© 2015 Lu Lu
40
© 2015 Lu Lu
Transcript of © 2015 Lu Lu
© 2015 Lu Lu
PORCINE ROTAVIRUS ADSORPTION TO 24 SALAD VEGETABLES AND
SANITIZATION BY FREE CHLORINE
BY
LU LU
THESIS
Submitted in partial fulfillment of the requirements
for the degree of Master of Science in Environmental Engineering in Civil Engineering
in the Graduate College of the
University of Illinois at Urbana-Champaign, 2015
Urbana, Illinois
Adviser:
Associate Professor Thanh H. (Helen) Nguyen
ii
ABSTRACT1
Foodborne diseases are a persistent problem in the United States and worldwide.
Fresh produce, especially those used as raw foods like salad vegetables, can be
contaminated, causing illness. In this study, we determined the number of rotaviruses
adsorbed on produce surfaces using group A porcine rotaviruses and 24 cultivars of leafy
vegetables and tomato fruits. We also characterized the physicochemical properties of
each produce’s outermost surface layer, known as the epicuticle. The number of
rotaviruses found on produce surfaces varied among cultivars. Three-dimensional
crystalline wax structures on the epicuticular surfaces were found to significantly
contribute to the inhibition of viral adsorption to the produce surfaces (p=0.01). We
found significant negative correlations between the number of rotaviruses adsorbed on
the epicuticular surfaces and the concentrations of alkanes, fatty acids, and total waxes on
the epicuticular surfaces. Partial least square model fitting results suggest that alkanes,
ketones, fatty acids, alcohols, contact angle and surface roughness together can explain
60% of the variation in viral adsorption. The results suggest that various fresh produce
surface properties need to be collectively considered for efficient sanitation treatments.
Up to 10.8 % of the originally applied rotaviruses were found on the produce surfaces
after three washing treatments, suggesting a potential public health concern regarding
rotavirus contamination.
1 This abstract was published on PLoS ONE. Lu L, Ku K-M, Palma-Salgado SP, Storm AP, Feng H, Juvik
JA, et al. (2015) Influence of Epicuticular Physicochemical Properties on Porcine Rotavirus Adsorption to
24 Leafy Green Vegetables and Tomatoes. PLoS ONE 10(7): e0132841. doi:10.1371/journal.pone.0132841
iii
To Family and Friends
iv
ACKNOWLEDGMENTS
This work was supported by the USDA National Institute of Food and Agriculture
grant ILLU-000-615. I would like to thank Dr. Kang-mo Ku, Sindy Paola Palma-Salgado,
and Andrew Storm for their contribution to this project. All members in Professor Helen
Nguyen’s group are acknowledged with thanks, with special thanks given to Miyu
Fuzawa for her kind help with sanitizer experiments and Dr. Leonardo Gutierrez for
providing porcine rotavirus stock (OSU strain). I would like to express my gratitude to
Professor Helen Nguyen, Professor John Juvik, and Professor Hao Feng for their
guidance and precious advice during the project. Finally, I want to give my sincere thanks
again to my advisor Professor Helen Nguyen for her great support, patience and
encouragement throughout my master program.
v
TABLE OF CONTENTS
CHAPTER 1: INTRODUCTION ………………………………………………… 1
CHAPTER 2: MATERIALS AND METHODS………………………………….. 4
2.1 Cell culture and OSU rotavirus propagation and purification……………. 4
2.2 Rotavirus adsorption assay to leafy vegetables and tomato fruits.…......... 6
2.3 Viral RNA extraction from inoculated produce surfaces……………....... 8
2.4 Detection of OSU rotavirus adsorption by RT-qPCR ………………….... 8
CHAPTER 3: RESULTS……………………..…………………………………… 11
3.1 OSU rotavirus adsorption to epicuticular surfaces………………………... 11
3.2 Correlations within and between physicochemical properties of epicuticle and
viral adsorption………………………………………………………........ 13
CHAPTER 4: DISCUSSION…..………………………………………………….. 16
CHAPTER 5: SANITIZATION...…………………………………………………. 22
CHAPTER 6: REFERENCES…………………………………………………....... 29
1
CHAPTER 1
INTRODUCTION2
As a persistent problem in the United States, every year, foodborne pathogens
cause illness for approximately 48 million Americans, and among these cases, 3,000 are
fatal (1). According to the U.S. Food and Drug Administration (2), foodborne illnesses
are estimated to cost the U.S. economy $10-83 billion each year, from medical expenses,
reduced productivity, and other costs. Of all foodborne illnesses in the U.S., human
enteric viruses are a leading cause (3). In a number of foodborne outbreaks,
epidemiological evidence suggests that contaminated produce surfaces during pre- and
post-harvest are critical in viral transmission (4). Produce contamination before harvest,
such as being irrigated or spayed with contaminated water, is an important safety
concern, especially for raw and fresh produce (5-10). Although certain inactivation
strategies such as thermal inactivation and high hydrostatic pressure are effective in viral
inactivation, they are mostly not applicable to fresh vegetable produce used for raw
consumption because they either cook the produce or cause significant tissue damage and
changes in produce appearance and taste (11, 12). In the U.S., reports of foodborne
illnesses associated with contaminated raw produce have increased, with salad greens and
fruits found as the vehicles for pathogen transmission (13). Despite the role of fresh
produce in viral transmission, only limited information is available concerning the factors
controlling viral adsorption to produce surfaces.
Several factors, including surface charge, roughness, and hydrophobicity, were
found to contribute to viral adsorption to produce (14-17). Ionic strength and pH of
2 This chapter was included in the same plication on PLoS ONE.
2
solutions containing viruses and temperature also influenced viral adsorption and survival
(15, 17, 18). The presence of stomata and exposed carbohydrates of plant cell walls were
found to enhance adsorption of viruses to romaine lettuce (19-21). Produce surfaces or
cuticles are composed of various layers that serve separate functions in plant
development, protection, and adaptation to the growing environment (22). The outermost
layer of produce surfaces is composed of epicuticular waxes and is the most likely to
interact with microorganisms attaching to produce surfaces. The epicuticular waxes were
proposed to act as a physical barrier to prevent infection by plant viruses or fungi, in
addition to other critical functions, including drought tolerance and tissue protection from
ultraviolet light (23-25). While previous studies show an important role of the
physicochemical characteristics of produce surfaces for several species influencing viral
adsorption, a comprehensive study of the major leafy green salad species commonly
consumed by humans as fresh or minimally processed produce has not been conducted.
To fill this knowledge gap, we conducted a study to determine the correlations
between viral adsorption and physicochemical characteristics of produce surfaces using
24 cultivars of leafy green vegetables and tomato fruits. Group A rotavirus, the most
common cause of severe diarrhea in children under the age of five and of gastroenteritis
among all ages (4, 10, 26), was selected as a model enteric viral pathogen. Although a
rotavirus vaccine was developed and applied in both developed and developing countries,
in such areas as Africa and Asia, rotavirus is still a major cause of pediatric
gastroenteritis. Rotavirus vaccine efficacy is only 48% in Asia and 30% in Africa, with
the lowest efficacy found in Mali (17%) (27-30). Group A rotaviruses were detected in
wastewater and surface water in Kenya (31), irrigation water and even receiving
3
vegetables in South Africa (10). Group A porcine rotavirus (OSU strain), a surrogate for
human rotavirus Wa, was used in our study due to its stability and similar structural
proteins to the human rotavirus strain Wa (32). Twenty-four different cultivars of leafy
greens and tomatoes were grown in the greenhouse and used as model produce.
Compared to previous work (14-20, 33), the greater number of cultivars from various
species in this study provides more comprehensive information on viral adsorption to
produce and generates a larger database for future investigations. Undamaged vegetable
leaves and tomato fruit skins were characterized and tested in our viral assays to generate
correlations between viral adsorption and physicochemical characteristics of the
outermost layers of produce surfaces. The produce surface hydrophobicity, roughness,
stoma number and length, the presence or absence of 3-D epicuticular wax crystals, and
the chemical compositions of the epicuticular wax layers were determined based on the
measurements of contact angle, laser confocal microscopy, scanning electron microscopy
(SEM), and chemical identification using gas chromatography.
4
CHAPTER 2
MATERIALS AND METHODS3
2.1 Cell culture and OSU rotavirus propagation and purification
Group A porcine rotaviruses OSU strain (ATCC # VR-892) were propagated by
infecting embryonic African green monkey kidney cells (MA-104 cells) grown in
minimum essential medium (MEM, Gibco) containing 5% fetal bovine serum (FBS) (34,
35). Porcine rotaviruses OSU strain and MA-104 cells were purchased from ATCC
(Manassas, VA). Before virus infection, the MA-104 cells were grown in roller bottles
with an inner surface area of 850 cm2 (Thermo Fisher Scientific Inc., Waltham, MA) and
incubated at 37˚C under 5% CO2 for 5-6 days. The medium was replaced by fresh
medium on the third day of incubation. After a confluent cell monolayer was visible on
the bottle wall, the medium was removed, and the cells were washed twice with
phosphate-buffered saline (PBS) solution. After the PBS buffer was removed, rotaviruses
were activated with 10 μg/ml of trypsin for 30 min. The viruses were added to maintain
around 2-5 focus-forming units per cell (FFU/cell). After 90 min of incubation at 37˚C
under 5% CO2, the cells were washed twice with PBS and then incubated in MEM
without the serum for 16 to 18 h. Once the infected cells were fully detached from the
bottle wall, the cells and viral solution were collected and stored at 4˚C until further
purification. The rotavirus solution underwent three sequential freezing and thawing
treatments at -80˚C and 37˚C. Then, the viruses were separated from the cell debris by
centrifugation at 1000 × g for 10 min at 20e cell debris by centrifugation at 1000 e wall,
incubation. After a confluent cell monolayer was visiblThermo Scientific, Nalgene,
3 This chapter was included in the same plication on PLoS ONE.
5
Rochester, NY) to further remove cell debris. Then, the filtrate was subjected to
membrane dialysis using a 100 kDa ultrafiltration membrane (Koch Membrane, polymer
polyvinylidene fluoride; Koch, Wilmington, MA) in an Amicon stirred cell (Millipore) to
remove the medium and to concentrate the viruses, as described in previous work (36). In
this dialysis membrane system, the rotaviruses were retained on the membrane surface
and subsequently washed with a solution containing 0.1 mM of CaCl2 and 1 mM
NaHCO3. This concentration of Ca2+ was used to keep the rotavirus capsid stable (37).
The infectivity assay (FFU assay) was adopted from previous publications [38,
39], and the protocol is briefly described here. The rotavirus stock was treated with 10
μg/ml of trypsin for 30 min and made into a series of dilutions in serum-free MEM. After
confluent MA104 monolayers in a 96-well plate had been rinsed twice with PBS, 50 μl of
each diluted virus solution from the rotavirus stock was applied to the monolayers and
incubated at 37˚C under 5% CO2 for 30 min. Afterward, the virus solutions were
removed from the plate and the cell monolayers were washed twice with serum-free
MEM. The cells were then incubated with 100 μl of serum-free MEM in each well at
37˚C under 5% CO2 for 18 h prior to immunocytochemical quantification of infected
cells by rotaviruses.
After 18-h incubation, the cell monolayers were rinsed twice with PBS, and fixed
with 9:1 methanol (Sigma-Aldrich, St. Louis, MO) – glacial acidic acid (Fisher Scientific,
Waltham, MA) for 2 min. The monolayers were then hydrated with 70% and 50%
ethanol subsequently for 5min, and then subjected for 10-min treatment with 3% H2O2
(30%; Fisher Scientific, Waltham, MA) diluted in wash buffer (125 mM Tris (Fisher
Scientific, Waltham, MA), 350 mM NaCl (Fisher Scientific, Waltham, MA), and 0.25%
6
Triton X-100 (Sigma-Aldrich, St. Louis, MO); pH = 7.6). Afterward, the cells were
rinsed with wash buffer for 10 min and incubated with 5% normal goat serum (Vector
Laboratories, Burlingame, CA) for 20 min to block nonspecific bindings of primary
antibodies. After this step, the primary antibodies (Dako, Carpinteria, CA; catalog no.
B218) diluted 1:100 in wash buffer were applied to the monolayers and incubated at
37°C for 1 h. After being rinsed twice with wash buffer, the cells were incubated with the
secondary antibodies (biotinylated goat anti-rabbit immuno-globulin G; Vector
Laboratories, Burlingame, CA) diluted 1:200 in wash buffer for 20 min. Two washings
with wash buffer were applied to the monolayers after this step. After washing, the ABC
reagent (Vector Laboratories, Burlingame, CA), made 30 min prior to use and diluted as
1 (reagent A):1 (reagent B):50 (wash buffer), was applied to the monolayers for 20 min.
Afterward, the cells were rinsed twice with wash buffer and then incubated with the stain
peroxidase chromogen (KPL, Gaithersburg, Maryland) for less than 9 min to avoid
nonspecific cell staining. Deionized (DI) water was then added to each well, and the
brown-stained cells, which were the infected cells by rotaviruses, were quantified using
an inverted microscope. This assay using a 96 well plate has a detection limit of 1200
FFU (50 μl of 2.4 ×104 FFU ml-1 viral solution).
2.2 Rotavirus adsorption assay to leafy vegetables and tomato fruits
Harvested vegetable heads, leaves, or tomato fruits were rinsed with DI water to
remove soil particles attached to their surfaces and dried by gently laying a Kimwipe
(Kimberly-Clark, Irving, TX) on the adaxial surface. When no water was visible on the
produce surfaces, two 15.6 mm diameter disks were excised from each leaf and fruit
sample. For each cultivar, two leaves, heads, or fruits from three different plants were
7
harvested for 6 replicate measurements. Each piece was gently transferred, with a
tweezer, onto the top of a droplet of 300 µl diluted porcine rotavirus solution in PBS on a
35-mm-glass-bottom-dish (MatTek Corporation, Ashland, MA). See Figure 1 for the
experimental schema. Rotavirus concentration in this droplet was determined to be 7.17 ±
0.05 log10 genome copies/ml (N=4) by RT-qPCR (see below). The petri dish containing
the produce piece and the viral droplet was loosely capped and incubated for 2 h at room
temperature in a biological cabinet. After this incubation period, the produce pieces were
transferred with a tweezer, in the same way as described above, to a 24-well plate, which
had 700 µl PBS in each well. The plate was gently shaken for 15 s, and the PBS solution
was then carefully removed. This washing step was repeated three times before the
produce pieces were removed from the well plate and the disks were excised with another
corker borer (with a diameter of 11.1 mm) into smaller diameter pieces to remove the cut
edges. Since viruses might be attached to the edges during the incubation period or
washing steps, this treatment was important to avoid potentially confounding results.
Each piece was transferred with a tweezer into a 1.7 ml labeled tube for RNA extraction
and RT-qPCR. The adaxial surfaces were kept facing up throughout the whole
experiment, except during incubation and washing.
Figure 1. Experimental schema for the OSU rotavirus adsorption assay to leafy
vegetables and tomato fruits.4
4 This figure was included in the same plication on PLoS ONE.
8
The negative controls for these assays underwent the same procedure except that
they were incubated on PBS droplets without porcine rotaviruses for 2 h. Based on the
results obtained from the negative controls, we concluded that the leaves were not
previously contaminated with rotaviruses. Due to the pool of 24 cultivars whose mature
tissues were available at different times, the viral assays were conducted over an 8-week
period from March to May, 2014. All viral adsorption experiments were conducted using
the same OSU rotavirus stock (see below for concentration determination). Infectivity
assays showed that the OSU rotavirus stock had approximately 5×107 FFU/ml. Infectivity
assays were also conducted for the viral adsorption experiments, however, the
concentration of infective rotaviruses on the produce samples was generally below the
detection limit of the infectivity assay using a 96 well plate (2.4 ×104 FFU ml-1 viral
solution). While the infectivity assay may be sensitive to aggregation of viruses, the
qPCR method is not because it is based on the extracted genomes of all viruses.
2.3 Viral RNA extraction from inoculated produce surfaces
The RNA extraction was conducted with E.Z.N.A Total RNA Kit I (Omega,
Norcross, GA) following the manufacturer’s protocol in a sterilized RNA extraction
cabinet to avoid RNA contamination and degradation. The extracted RNA was dissolved
in diethylpyrocarbonate (DEPC) water and stored at -80˚C before quantification by real-
time quantitative PCR (RT-qPCR).
2.4 Detection of OSU rotavirus adsorption by RT-qPCR
We first determined the concentration of the OSU rotavirus stock (8 log10 genome
copies/ml) by conducting one-step RT-qPCR in parallel with a standard calibration curve
9
for known concentrations of a plasmid cDNA standard (2207 bp) containing the inserted
rotavirus NSP3 gene (212 bp). The ‘JVK’ Primers (Forward:
CAGTGGTTGATGCTCAAGAT and Reverse:
TCATTGTAATCATATTGAATACCCA) were used as described in previous studies
(38, 39) to specifically amplify the NSP3 gene of the OSU rotaviruses. The primers and
the plasmid cDNA standards were purchased from Integrated DNA Technologies
(Coralville, IA). The concentration of dissolved plasmid DNA in DI water was measured
by Qubit dsDNA HS assay kit (Life Technologies, Grand Island, NY), according to the
manufacturer’s manual. The measured cDNA standard concentration (1.88 µg/ml) was
then converted into copy numbers (11.9 log10 genome copies/ml). For experiments with
plant tissues, the extracted RNA from the OSU stock with known concentration (8 log10
genome copies/ml) was used to determine a detection limit of 3.9 log10 genome copies/ml
with the corresponding Ct value at 34.3 ± 0.1 (N=3).
The number of adsorbed rotaviruses on each produce sample surface was
determined by one-step RT-qPCR using an iTaq One-Step Universal SYBER RT-qPCR
kit (Bio-Rad Laboratories, Hercules, CA). The overall volume of each qPCR reaction
was 10 µl, composed of 2 × iTaq Mix, 0.3 mM of each primer, 125 × iScript reverse
transcriptase, 3 µl RNA template, and DNase/RNase-free distilled water. The prepared
PCR reactions were conducted with a Bio-Rad Unicon qPCR machine (Hercules, CA).
The qPCR program was 48˚C, 10 min (reverse transcription), and 95d 0 min (reverse
transcription), PCR program was 48was 48TechnologiiTaq polymerase), with cycles of
95˚C, 15 s (melting DNA double strands), 54˚C, 20 s (primers annealing), 60˚C, 30 s
(elongation), 60-95˚C, and 0.05 s increments. The PCR specificity was checked on a gel
10
after qPCR, and only one band at around 200bp was observed under a Bio-Rad Universal
Hood II Imager (Hercules, CA). The number of RNA genome copies from OSU
rotaviruses adsorbed to each sample disk was calculated via equations obtained from
standard curves conducted for every set of qPCR. For example, Y = −3.497X + 47.536
(R2 = 0.99, efficiency = 93%). Y is the RNA amount (log10 genome copies/ml), and X is
the Ct value. The number of adsorbed OSU rotaviruses was expressed as log10 genome
copies normalized by the produce sample area in cm2.
Leaves from two cultivars with epicuticular wax crystals (‘Top Bunch’ collards
and ‘Red Russian’ kale) and two cultivars without epicuticular wax crystals (‘Two Star’
lettuce, and ‘Totem’ Belgian endive) were selected as additional controls for RT-qPCR
inhibitors. RT-qPCR inhibitors were tested by spiking RNA extracted from the OSU
virus stock into the extracted solutions from these four cultivars used as controls. The
measured Ct values from these four controls were compared with those determined for
the extracted RNA at the same concentration. The extracted RNA with a concentration of
5.3 log10 genome copies /mL showed an average Ct value of 28.72 ± 0.4 (N=6), while the
controls with the same concentration had Ct values of 28.89 ± 0.2 (N=8). No significant
difference was found between these two sets of Ct values (P=0.35), and therefore no
inhibitors were present in this system. The negative controls for rotavirus adsorption
assays showed their Ct values as “NA”, indicating no rotaviruses present on the 24
vegetables prior to the viral adsorption assays. The same Ct readings (“NA”) were
obtained for qPCR negative controls, which used DNase/RNase-free distilled water as
templates, suggesting no contamination in the qPCR reactions.
11
CHAPTER 3
RESULTS5
3.1 OSU rotavirus adsorption to epicuticular surfaces
As confirmed by RT-qPCR results, OSU rotaviruses were found on the adaxial
surfaces of all 24 cultivars when the produce surfaces were incubated with the viral
suspension for 2 h at room temperature. The number of adsorbed rotaviruses on the leaf
or tomato fruit surfaces (an area with a diameter of 11 mm) ranged from approximately
3.7 to 5.6 log10 genome copies/cm2 (Table 1). The three species with the highest levels of
viral adsorption included ‘Southern Giant Curled’ mustard greens (5.6 ± 0.1 log10
genome copies/cm2), Tatsoi (5.4 ± 0.1 log10 genome copies/cm2), and ‘Racoon’ spinach
(5.6 ± 0.2 log10 genome copies/cm2). The three species with the lowest the number of
rotaviruses adsorbed on epicuticular surfaces were ‘Top Bunch’ collard (3.7 ± 0.1 log10
genome copies/cm2), ‘Sun Gold’ tomato (3.9 ± 0.4 log10 genome copies/cm2) and
‘Outredgeous’ romaine lettuce (4.1 ± 0.5 log10 genome copies/cm2). Within the Solanum
genus, the cultivar ‘Rose’ had the highest number of adsorbed rotaviruses (4.4 ± 0.3 log10
genome copies/cm2), followed by ‘Indigo Rose’ (4.2 ± 0.4 log10 genome copies/cm2), and
‘Sun Gold’ tomatoes (3.9 ± 0.4 log10 genome copies/cm2). The percentage of rotaviruses
that adhered to each cultivar was calculated using the numbers of rotaviruses adsorbed on
the produce surfaces divided by the rotavirus genome copies in the initial virus
suspension. From 0.1% to 10.8% of the initial viruses were found on produce surfaces,
suggesting that the surface physicochemical properties of the produce may play an
important role on viral adsorption. Control experiments with ‘Stabor’ kale and ‘Red
5 This chapter was included in the same plication on PLoS ONE.
12
Russian’ kale showed that viral adsorption was statistically similar for adaxial and
abaxial surfaces (P = 0.89 for ‘Stabor’ kale; P = 0.18 for ‘Red Russian’ kale).
Table 1. Chemical composition of epicuticular waxes from 24 vegetable leaves and
tomato fruits and the genome copies from adsorbed rotaviruses on these produce
surfaces. 6
a The percentage was calculated using number of adsorbed rotaviruses divided by OSU
rotavirus genome copies in the initial viral solution (7.17 ± 0.05 log10 genome copies/ml).
LSD value was calculated by Student’s T-test at P = 0.05.
6 This table was included in the same plication on PLoS ONE and created by Dr. Kang-mo Ku. Data of
epicuticular wax content were provided by Dr. Kang-mo Ku.
13
3.2 Correlations within and between physicochemical properties of epicuticle and
viral adsorption
Based on the statistical analysis, 16 significant correlations were found among
and between physicochemical properties of epicuticular layer and the number of adsorbed
rotaviruses (Table 2). Correlations within physicochemical properties of the produce
were conducted from data generated from produce collected at the same time. Contact
angle showed significant positive correlations with alkane (r = 0.659, P < 0.001), fatty
acid (r = 0.442, P = 0.031), ketone (r = 0.637, P < 0.001), and total wax concentrations (r
= 0.647, P < 0.001). Different wax concentrations were positively and significantly
correlated with each other. Previous research that used leeks as a model found that
epicuticular wax biosynthesis is initiated by the conversion of fatty acids to aldehydes,
then alkanes, alcohols, and ketones (40). This shared biosynthetic pathway would explain
the co-correlation of the concentrations of various waxes.
Table 2. Correlation coefficients (r) between epicuticular physiochemical properties and
the number of rotaviruses adsorbed on the produce surfaces.7
Pearson’s correlation coefficients (r) were calculated by mean values of each variables
from each cultivar, and the r values in bold are significantly correlated at P < 0.05.
7 This table was included in the same plication on PLoS ONE and created by Dr. Kang-mo Ku. Data were
provided by Dr. Kang-mo Ku.
14
Three significant correlations were found between the number of adsorbed
rotaviruses and physicochemical properties of the epicuticle. The numbers of OSU
rotaviruses adsorbed on the produce surfaces showed significant negative correlations
with alkane (r = -0.498, P = 0.013), fatty acid (r = -0.466, P = 0.022), and total wax
concentrations (r = -0.473, P = 0.020). Contact angle (r = -0.019, P = 0.930), surface
roughness (r = 0.360, P = 0.084), stoma numbers (r = -0.356, P = 0.089), stoma lengths (r
= 0.112, P = 0.518), alcohols (r = -0.226, P = 0.195), and ketones (r = -0.246, P = 0.174)
were not correlated with the number of adsorbed rotaviruses. The six major epicuticular
variables, alkane, fatty acid, alcohol, and ketone concentrations, contact angle, and
surface roughness, were used to generate a PLS model (Figure 2) to predict the number of
rotaviruses adsorbed on the epicuticular surfaces. Total wax was excluded because this is
a redundant indicator for individual wax components. Stomata lengths and numbers were
also excluded because viral adsorption was found on stomata-free tomato fruits. The
performance of the final PLS model is evaluated according to the coefficient of
determination (R2) and the root mean square error of prediction (RMSEP) in the
prediction set. Generally, R2, which describes how well the data of the training set is
mathematically reproduced, varies between 0 and 1 (with 1 indicating a perfectly fitted
model). In PLS model six factors were extracted to get a maximized prediction value as
the van der voet T2 statistic tests did not differ significantly from the optimized model (3
factors extraction, R2=0.60) with the minimum predicted residual sum of squares
(PRESS) value. As RMSEP is a good measure of how accurately the model predicts the
response, lower values of RMSEP indicate a better fit. A VIP score indicates how
important this factor contributes to describing the variation in viral adsorption to
15
vegetable surfaces, compared to other variables. A VIP ≥ 0.8 is considered the cut-off
value for a variable making a significant contribution to dimensionality reduction (41).
We found that the RMSEP was 0.25 when 6 PLS factors were extracted in the prediction
model and the PLS model explained 60% (adjusted R2=0.60) of the experiment-wide
variation in the number of adsorbed rotaviruses using the physicochemical data. The
alkane concentration showed the highest variable importance for projection value (VIP =
1.15), followed by fatty acids (1.12), contact angle (0.97), ketones (0.95), alcohols (0.92),
and surface roughness (0.85).
Figure 2. Partial least squares prediction model for the number of adsorbed viral particles
on produce surfaces using six epicuticular physicochemical properties, including
concentrations of alkanes, fatty acids, alcohols, and ketones, contact angle, and surface
roughness.8
8 This figure was included in the same plication on PLoS ONE.
16
CHAPTER 4
DISCUSSION9
In this study, the influence of 3-D epicuticular wax crystals, the chemical
components of epicuticular layers, hydrophobicity and roughness of the produce surfaces,
and the presence of stomata were investigated to reveal major surface properties
associated with the number of adsorbed rotaviruses. Significantly, negative correlations
between viral adsorption and the concentrations of alkanes, fatty acids, and total wax on
the epicuticular surface were observed (Table 2). Although concentrations of alkanes,
fatty acids, and total wax were significantly correlated with contact angle, which is a
measurement of surface hydrophobicity, this trait was not correlated with the number of
adsorbed rotaviruses. The lack of correlation with contact angle implies that the
inhibition effects of the epicuticular wax components on viral adsorption may not be
directly associated with increased hydrophobicity of the surfaces, but rather by the
presence of 3-D epicuticular wax crystals. Indeed, the presence of 3-D wax crystals on
the epicuticular layers of the produce showed significantly lower rotavirus adsorption
than those without 3-D crystalized wax structures (P = 0.012; Table 3). For example, we
observed a significantly lower number of rotaviruses adsorbed on the epicuticular
surfaces on ‘Outredgeous’ romaine lettuce than on the other two lettuces (‘Two star’ and
‘Tropicana’). While these three lettuce cultivars had similar adaxial contact angles, only
‘Outredgeous’ romaine lettuce had 3-D epicuticular wax crystals. These results suggest
that the presence of the 3-D epicuticular wax crystals may play a more important role in
viral adsorption than surface hydrophobicity. Another explanation of the lack of
correlation between OSU viral adsorption and hydrophobicity is that the measurement of
9 This chapter was included in the same plication on PLoS ONE.
17
contact angle was likely influenced by both surface hydrophobicity and roughness (42,
43).
Table 3. Comparison of physiochemical epicuticular properties between cultivars with 2-
D or 3-D wax crystals on leaf surfaces.
Absence or presence of 3-D wax crystals was determined by SEM. Tomato cultivars were
excluded because of different tissue type.10
Although previous work suggested that surface roughness favors microorganism
adhesion and prevents detachment of E. coli from selected fruits and sprouting seeds
when treated with a combination of organic acids and surfactants (44, 45), the smaller
size of OSU rotaviruses compared to bacteria may allow for viral adsorption on the
10 This table was included in the same plication on PLoS ONE and created by Dr. Kang-mo Ku. Table data
were provided by Dr. Kang-mo Ku.
18
produce surfaces regardless of the roughness. Using the dynamic light scattering method
described in previous studies (46, 47), we found that the rotavirus suspension showed one
peak with an average diameter of 175 ± 1 nm, suggesting of a slight aggregation of every
two viruses. This aggregation size is much lower than the height variations of adaxial
surfaces (1.1 µm to 8.0 µm) within the 24 cultivars from various species. We suggest that
the relatively smaller size of rotaviruses compared to the height variations of the leaf
surfaces allow the adsorbed rotaviruses to be located in the “valleys” of produce surfaces
and may not be removed by the washing treatments. Our results suggest that for
nanometer-sized viruses, compared to micrometer scale bacteria like E. coli, surface
roughness may not be a critical factor controlling viral adsorption to produce surfaces.
Previous work found the aggregation of E. coli O157 and norovirus virus-like-
particles on or inside the stomata (13, 19), suggesting that the presence of stomata may
significantly help viruses adsorb to the vegetable surfaces. Hence, the contribution of
stomata to viral adsorption was also investigated in our study by correlating adaxial
stoma numbers and lengths with the number of adsorbed rotaviruses. While no significant
correlations were found between the numbers of adsorbed rotaviruses and adaxial stoma
numbers (P = 0.113) and lengths (P = 0.689), we found that vegetable samples with
crystalized wax present on their surfaces showed significantly higher contact angles, and
concentrations of alkanes, fatty acids, ketones, and total wax, as well as significantly
lower surface roughness and the number of adsorbed rotaviruses, than the samples
without 3-D crystalized wax present on the epicuticular surface (Table 3). This
observation is consistent with a previous study reporting a reduced adsorption of the plant
fungal pathogen, Agathis robusta, when stomata were covered by wax (48). In our study,
19
eight of the 24 vegetables had 3-D wax crystals on their epicuticular layers, and seven out
of eight had stomata covered by wax crystals, as shown in Figure 3. The wax crystals
shielding the stomata could prevent OSU rotaviruses from residing on or inside the
stomata. Notably, ‘Outredgeous’ romaine lettuce did not have stomata covered by wax
crystals, suggesting the potential for deposition of rotaviruses on or inside the stomata as
observed in a previous study showing norovirus-like-particle aggregation at stomata of
romaine lettuce leaves (19). In addition, up to 4.4 ± 0.3 log10 genome copies/ cm2 OSU
rotaviruses were able to adsorb to tomato fruit surfaces, which do not have stomata (49).
These results suggest that for this comprehensive set of 24 fresh produce cultivars the
presence of stomata is not necessary for rotavirus adsorption to produce surfaces, and the
presence of 3-D epicuticular wax crystals covering stomata, rather than the stoma lengths
and numbers, may play a more important role in the number of adsorbed rotaviruses
associated with leaf stomata.
Figure 3. Epicuticular images from various vegetable leaves and tomato fruits.11
11 This figure was included in the same plication on PLoS ONE and created by Dr. Kang-mo Ku.
20
Electrostatic forces, the presence of stomata, and exposed carbohydrates on
epicuticular surfaces of plants have been suggested as important contributors to the
number of rotaviruses adsorbed on the produce surfaces (15, 18, 19). Here we established
a PLS prediction model to quantitatively explain the number of rotaviruses adsorbed on
the epicuticular surfaces based on the physicochemical properties of the epicuticular
surfaces. The PLS model was selected instead of multiple linear regression model
because PLS allows for the inclusion of X variables that co-correlate (50). As described
above, significant correlations between contact angles and concentrations of alkane,
ketones, and fatty acids were observed. Based on the PLS model results, the major
epicuticular properties which included the concentration of alkanes, fatty acids, alcohols,
and ketones, contact angle, and surface roughness, together could explain 60% of the
variation in viral adsorption among the cultivars. While we found moderate correlations
between each individual variable and the number of adsorbed rotaviruses, none of these
factors can individually explain more than 25% of the viral adsorption results. The
highest coefficient of determination was observed between viral adsorption and alkane
concentrations (R2 = 0.238). The PLS model results suggest that these major epicuticular
properties together impact the number of adsorbed rotaviruses. In addition, these major
epicuticular properties are interdependent. For example, increasing wax contents may
generate physical barriers that can increase contact angle. To the best of our knowledge,
statistical modeling for prediction of viral adsorption has not been conducted, and this
study for the first time calculated how these produce surface variables could
quantitatively describe viral adsorption.
21
In summary, OSU rotaviruses were found to attach to a wide range of salad
vegetables, suggesting a potential public health concern regarding rotavirus
contamination during fresh produce pre-harvest production. This is the first report of
lower viral adsorption on fresh produce surfaces associated with the presence of 3-D
epicuticular wax crystals. In addition, the results obtained with 24 cultivars of leafy
vegetables and tomato fruits commonly used in salads suggest that physical and chemical
surface properties of the fresh produce need to be collectively considered for efficient
sanitizer development. Future studies will determine whether commonly used sanitation
strategies effectively remove adsorbed viruses and how these strategies influence the
concentrations of alkanes, fatty acids, alcohols, and ketones on the produce surfaces that
may allow for recontamination after sanitation.
22
CHAPTER 5
SANITIZATION
Introduction:
As the major pathogen that causes severe gastroenteritis among children, Group A
rotaviruses can be a food safety concern through its pre-harvest contamination of produce
(51). In South Africa, group A rotaviruses were detected in irrigation water and receiving
vegetables, suggesting a potential human infection with rotavirus (10). Fresh produce,
due to the raw consumption and little processing, puts consumers at a higher risk of being
infected. Therefore, in this study, the sanitization effects of free chlorine, one of the most
commonly used and cheap sanitizers in food industry, were tested on three species of
salad vegetables at various contact-time lengths. Previous studies recommended to use
free chlorine at above 50 mg/l, at a pH < 8.0, and with a contact time between 1-2
minutes for fresh vegetables (52). Hence, free chlorine was used at 50 ppm and pH = 7 in
this study.
In order to detect only infectious rotaviruses at very low concentrations, a new
quantification method was adopted from previous publication but modified in this
experiment to greatly increase the sensitivity of viral infectivity assays (53). Instead of
ELISA tests, FFU assays were integrated with RT-qPCR and eventually able to detect
viruses at only 2 FFU. This experimental design was able to provide preliminary data on
rotavirus removal by free chlorine from vegetable surfaces for future experiments and
mechanism investigations. Meanwhile, the obtained results suggested a potential
correlation of produce surface properties to rotavirus removal by free chlorine.
23
Materials and methods
In this study, ‘Red Russian’ kale, ‘Starbor’ kale and ‘Totem’ Belgian endive were
selected as model produce and harvested at market maturity. OSU porcine rotaviruses
(un-tripsinized) were propagated and harvested as described before (35). Free chlorine
(sodium hypochlorite solution, pH = 7) was used in this study at 50 ppm.
Harvested leaves were gently rinsed with DI water to remove soil particles. Six
disks (three for adaxial and three for abaxial inoculation) were exercised from each leaf
of the three species. On the surface of each leaf disk, 2 drops of 20 μl OSU rotavirus (5.1
log 10 FFU/ml) solution were carefully placed on either adaxial side or abaxial side. The
inoculated disks were incubated for 1 h at room temperature in a biological cabinet for
the droplets to dry. After the incubation, the leaf disks were treated with 4ml (1 g leaf :
150 ml sanitizer) sodium hypochlorite solution (50 ppm, pH =7) for different time
lengths (0.5 min, 1min, 2min, 4min, 5min, 8min, and 10min) on ice. For each species,
every time point had six replicates, three from adaxial and three from abaxial sides. The
free chlorine solution was freshly made by diluting chlorine in DI water at a ratio of
1.84:1000, and the pH was adjusted to 7. The solution was stored at 4 °C before using.
After the disks were sanitized by free chlorine for the expected lengths of time, 100 μl of
7 mM sodium thiosulfate solution was immediately added into the chlorine solution to
stop disinfection reactions. Afterward, the leaf disks were carefully transferred with a
tweezer into 1.5 ml centrifuge tubes, and 500 μl MEM without FBS was added into each
tube for the elution of remaining rotaviruses on each leaf disk. Each sample was then
vortexed for 30 s to completely remove rotaviruses from leaf surface into elution buffer.
24
The elution efficiency was checked by quantifying and comparing remaining rotaviruses
on leaf disks and in elution buffer through RT-qPCR, and was found to achieve 100%.
The infectious rotaviruses in elution buffer were quantified through integrated cell
culture and qPCR assay (ICC-qPCR) that was adopted and modified based on previous
publication (53). The protocol is briefly described here. 400 out of 500 μl viral solution
was activated with 10 μg/ml of trypsin for 30 min, and then added to confluent
monolayers of MA-104 cells in 24-well plates for 30-min incubation at 37°C under 5%
CO2. After 30 min, the cell monolayers were gently washed with serum-free MEM to
remove unbound rotaviruses, and then incubated in 500 μl of fresh MEM without the
serum for 18 h at 37°C under 5% CO2. 18 h later, the plates underwent RNA extraction
for the collection of both cellular and viral RNA. The number of amplified rotaviruses
and cells were quantified by running qPCR for the extracted RNA samples. See Chapter
2 for the detailed protocol of RNA extraction and qPCR quantification of OSU
rotaviruses. The positive controls for each vegetable species underwent the same
procedure except that they skipped chlorine sanitization treatment, and therefore right
after the 1-h incubation with rotaviruses, the leaf disks were transferred into 1.5 ml
centrifuge tubes for virus elution. As described in Chapter 2, the negative controls
incubated with PBS instead of viral solution showed that the vegetables had not been
previously contaminated with OSU rotaviruses.
The cell numbers in each well of a 24-well plate were determined by RT-qPCR
using the same qPCR kit, program, reaction recipe as for rotaviruses quantification
described in Chapter 2, except that different primers and standards for the generation of
calibration curves were used. The primers (Forward: AATCCCATCACCATCTTCCAG
25
and Reverse: AAATGAGCCCCAGCCTTC) were used to specifically amplify cellular
GADPH genes as described in previous study (54). The standard curve was generated by
correlating cell concentrations of a serially diluted MA-104 cell stock, which had been
quantified with hemocytometer, with the corresponding Ct values of dilutions from
qPCR. The cell concentration of each sample was calculated from standard curves that
were conducted for every set of RT-qPCR. For example, Y = −3.15X + 42.515 (R2 =
0.99, efficiency = 107%). Y is the cell concentration (log10 cell numbers/ml), and X is the
Ct value.
In order to quantify infectious viruses in elution buffer, the qPCR results from
rotavirus samples after the 18-h incubation need to be correlated with the amount of
infectious viruses before the ICC-qPCR step. To achieve this, a calibration curve was
generated using the same OSU rotavirus solution as used in sanitizer assays. The OSU
rotavirus solution (5.1 log10 FFU/ml) was activated with 10 μg/ml of trypsin for 30 min,
and then serially diluted in serum-free MEM at 10, 100, and 1000 times to generate four
standards. 400 μl of each standard was added to confluent cell monolayers in a 24-well
plate, and quantified using ICC-qPCR as described above. Afterward, a standard curve
was generated to correlate the number of infectious viruses (log10 FFU) before viral
amplification in cells with the ratio of amplified viruses to cell concentrations (log10
amplified viruses per cell). Here the cell concentrations were taken into consideration in
order to decrease the influence of different cell numbers on viral infectivity
quantification. For example, Y = 0.9238X + 2.4279 (R2 = 0.99). Y is the amount of
infectious rotaviruses (log10 FFU), and X is the ratio of amplified viruses to cell
26
concentrations (log10 ratio). For every set of experiment, the standards went through the
ICC-qPCR step the same time as the samples.
Data analysis was conducted with Microsoft excel.
Results and discussion
As shown in Figure 4, obtained data of remaining infectious rotaviruses on the
vegetable leaf surfaces were plotted as log10 N/No versus lengths of contact time. N
refers to the amount of remaining infectious viruses after sanitization treatment for
certain time lengths, and No is the number of infectious rotaviruses in the initial OSU
viral solution. Hence, the plots of log10 N/No versus contact time could be interpreted as
rotavirus removal from the vegetable leaf surfaces by sodium hypochlorite solution with
time. For positive controls, whose contact time was counted as zero, N equaled No and
therefore log10 N/No equaled zero.
Figure 4. The plots of rotavirus removal from vegetable surfaces of three different
species with time. Free chlorine was used as sanitizers at a concentration of 50 ppm.
27
In this experiment, ‘Totem’ Belgian endive (log10 N/No = -3.37 ± 0.5 at 0.5 min)
showed the highest rate of rotavirus removal within the first 30 s, followed by ‘Red
Russian’ kale (log10 N/No = -2.34 ± 0.67) and ‘Starbor’ kale (log10 N/No = -1.80 ± 1.2).
These results seemed to imply that the rotavirus removal from leaf surfaces might be
related to the wax contents of the epicuticular layers of each species. As in our published
work, ‘Totem’ Belgian endive showed lowest wax concentration in the epicuticular layer
while ‘Red Russian’ and ‘Starbor’ kale had high concentration of wax content (55).
However, further experiments need to be conducted for confirmation.
The major virus reduction in this experiment was observed within 1 min. This
result was similar to the previous report that no recoverable L. monocytogenes were
found after treating the microbes with chlorine (≥ 50 ppm) for 20 seconds or longer (56).
When exposed longer to free chlorine, the rotavirus removal did not go higher but stayed
as constant. This was because very few infectious viruses were left after 1-min
sanitization. The consumption of chlorine by the organic compounds on vegetable
surfaces was not likely responsible for the “steady phase” of virus removal, since
maximum 50 ppm of free chlorine was found to be consumed by organic compounds
present on ‘Red Russian’ kale surfaces. For conservative evaluation of sanitization effects
on rotavirus removal, the samples at longer contact time that had infectious rotaviruses
under qPCR detection limit (3.9 log10 genome copies/ml) were also taken into
consideration with the detection limit as their manually assigned results. In this way, the
potentially stronger sanitization effects for longer contact time could be quantitatively
and conservatively evaluated. However, this method might be influenced by background
noise. Therefore, for the future experiment, a higher concentration of rotavirus solution is
28
highly recommended to use for the measurement of sanitization effects at longer contact
time.
Compared to previously published work, our results showed higher virus
reduction by free chlorine (57). The difference could come from different experimental
materials, scale and procedure. For example, fewer viruses were used in this study. We
only used 40 μl of rotavirus solution (5.1 log10 FFU/ml) for inoculation, while in the
previous publication, the authors achieved a much higher inoculation level (1.5× 108
PFU). In our experiment, small leaf disks (with a diameter of 15.6 mm) were manipulated
instead of whole leaves or vegetables. The flat disk surfaces might be easier for the
chlorine solution to wash off adsorbed viruses than the curved leaves with valleys on the
surfaces.
29
CHAPTER 6
REFERENCES
1. Painter JA, Hoekstra RM, Ayers T, Tauxe RV, Braden CR, Angulo FJ, Griffin
PM. 2013. Attribution of foodborne illnesses, hospitalizations, and deaths to food
commodities by using outbreak data, United States, 1998–2008. Emerg. Infect. Dis.
19:407.
2. U.S. Food and Drug Administration. 2004. Produce Safety From Production to
Consumption: 2004 Action Plan to Minimize Foodborne Illness Associated with
Fresh Produce Consumption.
3. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson M-A, Roy SL,
Jones JL, Griffin PM. 2011. Foodborne illness acquired in the United States—
major pathogens. Emerg. Infect Dis. 17.
4. Carter MJ. 2005. Enterically infecting viruses: pathogenicity, transmission and
significance for food and waterborne infection. J. Appl. Microbiol. 98:1354-1380.
5. Barker SF, O'Toole J, Sinclair MI, Leder K, Malawaraarachchi M, Hamilton
AJ. 2013. A probabilistic model of norovirus disease burden associated with
greywater irrigation of home-produced lettuce in Melbourne, Australia. Water Res.
47:1421-1432.
6. Maimon A, Friedler E, Gross A. 2014. Parameters affecting greywater quality
and its safety for reuse. Science of the Total Environment 487:20-25.
7. Mok H-F, Barker SF, Hamilton AJ. 2014. A probabilistic quantitative microbial
risk assessment model of norovirus disease burden from wastewater irrigation of
vegetables in Shepparton, Australia. Water Res. 54:347-362.
8. Mok H-F, Hamilton AJ. 2014. Exposure Factors for Wastewater-Irrigated Asian
Vegetables and a Probabilistic Rotavirus Disease Burden Model for Their
Consumption. Risk Analysis 34:602-613.
9. Symonds EM, Verbyla ME, Lukasik JO, Kafle RC, Breitbart M, Mihelcic JR.
2014. A case study of enteric virus removal and insights into the associated risk of
water reuse for two wastewater treatment pond systems in Bolivia. Water Res.
65:257-270.
10. van Zyl WB, Page NA, Grabow WOK, Steele AD, Taylor MB. 2006. Molecular
epidemiology of group A rotaviruses in water sources and selected raw vegetables
in southern Africa. Appl. Environ. Microbiol. 72:4554-4560.
11. Bozkurt H, Ye X, Harte F, D'Souza DH, Davidson PM. 2015. Thermal
inactivation kinetics of hepatitis A virus in spinach. Int. J. Food Microbiol.
193:147-151.
30
12. Lou F, Neetoo H, Li J, Chen H, Li J. 2011. Lack of Correlation between Virus
Barosensitivity and the Presence of a Viral Envelope during Inactivation of Human
Rotavirus, Vesicular Stomatitis Virus, and Avian Metapneumovirus by High-
Pressure Processing. Appl. Environ. Microbiol. 77:8538-8547.
13. Berger CN, Sodha SV, Shaw RK, Griffin PM, Pink D, Hand P, Frankel G.
2010. Fresh fruit and vegetables as vehicles for the transmission of human
pathogens. Environmental Microbiology 12:2385-2397.
14. Kukavica-Ibrulj I, Darveau A, Jean J, Fliss I. 2004. Hepatitis A virus attachment
to agri-food surfaces using immunological, virological and thermodynamic assays.
Journal of Applied Microbiology 97:923-934.
15. Vega E, Garland J, Pillai SD. 2008. Electrostatic forces control nonspecific virus
attachment to lettuce. Journal of Food Protection 71:522-529.
16. Deboosere N, Pinon A, Caudrelier Y, Delobel A, Merle G, Perelle S, Temmam
S, Loutreul J, Morin T, Estienney M, Belliot G, Pothier P, Gantzer C, Vialette
M. 2012. Adhesion of human pathogenic enteric viruses and surrogate viruses to
inert and vegetal food surfaces. Food Microbiol. 32:48-56.
17. Hirneisen KA, Kniel KE. 2013. Norovirus Surrogate Survival on Spinach During
Preharvest Growth. Phytopathology 103:389-394.
18. Vega E, Smith J, Garland J, Matos A, Pillai SD. 2005. Variability of virus
attachment patterns to butterhead lettuce. Journal of Food Protection 68:2112-
2117.
19. Esseili MA, Wang Q, Saif LJ. 2012. Binding of Human GII.4 Norovirus Virus-
Like Particles to Carbohydrates of Romaine Lettuce Leaf Cell Wall Materials.
Appl. Environ. Microbiol. 78:786-794.
20. Esseili MA, Wang Q, Zhang Z, Saif LJ. 2012. Internalization of sapovirus, a
surrogate for norovirus, in romaine lettuce and the effect of lettuce latex on virus
infectivity. Applied and environmental microbiology 78:6271-6279.
21. Wei J, Jin Y, Sims T, Kniel KE. 2010. Manure- and biosolids-resident Murine
Norovirus 1 attachment to and internalization by romaine lettuce. Appl. Environ.
Microbiol. 76:578-583.
22. Bargel H, Barthlott W, Koch K, Schreiber L, Neinhuis C. 2004. Plant cuticles:
multifunctional interfaces between plant and environment, p. 171. In Hemsley AR,
Poole I (ed.), The Evolution of Plant Physiology. Elsevier Science.
23. Gniwotta F, Vogg G, Gartmann V, Carver TLW, Riederer M, Jetter R. 2005.
What Do Microbes Encounter at the Plant Surface? Chemical Composition of Pea
Leaf Cuticular Waxes. Plant Physiol. 139:519-530.
31
24. Trdan S, Znidarcic D, Zlatic, J. Jerman E, Jerman J. 2004. Correlation between
epicuticular wax content in the leaves of early white cabbage (Brassica oleracea L.
Var. Capitata) and damage caused by Thrips tabaci Lindeman (Thysanoptera:
Thripidae). Acta Phytopathol. et Entomol. Hung. 39:173-185.
25. Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lu S, Joubes J, Jenks MA.
2009. The impact of water deficiency on leaf cuticle lipids of Arabidopsis. Plant
Physiol. 151:1918-1929.
26. Marshall GS. 2009. Rotavirus disease and prevention through vaccination. Pediatr.
Infect. Dis. J. 28:351-362.
27. Armah GE, Sow SO, Breiman RF, Dallas MJ, Tapia MD, Feikin DR, Binka
FN, Steele AD, Laserson KF, Ansah NA, Levine MM, Lewis K, Coia ML,
Attah-Poku M, Ojwando J, Rivers SB, Victor JC, Nyambane G, Hodgson A,
Schoedel F, Ciarlet M, Neuzil KM. 2010. Efficacy of pentavalent rotavirus
vaccine against severe rotavirus gastroenteritis in infants in developing countries in
sub-Saharan Africa: a randomised, double-blind, placebo-controlled trial. Lancet
376:606-614.
28. Feikin DR, Laserson KF, Ojwando J, Nyambane G, Ssempijja V, Audi A,
Nyakundi D, Oyieko J, Dallas MJ, Ciarlet M, Neuzil KM, Breiman RF. 2012.
Efficacy of pentavalent rotavirus vaccine in a high HIV prevalence population in
Kenya. Vaccine 30:A52-A60.
29. Madhi SA, Cunliffe NA, Steele D, Witte D, Kirsten M, Louw C, Ngwira B,
Victor JC, Gillard PH, Cheuvart BB, Han HH, Neuzil KM. 2010. Effect of
Human Rotavirus Vaccine on Severe Diarrhea in African Infants. New England
Journal of Medicine 362:289-298.
30. Zaman K, Anh DD, Victor JC, Shin S, Yunus M, Dallas MJ, Podder G, Thiem
VD, Mai LTP, Luby SP, Tho LH, Coia ML, Lewis K, Rivers SB, Sack DA,
Schoedel F, Steele AD, Neuzil KM, Ciarlet M. 2010. Efficacy of pentavalent
rotavirus vaccine against severe rotavirus gastroenteritis in infants in developing
countries in Asia: a randomised, double-blind, placebo-controlled trial. Lancet
376:615-623.
31. Kiulia NM, Netshikweta R, Page NA, van Zyl WB, Kiraithe MM, Nyachieo A,
Mwenda JM, Taylor MB. 2010. The detection of enteric viruses in selected urban
and rural river water and sewage in Kenya, with special reference to rotaviruses. J.
Appl. Microbiol. 109:818-828.
32. Romero-Maraccini OC, Sadik NJ, Rosado-Lausell SL, Pugh CR, Niu XZ,
Croue JP, Nguyen TH. 2013. Sunlight-induced inactivation of human Wa and
porcine OSU rotaviruses in the presence of exogenous photosensitizers. Environ.
Sci. Technol. 47:11004-11012.
32
33. D'Souza DH, Sair A, Williams K, Papafragkou E, Jean J, Moore C, Jaykus L.
2006. Persistence of caliciviruses on enviromnental surfaces and their transfer to
food. International Journal of Food Microbiology 108:84-91.
34. Romero OC, Straub AP, Kohn T, Nguyen TH. 2011. Role of temperature and
Suwannee River natural organic matter on inactivation kinetics of rotavirus and
bacteriophage MS2 by solar irradiation. Environ. Sci. Technol. 45:10385-10393.
35. Rolsma MD, Gelberg HB, Kuhlenschmidt MS. 1994. Assay for Evaluation of
Rotavirus-Cell Interactions - Identification of an Enterocyte Ganglioside Fraction
That Mediates Group-a Porcine Rotavirus Recognition. J. Virol. 68:258.
36. Gutierrez L, Li X, Wang J, Nangmenyi G, Economy J, Kuhlenschmidt TB,
Kuhlenschmidt MS, Nguyen TH. 2009. Adsorption of rotavirus and
bacteriophage MS2 using glass fiber coated with hematite nanoparticles. Water
Res. 43:5198-5208.
37. Ruiz MC, Charpilienne A, Liprandi F, Gajardo R, Michelangeli F, Cohen J.
1996. The concentration of Ca2+ that solubilizes outer capsid proteins from
rotavirus particles is dependent on the strain. J. Virol. 70:4877-4883.
38. Jothikumar N, Kang G, Hill VR. 2009. Broadly reactive TaqMan® assay for real-
time RT-PCR detection of rotavirus in clinical and environmental samples. Journal
of Virological Methods 155:126-131.
39. Mattioli MC, Pickering AJ, Gilsdorf RJ, Davis J, Boehm AB. 2013. Hands and
water as vectors of diarrheal pathogens in Bagamoyo, Tanzania. Environ. Sci.
Technol. 47:355-363.
40. Rhee Y, Hlousek-Radojcic A, Ponsamuel J, Liu D, Post-Beittenmiller D. 1998.
Epicuticular Wax Accumulation and Fatty Acid Elongation Activities Are Induced
during Leaf Development of Leeks. Plant Physiol. 116:901-911.
41. Cox I, Gaudard M. 2013. Discovering Partial Least Squares with JMP. SAS
Institute.
42. Boyce RL, Berlyn GP. 1988. Measuring the contact angle of water droplets on
foliar surfaces. Canadian Journal of Botany 66:2599-2602.
43. Yuan Y, Lee TR. 2013. Contact Angle and Wetting Properties, p. 3-30. In Bracco
G, Holst B (ed.), Surface Science Techniques. Springer.
44. Wang H, Feng H, Liang W, Luo Y, Malyarchuk V. 2009. Effect of Surface
Roughness on Retention and Removal of Escherichia coli O157:H7 on Surfaces of
Selected Fruits. J. Food Sci. 74:E8-E15.
33
45. Francisca L, Feng H. 2012. Effect of surface roughness on inactivation of
Escherichia coli O157:H7 87-23 by new organic acid-surfactant combinations on
alfalfa, broccoli, and radish seeds. J. Food Prot. 75:261-269.
46. Gutierrez L, Mylon SE, Nash B, Nguyen TH. 2010. Deposition and Aggregation
Kinetics of Rotavirus in Divalent Cation Solutions. Environ. Sci. Technol.
44:4552-4557.
47. Gutierrez L, Nguyen TH. 2012. Interactions between Rotavirus and Suwannee
River Organic Matter: Aggregation, Deposition, and Adhesion Force
Measurement. Environ. Sci. Technol. 46:8705-8713.
48. Jenks MA, Ashworth EN. 2010. Plant Epicuticular Waxes: Function, Production,
and Genetics, p. 1-68, Horticultural Reviews. John Wiley & Sons, Inc.
49. Vogg G, Fischer S, Leide J, Emmanuel E, Jetter R, Levy AA, Riederer M.
2004. Tomato fruit cuticular waxes and their effects on transpiration barrier
properties: functional characterization of a mutant deficient in a very‐long‐chain
fatty acid n‐ketoacyl‐CoA synthase. J. Exp. Bot. 55:1401-1410.
50. Eriksson L, AB. U. 2006. Multi- and Megavariate Data Analysis. Umetrics AB.
51. Ciarlet M, Conner ME, Finegold MJ, Estes MK. 2002. Group A Rotavirus
Infection and Age-Dependent Diarrheal Disease in Rats: a New Animal Model To
Study the Pathophysiology of Rotavirus Infection. Journal of Virology 76:41-57.
52. Beuchat LR. 1996. Pathogenic Microorganisms Associated with Fresh Produce.
Journal of Food Protection 59:204-216.
53. Li D, Gu AZ, Yang W, He M, Hu X-h, Shi H-C. 2010. An integrated cell culture
and reverse transcription quantitative PCR assay for detection of infectious
rotaviruses in environmental waters. Journal of microbiological methods 82:59-63.
54. Bhowmick R, Halder UC, Chattopadhyay S, Nayak MK, Chawla-Sarkar M.
2013. Rotavirus-Encoded Nonstructural Protein 1 Modulates Cellular Apoptotic
Machinery by Targeting Tumor Suppressor Protein p53. Journal of Virology
87:6840-6850.
55. Lu L, Ku K-M, Palma-Salgado SP, Storm AP, Feng H, Juvik JA, Nguyen TH.
2015. Influence of Epicuticular Physicochemical Properties on Porcine Rotavirus
Adsorption to 24 Leafy Green Vegetables and Tomatoes. PLoS ONE 10:e0132841.
56. Brackett RE. 1987. MICROBIOLOGICAL CONSEQUENCES OF
MINIMALLY PROCESSED FRUITS AND VEGETABLES. Journal of Food
Quality 10:195-206.
34
57. Predmore A, Jianrong L. 2011. Enhanced Removal of a Human Norovirus
Surrogate from Fresh Vegetables and Fruits by a Combination of Surfactants and
Sanitizers. Applied & Environmental Microbiology 77:4829-4838.
