Tree Thinking Demo

Post on 02-Nov-2014

548 views 0 download

Tags:

description

 

Transcript of Tree Thinking Demo

TREE THINKING GAME MODULES DEMO

NOTE These slides do not represent the final game design or completed content.

They are for demonstration purposes only.

What is this game about?

An evolutionary tree is like a family tree

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

Grandparents

Cousins

Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

2nd cousins

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

2nd cousins

Great-grandparents

You and your second cousins share great-grandparents, three generations back.

Mrs. Mr.

Arthur Will

Liz Jorge Cho Aaron

Anastasia Ernesto Phil Anna Tony

What if you went even further back on your family tree?

What if you went even further back on your family tree?

What if you went even further back on your family tree?

Ten generations?

What if you went even further back on your family tree?

Ten generations?

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

A million?

What if you went even further back on your family tree?

Ten generations?

A thousand generations?

A million?

What do you think your distant cousins would look like then?

All of Life is part of one big family that began when the first cell started its life in a primordial pond almost 4 billion years ago.

All of the species alive today are cousins on the 3.8 billion year old tree of life

Human Cow Lizard Turtle

We use DNA to figure out where species belong on this tree

Human Cow Lizard Turtle

?

Human Cow Lizard Turtle Bird

We use DNA to figure out where species belong on this tree

This game lets you solve a puzzle, putting animals in their spot on the tree of life

DNA Animal 1

DNA Animal 2

When you drag an animal around, hover it over the species on the tree to see how much its DNA matches

95%

Eventually this game will be a lot fancier

Which new branch does the elephant go on?

…With a tutorial and fun facts about each animal

ORCA Orcinus orca

The orca, more commonly known as the killer whale, is the largest member of the dolphin family. The largest orcas grow almost as long as a school bus. Orcas are found throughout the world’s oceans, and swim in large family groups called “pods.” Members of each pod communicate in dialects of clicks and whistles that are unique to that group. FUN FACT: Orcas can live as long as the average human!

Proposed levels:

Level 1: (Broad evolutionary relationships) e.g, Humans, sea anemone, house fly, tree, seaweed, fungus, bacterium Level 2: (Animals) e.g, Humans, orcas, cow, elephant, opossum, alligator, coelacanth, trout Level 3: (Canids) Fox, wolf, Chinese Shar-Pei, chow chow, basenji, Siberian husky, Afghan hound, chihuahua, boxer Level 4: (Solve a societal problem) e.g, Figure out which contemporary influenza virus is most similar to the Spanish flu of 1918 (using RNA similarity)

Proposed 15-30 second long educational modules:

1)   What's this game about? 2)   What is DNA? 3)   How do scientists collect these DNA “fingerprints”? 4)   How does the game work? 5)   How closely related are these two animals? 6)   What does the percentage mean?

What is dNA?

Sample information module

Within every one of the trillions of cells that make up your body lies a small molecule called DNA.

Within every one of the trillions of cells that make up your body lies a small molecule called DNA.

Within every one of the trillions of cells that make up your body lies a small molecule called DNA.

This is DNA!

DNA is made up of four different pieces that form an alphabet

A

DNA is made up of four different pieces that form an alphabet

A T

DNA is made up of four different pieces that form an alphabet

A T G

DNA is made up of four different pieces that form an alphabet

A T G C

DNA is made up of four different pieces that form an alphabet

ATTCTTCGTATGGCCCCCCGTATGGATATATATATGCGCGGGGGACTGACTTGCGCTTCTCCCCCTATAGGTATGCCTCTCTATTATTATTCTTTGCTATACTTCCCCCCAACCCCTTGAGGAC

DNA is made up of four different pieces that form an alphabet that is read like an instruction manual for our bodies.

YOU CCCCGTGCGGGGTTCCACTCCATATATGGA

CTATTCTGCTTCTACC

TATGGATAAACCCCTAGGTATATGGATATATTGGCCTTCCGGGGACTGATAAGTATGCCTTATGGATATATATATGCGCGGATAGCAT

When the cells of our bodies multiply as we grow and have children, the DNA gets copied along with it.

Sometimes there is a little glitch in the copying process, and one of the letters of the DNA alphabet gets switched to another.

Sometimes there is a little glitch in the copying process, and one of the letters of the DNA alphabet gets switched to another.

These mistakes are called mutations!

As the tree of life grew and divided into many diverse species

As the tree of life grew and divided into many diverse species, each had its own unique sets of mutations which they passed on to their children.

These mutations are like "fingerprints" in the genetic code

These mutations are like "fingerprints" in the genetic code, and let us find where a creature belongs on the tree of life compared to its relatives.

These mutations are like "fingerprints" in the genetic code, and let us find where a creature belongs on the tree of life compared to its relatives.

CREDITS

Content and Design By Laura Crothers, Ammon Thompson, and PowersCombined

Worm by Ana María Lora Macias from The Noun Project

Grass by Bryn Mackenzie from The Noun Project

Sea Turtle by Baffi Lab from The Noun Project

Network by Juan Pablo Bravo from The Noun Project

Book by Pyetro Rapp from The Noun Project

Cell by Maurizio Fusillo from The Noun Project

Other images in the public domain or by Laura Crothers