/13.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
• transposase needs TIR sequences
• En/Spm-Transposons (Enhancer/Supressor of Mutation)
• Ac/Ds (Activator, Dissociation)
• Mu (Mutator)
transposons: autonomous
• „cut & paste“ mechanism (enzymatic) of the same copy transposition:
• transposase also recognizes deleted copies
structure:
• target site duplications („footprints“) after cutting
Transposase gene
TIR
(Terminal Inverted Repeat)
TIR
(Terminal Inverted Repeat)
4,9 kb - >10 kb
TDS TDS
TIR
(Terminal Inverted Repeat)
TIR
(Terminal Inverted Repeat)
TDS TDS
Thomas Schmidt
DNA transposons
(class II transposable elements)
(Target duplication site)
![Page 14: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/14.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Mutation by Ac/Ds
http://barleyworld.org
![Page 15: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/15.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
mutagenesis by transposition:
Gene Promotor G ene Promotor Transposon
mutated gene
(insertion) wildtype
examplel: pigmentation of a maize mutant
transposon in chalconsynthase,
dark dots: transposon jumped out of the gene
selection of mutants:
isolation of the gene:
G ene Promotor Transposon
hybridization with
transposon-specific probe
analysis of gene
Transposons as tools of genome analysis
![Page 16: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/16.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
3.2. T-DNA insertion populations
![Page 17: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/17.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
T-DNA mutagenesis
Agrobacterium – a plant pathogen
• 1897 Agrobacterium vitis was identified as source of „crown gall" in grapevine (Vitis
vinifera)
• 1974 virulence of Agrobacterium tumefaciens is based on a tumor-inducing plasmid
(Ti)
• 1977 T-DNA in Ti plasmid discovered in plant tumor cells
• 1983 first Agrobacterium mediated transformation with a recombinant gene
Gene
T-DNA insertion mutagenesis integration of T-DNA into the plant genome as:
• full lenght T-DNA
• truncated T-DNA
• multiple T-DNA
T DNA RB
LB T DNA RB
LB
![Page 18: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/18.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
LB T DNA RB
Agrobacterium tumefaciens culture
Susanne Lemcke
Transformation and selection
![Page 19: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/19.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
LB T DNA RB
marker for selection:
antibiotics resistance
herbicide resistance
Susanne Lemcke
Transformation und Selektion
![Page 20: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/20.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Identification of T-DNA flanking regions
Methods:
• inverse PCR
• "TAIL-PCR"(Thermal Asymmetric Interlaced PCR)
Susanne Lemcke
![Page 21: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/21.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Inverse PCR
T- DNA
T- DNA
EcoRI EcoRI
T-DNA
Susanne Lemcke
restriction
ligation
Inverse PCR
cloning und sequencing of PCR product
![Page 22: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/22.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
"TAIL-PCR"(Thermal Asymmetric Interlaced
PCR)
T-DNA
P1 P2 P3 AD
3 specific primers
1. primary PCR with primers P1 & DP
2. secundary PCR with primers P2 & DP
3. tertiary PCR with primers P3 & DP
↑
↓
↑
-
→
↑
P2 DP
DP DP
P1 DP
DP DP
P3 DP
DP DP
cloning und sequencing of PCR product
short arbitrary degenerate primer
yield
→combination of high, middle and low stringency cycles
![Page 23: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/23.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Applications of T-DNA
insertion mutagenesis (loss-of-function)
insertion libraries = gene targeted mutation
activation tagging (gain-of-function)*
enhancer-, promotor-trap screening*
expression of transgenes
* add 35S or other promoters or enhancers to T-DNA borders
![Page 24: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/24.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
3.3. EMS mutant populations (TILLING)
→ Systematic screening of complex genomes for
point mutations
![Page 25: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/25.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Targeting Induced Local Lesions IN Genomes
(TILLING)
AGTTTGCTCGATCTGCT
EMS mutagenesis AGTTTGCTCGATCTGCT AGTTTGCTAGATCTGCT
no mutation in target gene mutation in target gene
heteroduplex analysis
![Page 26: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/26.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
complete or partial
inactivation of a
gene (undirected
mutagenesis)
Chemical mutagenesis I
advantage: high efficiency of mutagenesis
problem: needs efficient methods to identify the mutations
method of choice: TILLING
plant genome
mutation in gene X
most plants
without mutation:
how to identify
mutants?
![Page 27: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/27.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Chemical mutagenesis II
methylnitroso-urea (MNU)
ethylnitroso-urea (ENU):
ethylmethanesulfonate (EMS):
![Page 28: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/28.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Mutagenesis with ethylmethanesulfonate (EMS) I
Sega (1984)
Mode of action:
ethylation
Targets in nucleic acids:
phosphate-backbone
purine/pyrimidine bases
Effects:
double strand breakage (chromosomal breakage)
deletions
depurination/depyrimidation (unspecific base exchange)
G/C → A/T transitions
![Page 29: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/29.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
point mutation:
G/C → A/T exchange (transition)
Mutagenesis with ethylmethanesulfonate (EMS) II
1
3
7 1 3
6
N N
7
![Page 30: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/30.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
List of possible triplett changes
# STOP #
#
#
#
96 out of 192 (64x3) ...
![Page 31: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/31.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
can be applied on all organisms (independant of transposon systems or transformation
efficiencies, regardless of genotype and species
effect is a function of concentration: application in ranges with lethalities <50% and M1
fertilities >50% leading to mutation frequencies of 10,000-100,000 transitions/plant
possible direct integration of mutant genotypes in standard breeding programs (no
transgenic approach)
broad spectrum of allelic mutations with effects on gene function:
- complete loss-of-function (stop-, splice site-, regulatory mutants)
- partial loss-of-function (reduced enzyme activity)
- changed function (modified substrate specificity)
- gain-of-function (modified effector or subtrate binding, promoter activation,
repressor inactivation)
Advantages of EMS mutagenesis
![Page 32: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/32.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
I. Reverse Genetics
- requires high level of information beforehand:
complete genomic and coding sequence, copy number, expression
data
II. Forward or Reverse Genetics
- most mutations are recessive → phenotype only in homozygous
plants (selfing required, no detection in a Forward approach)
- background mutations (up to 100,000/plant!) must be eliminated by
repeated backcrossing (5 to 10 times) with elite breeding material
(problem in selection of desired phenotype by cumulative effects of
background mutations)
Disadvantages of EMS mutagenesis
![Page 33: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/33.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Detection of mutation in selected genes
AGGTCCTAGGTCATAGCATAGGATAGACATAG
AGGTCCTAGGTCATGGCATAGGATAGACATAG
amplification of defined sequences
mutagenesis
Detection of SNP by gel electrophoresis
wildtype:
mutant:
population size:
3000-5000 plants
![Page 34: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/34.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
TILLING technique Till et al. 2006, Nature Protocols 1, 2465
![Page 35: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/35.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Application in Winter Rapeseed
Oil seed rape:
70-85 % of phenolics are
sinapic acid metabolites
Sinapine (sinapoylcholine):
• phenolic with unpleasant bitter taste
• conventional seeds contain up to
12 mg/g seeds
• transgenic approach (inactivation of
sinapine sythesis genes): reduction
below 2 mg/g
• classical selection in breeding
programs: down to 5 mg/g
• breeders‘ aim: 1-2 mg/g
unter 50
50 bis unter 70
70 bis unter 75
75 und mehr
Landwirtschaftsfläche in %
Statistisches Amt für Hamburg und Schleswig Holstein
2008/2009: Canola
Area: 115.000 ha
Harvest: 520.000 t
![Page 36: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/36.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Rapeseed meal as chicken feed
Rapeseed meal (after oil extraction) is rich in valuable proteins,
minerals und vitamins, but also contains antinutritive compounds
(sinapic acid esters, glucosinolates)
![Page 37: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/37.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Problem and Solution
Aim: use of rapeseed meal for feed and food
Problem: high sinapine content
Approach:
- inactivation of sinapine synthesis genes (GMO)
- use of low sinapine mutants (TILLING)
Method: selection of low sinapine mutants
![Page 38: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/38.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
candidate genes
aim: selection of mutants with reduced enzyme activity
Sinapine metabolism in Brassicaceae
![Page 39: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/39.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Rapeseed is an allotetraploid crop plant
U‘s Triangle, 1935
1 gene copy in A. th.
~2-6 gene copies in B. napus
![Page 40: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/40.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
EMS mutagenesis (seeds)
LD50
buffer control
12 8 24 h 0
EMS (0.5%) buffer
EMS (0.5%) buffer
EMS (0.5%)
EMS (1%) buffer
EMS (1%) buffer
EMS (1%)
determination of survival rate
soaking
EMS
treatment
washing step
germination
cultivation
chlorotic chimeras
level of mutagenesis
viability fertility
optimization
![Page 41: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/41.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Basic Genotype: YN01-429, canadian yellow seeded spring type (Dr. G. Rakow)
EMS treatment (0.8% - 1.2% EMS), 7,400 seeds
5,980 M1 plants in the greenhouse and in the field
5,980 bag isolations
Seeds harvested from 3,200 M1 plants
8,100 M2 plants grown in the field
5,867 M2 plants germinate
Select 2,700 M2 families
Seeds harvested from 5,567 M2 plants
DNA extracted from 5,860 plants (TILLING population)
>50 seeds/plant
M1
M2
M3
Rapeseed TILLING population YN01-429
![Page 42: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/42.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Mutation breeding in Brassica napus
mutagenesis in seeds
phenotyping of mutant plants
![Page 43: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/43.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
controls
mutant plants
Phenotypic variation in the M2 generation I: leaf morphology
![Page 44: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/44.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
4,6 g seeds 0,6 g seeds no seeds
Phenotypic variation in the M2 generation II:
flower morphology and seed set
![Page 45: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/45.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
High throughput TILLING
............... ............... ............... ............... ............... ............... ............... ...............
............... ............... ............... ............... ............... ............... ............... ...............
............... ............... ............... ............... ............... ............... ............... ...............
............... ............... ............... ............... ............... ............... ............... ...............
............... ............... ............... ............... ............... ............... ............... ...............
............... ............... ............... ............... ............... ............... ............... ...............
DNA
DNA pools endonuclease digest
denature
gel electrophoresis
denature
renature
PCR with gene
specific primers
IRD700
IRD800
Analyse individual plants to
identify mutant
TILLING database Seed bank
(after Till 2006)
![Page 46: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/46.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
A 96 lane Li-Cor DNA
sequencer examining
the top strand (left) and
bottom strand (right) of
a PCR product
heteroduplex by CEL I
mutation detection.
Each lane has the DNA
of five plants, total 480
plants (5x pools).
Signals on left have
corresponding signals
on right.
Mutation detection on a LiCor gel IRD700 channel IRD800 channel
![Page 47: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/47.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
2D 8x Pooling strategy
![Page 48: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/48.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
2D mutant identification
1211 bp
621 bp 553 bp
519.3 / 553 bp 519.3: 553 bp
518.2: 622 bp
533.3: 1220 bp
column pools row pools
![Page 49: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/49.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Wildtyp Mutant Heteroduplex Homoduplex
Mutation detection platforms
• PAGE (LICOR)
[polyacrylamide gel electrophoresis]
• DHPLC (WAVE)
[denaturing high performance liquid chromatography]
• Fluorescent Capillary electrophoresis (FCE)
LICOR website
• High Resolution Melting Analysis (HRM)
• Next Generation Sequencing (NGS: 454 Sequencing)
![Page 50: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/50.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Principle of DHPLC
similar:
Conformation Sensitive Capillary Electrophoresis
(Gady et al. 2009, Plant Methods 5:13)
![Page 51: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/51.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Use of Next Generation Sequencing
Discovery of Rare Mutations in Populations:
TILLING by Sequencing
(Tsai et al. 2011: Plant Physiology156,1257–1268)
3D pooling
PCR of superpools (1.5 kb amplicons)
barcoded adapters for libraries
Illumina sequencing
(for example 40 Mio reads of 40 bp length,
2500x coverage)
![Page 52: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/52.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel 52
Mutation frequency:
Mutation density:
𝐷 [𝑚𝑢𝑡𝑎𝑡𝑖𝑜𝑛𝑠
𝑝𝑙𝑎𝑛𝑡] = (mutation frequency F x genome size x G/C correction factor)
(B. napus: average G/C content = 36%; genome size = 2258 Mbp/2n;
G/C correction factor = (average %) / (% in candidate gene))
Calculation formulas
![Page 53: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/53.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
TILLING Reference list
* methyl nitroso-urea (MNU) as mutagen
Species ProjectMutation frequency
[1/kb]Reference
Arabidopsis ATP 170-300 Greene et al. Genetics 2003, 164: 731-740
GABI-TILL 100-150http://www.gabi-till.de/project/project/gabi-till-
project.html
Barley SCIR 1000 Caldwell et al., Plant Journal 2004, 40: 143-150
GABI-TILL 600http://www.gabi-till.de/project/project/gabi-till-
project.html
TILLMORE 374* Talame et al. Plant Biotechnol J. 2008, 6: 477-485
Brassica napus GABI-TILL 12-60 Harloff et al. Theor Appl Genet 2012, 124, 957-69
42-130 Wang et al. New Phytol. 2008, 180: 751-765
CAN-TILL 100 http://www3.botany.ubc.ca/can-till/
Brassica oleracea CAN-TILL 447 Himelblau et al. TAG 2009, 118: 953-961
Brassica rapa 30 Stephenson et al. BMC Plant Biol 2010, 10
Lotus GENPOP 154 Perry et al. Plant Physiol 2009, 151: 1281-1291
Maize MTP 608-2548 Weil et al. Crop Science 2007, 47: S60-S67
Medicago GLIP 485 Le Signor Plant Biotechnol J. 2009, 7: 430-441
Pea PETILL 200 Dalmais et al. Genome Biol. 2008, 9: R43
Rice 135* Suzuki et al. Mol Genet Genom 2008, 279: 213-223
Rice RICETILL 294/264* Till et al. BMC Plant Biol 2007, 7
Sorghum USDA-ARS 526 Xin et al. BMC Plant Biol 2008, 8: 103
Soybean SMP 140-550 Cooper et al. BMC Plant Biol 2008, 8: 9
Sugar beet GABI-TILL 280-700http://www.gabi-till.de/project/project/gabi-till-
project.html
322-577 Minoia et al. BMC Res Notes 2010, 3: 69
1337 Rigola et al. PLOS One 2009, 4: e4761
737 Gady et al. Plant Methods 2010, 5: 13
Wheat (4x/6x)) 40/24 Slade et al. Nature Biotechnol 2005, 23: 78-81
Oat CropTailor AB 20-40 Chawade et al. BMC Plant Biol 2010, 10
Tomato
![Page 54: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/54.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
• identification of mutations in selected genes
• applicable on all organisms
• great variance of induced gene modifications
• direct use of favorable alleles in breeding programs (if <4
functional gene copies)
• alternative to GMO
• exploit natural variability by screening of natural populations:
Eco-TILLING (without artificial mutagenesis)
TILLING summary
![Page 55: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/55.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Transgene mediated mutagenesis
![Page 56: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the](https://reader030.fdocuments.in/reader030/viewer/2022011903/5f17f8a5880a0036f53de266/html5/thumbnails/56.jpg)
Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel
Transgene mediated mutagenesis
• Overexpression of truncated (non-functional) OsPMS1 leads to
suppression of intrinsic functional OsPMS1
• in segregating T2 mutant families the mutation rate is
wildtype allel < heterozygous allel ≈ homozygous allel, showing that the
mutation load increases from generation to generation
• Transgene is eliminated by isolating plants with wildtype allel from
segregating mutant families or by backcrossing with non-transgenic
wildtype plant
• Mostly G/C→A/T in rice but less than in TILLING (60 instead of 70 %)