07 Brute Force
description
Transcript of 07 Brute Force
FIT 1029 Algorithmic Problem Solving
Lecture 7 Brute Force
Prepared by Julian García
COMMONWEALTH OF AUSTRALIA Copyright Regulations 1969
WARNING This material has been reproduced and communicated to you by or on behalf of Monash University pursuant to Part VB of the Copyright Act 1968 (the Act).The material in this communication may be subject to copyright under the Act.Any further
reproduction or communication of this material by you may be the subject of copyright protection under the Act. Do not remove this notice.
Using Kruskal’s algorithm
4
62
8
10
12
4
62
8
10
124
62
8
10
12
4
62
8
10
12
4
62
8
10
12
4
62
8
10
12 224
62
10
• Can be applied to most problems ...resulting in reasonable algorithms.
• Generally cheap to design and implement.
• Useful for small size instances of the problems.
• Generating and checking solutions can occur in parallel.
Brute Force is Good...
Finding a phone numberConsider the problem of trying to find a
telephone number in a phone book.
Aabataglilia A. ........9317 4532 Aabhas A. ...........0433 26 1471 Aabid Y & H. ............9729 8181 Aabryn B & K. ........ 9561 8162
ApproachInput: phoneNum, a phone numberOutput: Name corresponding to the phoneNum
Prints the name associated to a phone number (if the number exists in the telephone book)
Look at the first record
Does the record have the phone number?
Look at the next record
print name
yes
Is there another record?
no
yes
stop
Sequential Search! Given a value: target, and a list L.! Find the first item in L, which has the
value target.! Return: ◦ If target is found then return the index of
the item. ◦ If target not found then return -1.
Algorithm: Sequential SearchInput: target, and a list L[0..n-1]Output: If target is in L, returns the index of the first item with that value. Otherwise returns -1.
Search for target in L
k ← 0
k = length(L)
k ← k +1
return -1yes
L[k] = target?
no
no
yesreturn k
Algorithm: Sequential SearchInput: target, and a list L[0, n-1]Output: If target is in L, returns the index of the first item with that value. Otherwise returns -1.
Search for target in L
SequentialSearch(target, L)k ← 0 while (k ≠ length(L)) do {
if (L[k] = target ) { return k } k ← k+1
} return -1
k ← 0
k = length(L)
k ← k +1
return -1yes
L[k] = target?
no
no
yesreturn k
SequentialSearch(target, L) k ← 0 while (k ≠ length(L)) do {
if (L[k] = target ) { return k } k ← k+1
} return -1
Algorithm: Sequential SearchInput: target, and a list L[0.. n-1]Output: If target is in L, returns the index of the first item with that value. Otherwise returns -1.
SequentialSearch(target, L)k ← 0 while (k ≠ length(L)) do {
if (L[k] = target ) { return k } k ← k+1
} return -1
input: L = [3,1,4,5,9,2,6]; target =2 output: 5
input: L = [ ]; target =2 output: -1
input: L = [2,2,3,5,9,2]; target =2 output: 0
input: L = [3,1,4,9,5,6,1]; target =5 output: 4
input: L = [3,1,4,9,5,6,1]; target =8 output: -1
Is the substring cagcag in this string?
A) Yes
B) No
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
String Matching
A substring of a string S is another string T "that occurs in" S.
is T a substring of S?
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
cagcag
Brute Force String Matching
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
cagcag
Brute Force String Matching
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
cagcag
Brute Force String Matching
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
cagcag
Brute Force String Matching
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
cagcag
Brute Force String Matching
Look athe the first length(T) carachters of S
Does the substring match
T?
Move one character along S
return true
yes
Are we at the end of S?
no
no
yes return false
Algorithm: StringMatchInput: string S, potential substring TOutput: true if T is in S, false if T is not in S.
Checks if a string T is a substring of S
Strings as Lists
0. a1. t
2. g
Str
Str = [a, t, g] or Str = “atg” Str[1] = “t”Str[1..2] = [t, g] = “tg”Str[0..1] = [a, t] = “at”
Substrings
Str = [a, g, t, t, a, c, g, a, t, t, a]0 1 2 3 4 5 6 7 8 9 10
Str[2..4] = [t, t, a]
Str[3..5] = [t, a, c]
Str[8 ..10] = [t, t, a]
k ← 0 while (k + length(T) ≤ length(S)) do {
If (S[k .. k+length(T)-1] = T) {
return true } k ← k + 1
} return false
Algorithm: StringMatch(S, T)Input: string S, substring TOutput: true if T is in S, false if T is not in S.
Checks if T is a substring of S
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
T = cagcaglenght(T) = 6
k=0 k+lenght(T)-1=5
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
T = cagcaglenght(T) = 6
k=1 k+lenght(T)-1=6
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
T = cagcaglenght(T) = 6
k=2 k+lenght(T)-1=7
atggctaagtctatgctttctggaattgtttttgctggtcttgttgctgctgcagcggccagttcggccaacaacagcgccgccaacgtctccgttttggagagtgggcccgctgtgcaggaagtgccagcgcgcacggtcacagctcgcctggcgaagcctttgctgcttcttttctgctcttgctgcgactttggcagcagct
T = cagcaglenght(T) = 6
k=3 k+lenght(T)-1=8
k ← 0 while (k + length(T) ≤ length(S)) do {
If (S[k .. k+length(T)-1] = T) {
return true } k ← k + 1
} return false
Start checking at the beginning
Are there enough characters left?k + length(T) is the size of we have covered
Check substring given by kStr[k..k+lenght(T)-1] has size length(T)
k k+ length(T)-1
Ready for another substring
k ← 0 while (k + length(T) ≤ length(S)) do {
If (S[k .. k+length(T)-1] = T) {
return true } k ← k + 1
} return false
k ← 0 while (k + length(T) ≤ length(S)) do {
j ← 0 match ← true while (j < length(T) and match = true) do { If (S[j+k] ≠ T[j]) {
match ← false } j ← j+1
} If (match == true) {
return true } k ← k + 1
} return false
k ← 0 while (k + length(T) ≤ length(S)) do {
If (S[k .. k+length(T)-1] = T) {
return true } k ← k + 1
} return false
j ← 0 match ← true while (j < length(T) and match = true) do { If (S[j+k] ≠ T[j]) {
match ← false } j ← j+1
}
Check substring given by kStr[k..k+lenght(T)-1] has size length(T)
k k+ length(T)-1
j
T
k ← 0 while (k + length(T) ≤ length(S)) do {
j ← 0 match ← true while (j < length(T) and match = true) do { If (S[j+k] ≠ T[j]) {
match ← false } j ← j+1
} If (match == true) {
return true } k ← k + 1
} return false
k ← 0 while (k + length(T) ≤ length(S)) do {
If (S[k .. k+length(T)-1] == T) {
return true } k ← k + 1
} return false
A Boat ProblemA farmer wishes to take a goat, a cabbage and a wolf across
a river. However, his boat can only take one of them at a time. Therefore he will need to make several trips. Also, he cannot leave the goat alone with the cabbage, and cannot
leave the wolf alone with the goat. Find a way for the farmer to get everything across the river.
Cover Design of Anany Levitin, Introduction to the Design and Analysis of Algorithms (2nd Edition)
List StatesFarmer Wolf Goat CabbageR R R RR R R LR R L RR R L LR L R RR L R LR L L RR L L LL R R RL R R LL R L RL R L LL L R RL L R LL L L RL L L L
R = right side of the riverL = left side of the river
END
START
List StatesFarmer Wolf Goat CabbageR R R RR R R LR R L RR R L LR L R RR L R LR L L RR L L LL R R RL R R LL R L RL R L LL L R RL L R LL L L RL L L L
R = right side of the riverL = left side of the river
END
START
Representation of StatesFarmer Wolf Goat CabbageR R R R FWGCR R R L FWGcR R L R FWgCR L R R fwGCR L R L FwGcL R L R fWgCL R L L fWgcL L R L fwGcL L L R fwgCL L L L fwgc
! lower case they on the left side ! UPPER CASE they on the right side
! R means they are on the right side of the river ! L means they are on the left side of the river
Representation of StatesFarmer Wolf Goat CabbageR R R R FWGCR R R L FWGcR R L R FWgCR L R R fwGCR L R L FwGcL R L R fWgCL R L L fWgcL L R L fwGcL L L R fwgCL L L L fwgc
! lower case they on the left side ! UPPER CASE they on the right side
! R means they are on the right side of the river ! L means they are on the left side of the river
Representation of StatesFarmer Wolf Goat CabbageR R R R FWGCR R R L FWGcR R L R FWgCR L R R fwGCR L R L FwGcL R L R fWgCL R L L fWgcL L R L fwGcL L L R fwgCL L L L fwgc
! lower case they on the left side ! UPPER CASE they on the right side
! R means they are on the right side of the river ! L means they are on the left side of the river
Representation of StatesFarmer Wolf Goat CabbageR R R R FWGCR R R L FWGcR R L R FWgCR L R R fwGCR L R L FwGcL R L R fWgCL R L L fWgcL L R L fwGcL L L R fwgCL L L L fwgc
! R means they are on the right side of the river ! L means they are on the left side of the river ! lower case they on the left side ! UPPER CASE they on the right side
Final State
Start State
Brute force approach to the boat problem
1. List all possible states2. Eliminate states that are not valid3. Identify transitions between states4. Look for a path that starts at the initial state, and ends at the end state
Traveling SalesmanSuppose you are given the following driving distances in
kms between the following capital cities.
Find the shortest route that enables a salesman to start at Canberra, visit all the other cities, before returning to
Canberra.
Adelaide Brisbane Canberra Darwin Sydney
Adelaide 2053 1155 3017 1385
Brisbane 2053 1080 3415 939
Canberra 1155 1080 3940 285
Darwin 3017 3415 3940 3975
Sydney 1385 939 285 3975