Transcript of Supplementary Tables Name Sequence (Forward 5'-3') or pre-designed siRNA ID# from Ambion Target gene...
- Slide 1
- Supplementary Tables Name Sequence (Forward 5'-3') or
pre-designed siRNA ID# from Ambion Target gene #1 Ctrl
siRNAAM4611None siGFPCAAGCUGACCCUGAAGUUCGFP
siLucCGUACGCGGAAUACUUCGALuciferase Non-human Ctrl
siRNAGUCCGGGCAGGUCUACUUUMouse TNF-a siIFIT5-1s24410Human IFIT5
siIFIT5-2s24411Human IFIT5 siDENND2D-1s36728Human DENND2D
siDENND2D-2s36729Human DENND2D siPARP14 -1s29270Human PARP14
siPARP14-2s29271Human PARP14 siTRIM 21-1s13463Human Trim21
siTRIM21-2s13464Human Trim21 siPCGF1-1s39408Human PCGF1
siPCGF1-2s39410Human PCGF1 siIRF3-1s7508Human IRF3
siIRF3-2s7509Human IRF3 siRIG-I-1s223614Human RIG-I
siRIG-I-2s22144Human RIG-I siIFI16-1s7136Human IFI16
siIFI16-2s7138Human IFI16 siSTING-1s50644Human STING
siSTING-2s50646Human STING siTBK1-1s761Human TBK1 siTBK1-2s763Human
TBK1 siMAVS-1s33178Human MAVS siMAVS-2s33180Human MAVS
Supplementary Table S1. Pre-designed siRNA ID# (Ambion) or
sequences of siRNAs used in this study
- Slide 2
- Supplementary Figure S1. (A) Stabilities of siRNAs. HeLa cells
were transfected with 10 nM siRNA and then cultured for 24 h or 48
h. siRNA quantitation was performed using the custom TaqMan Small
RNA assay. (B) Correlation of siRNA stability and their IFN-1
induction activity. The data in the X axis and Y axis indicate
copies of intact siRNA from Supplementary Figure S1A and IFN-1
expression level from the Figure 1B, respectively. A B
- Slide 3
- Supplementary Figure S2. IFN-1 inhibited HIV-1 replication in
Macrophages and iDCs. Macrophages (left) or iDCs (right) from a
normal healthy donor were infected with HIV BAL strain for 2 h and
then cultured for 10-14 days in the presence of different
concentration of IFN- 1. HIV replication in culture was monitored
using HIV p24 antigen kit. All experiments were performed in
quadruplicate assay and data indicates mean + SD. iDC Macrophage
Supplementary Figures
- Slide 4
- Supplementary Figure S3. IFN- enhanced the siRNA and
DNA-mediated IFN- 1 induction in a dose dependent manner. HeLa
cells were transfected by 10 nM Non- human Ctrl siRNA on day 1, and
then treated with IFN- at different concentration on day 2, The
cells were further transfected by DNA at day 3. A total RNA was
isolated 6 h after DNA transfection. The relative IFN-1 production
were detected by real time RT-PCR and compared with untreated
cells.
- Slide 5
- Supplementary Figure S4. The stabilities of siRNAs with
different end overhang structure. HeLa cells were transfected with
10 nM siRNA and the small RNA was isolated using TaqMan MicroRNA
Cell-to-Ct kit 24 h or 48 h after transfection. siRNA quantitation
was performed using the custom TaqMan Small RNA assay. the Ct value
of RNU44 was used as a internal control to detect the cell numbers
for each sample as described in Supplementary materials and
methods.
- Slide 6
- Supplementary Figure S5. Oligermerization of RIG-I upon siRNA
stimulation. 293T cells were transfected with RIG-I expression
vector on day 1, and further transfected with or without 10 nM
Non-human Ctrl siRNA on day 2. Cytosolic fraction from the cells (1
mg) were loaded on a S-200 column. Fractions were collected and
RIG-I protein was detected by Western blot (Upper panel).
Distribution of RIG-I was analyzed by NIH Image J based on the
result of Western blot analysis (lower panel). FPLC fraction number
- siRNA + siRNA 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
51 52 53 54 55 349 219158 KDa IB: RIG-I
- Slide 7
- Supplementary Figure S6. The binding affinity of different
siRNA molecules with RIG-I. AlphaScreen assay was performed to
estimate the binding affinity between RIG-I and siRNA molecules.
Purified FLAG-RIG-I was incubated with different concentrations of
siRNA molecules bearing a biotin at 5 end of the antisense strand.
The resulting fluorescence signal correlates with the number and
proximity of interacting donor (Biotin-siRNA)acceptor (FLAG- RIG-I)
pairs. Concentration of indicated siRNAs is plotted against the
AlphaScreen signal. The LogEC50 correlated with the dissociation
constant Kd. There is an inverse relationship between LogEC50 and
affinity (46). The LogEC50 is calculated by statistical analysis
(non- linear regression).
- Slide 8
- Supplementary Figure S7. siRNA highly enhanced DNA-mediated
IFN-1 and IFN- gene induction compared with that of 5PPP-RNA. (A)
HeLa cells were transfected with 5PPP-RNA (Dashed line) (Invivogen)
or Non-human Ctrl siRNA (Solid line) at different concentrations
followed by IFN- treatment (1000 U/mL) and plasmid DNA (1 g)
transfection on day 2 and day 3, respectively. The IFN-1 (Black
line) and IFN- (Blue line) gene expression levels were measured 6 h
after DNA transfection by real-time RT-PCR and compared with the
cells without RNA transfection. (B) IFN- -treated HeLa cells (1000
U/mL) were transfected with 5PPP-RNA (Dashed line) or Non-human
Ctrl siRNA (Solid line) at different concentrations. The cell
lysate for RNA extraction were collected at 6 h after RNA
transfection. The IFN-1 (Black line) and IFN- (Blue line) gene
expression levels were measured by real-time RT-PCR and compared
with the cells without RNA transfection. A B IFN-1 IFN-
- Slide 9
- 293T HEK293 A B GFP
- Slide 10
- IFN- treated HeLa RIG-I IFI16 HEK293 293T -actin IFN- treated
HeLa HeLa RIG-I IFI16 -actin C D Supplementary Figure S8. Plasmid
DNA encoding GPF transfection in 293T cells induced GFP but doesnt
induce IFN-1 production. HEK293 and 293T cells were transfected
with plasmid pCMV-GFP, 24 h after transfection, the cells were
observed under Fluorescence Microscope. (B) Total RNA was extracted
24 h after DNA transfection and relative IFN-1 expression was
measured by real-time RT-PCR and the gene expression level was
compared with the untransfected cells. **p < 0.001. (C) &
(D) Comparison of endogenous level of RIG-I and IFI16 expression.
Western blot was performed with a whole cell lysate of (C) HEK293
and 293T cells or (D) untreated and IFN- -treated HeLa cells.
Western blot was probed anti-RIG-I and anti-IFI16. -actin was
detected as a loading control. IFN- -treated HeLa cells was loaded
as a positive control for protein detection.
- Slide 11
- Supplementary Figure S9. Comparison of the IFN-1 promoter
activity in 293T cells transfected by siRNA alone or DNA alone.
293T cells in a six-well plate were co- transfected with IFN-1
reporter plasmid (pGL4-IFN-1, 100 ng), Renilla luciferase plasmid
(pRL-TK, 10 ng), IFI16 (200 ng) and RIG-I (100 ng) expression
vectors. Cells were then transfected with 10 nM siRNA on day 2 or 1
g plasmid DNA on day 3, respectively. Cells were then collected for
luciferase assay on day 4.
- Slide 12
- MAVS -actin Lipid alone siMAVS-1 siMAVS-2 Non-human Ctrl siRNA+
No siRNA + Non-human Ctrl siRNA Supplementary Figure S10. MAVS has
less effect on the HSV-1-mediated IFN-1 induction compared with
STING. (A) HeLa cells were transfected with 10 nM Non-human Ctrl
siRNA along with or without siRNA targeting STING or MAVS. Cells
were then treated with IFN- (1000 U/mL) on day 2 followed by an
infection with HSV-1 at a MOI of 5 on day 3. RNA was extracted 6 h
after virus infection. Relative IFN-1 mRNA expression level was
measured by real-time RT-PCR and compared with the cells without
siRNA transfection. (B) Whole-cell lysates were collected, and an
equal amount of total proteins was loaded on SDS-PAGE and then
subjected to Western blot by anti-MAVS (Millipore). A B
- Slide 13
- Supplementary materials and methods: Quantification of siRNA
(siRNA stability assay) HeLa cells were transfected with siRNA at
10 nM and then cultured for 24 h or 48 h. The small RNA was
isolated using TaqMan MicroRNA Cells-to-Ct Kit (Applied Biosystems)
according to the instruction manual. Reverse transcription for each
siRNA was performed using the TaqMan microRNA reverse transcription
kit (Applied Biosystems). Amounts of undegraded siRNA was measured
using quantitative RT-PCR on a CFX96 real-time system (BioRad).
Chemically synthesized siRNA was used to make a standard curve and
the TaqMan Ct values of siRNA were converted into the siRNA copy
numbers. The Ct values for RNU44 small nucleolar were converted
into the cell numbers using a standard curve developed between the
Ct values of RNU44 and cell numbers. The intact siRNA copy numbers
were normalized by cell numbers. The abundance of intact siRNA were
expressed by copies per cell. HIV-1 infection and replication assay
Macrophages and Immature dendritic cells (iDC) were produced from
monocytes isolated from healthy donors as previously described
(47). Macrophages or iDC were infected with HIV-1BaL strain
(Advanced Biotechnologies Inc) for 2 h and then cultured for 10-14
days in the presence of different concentration of IFN-1 (R&D
system). Macrophages were maintained in DMEM supplemented with 10%
Human AB serum and 10 mM HEPES, whereas iDCs were cultured in
RPMI-1640 supplemented with 10% FBS, 10 mM HEPES, 50 ng/ml GM-CSF
and 50 ng/ml of IL-4. Half culture medium were changed every 3-4
days with a fresh medium with the same concentration of IFN-1.
HIV-1 replication was determined by measuring p24 antigen in the
culture supernatant using a p24 antigen capture assay
(PerkinElmer). All experiments were performed in quadruplicate
assay and data indicates mean + SD.
- Slide 14
- Size-exclusion chromatography Oligomerization of RIG-I upon
siRNA transfection was analyzed by a size-exclusion chromatography
using an S-200 column connected to an FPLC system (GE Healthcare).
The column was equilibrated with 50 mM HEPES (pH 7.5), 125 mM NaCl,
10% glycerol (v/v), 0.1% NP40, 0.05% NaN3 and 1 mM DTT). A total of
1 mg of cytosolic protein was applied to the gel filtration column.
Protein elution was monitored by UV absorption at 280 nm. The
column was calibrated using a high- molecular-weight calibration
kit (GE Healthcare). The molecular masses of each fraction were
estimated using the calibration curve. Protein purification and
analysis Flag-tagged RIG-I was transiently overexpressed in 293T
cells and lysed in Pierce IP lysis buffer (Thermo Scientific)
including protease inhibitor cocktail (Roche). The lysate was
incubated over night at 4C with anti-FLAG beads (Sigma). Anti-FLAG
beads were washed subsequently with the IP lysis buffer. FLAG-RIG-I
was eluted by 0.1 M glycine HCL (PH 3.5) and neutralized by 0.5 M
Tris HCL, pH 7.4 with 1.5M NaCL. Purity of recombinant RIG-I was
determined by SDS-PAGE separation and subsequent Coomassie blue
stain. AlphaScreen RIG-I-binding assay The binding affinity of
siRNA for FLAG-tagged RIG-I was determined by an amplified
luminescent proximity homogenous assay (AlphaScreen; Perkin Elmer)
as described (30). Briefly, purified FLAG-RIG-I was incubated with
different concentration of biotinylated siRNA for 1 h at 37C in
buffer (50 mM Tris/pH7.4, 100 mM NaCl, 0.01% Tween20, 0.1% BSA) and
subsequently incubated for 30 min at 25C with anti-FLAG conjugated
acceptor beads (Perkin-Elmer) and Streptavidine conjugated donor
beads (Perkin Elmer). The resulting chemiluminescence emitting in
the range of 520620 nm correlates with the number and proximity of
associated beads which is inversely correlated with the
dissociation constant of donor (biotin- siRNA) and acceptor
(FLAG-RIG-I). The assay was performed in wells of half area 96-well
plates (Perkin-Elmer). Plates were analyzed for emitted
fluorescence with a multilabel reader (Envision; Perkin
Elmer).