UMass Online Introduction to Lean Thinking and Practice Demo
Tree Thinking Demo
-
Upload
lrcrothers -
Category
Technology
-
view
547 -
download
0
description
Transcript of Tree Thinking Demo
TREE THINKING GAME MODULES DEMO
NOTE These slides do not represent the final game design or completed content.
They are for demonstration purposes only.
What is this game about?
An evolutionary tree is like a family tree
Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
Cousins
Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
Cousins
Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
Cousins
Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
Grandparents
Cousins
Looking at your family tree, you can see you and your first cousins share grandparents, two generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
You and your second cousins share great-grandparents, three generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
2nd cousins
You and your second cousins share great-grandparents, three generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
2nd cousins
You and your second cousins share great-grandparents, three generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
2nd cousins
You and your second cousins share great-grandparents, three generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
2nd cousins
You and your second cousins share great-grandparents, three generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
2nd cousins
Great-grandparents
You and your second cousins share great-grandparents, three generations back.
Mrs. Mr.
Arthur Will
Liz Jorge Cho Aaron
Anastasia Ernesto Phil Anna Tony
What if you went even further back on your family tree?
What if you went even further back on your family tree?
What if you went even further back on your family tree?
Ten generations?
What if you went even further back on your family tree?
Ten generations?
What if you went even further back on your family tree?
Ten generations?
A thousand generations?
What if you went even further back on your family tree?
Ten generations?
A thousand generations?
What if you went even further back on your family tree?
Ten generations?
A thousand generations?
A million?
What if you went even further back on your family tree?
Ten generations?
A thousand generations?
A million?
What do you think your distant cousins would look like then?
All of Life is part of one big family that began when the first cell started its life in a primordial pond almost 4 billion years ago.
All of the species alive today are cousins on the 3.8 billion year old tree of life
Human Cow Lizard Turtle
We use DNA to figure out where species belong on this tree
Human Cow Lizard Turtle
?
Human Cow Lizard Turtle Bird
We use DNA to figure out where species belong on this tree
This game lets you solve a puzzle, putting animals in their spot on the tree of life
DNA Animal 1
DNA Animal 2
When you drag an animal around, hover it over the species on the tree to see how much its DNA matches
95%
Eventually this game will be a lot fancier
Which new branch does the elephant go on?
…With a tutorial and fun facts about each animal
ORCA Orcinus orca
The orca, more commonly known as the killer whale, is the largest member of the dolphin family. The largest orcas grow almost as long as a school bus. Orcas are found throughout the world’s oceans, and swim in large family groups called “pods.” Members of each pod communicate in dialects of clicks and whistles that are unique to that group. FUN FACT: Orcas can live as long as the average human!
Proposed levels:
Level 1: (Broad evolutionary relationships) e.g, Humans, sea anemone, house fly, tree, seaweed, fungus, bacterium Level 2: (Animals) e.g, Humans, orcas, cow, elephant, opossum, alligator, coelacanth, trout Level 3: (Canids) Fox, wolf, Chinese Shar-Pei, chow chow, basenji, Siberian husky, Afghan hound, chihuahua, boxer Level 4: (Solve a societal problem) e.g, Figure out which contemporary influenza virus is most similar to the Spanish flu of 1918 (using RNA similarity)
Proposed 15-30 second long educational modules:
1) What's this game about? 2) What is DNA? 3) How do scientists collect these DNA “fingerprints”? 4) How does the game work? 5) How closely related are these two animals? 6) What does the percentage mean?
What is dNA?
Sample information module
Within every one of the trillions of cells that make up your body lies a small molecule called DNA.
Within every one of the trillions of cells that make up your body lies a small molecule called DNA.
Within every one of the trillions of cells that make up your body lies a small molecule called DNA.
This is DNA!
DNA is made up of four different pieces that form an alphabet
A
DNA is made up of four different pieces that form an alphabet
A T
DNA is made up of four different pieces that form an alphabet
A T G
DNA is made up of four different pieces that form an alphabet
A T G C
DNA is made up of four different pieces that form an alphabet
ATTCTTCGTATGGCCCCCCGTATGGATATATATATGCGCGGGGGACTGACTTGCGCTTCTCCCCCTATAGGTATGCCTCTCTATTATTATTCTTTGCTATACTTCCCCCCAACCCCTTGAGGAC
DNA is made up of four different pieces that form an alphabet that is read like an instruction manual for our bodies.
YOU CCCCGTGCGGGGTTCCACTCCATATATGGA
CTATTCTGCTTCTACC
TATGGATAAACCCCTAGGTATATGGATATATTGGCCTTCCGGGGACTGATAAGTATGCCTTATGGATATATATATGCGCGGATAGCAT
When the cells of our bodies multiply as we grow and have children, the DNA gets copied along with it.
Sometimes there is a little glitch in the copying process, and one of the letters of the DNA alphabet gets switched to another.
Sometimes there is a little glitch in the copying process, and one of the letters of the DNA alphabet gets switched to another.
These mistakes are called mutations!
As the tree of life grew and divided into many diverse species
As the tree of life grew and divided into many diverse species, each had its own unique sets of mutations which they passed on to their children.
These mutations are like "fingerprints" in the genetic code
These mutations are like "fingerprints" in the genetic code, and let us find where a creature belongs on the tree of life compared to its relatives.
These mutations are like "fingerprints" in the genetic code, and let us find where a creature belongs on the tree of life compared to its relatives.
CREDITS
Content and Design By Laura Crothers, Ammon Thompson, and PowersCombined
Worm by Ana María Lora Macias from The Noun Project
Grass by Bryn Mackenzie from The Noun Project
Sea Turtle by Baffi Lab from The Noun Project
Network by Juan Pablo Bravo from The Noun Project
Book by Pyetro Rapp from The Noun Project
Cell by Maurizio Fusillo from The Noun Project
Other images in the public domain or by Laura Crothers